The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP034653	Xanthomonas campestris pv. arecae strain NCPPB 2649 chromosome, complete genome	4931460	582133	588504	4931460		Enterobacteria_phage(50.0%)	6	NA	NA
AZR25584.1|582133_583189_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	48.0	1.1e-84
AZR25585.1|583244_584132_+	glucose-1-phosphate thymidylyltransferase	NA	I7I009	Enterobacteria_phage	57.1	3.2e-93
AZR25586.1|584128_584686_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	48.9	8.6e-44
AZR25587.1|584682_585591_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	35.1	1.8e-27
AZR25588.1|585708_587112_-	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	29.7	5.5e-47
AZR25589.1|587157_588504_-	phosphomannomutase/phosphoglucomutase	NA	A0A127AWJ1	Bacillus_phage	26.7	2.6e-33
>prophage 2
CP034653	Xanthomonas campestris pv. arecae strain NCPPB 2649 chromosome, complete genome	4931460	1611723	1659272	4931460	transposase,tRNA,integrase	Escherichia_phage(33.33%)	41	1607073:1607088	1648774:1648789
1607073:1607088	attL	TTCGCGCGCCGCAATG	NA	NA	NA	NA
AZR26338.1|1611723_1613004_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	55.4	4.4e-99
AZR26339.1|1614056_1615073_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AZR28927.1|1615671_1617066_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
AZR26340.1|1617089_1617539_-	RES domain-containing protein	NA	NA	NA	NA	NA
AZR26341.1|1617539_1618025_-	hypothetical protein	NA	NA	NA	NA	NA
AZR26342.1|1618743_1619058_-	hypothetical protein	NA	NA	NA	NA	NA
AZR28928.1|1619107_1619902_-	hypothetical protein	NA	NA	NA	NA	NA
AZR26343.1|1619969_1620311_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AZR26344.1|1621236_1622037_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	59.9	1.2e-83
AZR26345.1|1622036_1623077_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	47.1	5.9e-78
AZR26346.1|1623690_1624792_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.6	7.0e-45
AZR26347.1|1625370_1626411_+|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	47.1	5.9e-78
AZR26348.1|1626410_1627211_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	59.9	1.2e-83
AZR28929.1|1627265_1628771_+	plasmid mobilization protein	NA	NA	NA	NA	NA
AZR26349.1|1628823_1629165_-	hypothetical protein	NA	NA	NA	NA	NA
AZR26350.1|1629539_1630647_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.8	7.7e-44
AZR26351.1|1631127_1631742_-	hypothetical protein	NA	NA	NA	NA	NA
AZR26352.1|1631761_1633267_-	DUF853 family protein	NA	A0A248XCZ8	Klebsiella_phage	45.7	3.2e-85
AZR26353.1|1633561_1635145_+	LysM peptidoglycan-binding domain-containing protein	NA	I1VXB7	Halocynthia_phage	30.6	4.7e-10
AZR26354.1|1635543_1635681_-	phosphatidylserine decarboxylase	NA	NA	NA	NA	NA
AZR26355.1|1635715_1636564_-	phosphatidylserine decarboxylase	NA	NA	NA	NA	NA
AZR26356.1|1636560_1637211_-	SCO family protein	NA	NA	NA	NA	NA
AZR26357.1|1637291_1638218_+	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
AZR26358.1|1638228_1639332_+	chorismate synthase	NA	A0A291AU41	Pandoravirus	40.4	2.1e-73
AZR26359.1|1639324_1640398_+	D-glycerate dehydrogenase	NA	M1HTA3	Paramecium_bursaria_Chlorella_virus	23.4	2.1e-14
AZR26360.1|1640481_1641507_+	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
AZR26361.1|1642075_1644145_+	ferrous iron transporter B	NA	NA	NA	NA	NA
AZR26362.1|1644141_1644549_+	VOC family protein	NA	NA	NA	NA	NA
AZR26363.1|1644716_1645490_+|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
AZR26364.1|1645486_1646155_+	phosphoribosylanthranilate isomerase	NA	NA	NA	NA	NA
AZR26365.1|1646554_1647481_-	LysR family transcriptional regulator	NA	Q6JIH3	Burkholderia_virus	23.7	3.0e-09
AZR26366.1|1647586_1648804_+	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
1648774:1648789	attR	CATTGCGGCGCGCGAA	NA	NA	NA	NA
AZR26367.1|1649311_1650130_+	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
AZR26368.1|1650647_1651535_+	acetyl-CoA carboxylase carboxyl transferase subunit beta	NA	NA	NA	NA	NA
AZR26369.1|1651531_1652881_+	phosphoglucosamine mutase	NA	NA	NA	NA	NA
AZR26370.1|1653001_1653940_+	isopenicillin N synthase family oxygenase	NA	NA	NA	NA	NA
AZR26371.1|1654148_1654832_+	methylamine utilization protein	NA	NA	NA	NA	NA
AZR26372.1|1654828_1657195_+	sensor domain-containing phosphodiesterase	NA	NA	NA	NA	NA
AZR26373.1|1657191_1658064_+	DUF3034 family protein	NA	NA	NA	NA	NA
AZR26374.1|1658063_1658492_+	group 1 truncated hemoglobin	NA	NA	NA	NA	NA
AZR26375.1|1658500_1659272_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 3
CP034653	Xanthomonas campestris pv. arecae strain NCPPB 2649 chromosome, complete genome	4931460	1682844	1774327	4931460	transposase,tRNA,head,plate,integrase,capsid,holin,tail,terminase	Stenotrophomonas_phage(50.0%)	93	1730836:1730881	1774450:1774495
AZR26396.1|1682844_1683771_+|tRNA	tRNA pseudouridine(55) synthase TruB	tRNA	NA	NA	NA	NA
AZR26397.1|1683928_1684189_+	30S ribosomal protein S15	NA	NA	NA	NA	NA
AZR26398.1|1684358_1686473_+	polyribonucleotide nucleotidyltransferase	NA	NA	NA	NA	NA
AZR26399.1|1686746_1687799_-	DUF2272 domain-containing protein	NA	NA	NA	NA	NA
AZR26400.1|1687862_1688750_-	carboxylating nicotinate-nucleotide diphosphorylase	NA	NA	NA	NA	NA
AZR26401.1|1688746_1689016_-	Trm112 family protein	NA	NA	NA	NA	NA
AZR26402.1|1689074_1689578_+	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	38.7	1.3e-17
AZR26403.1|1689574_1690720_+	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
AZR26404.1|1690857_1691436_-	superoxide dismutase	NA	Q56AR7	Bacillus_thuringiensis_phage	40.6	1.5e-35
AZR26405.1|1691557_1691878_+	Grx4 family monothiol glutaredoxin	NA	NA	NA	NA	NA
AZR26406.1|1691874_1692618_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
AZR26407.1|1692614_1693214_+	YhgN family NAAT transporter	NA	NA	NA	NA	NA
AZR26408.1|1693848_1697073_+	TonB-dependent receptor	NA	NA	NA	NA	NA
AZR26409.1|1697179_1698565_+	LOG family protein	NA	NA	NA	NA	NA
AZR28932.1|1698583_1699135_-	sensor histidine kinase	NA	NA	NA	NA	NA
AZR26410.1|1699748_1700357_+	prepilin-type N-terminal cleavage/methylation domain-containing protein	NA	NA	NA	NA	NA
AZR26411.1|1700364_1700799_+	type IV pilus modification protein PilV	NA	NA	NA	NA	NA
AZR28933.1|1700834_1701809_+	type IV pilus assembly protein PilW	NA	NA	NA	NA	NA
AZR26412.1|1701805_1702318_+	pilus assembly protein	NA	NA	NA	NA	NA
AZR28934.1|1703931_1706067_+	pilus assembly protein	NA	NA	NA	NA	NA
AZR26413.1|1706069_1706495_+	type IV pilin protein	NA	NA	NA	NA	NA
AZR26414.1|1706787_1707321_-	prepilin-type N-terminal cleavage/methylation domain-containing protein	NA	NA	NA	NA	NA
AZR26415.1|1707470_1709492_+	excinuclease ABC subunit UvrB	NA	NA	NA	NA	NA
AZR26416.1|1710071_1711173_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.6	7.0e-45
AZR26417.1|1711520_1712765_-	MFS transporter	NA	NA	NA	NA	NA
AZR26418.1|1713251_1713545_+	zinc ribbon domain-containing protein	NA	NA	NA	NA	NA
AZR28935.1|1713762_1713942_+	hypothetical protein	NA	NA	NA	NA	NA
AZR26419.1|1714146_1714914_-	DUF3011 domain-containing protein	NA	NA	NA	NA	NA
AZR26420.1|1715071_1716838_+|tRNA	aspartate--tRNA ligase	tRNA	NA	NA	NA	NA
AZR26421.1|1717147_1717675_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AZR26422.1|1717787_1718465_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
AZR26423.1|1718554_1719283_+	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
AZR26424.1|1719403_1719928_+	crossover junction endodeoxyribonuclease RuvC	NA	NA	NA	NA	NA
AZR26425.1|1720085_1720670_+	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
AZR26426.1|1720867_1722775_+	potassium transporter Kup	NA	M1IBC2	Acanthocystis_turfacea_Chlorella_virus	34.2	4.0e-80
AZR26427.1|1722903_1723941_+	Holliday junction branch migration DNA helicase RuvB	NA	B3GAM6	uncultured_virus	28.2	2.7e-06
AZR28936.1|1723993_1724452_+	tol-pal system-associated acyl-CoA thioesterase	NA	NA	NA	NA	NA
AZR26428.1|1724463_1725243_+	protein TolQ	NA	NA	NA	NA	NA
AZR26429.1|1725400_1725850_+	protein TolR	NA	NA	NA	NA	NA
AZR26430.1|1725839_1726880_+	cell envelope integrity protein TolA	NA	NA	NA	NA	NA
AZR26431.1|1727136_1728456_+	Tol-Pal system beta propeller repeat protein TolB	NA	NA	NA	NA	NA
AZR26432.1|1728513_1729032_+	peptidoglycan-associated lipoprotein Pal	NA	NA	NA	NA	NA
AZR26433.1|1729037_1729856_+	tol-pal system protein YbgF	NA	NA	NA	NA	NA
AZR26434.1|1729898_1730582_+	7-carboxy-7-deazaguanine synthase QueE	NA	J9PV61	Bacillus_phage	40.5	3.0e-38
1730836:1730881	attL	TGGTGGGCCGTGATGGATTCGAACCATCGACCAAAAGATTAAAAGT	NA	NA	NA	NA
AZR28937.1|1731008_1731263_-	hypothetical protein	NA	NA	NA	NA	NA
AZR26435.1|1732461_1733022_+	hypothetical protein	NA	NA	NA	NA	NA
AZR28938.1|1737509_1738145_+	hypothetical protein	NA	NA	NA	NA	NA
AZR26436.1|1738857_1739960_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.6	7.0e-45
AZR26437.1|1740289_1742074_-|terminase	terminase ATPase subunit family protein	terminase	V9IQL5	Stenotrophomonas_phage	77.0	9.2e-273
AZR26438.1|1742195_1743038_+|capsid	GPO family capsid scaffolding protein	capsid	A0A2H4J928	uncultured_Caudovirales_phage	53.0	2.0e-68
AZR26439.1|1743095_1744112_+|capsid	phage major capsid protein, P2 family	capsid	Q9ZXM3	Pseudomonas_virus	69.9	2.7e-136
AZR26440.1|1744115_1744835_+|terminase	terminase	terminase	Q9ZXM2	Pseudomonas_virus	62.5	2.9e-68
AZR26441.1|1744933_1745401_+|head	head completion/stabilization protein	head	V9IQW6	Stenotrophomonas_phage	50.3	2.4e-31
AZR26442.1|1745400_1745610_+|tail	phage tail protein	tail	K4PAW7	Burkholderia_phage	59.4	7.0e-15
AZR26443.1|1745614_1745971_+	hypothetical protein	NA	V9IQG9	Stenotrophomonas_phage	55.3	3.8e-21
AZR26444.1|1745963_1746236_+|holin	phage holin family protein	holin	V9IQV8	Stenotrophomonas_phage	60.9	3.2e-20
AZR26445.1|1746232_1746874_+	glycoside hydrolase family 19 protein	NA	V9IQK6	Stenotrophomonas_phage	63.3	1.4e-50
AZR26446.1|1746873_1747362_+	hypothetical protein	NA	V9IQW8	Stenotrophomonas_phage	52.4	2.4e-29
AZR26447.1|1747358_1747778_+|tail	phage tail protein	tail	A0A2H4J906	uncultured_Caudovirales_phage	65.2	1.7e-39
AZR26448.1|1747765_1748215_+	phage virion morphogenesis protein	NA	V9IQH0	Stenotrophomonas_phage	54.7	1.1e-36
AZR26449.1|1748296_1749187_+|plate	baseplate assembly protein	plate	V9IQV9	Stenotrophomonas_phage	54.4	5.5e-85
AZR26450.1|1749179_1749725_+|tail	phage tail protein I	tail	V9IQK7	Stenotrophomonas_phage	55.4	7.1e-51
AZR26451.1|1749737_1751537_+	hypothetical protein	NA	V9IQX0	Stenotrophomonas_phage	38.3	1.4e-79
AZR28939.1|1751609_1751903_+	hypothetical protein	NA	NA	NA	NA	NA
AZR26452.1|1751905_1752580_+	hypothetical protein	NA	NA	NA	NA	NA
AZR26453.1|1752722_1753286_+|plate	phage baseplate assembly protein V	plate	Q9ZXL0	Pseudomonas_virus	47.0	6.3e-26
AZR26454.1|1753282_1753642_+|plate	baseplate assembly protein	plate	V9IQW0	Stenotrophomonas_phage	64.4	1.5e-36
AZR26455.1|1753653_1754820_+|tail	phage tail sheath protein	tail	E5FFG9	Burkholderia_phage	63.4	3.8e-134
AZR26456.1|1754848_1755358_+|tail	phage major tail tube protein	tail	V9IQX1	Stenotrophomonas_phage	80.5	2.1e-73
AZR26457.1|1755403_1755706_+|tail	phage tail assembly protein	tail	V9IQM4	Stenotrophomonas_phage	66.3	6.3e-25
AZR26458.1|1755714_1755828_+|tail	GpE family phage tail protein	tail	A0A0M4R2P3	Salmonella_phage	68.6	4.2e-06
AZR26459.1|1755857_1758728_+|tail	phage tail tape measure protein	tail	V9IQL1	Stenotrophomonas_phage	48.3	2.0e-197
AZR26460.1|1758739_1759141_+|tail	phage tail protein	tail	V9IQX3	Stenotrophomonas_phage	62.9	1.2e-39
AZR26461.1|1759137_1760121_+	phage late control D family protein	NA	V9IQM7	Stenotrophomonas_phage	53.9	1.2e-88
AZR26462.1|1760737_1761839_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.6	7.0e-45
AZR28940.1|1762495_1763020_+	hypothetical protein	NA	NA	NA	NA	NA
AZR26463.1|1763368_1763812_-	hypothetical protein	NA	NA	NA	NA	NA
AZR26464.1|1763935_1764367_-	transcriptional regulator	NA	E5E3P4	Burkholderia_phage	33.6	8.2e-10
AZR28941.1|1764703_1765024_+	hypothetical protein	NA	V9IQW3	Stenotrophomonas_phage	56.2	1.4e-25
AZR26465.1|1765034_1765313_+	hypothetical protein	NA	NA	NA	NA	NA
AZR26466.1|1765473_1766274_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	59.9	1.2e-83
AZR26467.1|1766273_1767314_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	47.1	5.9e-78
AZR26468.1|1767312_1767498_+	hypothetical protein	NA	NA	NA	NA	NA
AZR28942.1|1767530_1770203_+	toprim domain-containing protein	NA	V9IQW5	Stenotrophomonas_phage	69.7	0.0e+00
AZR26469.1|1770529_1770748_+	hypothetical protein	NA	NA	NA	NA	NA
AZR26470.1|1770744_1771023_+	hypothetical protein	NA	NA	NA	NA	NA
AZR26471.1|1771019_1771286_+	hypothetical protein	NA	NA	NA	NA	NA
AZR26472.1|1771364_1771775_+	hypothetical protein	NA	NA	NA	NA	NA
AZR28943.1|1771966_1772212_+	hypothetical protein	NA	NA	NA	NA	NA
AZR26473.1|1772208_1772454_+	hypothetical protein	NA	NA	NA	NA	NA
AZR26474.1|1772450_1772723_+	hypothetical protein	NA	NA	NA	NA	NA
AZR26475.1|1772719_1772926_+	hypothetical protein	NA	NA	NA	NA	NA
AZR26476.1|1773142_1774327_+|integrase	integrase	integrase	V9IQN0	Stenotrophomonas_phage	57.2	2.6e-122
1774450:1774495	attR	TGGTGGGCCGTGATGGATTCGAACCATCGACCAAAAGATTAAAAGT	NA	NA	NA	NA
>prophage 4
CP034653	Xanthomonas campestris pv. arecae strain NCPPB 2649 chromosome, complete genome	4931460	2188681	2261630	4931460	transposase,tRNA,protease	Staphylococcus_phage(11.11%)	50	NA	NA
AZR26783.1|2188681_2191324_+|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	40.0	1.5e-173
AZR26784.1|2191831_2192476_+	hypothetical protein	NA	NA	NA	NA	NA
AZR26785.1|2192495_2193524_+	DNA polymerase III subunit delta	NA	NA	NA	NA	NA
AZR26786.1|2193520_2194423_+	nicotinate-nucleotide adenylyltransferase	NA	NA	NA	NA	NA
AZR26787.1|2194479_2194893_+	ribosome silencing factor	NA	NA	NA	NA	NA
AZR26788.1|2196815_2197286_+	23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH	NA	NA	NA	NA	NA
AZR26789.1|2197716_2198391_-	energy transducer TonB	NA	NA	NA	NA	NA
AZR26790.1|2198701_2201812_-	TonB-dependent receptor	NA	NA	NA	NA	NA
AZR26791.1|2202134_2202869_-	SIMPL domain-containing protein	NA	NA	NA	NA	NA
AZR26792.1|2203006_2203579_+	Maf-like protein	NA	NA	NA	NA	NA
AZR26793.1|2203578_2205078_+	ribonuclease G	NA	NA	NA	NA	NA
AZR26794.1|2205247_2209168_+	TIGR02099 family protein	NA	NA	NA	NA	NA
AZR28972.1|2209173_2209926_-	hypothetical protein	NA	NA	NA	NA	NA
AZR26795.1|2210024_2211470_+|protease	metalloprotease TldD	protease	NA	NA	NA	NA
AZR26796.1|2211639_2212221_-	ribosome-associated protein	NA	NA	NA	NA	NA
AZR26797.1|2212367_2213735_+|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
AZR26798.1|2214061_2214523_+	DUF4870 domain-containing protein	NA	NA	NA	NA	NA
AZR26799.1|2214592_2215690_-|protease	protease	protease	NA	NA	NA	NA
AZR26800.1|2216150_2217026_-	polyprenyl synthetase family protein	NA	NA	NA	NA	NA
AZR26801.1|2217027_2217288_-	exodeoxyribonuclease 7 small subunit	NA	NA	NA	NA	NA
AZR26802.1|2217319_2218624_-|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
AZR26803.1|2219128_2220835_-	alkaline phosphatase	NA	NA	NA	NA	NA
AZR26804.1|2220976_2222317_+	dicarboxylate/amino acid:cation symporter	NA	NA	NA	NA	NA
AZR26805.1|2223416_2223908_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
AZR26806.1|2224117_2224867_-	NlpC/P60 family protein	NA	A0A0K2SUC1	Clostridium_phage	37.7	2.6e-19
AZR28973.1|2224976_2225519_-	peptidoglycan endopeptidase	NA	A0A1V0DZX6	Clostridioides_phage	40.2	7.2e-19
AZR26807.1|2225628_2226108_+	peptidylprolyl isomerase	NA	NA	NA	NA	NA
AZR26808.1|2226335_2227580_+	DUF418 domain-containing protein	NA	NA	NA	NA	NA
AZR26809.1|2227587_2228838_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
AZR26810.1|2228834_2230205_+	glutathione-disulfide reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	25.6	8.7e-37
AZR26811.1|2230665_2231061_+	cysteine methyltransferase	NA	NA	NA	NA	NA
AZR26812.1|2231101_2231800_+|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
AZR26813.1|2232023_2234039_-	M13 family peptidase	NA	NA	NA	NA	NA
AZR26814.1|2234223_2236323_-	M13 family peptidase	NA	E3T4I7	Cafeteria_roenbergensis_virus	28.8	4.1e-70
AZR26815.1|2236709_2238851_-	peptidase	NA	A0A1V0SHG2	Klosneuvirus	28.0	2.0e-72
AZR26816.1|2239800_2242893_-	Oar protein	NA	NA	NA	NA	NA
AZR26817.1|2246584_2247436_+	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
AZR26818.1|2247679_2248249_+	dCTP deaminase	NA	S5VM63	Pseudomonas_phage	70.6	1.8e-73
AZR26819.1|2248410_2248596_-	hypothetical protein	NA	NA	NA	NA	NA
AZR26820.1|2249346_2249514_-	hypothetical protein	NA	NA	NA	NA	NA
AZR26821.1|2249541_2249976_-	HIT family protein	NA	NA	NA	NA	NA
AZR26822.1|2249972_2250635_-	dienelactone hydrolase family protein	NA	NA	NA	NA	NA
AZR26823.1|2250816_2252181_+	30S ribosomal protein S12 methylthiotransferase RimO	NA	NA	NA	NA	NA
AZR26824.1|2252177_2252702_-	hypothetical protein	NA	NA	NA	NA	NA
AZR26825.1|2252707_2253211_-	transcription elongation factor GreB	NA	NA	NA	NA	NA
AZR26826.1|2253322_2253598_+	hypothetical protein	NA	NA	NA	NA	NA
AZR26827.1|2254962_2256237_-	hypothetical protein	NA	NA	NA	NA	NA
AZR26828.1|2256833_2257941_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.8	7.7e-44
AZR26829.1|2260197_2260428_+	hypothetical protein	NA	NA	NA	NA	NA
AZR26830.1|2260589_2261630_+|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	47.1	5.9e-78
>prophage 5
CP034653	Xanthomonas campestris pv. arecae strain NCPPB 2649 chromosome, complete genome	4931460	2657922	2698555	4931460	transposase	Escherichia_phage(60.0%)	34	NA	NA
AZR27108.1|2657922_2660898_-|transposase	Tn3-like element ISXc4 family transposase	transposase	Q1MVP5	Enterobacteria_phage	47.1	4.7e-253
AZR27109.1|2660902_2661322_-	putative toxin-antitoxin system toxin component, PIN family	NA	NA	NA	NA	NA
AZR27110.1|2661321_2661561_-	methionine repressor-like protein	NA	NA	NA	NA	NA
AZR27111.1|2661774_2662698_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	51.4	2.8e-39
AZR27112.1|2664502_2665171_+	hypothetical protein	NA	NA	NA	NA	NA
AZR29006.1|2665218_2665431_+	hypothetical protein	NA	NA	NA	NA	NA
AZR27113.1|2665423_2665804_+	hypothetical protein	NA	NA	NA	NA	NA
AZR27114.1|2665805_2666672_+	type IV secretion system protein	NA	NA	NA	NA	NA
AZR27115.1|2666668_2667343_+	type IV secretion system protein	NA	NA	NA	NA	NA
AZR27116.1|2667367_2668150_+	P-type conjugative transfer protein VirB9	NA	NA	NA	NA	NA
AZR27117.1|2668151_2669372_+	type VI secretion protein	NA	NA	NA	NA	NA
AZR27118.1|2669382_2670405_+	P-type DNA transfer ATPase VirB11	NA	NA	NA	NA	NA
AZR29007.1|2670415_2671303_+	lytic transglycosylase	NA	NA	NA	NA	NA
AZR27119.1|2671544_2671841_+	hypothetical protein	NA	NA	NA	NA	NA
AZR29008.1|2671944_2672304_+	hypothetical protein	NA	NA	NA	NA	NA
AZR27120.1|2672563_2673364_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	59.9	1.6e-83
AZR27121.1|2673363_2674404_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	47.1	5.9e-78
AZR27122.1|2675525_2676098_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	54.9	5.6e-46
AZR27123.1|2676296_2676518_+	DUF3018 family protein	NA	NA	NA	NA	NA
AZR27124.1|2676514_2676838_+	type II toxin-antitoxin system PemK/MazF family toxin	NA	NA	NA	NA	NA
AZR27125.1|2676863_2677151_+	hypothetical protein	NA	NA	NA	NA	NA
AZR27126.1|2677157_2678345_+	hypothetical protein	NA	NA	NA	NA	NA
AZR27127.1|2678530_2678815_-	hypothetical protein	NA	NA	NA	NA	NA
AZR27128.1|2679103_2682082_-	conjugative relaxase	NA	V5UQN3	Mycobacterium_phage	28.3	5.9e-06
AZR27129.1|2682095_2683670_-	TrwB protein	NA	NA	NA	NA	NA
AZR27130.1|2683846_2684245_-	conjugal transfer protein TraA	NA	NA	NA	NA	NA
AZR27131.1|2684624_2685665_+|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	47.1	5.9e-78
AZR27132.1|2685664_2686465_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	59.9	1.6e-83
AZR27133.1|2686924_2689888_-|transposase	Tn3 family transposase	transposase	NA	NA	NA	NA
AZR27134.1|2691048_2692104_+	DNA-binding protein	NA	NA	NA	NA	NA
AZR27135.1|2692279_2693242_-|transposase	IS1595-like element IS1595 family transposase	transposase	NA	NA	NA	NA
AZR29009.1|2694588_2696136_+	outer protein C	NA	NA	NA	NA	NA
AZR27136.1|2697050_2697851_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	59.9	1.6e-83
AZR27137.1|2697850_2698555_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	44.9	4.0e-46
>prophage 6
CP034653	Xanthomonas campestris pv. arecae strain NCPPB 2649 chromosome, complete genome	4931460	2838972	2876546	4931460	transposase,plate	Escherichia_phage(28.57%)	28	NA	NA
AZR27248.1|2838972_2840013_+|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	47.1	5.9e-78
AZR27249.1|2840012_2840813_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	59.9	1.2e-83
AZR29019.1|2842380_2843088_+	response regulator	NA	NA	NA	NA	NA
AZR27250.1|2843084_2844077_+	c-type cytochrome	NA	NA	NA	NA	NA
AZR27251.1|2844073_2846533_+	two-component system VirA-like sensor kinase	NA	W8CYF6	Bacillus_phage	30.8	8.9e-16
AZR27252.1|2846646_2847627_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AZR27253.1|2847635_2848664_+	type VI secretion system protein TssA	NA	NA	NA	NA	NA
AZR27254.1|2848836_2849163_-	hypothetical protein	NA	NA	NA	NA	NA
AZR27255.1|2849159_2852057_-	serine/threonine protein kinase	NA	A0A2R8FF19	Brazilian_cedratvirus	24.1	7.3e-09
AZR27256.1|2852053_2852776_-	serine/threonine-protein phosphatase	NA	NA	NA	NA	NA
AZR27257.1|2852772_2853426_-	type VI secretion system-associated protein TagF	NA	NA	NA	NA	NA
AZR27258.1|2853422_2856881_-	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
AZR27259.1|2856884_2858201_-	type VI secretion system protein TssL	NA	NA	NA	NA	NA
AZR27260.1|2858202_2859540_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
AZR27261.1|2859536_2860943_-	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
AZR27262.1|2860939_2861479_-	hypothetical protein	NA	NA	NA	NA	NA
AZR27263.1|2861487_2863425_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	29.2	5.3e-40
AZR27264.1|2864251_2864458_-	hypothetical protein	NA	NA	NA	NA	NA
AZR27265.1|2864852_2865773_-	hypothetical protein	NA	NA	NA	NA	NA
AZR27266.1|2865769_2868523_-	type VI secretion system ATPase TssH	NA	H6X3M6	Enterobacteria_phage	29.5	3.0e-81
AZR27267.1|2868554_2869565_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
AZR27268.1|2869528_2871406_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
AZR27269.1|2871409_2871913_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
AZR27270.1|2871900_2872734_-	ImpE protein	NA	NA	NA	NA	NA
AZR27271.1|2872769_2873273_-	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
AZR27272.1|2873372_2874887_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
AZR27273.1|2874879_2875407_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
AZR27274.1|2875883_2876546_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	35.7	1.2e-31
>prophage 7
CP034653	Xanthomonas campestris pv. arecae strain NCPPB 2649 chromosome, complete genome	4931460	3315355	3395578	4931460	transposase,holin	Leptospira_phage(28.57%)	56	NA	NA
AZR27582.1|3315355_3316458_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.6	7.0e-45
AZR29051.1|3317079_3317478_-	hypothetical protein	NA	NA	NA	NA	NA
AZR27583.1|3317920_3318412_-	DUF4189 domain-containing protein	NA	NA	NA	NA	NA
AZR27584.1|3318435_3319500_-	type IV secretion system protein	NA	NA	NA	NA	NA
AZR29052.1|3319600_3320323_-	hypothetical protein	NA	NA	NA	NA	NA
AZR27585.1|3320423_3322877_-	VirB4 family type IV secretion/conjugal transfer ATPase	NA	NA	NA	NA	NA
AZR27586.1|3322978_3323290_-	hypothetical protein	NA	NA	NA	NA	NA
AZR27587.1|3323282_3323693_-	hypothetical protein	NA	NA	NA	NA	NA
AZR27588.1|3323750_3324593_-	lytic transglycosylase domain-containing protein	NA	NA	NA	NA	NA
AZR27589.1|3324641_3325700_-	P-type DNA transfer ATPase VirB11	NA	NA	NA	NA	NA
AZR27590.1|3325696_3326866_-	TrbI/VirB10 family protein	NA	NA	NA	NA	NA
AZR27591.1|3326862_3327630_-	type IV secretion system protein VirB9	NA	NA	NA	NA	NA
AZR27592.1|3327626_3328661_-	conjugative transfer protein	NA	NA	NA	NA	NA
AZR29053.1|3328771_3329182_-	hypothetical protein	NA	NA	NA	NA	NA
AZR27593.1|3329514_3331188_-	type IV secretory system conjugative DNA transfer family protein	NA	NA	NA	NA	NA
AZR27594.1|3331224_3331467_-	hypothetical protein	NA	NA	NA	NA	NA
AZR27595.1|3331887_3332990_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.6	7.0e-45
AZR27596.1|3333885_3334248_+	hypothetical protein	NA	NA	NA	NA	NA
AZR27597.1|3334445_3334814_+	hypothetical protein	NA	NA	NA	NA	NA
AZR27598.1|3335093_3336248_+	2-aminoethylphosphonate--pyruvate transaminase	NA	NA	NA	NA	NA
AZR27599.1|3336247_3337570_+	O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase	NA	NA	NA	NA	NA
AZR27600.1|3337595_3338636_+	dihydrorhizobitoxine desaturase	NA	NA	NA	NA	NA
AZR27601.1|3338653_3339493_+	gamma-glutamyl-gamma-aminobutyrate hydrolase family protein	NA	NA	NA	NA	NA
AZR27602.1|3339501_3340302_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	59.9	1.2e-83
AZR27603.1|3340301_3341342_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	47.1	5.9e-78
AZR27604.1|3341523_3342123_+	LysE family translocator	NA	NA	NA	NA	NA
AZR27605.1|3342190_3343126_+	homoserine O-succinyltransferase	NA	NA	NA	NA	NA
AZR29054.1|3343191_3344544_+	glutamine synthetase	NA	NA	NA	NA	NA
AZR27606.1|3346502_3348914_+	TonB-dependent receptor	NA	NA	NA	NA	NA
AZR27607.1|3349143_3351300_+|holin	phospholipase C, phosphocholine-specific	holin	NA	NA	NA	NA
AZR27608.1|3351564_3353121_-	hypothetical protein	NA	NA	NA	NA	NA
AZR27609.1|3354372_3355266_-	class A beta-lactamase	NA	A0A1B0VBP7	Salmonella_phage	45.5	6.2e-60
AZR27610.1|3355366_3356242_+	LysR family transcriptional regulator	NA	Q6JIH3	Burkholderia_virus	28.7	1.8e-16
AZR27611.1|3357090_3359007_-	ABC transporter ATP-binding protein	NA	A0A2K9L0W2	Tupanvirus	31.0	5.6e-66
AZR27612.1|3359187_3361575_+	TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	23.6	1.4e-13
AZR27613.1|3362246_3362480_+	glyoxalase	NA	NA	NA	NA	NA
AZR27614.1|3362752_3365140_+	TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	32.9	1.2e-09
AZR27615.1|3365469_3367869_+	TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	32.3	2.9e-11
AZR27616.1|3369915_3371613_+	Kef family K(+) transporter	NA	NA	NA	NA	NA
AZR27617.1|3371954_3372716_+	4-hydroxy-2-oxovalerate aldolase	NA	NA	NA	NA	NA
AZR27618.1|3372716_3374858_+	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
AZR27619.1|3375095_3376322_+	ATP-grasp domain-containing protein	NA	NA	NA	NA	NA
AZR27620.1|3376318_3378121_+	IucA/IucC family siderophore biosynthesis protein	NA	NA	NA	NA	NA
AZR27621.1|3378117_3379314_+	MFS transporter	NA	NA	NA	NA	NA
AZR27622.1|3379291_3381061_+	iron transporter	NA	NA	NA	NA	NA
AZR27623.1|3381057_3382347_+	type III PLP-dependent enzyme	NA	NA	NA	NA	NA
AZR27624.1|3383724_3384060_-	hypothetical protein	NA	NA	NA	NA	NA
AZR29055.1|3384614_3386519_-	TonB-dependent vitamin B12 receptor	NA	A0A0P0I887	Acinetobacter_phage	31.9	4.9e-06
AZR27625.1|3386993_3387206_-	hypothetical protein	NA	NA	NA	NA	NA
AZR27626.1|3387269_3387524_+	hypothetical protein	NA	NA	NA	NA	NA
AZR27627.1|3387762_3388590_-	hypothetical protein	NA	S5VKI3	Leptospira_phage	29.7	3.9e-16
AZR27628.1|3388830_3389811_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.7	1.5e-99
AZR27629.1|3390169_3390367_-	hypothetical protein	NA	NA	NA	NA	NA
AZR27630.1|3392578_3393457_-	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
AZR29056.1|3393453_3393849_-	biotin/lipoyl-binding protein	NA	NA	NA	NA	NA
AZR27631.1|3394476_3395578_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.6	7.0e-45
>prophage 8
CP034653	Xanthomonas campestris pv. arecae strain NCPPB 2649 chromosome, complete genome	4931460	4280631	4290879	4931460	transposase,holin,tail	Stenotrophomonas_phage(40.0%)	12	NA	NA
AZR28334.1|4280631_4280841_+|tail	phage tail protein	tail	K4PAW7	Burkholderia_phage	59.4	7.0e-15
AZR28335.1|4280845_4281202_+	hypothetical protein	NA	V9IQG9	Stenotrophomonas_phage	55.3	3.8e-21
AZR28336.1|4281194_4281467_+|holin	phage holin family protein	holin	V9IQV8	Stenotrophomonas_phage	60.9	3.2e-20
AZR28337.1|4282099_4282588_+	hypothetical protein	NA	V9IQW8	Stenotrophomonas_phage	49.4	3.8e-27
AZR28338.1|4282584_4283004_+|tail	phage tail protein	tail	A0A2H4J906	uncultured_Caudovirales_phage	65.9	1.1e-40
AZR28339.1|4282991_4283456_+	phage virion morphogenesis protein	NA	V9IQH0	Stenotrophomonas_phage	61.5	6.7e-42
AZR28340.1|4283702_4284056_-	hypothetical protein	NA	NA	NA	NA	NA
AZR28341.1|4284086_4284887_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	59.9	1.2e-83
AZR28342.1|4284886_4285927_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	47.1	5.9e-78
AZR28343.1|4286186_4287288_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.6	7.0e-45
AZR29102.1|4287573_4288398_+	hypothetical protein	NA	NA	NA	NA	NA
AZR28344.1|4289770_4290879_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.8	1.0e-43
