The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP026044	Proteus mirabilis strain FDAARGOS_60 chromosome, complete genome	4105573	57854	116715	4105573	tRNA,capsid,tail,terminase,holin,integrase,protease,head,portal	Cronobacter_phage(62.86%)	63	67269:67286	111117:111134
AUT90217.1|57854_58889_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
AUT90218.1|59321_60386_+	hypothetical protein	NA	NA	NA	NA	NA
AUT90219.1|60548_61886_+|protease	serine protease	protease	Q2A0D0	Sodalis_phage	29.6	1.3e-29
AUT90220.1|62329_63445_+	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	G3M9Y6	Bacillus_virus	36.4	5.8e-31
AUT90221.1|63428_64289_+	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	25.7	5.7e-10
AUT90222.1|64285_65065_+	spermidine/putrescine ABC transporter permease PotC	NA	NA	NA	NA	NA
AUT90223.1|65181_66225_+	spermidine/putrescine ABC transporter substrate-binding protein PotD	NA	NA	NA	NA	NA
AUT90224.1|66357_66675_-	XRE family transcriptional regulator	NA	A0A1W6JNW5	Morganella_phage	51.6	2.5e-08
AUT90225.1|66701_67775_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
67269:67286	attL	TTTATCTGTCACCACAAA	NA	NA	NA	NA
AUT90226.1|67774_68293_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
AUT90227.1|69762_70794_-|integrase	integrase	integrase	A0A218M4I3	Erwinia_phage	62.7	1.8e-124
AUT90228.1|70798_71221_-	hypothetical protein	NA	NA	NA	NA	NA
AUT90229.1|71235_71826_-	phage repressor protein CI	NA	F1BUN8	Cronobacter_phage	34.3	1.6e-27
AUT90230.1|71975_72200_+	regulator	NA	NA	NA	NA	NA
AUT90231.1|72229_72739_+	hypothetical protein	NA	E5G6L3	Salmonella_phage	50.3	1.0e-38
AUT90232.1|72898_73414_+	hypothetical protein	NA	NA	NA	NA	NA
AUT90233.1|73425_73773_+	hypothetical protein	NA	E5G6L5	Salmonella_phage	42.7	1.5e-17
AUT90234.1|73849_74101_+	DUF2732 domain-containing protein	NA	NA	NA	NA	NA
AUT90235.1|74102_76304_+	replication endonuclease	NA	F1BUS0	Erwinia_phage	56.4	1.1e-206
AUT90236.1|76290_76491_+	hypothetical protein	NA	NA	NA	NA	NA
AUT90237.1|76490_76988_+	hypothetical protein	NA	NA	NA	NA	NA
AUT90238.1|77079_77262_+	hypothetical protein	NA	NA	NA	NA	NA
AUT90239.1|77263_77572_-	transcriptional regulator	NA	F1BUM8	Cronobacter_phage	60.4	2.1e-28
AUT90240.1|77571_78603_-|portal	phage portal protein	portal	F1BUM7	Cronobacter_phage	64.1	2.1e-128
AUT93760.1|78602_80390_-|terminase	terminase	terminase	F1BUM5	Cronobacter_phage	65.8	2.6e-227
AUT90241.1|80551_81388_+|capsid	phage capsid protein	capsid	F1BUM4	Cronobacter_phage	42.5	5.1e-48
AUT90242.1|81398_82430_+|capsid	phage major capsid protein, P2 family	capsid	F1BUM2	Cronobacter_phage	69.9	1.7e-130
AUT90243.1|82435_83140_+|terminase	terminase	terminase	F1BUM0	Cronobacter_phage	53.9	1.3e-65
AUT90244.1|83248_83455_+	hypothetical protein	NA	NA	NA	NA	NA
AUT90245.1|83474_83927_+|head	head completion protein	head	F1BUL8	Cronobacter_phage	53.3	2.4e-36
AUT90246.1|83923_84400_+|tail	phage tail protein	tail	Q1I0Z6	Pasteurella_virus	25.5	2.9e-08
AUT90247.1|84396_85095_+	hypothetical protein	NA	F1BUL6	Cronobacter_phage	59.3	5.5e-64
AUT90248.1|85109_86228_+	DUF2586 domain-containing protein	NA	F1BUL5	Cronobacter_phage	64.9	2.4e-133
AUT90249.1|86227_86680_+	DUF2597 domain-containing protein	NA	F1BUL4	Cronobacter_phage	62.6	1.2e-48
AUT90250.1|86694_86988_+|holin	holin	holin	S4TP56	Salmonella_phage	51.2	1.1e-16
AUT90251.1|86984_87317_+	hypothetical protein	NA	F1BUL3	Cronobacter_phage	72.3	1.4e-36
AUT90252.1|87316_87691_+	hypothetical protein	NA	F1BUL2	Cronobacter_phage	53.2	9.6e-23
AUT90253.1|87584_87803_+	hypothetical protein	NA	F1BUL1	Cronobacter_phage	60.9	5.1e-16
AUT90254.1|87799_88069_+	hypothetical protein	NA	A5X9I7	Aeromonas_virus	49.4	1.3e-16
AUT90255.1|88256_90773_+|tail	phage tail tape measure protein	tail	F1BUK9	Cronobacter_phage	43.1	6.7e-128
AUT90256.1|90783_91119_+	DUF2590 domain-containing protein	NA	F1BUK8	Cronobacter_phage	68.0	1.6e-32
AUT90257.1|91108_92293_+	hypothetical protein	NA	F1BUK6	Cronobacter_phage	65.6	4.5e-151
AUT90258.1|92285_92834_+	hypothetical protein	NA	F1BUK5	Cronobacter_phage	64.1	1.6e-66
AUT90259.1|92843_95054_+	hypothetical protein	NA	F1BUK3	Cronobacter_phage	59.3	4.7e-109
AUT90260.1|95053_95674_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	48.1	4.2e-31
AUT90261.1|95670_96393_+	hypothetical protein	NA	F1BUK1	Cronobacter_phage	32.8	2.3e-36
AUT93761.1|96403_96964_+	hypothetical protein	NA	F1BUJ9	Cronobacter_phage	51.6	8.1e-42
AUT90262.1|96950_98597_+	hypothetical protein	NA	F1BUJ7	Cronobacter_phage	55.2	1.5e-147
AUT90263.1|100536_101214_-	type 1 fimbrial chaperone protein	NA	NA	NA	NA	NA
AUT90264.1|101312_101873_-	fimbrial protein	NA	NA	NA	NA	NA
AUT90265.1|102742_103678_+	drug/metabolite DMT transporter permease	NA	NA	NA	NA	NA
AUT90266.1|103866_105141_+	O-acetylhomoserine aminocarboxypropyltransferase	NA	A0A0B5JD48	Pandoravirus	28.4	2.0e-19
AUT90267.1|105571_106165_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
AUT90268.1|106185_107046_+	winged helix family transcriptional regulator	NA	NA	NA	NA	NA
AUT90269.1|107045_107564_+	hypothetical protein	NA	NA	NA	NA	NA
AUT90270.1|108138_108417_+	BMC domain-containing protein	NA	NA	NA	NA	NA
AUT90271.1|108437_108722_+	BMC domain-containing protein	NA	NA	NA	NA	NA
AUT90272.1|108736_109015_+	BMC domain-containing protein	NA	NA	NA	NA	NA
AUT90273.1|109082_110735_+	acetaldehyde dehydrogenase (acetylating)	NA	NA	NA	NA	NA
AUT90274.1|110761_111025_+	ethanolamine utilization protein EutN	NA	NA	NA	NA	NA
AUT90275.1|111032_112181_+	alcohol dehydrogenase	NA	NA	NA	NA	NA
111117:111134	attR	TTTGTGGTGACAGATAAA	NA	NA	NA	NA
AUT90276.1|112232_115661_+|holin	choline trimethylamine-lyase	holin	NA	NA	NA	NA
AUT90277.1|115764_116715_+|holin	choline TMA-lyase-activating enzyme	holin	NA	NA	NA	NA
>prophage 2
CP026044	Proteus mirabilis strain FDAARGOS_60 chromosome, complete genome	4105573	392115	400965	4105573		Caulobacter_phage(50.0%)	9	NA	NA
AUT90511.1|392115_393261_-	adenine/guanine phosphoribosyltransferase	NA	A0A172Q0Y1	Acinetobacter_phage	27.2	1.2e-31
AUT90512.1|393653_394238_+	tellurium resistance protein TerZ	NA	K4JRX3	Caulobacter_phage	30.2	4.2e-17
AUT90513.1|394238_395381_+	tellurium resistance protein TerA	NA	NA	NA	NA	NA
AUT90514.1|395405_395861_+	Tellurium resistance protein TerB	NA	NA	NA	NA	NA
AUT90515.1|395895_396921_+	tellurium resistance protein TerC	NA	K7QKE8	Escherichia_phage	47.9	1.3e-74
AUT90516.1|396988_397567_+	TerD family protein	NA	K4JRX3	Caulobacter_phage	41.5	2.4e-33
AUT90517.1|397643_398219_+	TerD family protein	NA	K4JRX3	Caulobacter_phage	40.3	1.2e-27
AUT90518.1|398315_398996_-	HAD-IB family hydrolase	NA	NA	NA	NA	NA
AUT90519.1|399396_400965_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	33.7	7.2e-11
>prophage 3
CP026044	Proteus mirabilis strain FDAARGOS_60 chromosome, complete genome	4105573	660959	677214	4105573		Morganella_phage(72.73%)	20	NA	NA
AUT90727.1|660959_662171_+	DUF4102 domain-containing protein	NA	Q7M297	Enterobacteria_phage	55.7	3.8e-129
AUT90728.1|662383_663169_+	hypothetical protein	NA	NA	NA	NA	NA
AUT90729.1|663161_663932_+	protein kinase	NA	NA	NA	NA	NA
AUT90730.1|664056_664275_+	AlpA family transcriptional regulator	NA	A0A2H4J8C8	uncultured_Caudovirales_phage	45.3	6.6e-08
AUT90731.1|664274_664670_+	hypothetical protein	NA	A0A1W6JPH9	Morganella_phage	57.8	7.3e-29
AUT90732.1|664684_665278_+	antirepressor protein	NA	A0A1W6JPH8	Morganella_phage	76.1	1.5e-81
AUT93774.1|665298_666303_+	hypothetical protein	NA	A0A1W6JPK3	Morganella_phage	49.2	9.1e-68
AUT90733.1|666295_666469_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
AUT90734.1|666471_666729_+	hypothetical protein	NA	NA	NA	NA	NA
AUT90735.1|666725_666905_+	hypothetical protein	NA	NA	NA	NA	NA
AUT90736.1|666901_667111_+	hypothetical protein	NA	A0A1W6JPF1	Morganella_phage	52.2	4.7e-11
AUT90737.1|668018_668204_+	hypothetical protein	NA	NA	NA	NA	NA
AUT90738.1|668203_668800_+	hypothetical protein	NA	A0A286S1S7	Klebsiella_phage	38.8	4.9e-29
AUT90739.1|668814_669159_+	hypothetical protein	NA	A0A1W6JPD8	Morganella_phage	71.9	3.7e-45
AUT90740.1|669155_671903_+	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	47.7	1.5e-226
AUT90741.1|672222_672660_+	osmoprotectant transporter ProQ	NA	A0A1W6JPI6	Morganella_phage	57.4	5.6e-14
AUT90742.1|672734_673265_+	hypothetical protein	NA	NA	NA	NA	NA
AUT90743.1|673449_673623_+	3-hydroxybutyryl-CoA dehydrogenase	NA	NA	NA	NA	NA
AUT90744.1|673622_673964_+	hypothetical protein	NA	NA	NA	NA	NA
AUT90745.1|673980_677214_+	tape measure protein	NA	A0A1W6JNU2	Morganella_phage	39.7	3.9e-96
>prophage 4
CP026044	Proteus mirabilis strain FDAARGOS_60 chromosome, complete genome	4105573	868016	904350	4105573	tRNA,capsid,tail,holin,lysis,plate,integrase,head,portal	Salmonella_phage(27.78%)	46	874270:874294	905359:905383
AUT90890.1|868016_868958_+	site-specific tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	30.7	4.1e-30
AUT90891.1|868991_869699_+	bifunctional protein-disulfide isomerase/oxidoreductase DsbC	NA	NA	NA	NA	NA
AUT90892.1|869708_871442_+	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	29.3	4.3e-65
AUT90893.1|871613_872711_+	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	37.3	4.1e-05
AUT90894.1|872720_874235_+|tRNA	lysine--tRNA ligase	tRNA	A0A2K9L3L6	Tupanvirus	38.0	4.1e-88
874270:874294	attL	AGCCATCGCAAGATGGCTTTTTTAT	NA	NA	NA	NA
AUT90895.1|874403_875387_-|integrase	integrase	integrase	Q83VS6	Escherichia_phage	56.8	4.4e-99
AUT90896.1|875453_875753_-	XRE family transcriptional regulator	NA	Q1JS29	Enterobacteria_phage	68.7	8.2e-33
AUT90897.1|875856_876132_+	hypothetical protein	NA	Q1JS60	Enterobacteria_phage	49.4	2.0e-17
AUT90898.1|876140_876335_+	hypothetical protein	NA	NA	NA	NA	NA
AUT90899.1|876331_876601_+	hypothetical protein	NA	NA	NA	NA	NA
AUT90900.1|876597_876786_-	hypothetical protein	NA	NA	NA	NA	NA
AUT90901.1|877050_877446_+	hypothetical protein	NA	NA	NA	NA	NA
AUT90902.1|877463_877721_+	DUF2732 domain-containing protein	NA	NA	NA	NA	NA
AUT90903.1|877713_877935_+	hypothetical protein	NA	F1BUS2	Erwinia_phage	52.1	2.0e-12
AUT90904.1|877936_878245_+	DUF3850 domain-containing protein	NA	A0A218M496	Shigella_phage	43.2	2.9e-09
AUT90905.1|878244_879072_+	DNA adenine methylase	NA	F1BUN1	Cronobacter_phage	47.8	8.8e-61
AUT90906.1|879071_879395_+	hypothetical protein	NA	NA	NA	NA	NA
AUT90907.1|879394_881773_+	replication endonuclease	NA	Q7Y4B8	Escherichia_virus	47.6	2.0e-166
AUT90908.1|881765_881978_+	hypothetical protein	NA	NA	NA	NA	NA
AUT90909.1|881979_882663_+	hypothetical protein	NA	A0A1S5NQ18	Burkholderia_phage	33.3	7.2e-16
AUT90910.1|882649_883207_+	hypothetical protein	NA	NA	NA	NA	NA
AUT90911.1|883702_884731_-|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	68.1	2.7e-136
AUT90912.1|884730_886485_-	oxidoreductase	NA	A0A1S6KZW3	Salmonella_phage	72.8	3.3e-259
AUT90913.1|886657_887467_+|capsid	capsid scaffolding protein	capsid	F1BUR1	Erwinia_phage	48.8	2.6e-65
AUT90914.1|887482_888628_+|capsid	phage major capsid protein, P2 family	capsid	A0A1S6KZZ3	Salmonella_phage	67.2	1.2e-127
AUT90915.1|888627_889296_+	hypothetical protein	NA	F1BUQ7	Erwinia_phage	46.6	7.2e-45
AUT90916.1|889373_889829_+|head	head protein	head	E5E3S2	Burkholderia_phage	45.3	1.9e-28
AUT90917.1|889828_890035_+|tail	phage tail protein	tail	K4PAW7	Burkholderia_phage	51.5	4.8e-16
AUT90918.1|890054_890369_+|holin	holin	holin	NA	NA	NA	NA
AUT90919.1|890361_890766_+	peptidase M15	NA	K4F776	Cronobacter_phage	57.4	6.1e-39
AUT90920.1|890762_891266_+|lysis	lysis protein	lysis	M1FJ79	Enterobacteria_phage	30.1	1.4e-05
AUT90921.1|891240_891678_+|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	49.3	3.2e-33
AUT90922.1|891667_892303_+	phage virion morphogenesis protein	NA	A0A0M4RCU1	Salmonella_phage	35.8	4.4e-28
AUT90923.1|892368_892995_+|plate	phage baseplate assembly protein V	plate	Q6K1H6	Salmonella_virus	60.8	4.1e-58
AUT90924.1|892991_893330_+|plate	baseplate assembly protein	plate	F1BUP4	Erwinia_phage	49.5	8.4e-26
AUT90925.1|893331_894240_+|plate	baseplate assembly protein	plate	A0A218M4K5	Erwinia_phage	66.6	1.6e-108
AUT90926.1|894232_894844_+|tail	phage tail protein I	tail	F1BUP2	Erwinia_phage	69.4	1.1e-76
AUT90927.1|896785_897406_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	47.7	7.1e-31
AUT90928.1|897498_898671_+|tail	phage tail protein	tail	A0A1S6KZY7	Salmonella_phage	71.1	1.1e-165
AUT90929.1|898674_899190_+|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	56.7	5.0e-54
AUT90930.1|899209_899557_+|tail	phage tail assembly protein	tail	E5G6P9	Salmonella_phage	53.3	6.0e-19
AUT93780.1|899517_899691_+|tail	GpE family phage tail protein	tail	A0A2I8TV82	Erwinia_phage	49.1	1.8e-08
AUT90931.1|899683_902518_+|tail	phage tail tape measure protein	tail	A0A2H4JE61	uncultured_Caudovirales_phage	39.5	4.8e-106
AUT90932.1|902517_902982_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	61.4	3.3e-41
AUT90933.1|902981_904079_+	late control protein D	NA	E5G6Q3	Salmonella_phage	55.4	3.5e-113
AUT90934.1|904131_904350_+	transcriptional regulator	NA	Q53ZE7	Salmonella_virus	70.3	1.7e-19
905359:905383	attR	AGCCATCGCAAGATGGCTTTTTTAT	NA	NA	NA	NA
>prophage 5
CP026044	Proteus mirabilis strain FDAARGOS_60 chromosome, complete genome	4105573	1195417	1214215	4105573	holin,lysis	Burkholderia_phage(26.67%)	23	NA	NA
AUT91167.1|1195417_1196233_+	antitermination protein	NA	M9NZB0	Enterobacteria_phage	43.4	3.5e-54
AUT91168.1|1196209_1196413_-	hypothetical protein	NA	NA	NA	NA	NA
AUT91169.1|1196614_1196914_+|holin	phage holin, lambda family	holin	A0A1P8DTE4	Proteus_phage	51.0	1.9e-21
AUT91170.1|1196916_1197321_+	structural protein	NA	A0A0E3JJ20	Enterobacteria_phage	45.8	3.8e-25
AUT91171.1|1197317_1197767_+|lysis	lysis protein	lysis	NA	NA	NA	NA
AUT91172.1|1197803_1198316_+	hypothetical protein	NA	NA	NA	NA	NA
AUT91173.1|1198324_1199812_+	DUF3383 domain-containing protein	NA	A0A088C3U1	Shewanella_sp._phage	35.5	3.2e-77
AUT91174.1|1199822_1200275_+	hypothetical protein	NA	NA	NA	NA	NA
AUT91175.1|1200334_1200793_+	hypothetical protein	NA	Q6IWV4	Burkholderia_phage	48.5	1.9e-25
AUT91176.1|1200875_1203179_+	hypothetical protein	NA	A0A2H5BG44	Pseudoalteromonas_phage	23.3	5.4e-15
AUT91177.1|1203181_1203670_+	hypothetical protein	NA	NA	NA	NA	NA
AUT91178.1|1203682_1204003_+	hypothetical protein	NA	NA	NA	NA	NA
AUT91179.1|1203971_1204784_+	hypothetical protein	NA	Q6IWQ0	Burkholderia_phage	39.2	9.0e-42
AUT91180.1|1204786_1205479_+	hypothetical protein	NA	A0A2H4P6V3	Pseudomonas_phage	35.7	1.2e-29
AUT91181.1|1205475_1205820_+	hypothetical protein	NA	NA	NA	NA	NA
AUT91182.1|1205812_1207000_+	hypothetical protein	NA	A0A2H5BG53	Pseudoalteromonas_phage	37.7	8.5e-73
AUT91183.1|1206996_1207653_+	DUF2612 domain-containing protein	NA	Q6IWQ4	Burkholderia_phage	39.9	2.3e-35
AUT91184.1|1207658_1208864_+	hypothetical protein	NA	Q6IWQ6	Burkholderia_phage	34.1	3.1e-14
AUT91185.1|1208967_1209147_-	GhoT/OrtT family toxin	NA	NA	NA	NA	NA
AUT91186.1|1209715_1210258_+	DUF924 domain-containing protein	NA	A0A1V0SIY0	Klosneuvirus	34.7	1.9e-19
AUT91187.1|1210373_1211150_-	diguanylate cyclase	NA	A0A077SK59	Escherichia_phage	39.8	5.1e-42
AUT91188.1|1211153_1211771_-	dimethylsulfoxide reductase, chain B	NA	A0A077SL61	Escherichia_phage	67.8	1.3e-88
AUT91189.1|1211782_1214215_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	54.5	5.0e-261
>prophage 6
CP026044	Proteus mirabilis strain FDAARGOS_60 chromosome, complete genome	4105573	1585427	1632987	4105573	integrase,tail,lysis,terminase	Proteus_phage(22.22%)	70	1584701:1584716	1586425:1586440
1584701:1584716	attL	TTTAATGGAGAAAATT	NA	NA	NA	NA
AUT91513.1|1585427_1586423_-|integrase	integrase	integrase	Q9MCR4	Enterobacteria_phage	44.9	9.3e-73
AUT91514.1|1586379_1586625_-	excisionase	NA	NA	NA	NA	NA
1586425:1586440	attR	AATTTTCTCCATTAAA	NA	NA	NA	NA
AUT91515.1|1586621_1586942_-	DUF2591 domain-containing protein	NA	A0A1P8DTH6	Proteus_phage	51.9	1.3e-15
AUT91516.1|1587268_1587544_-	hypothetical protein	NA	NA	NA	NA	NA
AUT91517.1|1587536_1587764_-	hypothetical protein	NA	A0A1P8DTI8	Proteus_phage	71.2	5.3e-24
AUT91518.1|1587816_1588401_-	hypothetical protein	NA	NA	NA	NA	NA
AUT91519.1|1588472_1588769_-	hypothetical protein	NA	NA	NA	NA	NA
AUT91520.1|1588833_1589514_-	hypothetical protein	NA	R9VWB9	Serratia_phage	54.8	9.8e-66
AUT93790.1|1589516_1589696_-	hypothetical protein	NA	A0A1P8DTH9	Proteus_phage	94.7	5.8e-26
AUT91521.1|1589757_1590186_-	single-stranded DNA-binding protein	NA	A0A1W6JNW8	Morganella_phage	74.6	7.3e-51
AUT91522.1|1590175_1590982_-	recombinase RecT	NA	A0A1P8DTF2	Proteus_phage	94.3	3.9e-138
AUT91523.1|1590974_1591793_-	exodeoxyribonuclease VIII	NA	A0A1P8DTH1	Proteus_phage	96.3	3.8e-157
AUT91524.1|1591789_1592044_-	hypothetical protein	NA	A0A1P8DTG3	Proteus_phage	95.2	7.2e-38
AUT91525.1|1592171_1592354_-	hypothetical protein	NA	A0A1P8DTH8	Proteus_phage	83.3	9.7e-21
AUT91526.1|1592630_1592906_-	hypothetical protein	NA	NA	NA	NA	NA
AUT91527.1|1593070_1593256_+	hypothetical protein	NA	NA	NA	NA	NA
AUT91528.1|1593590_1593806_+	hypothetical protein	NA	NA	NA	NA	NA
AUT91529.1|1593802_1594018_-	hypothetical protein	NA	NA	NA	NA	NA
AUT91530.1|1594026_1594338_-	hypothetical protein	NA	NA	NA	NA	NA
AUT91531.1|1594816_1595233_-	hypothetical protein	NA	NA	NA	NA	NA
AUT91532.1|1595237_1595897_-	hypothetical protein	NA	A0A0P0ZCT8	Stx2-converting_phage	66.4	4.6e-44
AUT91533.1|1595893_1596181_-	type II toxin-antitoxin system HigB family toxin	NA	A0A0P0ZE17	Stx2-converting_phage	58.9	1.8e-29
AUT91534.1|1596280_1597006_-	helix-turn-helix transcriptional regulator	NA	A0A2I6PIE7	Escherichia_phage	42.0	8.9e-41
AUT91535.1|1597111_1597339_+	transcriptional regulator	NA	E5AGE7	Erwinia_phage	67.6	6.0e-20
AUT91536.1|1597481_1597829_+	hypothetical protein	NA	A0A1P8DTF0	Proteus_phage	35.4	2.6e-06
AUT91537.1|1598095_1598863_+	helix-turn-helix domain-containing protein	NA	A5LH71	Enterobacteria_phage	51.9	1.5e-22
AUT91538.1|1598862_1600248_+	helicase	NA	Q716D2	Shigella_phage	47.7	1.0e-114
AUT91539.1|1600273_1600723_+	hypothetical protein	NA	A0A2H4FNF5	Salmonella_phage	31.6	7.0e-12
AUT91540.1|1600729_1601395_+	NinG family protein	NA	A0A1W6JNX3	Morganella_phage	72.4	1.6e-84
AUT91541.1|1601444_1601840_+	antitermination protein	NA	S5M7R9	Escherichia_phage	55.6	1.2e-31
AUT91542.1|1601993_1602227_+	hypothetical protein	NA	NA	NA	NA	NA
AUT91543.1|1602367_1602562_+	hypothetical protein	NA	NA	NA	NA	NA
AUT91544.1|1602635_1603658_+	site-specific DNA-methyltransferase	NA	A0A1W6JP25	Morganella_phage	77.5	6.9e-132
AUT91545.1|1603721_1604519_-	hypothetical protein	NA	NA	NA	NA	NA
AUT91546.1|1604696_1605020_+	negative regulator GrlR	NA	NA	NA	NA	NA
AUT91547.1|1605016_1605208_+	hypothetical protein	NA	NA	NA	NA	NA
AUT91548.1|1605370_1605793_+	hypothetical protein	NA	NA	NA	NA	NA
AUT91549.1|1605846_1606116_+	hypothetical protein	NA	A0A2H4FNF0	Salmonella_phage	53.5	3.5e-19
AUT91550.1|1606115_1606586_+	lysozyme	NA	A0A1W6JNW4	Morganella_phage	62.5	4.4e-49
AUT91551.1|1606728_1607190_+|lysis	lysis protein	lysis	A0A1P8DTG0	Proteus_phage	48.3	5.7e-25
AUT91552.1|1607478_1607904_+	hypothetical protein	NA	NA	NA	NA	NA
AUT91553.1|1608026_1608266_+	hypothetical protein	NA	NA	NA	NA	NA
AUT91554.1|1608583_1609135_-	hypothetical protein	NA	NA	NA	NA	NA
AUT91555.1|1609199_1609802_+	hypothetical protein	NA	A0A077KBY7	Edwardsiella_phage	68.5	2.1e-64
AUT91556.1|1609804_1611292_+|terminase	terminase	terminase	A0A1W6JNY3	Morganella_phage	89.0	3.5e-265
AUT91557.1|1611291_1612662_+	DUF4055 domain-containing protein	NA	A0A1B0VMH0	Pseudomonas_phage	48.6	2.6e-118
AUT91558.1|1612658_1613780_+	hypothetical protein	NA	I6PD76	Cronobacter_phage	51.0	6.7e-104
AUT91559.1|1613891_1614653_+	hypothetical protein	NA	A0A1B0VMG1	Pseudomonas_phage	59.3	1.5e-67
AUT91560.1|1614666_1615620_+	hypothetical protein	NA	A0A1B0VMF8	Pseudomonas_phage	71.2	5.3e-126
AUT91561.1|1615684_1615948_-	hypothetical protein	NA	NA	NA	NA	NA
AUT91562.1|1615946_1616426_+	hypothetical protein	NA	G8C7P9	Escherichia_phage	47.7	3.8e-32
AUT91563.1|1616428_1616779_+	hypothetical protein	NA	I6PD77	Cronobacter_phage	45.1	3.8e-21
AUT91564.1|1616780_1617362_+	hypothetical protein	NA	G8C7Q1	Escherichia_phage	51.6	1.0e-47
AUT91565.1|1617358_1617760_+	hypothetical protein	NA	NA	NA	NA	NA
AUT91566.1|1617805_1618462_+|tail	phage tail protein	tail	G8C7Q3	Escherichia_phage	56.3	1.2e-57
AUT91567.1|1618513_1618819_+	hypothetical protein	NA	I6PDG2	Cronobacter_phage	55.4	6.6e-22
AUT93791.1|1618845_1619121_+	hypothetical protein	NA	A0A2H4J4F7	uncultured_Caudovirales_phage	47.9	2.5e-12
AUT91568.1|1619149_1619356_-	hypothetical protein	NA	NA	NA	NA	NA
AUT91569.1|1619508_1619880_+	hypothetical protein	NA	E7C9U7	Salmonella_phage	65.7	4.4e-36
AUT91570.1|1619893_1620076_-	hypothetical protein	NA	A0A192Y6A8	Salmonella_phage	76.3	3.7e-20
AUT91571.1|1620428_1621577_+	hypothetical protein	NA	NA	NA	NA	NA
AUT91572.1|1621578_1622112_+	hypothetical protein	NA	NA	NA	NA	NA
AUT91573.1|1622283_1622694_+	hypothetical protein	NA	B9UDL3	Salmonella_phage	71.1	2.5e-48
AUT91574.1|1622756_1625687_+|tail	phage tail tape measure protein	tail	K7PMB9	Enterobacterial_phage	35.5	3.1e-132
AUT91575.1|1625698_1625989_+	hypothetical protein	NA	NA	NA	NA	NA
AUT91576.1|1626351_1626693_+|tail	phage tail protein	tail	I6PBN7	Cronobacter_phage	50.0	9.0e-28
AUT91577.1|1626689_1627433_+|tail	phage minor tail protein L	tail	K7PJS0	Enterobacterial_phage	58.6	7.1e-86
AUT91578.1|1627429_1628140_+	peptidase P60	NA	A0A1P8DTI6	Proteus_phage	62.0	8.9e-86
AUT91579.1|1628136_1628742_+|tail	tail assembly protein	tail	F1C572	Cronobacter_phage	56.8	1.9e-52
AUT91580.1|1628793_1632987_+	DUF1983 domain-containing protein	NA	F1C571	Cronobacter_phage	54.4	8.4e-301
>prophage 7
CP026044	Proteus mirabilis strain FDAARGOS_60 chromosome, complete genome	4105573	1805439	1815431	4105573		Escherichia_phage(66.67%)	9	NA	NA
AUT91747.1|1805439_1807884_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	50.4	5.6e-220
AUT91748.1|1807895_1808513_+	dimethylsulfoxide reductase, chain B	NA	A0A077SL61	Escherichia_phage	58.6	2.2e-72
AUT91749.1|1808514_1809375_+	dimethylsulfoxide reductase	NA	A0A077SK59	Escherichia_phage	35.5	3.7e-25
AUT91750.1|1809514_1810126_+	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	39.1	7.3e-28
AUT91751.1|1810178_1810640_-	nucleoside deaminase	NA	S4VYZ2	Pandoravirus	34.6	7.0e-15
AUT91752.1|1810639_1811326_-	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
AUT91753.1|1811575_1811659_+	K(+)-transporting ATPase subunit F	NA	NA	NA	NA	NA
AUT91754.1|1811661_1813362_+	potassium-transporting ATPase subunit KdpA	NA	NA	NA	NA	NA
AUT91755.1|1813373_1815431_+	K(+)-transporting ATPase subunit B	NA	E4ZFI9	Streptococcus_phage	26.1	2.2e-31
>prophage 8
CP026044	Proteus mirabilis strain FDAARGOS_60 chromosome, complete genome	4105573	2019653	2090425	4105573	capsid,tRNA,tail,terminase,lysis,head,integrase,protease,transposase,portal	Morganella_phage(22.5%)	84	2049479:2049495	2096302:2096318
AUT91932.1|2019653_2020862_-|transposase	transposase	transposase	A0A1B0VCD8	Salmonella_phage	81.0	1.1e-187
AUT91933.1|2020884_2021301_+|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	62.0	3.8e-44
AUT91934.1|2021419_2021851_+	hypothetical protein	NA	Q7Y3V7	Yersinia_phage	38.1	1.8e-20
AUT91935.1|2021961_2022825_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
AUT91936.1|2022967_2023351_-	antitermination protein	NA	A0A1W6JNX1	Morganella_phage	47.8	2.3e-24
AUT91937.1|2023585_2024362_-	type I methionyl aminopeptidase	NA	NA	NA	NA	NA
AUT91938.1|2024379_2024577_-	hypothetical protein	NA	NA	NA	NA	NA
AUT91939.1|2024952_2025513_+	ATPase	NA	A0A219VHB7	Ochrobactrum_phage	50.6	1.9e-19
AUT91940.1|2025575_2025818_-	hypothetical protein	NA	NA	NA	NA	NA
AUT91941.1|2025845_2026259_-	hypothetical protein	NA	NA	NA	NA	NA
AUT91942.1|2026627_2026909_-	hypothetical protein	NA	NA	NA	NA	NA
AUT91943.1|2027253_2027475_-	DUF465 domain-containing protein	NA	NA	NA	NA	NA
AUT91944.1|2028359_2029355_-	DUF1722 domain-containing protein	NA	NA	NA	NA	NA
AUT91945.1|2030012_2030369_-	hypothetical protein	NA	NA	NA	NA	NA
AUT91946.1|2030931_2031594_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AUT91947.1|2032152_2033379_+	phosphoadenosine phosphosulfate reductase	NA	A0A220GKF8	Streptococcus_phage	33.2	2.0e-61
AUT91948.1|2033391_2034033_+	hypothetical protein	NA	A0A0F7L444	uncultured_marine_virus	47.8	2.4e-50
AUT91949.1|2034041_2034302_+	hypothetical protein	NA	NA	NA	NA	NA
AUT91950.1|2034676_2034991_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AUT91951.1|2035336_2035576_+	hypothetical protein	NA	NA	NA	NA	NA
AUT91952.1|2035829_2036372_+	hypothetical protein	NA	NA	NA	NA	NA
AUT91953.1|2036395_2036593_-	hypothetical protein	NA	NA	NA	NA	NA
AUT91954.1|2036833_2037682_-	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
AUT93798.1|2037771_2038146_+	transcriptional regulator	NA	NA	NA	NA	NA
AUT91955.1|2038268_2038730_-	hypothetical protein	NA	NA	NA	NA	NA
AUT91956.1|2039220_2039679_-	heat-shock protein	NA	NA	NA	NA	NA
AUT91957.1|2040010_2040223_-	RNA chaperone/antiterminator CspA	NA	A0A1W6JNX5	Morganella_phage	78.6	2.0e-25
AUT91958.1|2040662_2041787_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
AUT91959.1|2042981_2043134_-	isocitrate dehydrogenase	NA	Q77Z09	Phage_21	90.0	2.0e-19
AUT91960.1|2043336_2043483_+|integrase	integrase	integrase	NA	NA	NA	NA
AUT91961.1|2043549_2043924_+	hypothetical protein	NA	NA	NA	NA	NA
AUT91962.1|2044285_2044999_+	type 1 fimbrial protein	NA	NA	NA	NA	NA
AUT91963.1|2045704_2045869_-	isocitrate dehydrogenase	NA	Q77Z09	Phage_21	92.6	1.6e-22
AUT91964.1|2046309_2047377_-	hypothetical protein	NA	NA	NA	NA	NA
AUT91965.1|2047397_2048801_-	DUF560 domain-containing protein	NA	NA	NA	NA	NA
2049479:2049495	attL	TTATCATTTGATAAATA	NA	NA	NA	NA
AUT91966.1|2049767_2050073_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AUT91967.1|2050773_2051034_-	hypothetical protein	NA	A0A1P8DTJ0	Proteus_phage	56.4	2.5e-17
AUT91968.1|2051083_2051698_-	hypothetical protein	NA	NA	NA	NA	NA
AUT91969.1|2051699_2052068_-	hypothetical protein	NA	NA	NA	NA	NA
AUT91970.1|2052061_2055787_-	DUF1983 domain-containing protein	NA	Q7Y3Z3	Yersinia_phage	51.8	3.4e-200
AUT91971.1|2055786_2056185_-	hypothetical protein	NA	A0A059VK01	Pseudomonas_phage	47.7	9.2e-32
AUT91972.1|2056216_2056522_-	hypothetical protein	NA	NA	NA	NA	NA
AUT91973.1|2056533_2057115_-	hypothetical protein	NA	Q7Y3Z7	Yersinia_phage	50.0	2.4e-52
AUT91974.1|2057114_2057711_-	hypothetical protein	NA	S4TSP7	Salmonella_phage	52.8	4.6e-51
AUT91975.1|2057711_2060987_-|tail	phage tail tape measure protein	tail	B7SE05	Pseudomonas_virus	45.6	4.9e-54
AUT91976.1|2061113_2061305_+	YqaE/Pmp3 family membrane protein	NA	NA	NA	NA	NA
AUT91977.1|2061329_2061608_-	DUF4035 domain-containing protein	NA	NA	NA	NA	NA
AUT91978.1|2061604_2062021_-	hypothetical protein	NA	NA	NA	NA	NA
AUT91979.1|2062085_2062751_-	hypothetical protein	NA	NA	NA	NA	NA
AUT91980.1|2062760_2063102_-	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
AUT91981.1|2063107_2063581_-	hypothetical protein	NA	A0A0R6PHU8	Moraxella_phage	31.5	1.9e-12
AUT91982.1|2063570_2063900_-|head,tail	head-tail adaptor protein	head,tail	NA	NA	NA	NA
AUT91983.1|2063899_2064199_-	hypothetical protein	NA	K7PKV5	Enterobacterial_phage	64.3	2.8e-33
AUT91984.1|2064237_2065404_-|capsid	phage major capsid protein	capsid	F1C582	Cronobacter_phage	79.8	5.6e-170
AUT91985.1|2065407_2066076_-|head,protease	HK97 family phage prohead protease	head,protease	K7PM91	Enterobacterial_phage	65.3	1.1e-82
AUT91986.1|2066093_2067362_-|portal	phage portal protein	portal	Q77W97	Enterobacteria_phage	80.2	5.1e-201
AUT91987.1|2067361_2069095_-|terminase	terminase large subunit	terminase	A0A0U2C138	Paracoccus_phage	46.3	2.0e-147
AUT91988.1|2069048_2069516_-|terminase	phage terminase small subunit P27 family	terminase	Q9B019	Phage_GMSE-1	59.7	5.5e-44
AUT91989.1|2069853_2070192_-	HNH endonuclease	NA	F1C587	Cronobacter_phage	67.9	1.6e-40
AUT91990.1|2071088_2071550_-|lysis	lysis protein	lysis	A0A1P8DTG0	Proteus_phage	47.6	3.7e-24
AUT91991.1|2071692_2072163_-	lysozyme	NA	A0A1W6JNW4	Morganella_phage	60.5	5.8e-49
AUT91992.1|2072162_2072432_-	hypothetical protein	NA	A0A2H4FNF0	Salmonella_phage	53.5	4.6e-19
AUT91993.1|2072875_2073127_-	hypothetical protein	NA	NA	NA	NA	NA
AUT91994.1|2073279_2073708_-	hypothetical protein	NA	NA	NA	NA	NA
AUT91995.1|2074123_2075050_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AUT91996.1|2075153_2075489_+	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
AUT91997.1|2075812_2076334_-	DUF1440 domain-containing protein	NA	NA	NA	NA	NA
AUT91998.1|2076735_2076948_-	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	75.7	7.6e-25
AUT91999.1|2077287_2077686_-	antitermination protein	NA	Q8W638	Enterobacteria_phage	55.8	3.5e-31
AUT92000.1|2078189_2079269_-	(p)ppGpp synthetase	NA	A0A1B0VBT5	Salmonella_phage	39.6	1.4e-50
AUT92001.1|2079568_2080594_-	DUF968 domain-containing protein	NA	A0A1W6JP62	Morganella_phage	45.9	3.0e-82
AUT92002.1|2080590_2081397_-	DNA-binding protein	NA	A0A1W6JP13	Morganella_phage	62.1	1.2e-89
AUT93799.1|2081418_2081934_-	hypothetical protein	NA	U5P0A0	Shigella_phage	44.2	4.6e-23
AUT92003.1|2082491_2082671_-	DUF4222 domain-containing protein	NA	A0A1W6JP38	Morganella_phage	55.2	2.6e-10
AUT92004.1|2082932_2083409_-	hypothetical protein	NA	A0A1W6JP72	Morganella_phage	61.1	7.9e-46
AUT92005.1|2083446_2083653_-	cell division protein	NA	H9C161	Pectobacterium_phage	40.7	8.5e-05
AUT92006.1|2083753_2084386_+	LexA family transcriptional repressor	NA	K7PLZ5	Enterobacterial_phage	44.4	1.5e-39
AUT92007.1|2084670_2085195_+	hypothetical protein	NA	A0A1W6JP41	Morganella_phage	60.5	1.1e-53
AUT92008.1|2085280_2085532_+	excisionase	NA	NA	NA	NA	NA
AUT92009.1|2085506_2086640_+|integrase	integrase	integrase	Q77Z04	Phage_21	72.2	6.5e-155
AUT92010.1|2086749_2088003_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	90.7	1.8e-20
AUT92011.1|2088141_2088771_+	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
AUT92012.1|2088763_2089216_+	NUDIX hydrolase	NA	NA	NA	NA	NA
AUT92013.1|2089321_2090425_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
2096302:2096318	attR	TTATCATTTGATAAATA	NA	NA	NA	NA
>prophage 9
CP026044	Proteus mirabilis strain FDAARGOS_60 chromosome, complete genome	4105573	2166822	2205867	4105573	tRNA,terminase,lysis,head,holin	Burkholderia_phage(26.32%)	49	NA	NA
AUT92081.1|2166822_2167608_+	glycosyltransferase LpsA	NA	A0A2P1EMF9	Moumouvirus	30.0	1.3e-08
AUT92082.1|2168987_2169644_-	DUF2612 domain-containing protein	NA	Q6IWQ4	Burkholderia_phage	40.9	3.4e-39
AUT92083.1|2169640_2170828_-	hypothetical protein	NA	Q6IWQ3	Burkholderia_phage	40.3	2.0e-69
AUT92084.1|2170820_2171165_-	hypothetical protein	NA	NA	NA	NA	NA
AUT92085.1|2171161_2171854_-	hypothetical protein	NA	A1Z003	Burkholderia_virus	39.4	9.1e-35
AUT92086.1|2171856_2172672_-	hypothetical protein	NA	A1Z005	Burkholderia_virus	24.9	1.4e-10
AUT92087.1|2172637_2172955_-	hypothetical protein	NA	Q6IWP9	Burkholderia_phage	32.3	7.4e-08
AUT92088.1|2172954_2173482_-	hypothetical protein	NA	NA	NA	NA	NA
AUT92089.1|2173478_2175773_-	hypothetical protein	NA	A0A2H5BG44	Pseudoalteromonas_phage	28.7	1.5e-17
AUT92090.1|2175856_2176315_-	hypothetical protein	NA	Q6IWV4	Burkholderia_phage	48.5	6.7e-26
AUT92091.1|2176355_2176808_-	hypothetical protein	NA	I7ATP4	Escherichia_phage	38.1	5.8e-22
AUT92092.1|2176818_2178306_-	DUF3383 domain-containing protein	NA	A0A088C3U1	Shewanella_sp._phage	37.7	1.1e-82
AUT92093.1|2178816_2179188_-	hypothetical protein	NA	NA	NA	NA	NA
AUT92094.1|2179187_2179646_-	hypothetical protein	NA	Q6IWU9	Burkholderia_phage	38.6	5.5e-12
AUT92095.1|2179645_2180077_-	DUF4054 domain-containing protein	NA	Q6IWU8	Burkholderia_phage	31.0	3.3e-11
AUT92096.1|2180079_2180421_-	hypothetical protein	NA	Q6IWU7	Burkholderia_phage	33.6	6.1e-08
AUT92097.1|2180490_2181558_-	DUF2184 domain-containing protein	NA	A0A088C493	Shewanella_sp._phage	38.9	2.6e-52
AUT92098.1|2181557_2182055_-	hypothetical protein	NA	NA	NA	NA	NA
AUT92099.1|2182054_2183317_-	DUF2213 domain-containing protein	NA	Q6IWU4	Burkholderia_phage	54.3	9.4e-46
AUT93801.1|2183313_2184027_-|head	phage head morphogenesis protein	head	Q6IWU3	Burkholderia_phage	40.0	1.5e-37
AUT92100.1|2184064_2185567_-	DUF1073 domain-containing protein	NA	A0A2H4P6S9	Pseudomonas_phage	44.2	5.5e-101
AUT93802.1|2185571_2186933_-	TerL protein	NA	A9YWZ6	Burkholderia_phage	61.6	1.9e-156
AUT92101.1|2187383_2188394_-|terminase	terminase small subunit	terminase	C5IHM0	Burkholderia_virus	38.6	2.1e-35
AUT92102.1|2188455_2189112_+	hypothetical protein	NA	NA	NA	NA	NA
AUT92103.1|2189112_2189556_-|lysis	lysis protein	lysis	A0A2H4JHL8	uncultured_Caudovirales_phage	38.2	3.7e-13
AUT93803.1|2189561_2189915_-	peptidase M15	NA	A0A1P8DTE2	Proteus_phage	78.7	2.5e-41
AUT93804.1|2189946_2190195_-|holin	holin	holin	NA	NA	NA	NA
AUT93805.1|2190315_2191356_-	site-specific DNA-methyltransferase	NA	A0A1W6JP25	Morganella_phage	71.8	1.5e-142
AUT92104.1|2191510_2191708_-	TrmB family transcriptional regulator	NA	A0A0P0ZDH6	Stx2-converting_phage	63.5	5.4e-09
AUT92105.1|2191870_2192404_-	antiterminator	NA	M1FPN0	Enterobacteria_phage	50.6	8.8e-38
AUT92106.1|2192391_2192703_-	DUF968 domain-containing protein	NA	A0A1I9KFA7	Aeromonas_phage	67.7	1.0e-33
AUT92107.1|2192714_2193308_-	DUF1367 domain-containing protein	NA	K7PKS6	Enterobacteria_phage	54.7	1.1e-57
AUT92108.1|2193382_2194594_-	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
AUT92109.1|2194607_2195276_-	hypothetical protein	NA	NA	NA	NA	NA
AUT92110.1|2195469_2196846_-	replicative DNA helicase	NA	A0A192Y673	Salmonella_phage	45.4	1.9e-100
AUT92111.1|2196835_2197429_-	DNA replication protein DnaC	NA	K7PLU3	Enterobacteria_phage	47.6	1.1e-44
AUT92112.1|2197421_2198249_-	helix-turn-helix domain-containing protein	NA	Q8W642	Enterobacteria_phage	47.4	1.2e-36
AUT92113.1|2198250_2198475_-	hypothetical protein	NA	H9C163	Pectobacterium_phage	54.1	6.8e-16
AUT92114.1|2198492_2198948_-|tRNA	tRNA-(guanine-N1)-methyltransferase	tRNA	H9C162	Pectobacterium_phage	55.4	9.9e-30
AUT92115.1|2198988_2199246_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AUT92116.1|2199350_2200109_+	XRE family transcriptional regulator	NA	A0A0M3LPF9	Mannheimia_phage	39.0	1.5e-27
AUT92117.1|2200565_2200898_+	hypothetical protein	NA	H9C158	Pectobacterium_phage	39.2	2.1e-05
AUT92118.1|2200897_2201158_+	hypothetical protein	NA	A0A1B1W282	Salmonella_phage	45.3	7.9e-08
AUT92119.1|2201170_2203138_+	hypothetical protein	NA	H9C157	Pectobacterium_phage	39.0	3.4e-119
AUT92120.1|2203137_2203638_+	hypothetical protein	NA	H9C156	Pectobacterium_phage	57.0	2.8e-41
AUT92121.1|2203685_2203865_+	hypothetical protein	NA	NA	NA	NA	NA
AUT92122.1|2204305_2204503_+	hypothetical protein	NA	H9C154	Pectobacterium_phage	44.4	1.2e-05
AUT92123.1|2204477_2204690_+	hypothetical protein	NA	NA	NA	NA	NA
AUT92124.1|2204691_2205867_+	recombinase	NA	A0A2D1GN00	Marinobacter_phage	31.9	2.1e-31
>prophage 10
CP026044	Proteus mirabilis strain FDAARGOS_60 chromosome, complete genome	4105573	2291836	2370836	4105573	tRNA,plate,protease	Bacillus_phage(17.65%)	58	NA	NA
AUT92198.1|2291836_2292268_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
AUT92199.1|2292275_2294051_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
AUT93807.1|2294014_2295052_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
AUT92200.1|2295056_2296325_+	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
AUT92201.1|2296326_2296878_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
AUT92202.1|2296870_2298238_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
AUT92203.1|2298230_2298986_+	hypothetical protein	NA	NA	NA	NA	NA
AUT92204.1|2298994_2301718_+	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	30.5	1.4e-83
AUT92205.1|2301721_2302510_+	Fis family transcriptional regulator	NA	NA	NA	NA	NA
AUT92206.1|2302511_2303162_+	type VI secretion system-associated protein TagO	NA	NA	NA	NA	NA
AUT92207.1|2303167_2304631_+	type VI secretion system protein TssA	NA	NA	NA	NA	NA
AUT92208.1|2304633_2308182_+	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
AUT92209.1|2308219_2309575_+	hypothetical protein	NA	NA	NA	NA	NA
AUT92210.1|2309567_2311304_+	type VI secretion protein	NA	NA	NA	NA	NA
AUT92211.1|2311394_2311868_+	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
AUT92212.1|2311960_2312611_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
AUT92213.1|2312660_2313209_-	DUF882 domain-containing protein	NA	NA	NA	NA	NA
AUT92214.1|2313540_2315256_-	L,D-transpeptidase	NA	NA	NA	NA	NA
AUT92215.1|2315598_2316312_-	acid phosphatase AphA	NA	NA	NA	NA	NA
AUT92216.1|2316717_2317371_+	type A chloramphenicol O-acetyltransferase	NA	G3CFL0	Escherichia_phage	78.0	1.4e-98
AUT92217.1|2317652_2322110_-	chromosome partition protein MukB	NA	NA	NA	NA	NA
AUT92218.1|2322106_2322838_-	condensin subunit E	NA	NA	NA	NA	NA
AUT92219.1|2322818_2324141_-	chromosome partition protein MukF	NA	NA	NA	NA	NA
AUT92220.1|2324150_2324924_-|tRNA	tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM	tRNA	NA	NA	NA	NA
AUT92221.1|2325303_2326134_+	envelope biogenesis factor ElyC	NA	NA	NA	NA	NA
AUT92222.1|2326257_2327019_-	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
AUT92223.1|2327023_2327203_-	hypothetical protein	NA	NA	NA	NA	NA
AUT92224.1|2327617_2327833_-	cold shock domain-containing protein	NA	NA	NA	NA	NA
AUT92225.1|2328328_2329330_-	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
AUT92226.1|2329326_2331072_-	lipid A ABC transporter ATP-binding protein/permease MsbA	NA	W8CYL7	Bacillus_phage	30.9	8.4e-61
AUT92227.1|2331108_2333478_-	DNA internalization-related competence protein ComEC/Rec2	NA	Q0H255	Geobacillus_phage	29.7	2.7e-22
AUT92228.1|2333909_2334197_-	integration host factor subunit beta	NA	A7KV42	Bacillus_phage	40.0	8.4e-11
AUT92229.1|2334261_2335935_-	30S ribosomal protein S1	NA	NA	NA	NA	NA
AUT92230.1|2336116_2336794_-	cytidylate kinase	NA	NA	NA	NA	NA
AUT92231.1|2337082_2338369_-	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
AUT92232.1|2338565_2339654_-	3-phosphoserine/phosphohydroxythreonine aminotransferase	NA	M1Q1P2	Streptococcus_phage	47.0	5.7e-84
AUT92233.1|2339790_2341221_+	MFS transporter	NA	A0A0M3UL24	Mycobacterium_phage	24.4	1.7e-06
AUT92234.1|2341357_2342626_+	filamentous hemagglutinin N-terminal domain-containing protein	NA	NA	NA	NA	NA
AUT92235.1|2342700_2343738_-	L-asparaginase 2	NA	NA	NA	NA	NA
AUT92236.1|2343965_2345723_+	30S ribosomal protein S12 methylthiotransferase accessory factor YcaO	NA	NA	NA	NA	NA
AUT92237.1|2346392_2347247_+	formate transporter FocA	NA	NA	NA	NA	NA
AUT92238.1|2347301_2349584_+	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.6	1.0e-159
AUT92239.1|2349691_2350432_+	pyruvate formate lyase 1-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	27.0	2.3e-20
AUT92240.1|2350789_2351695_+	hypothetical protein	NA	NA	NA	NA	NA
AUT92241.1|2351767_2352817_-	ureidoglycolate dehydrogenase	NA	NA	NA	NA	NA
AUT92242.1|2353214_2353547_+	hypothetical protein	NA	NA	NA	NA	NA
AUT92243.1|2353726_2355016_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	46.2	4.1e-97
AUT93808.1|2355149_2356499_-	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	40.6	1.8e-79
AUT92244.1|2356509_2357115_-	outer membrane lipoprotein carrier protein LolA	NA	NA	NA	NA	NA
AUT92245.1|2357227_2361055_-	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	49.3	1.7e-90
AUT92246.1|2361182_2361677_-	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
AUT92247.1|2362220_2363180_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	45.5	3.4e-64
AUT92248.1|2363321_2365091_+	thiol reductant ABC exporter subunit CydD	NA	W8CYL7	Bacillus_phage	23.5	3.0e-21
AUT92249.1|2365093_2366845_+	thiol reductant ABC exporter subunit CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	31.7	1.4e-18
AUT92250.1|2366846_2367539_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
AUT92251.1|2367858_2368077_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
AUT92252.1|2368196_2370491_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.9	1.3e-170
AUT92253.1|2370521_2370836_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.1	1.5e-13
>prophage 11
CP026044	Proteus mirabilis strain FDAARGOS_60 chromosome, complete genome	4105573	2521392	2576328	4105573	tRNA,tail,terminase,lysis,integrase,head	Morganella_phage(43.18%)	69	2523098:2523116	2576397:2576415
AUT92385.1|2521392_2523060_-|tRNA	glutamine--tRNA ligase	tRNA	A0A222YZ70	Escherichia_phage	85.0	1.0e-286
2523098:2523116	attL	ACTATAATCCAATAAGCAG	NA	NA	NA	NA
AUT92386.1|2523304_2523445_+	hypothetical protein	NA	A0A1P8DTI0	Proteus_phage	93.5	7.2e-16
AUT92387.1|2523938_2524484_+	F17 fimbrial protein	NA	NA	NA	NA	NA
AUT93812.1|2524549_2525275_+	molecular chaperone	NA	NA	NA	NA	NA
AUT92388.1|2525284_2527819_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
AUT92389.1|2527828_2528911_+	type 1 fimbrial protein	NA	NA	NA	NA	NA
AUT92390.1|2529011_2529317_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AUT92391.1|2530017_2530317_-	hypothetical protein	NA	A0A1P8DTJ0	Proteus_phage	55.3	1.3e-17
AUT92392.1|2530366_2530981_-	hypothetical protein	NA	NA	NA	NA	NA
AUT92393.1|2530982_2531351_-	hypothetical protein	NA	NA	NA	NA	NA
AUT92394.1|2531344_2535490_-	DUF1983 domain-containing protein	NA	A0A1W6JNW2	Morganella_phage	75.5	0.0e+00
AUT92395.1|2535489_2536056_-|tail	tail assembly protein	tail	A0A1W6JP03	Morganella_phage	76.7	3.1e-49
AUT92396.1|2535992_2536712_-|tail	phage tail protein	tail	A0A1W6JNU8	Morganella_phage	74.9	2.8e-111
AUT92397.1|2536715_2537414_-|tail	phage minor tail protein L	tail	A0A1W6JNT8	Morganella_phage	83.2	3.1e-115
AUT92398.1|2537410_2537740_-|tail	phage tail protein	tail	A0A1W6JNT2	Morganella_phage	71.6	9.6e-43
AUT92399.1|2537884_2538094_+	hypothetical protein	NA	NA	NA	NA	NA
AUT92400.1|2538083_2538308_-	hypothetical protein	NA	NA	NA	NA	NA
AUT92401.1|2538323_2541473_-	tape measure protein	NA	A0A1W6JNU2	Morganella_phage	53.0	3.3e-100
AUT92402.1|2541540_2542221_-	hypothetical protein	NA	NA	NA	NA	NA
AUT93813.1|2542385_2543180_-	phage antirepressor protein	NA	A0A2I7RX10	Vibrio_phage	42.7	8.0e-43
AUT92403.1|2544224_2545040_+	XRE family transcriptional regulator	NA	A0A1P8DTH0	Proteus_phage	26.5	4.0e-13
AUT92404.1|2545143_2545401_+	hypothetical protein	NA	NA	NA	NA	NA
AUT92405.1|2545660_2546236_-	hypothetical protein	NA	NA	NA	NA	NA
AUT92406.1|2546261_2547197_-	DUF4747 domain-containing protein	NA	NA	NA	NA	NA
AUT92407.1|2547479_2548172_-	hypothetical protein	NA	A0A1W6JNX2	Morganella_phage	70.6	4.9e-89
AUT92408.1|2548221_2548977_-	DNA breaking-rejoining protein	NA	A0A1W6JNT1	Morganella_phage	79.7	5.7e-107
AUT92409.1|2549041_2549413_-	hypothetical protein	NA	A0A1W6JNU7	Morganella_phage	70.7	1.5e-47
AUT92410.1|2549409_2549778_-	hypothetical protein	NA	A0A1W6JNX7	Morganella_phage	83.6	3.3e-52
AUT92411.1|2549780_2550122_-	hypothetical protein	NA	A0A1W6JNW7	Morganella_phage	79.6	1.2e-51
AUT92412.1|2550123_2550501_-	hypothetical protein	NA	A0A1W6JP09	Morganella_phage	71.2	5.8e-44
AUT92413.1|2550543_2551494_-	hypothetical protein	NA	A0A1W6JNV5	Morganella_phage	87.1	1.3e-153
AUT92414.1|2551499_2552186_-	hypothetical protein	NA	A0A1W6JNU9	Morganella_phage	81.1	3.4e-74
AUT92415.1|2552260_2553325_-|head	phage head morphogenesis protein	head	A0A1W6JNT7	Morganella_phage	51.4	9.2e-103
AUT92416.1|2553333_2554710_-	DUF4055 domain-containing protein	NA	A0A1W6JNV0	Morganella_phage	78.6	9.1e-212
AUT92417.1|2554711_2556196_-|terminase	terminase	terminase	A0A1W6JNY3	Morganella_phage	88.7	4.7e-270
AUT92418.1|2556198_2556807_-	hypothetical protein	NA	A0A077KBY7	Edwardsiella_phage	69.6	4.4e-65
AUT92419.1|2556989_2557196_-	hypothetical protein	NA	NA	NA	NA	NA
AUT92420.1|2557192_2557777_-	hypothetical protein	NA	Q3LZN7	Bacteriophage	48.2	2.0e-22
AUT92421.1|2558124_2558586_-|lysis	lysis protein	lysis	A0A2H4JHL8	uncultured_Caudovirales_phage	34.0	8.5e-13
AUT92422.1|2558728_2559199_-	lysozyme	NA	A0A1W6JNW4	Morganella_phage	60.8	1.4e-47
AUT92423.1|2559198_2559468_-	hypothetical protein	NA	A0A2H4FNF0	Salmonella_phage	53.5	6.0e-19
AUT92424.1|2559521_2559944_-	hypothetical protein	NA	NA	NA	NA	NA
AUT92425.1|2560102_2560624_-	DUF1440 domain-containing protein	NA	NA	NA	NA	NA
AUT92426.1|2560935_2561568_-	antitermination protein	NA	I6PDF8	Cronobacter_phage	34.3	3.3e-23
AUT92427.1|2561567_2561924_-	RusA family crossover junction endodeoxyribonuclease	NA	G8C7V6	Escherichia_phage	71.6	3.2e-44
AUT92428.1|2561920_2562211_-	DUF1364 domain-containing protein	NA	A0A2H4JIC4	uncultured_Caudovirales_phage	68.1	7.2e-34
AUT92429.1|2562289_2562739_-	hypothetical protein	NA	A0A2H4FNF5	Salmonella_phage	31.6	7.0e-12
AUT92430.1|2562764_2564150_-	helicase	NA	Q716D2	Shigella_phage	47.7	1.0e-114
AUT92431.1|2564149_2564917_-	helix-turn-helix domain-containing protein	NA	A5LH71	Enterobacteria_phage	51.9	1.5e-22
AUT92432.1|2565183_2565531_-	hypothetical protein	NA	A0A1P8DTF0	Proteus_phage	35.4	2.6e-06
AUT92433.1|2565676_2565886_-	XRE family transcriptional regulator	NA	K7PKH4	Enterobacteria_phage	83.3	1.2e-25
AUT92434.1|2565991_2566636_+	LexA family transcriptional repressor	NA	A0A077KGZ5	Edwardsiella_phage	65.0	1.9e-79
AUT92435.1|2566670_2567450_+	hypothetical protein	NA	NA	NA	NA	NA
AUT92436.1|2567446_2567812_+	hypothetical protein	NA	NA	NA	NA	NA
AUT92437.1|2568266_2568584_+	hypothetical protein	NA	A0A1W6JNZ0	Morganella_phage	52.3	7.1e-19
AUT92438.1|2568598_2568835_+	hypothetical protein	NA	NA	NA	NA	NA
AUT92439.1|2568806_2569088_-	DUF2622 domain-containing protein	NA	NA	NA	NA	NA
AUT92440.1|2569254_2569530_+	hypothetical protein	NA	NA	NA	NA	NA
AUT92441.1|2569806_2569989_+	hypothetical protein	NA	A0A1P8DTH8	Proteus_phage	81.7	6.3e-20
AUT92442.1|2570116_2570371_+	hypothetical protein	NA	A0A1P8DTG3	Proteus_phage	96.4	4.2e-38
AUT92443.1|2570367_2571186_+	exodeoxyribonuclease VIII	NA	A0A1P8DTH1	Proteus_phage	97.8	1.8e-159
AUT92444.1|2571178_2571985_+	recombinase RecT	NA	A0A1P8DTF2	Proteus_phage	98.9	1.9e-145
AUT92445.1|2572715_2572910_+	hypothetical protein	NA	NA	NA	NA	NA
AUT92446.1|2572937_2573117_+	hypothetical protein	NA	NA	NA	NA	NA
AUT92447.1|2573126_2573660_+	hypothetical protein	NA	J9Q748	Salmonella_phage	46.8	8.8e-38
AUT92448.1|2573688_2574414_+	hypothetical protein	NA	NA	NA	NA	NA
AUT92449.1|2574789_2575128_+	DUF2591 domain-containing protein	NA	A0A1P8DTH6	Proteus_phage	45.0	5.6e-14
AUT92450.1|2575124_2575370_+	excisionase	NA	NA	NA	NA	NA
AUT92451.1|2575326_2576328_+|integrase	integrase	integrase	Q9MCR4	Enterobacteria_phage	43.7	1.1e-68
2576397:2576415	attR	ACTATAATCCAATAAGCAG	NA	NA	NA	NA
>prophage 12
CP026044	Proteus mirabilis strain FDAARGOS_60 chromosome, complete genome	4105573	2622142	2630345	4105573		Mycobacterium_phage(28.57%)	9	NA	NA
AUT92487.1|2622142_2622517_+	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	52.0	2.7e-25
AUT92488.1|2623126_2623402_+	hypothetical protein	NA	NA	NA	NA	NA
AUT92489.1|2623586_2623829_-	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	70.0	6.9e-22
AUT92490.1|2623993_2624467_-	cysteine methyltransferase	NA	NA	NA	NA	NA
AUT92491.1|2624748_2624973_+	glutaredoxin-like protein NrdH	NA	V5UN81	Mycobacterium_phage	47.9	1.4e-13
AUT92492.1|2624984_2625389_+	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	R4JF54	Bacillus_phage	38.5	3.7e-12
AUT92493.1|2625417_2627544_+	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	V9VI16	Lactococcus_phage	51.3	3.4e-205
AUT92494.1|2627569_2628538_+	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	R4TBI6	Mycobacterium_phage	71.0	3.5e-133
AUT92495.1|2629145_2630345_+	proline/glycine betaine ABC transporter ATP-binding protein ProV	NA	G3M9Y6	Bacillus_virus	37.6	3.8e-28
>prophage 13
CP026044	Proteus mirabilis strain FDAARGOS_60 chromosome, complete genome	4105573	3167599	3223467	4105573	tRNA,protease	uncultured_Mediterranean_phage(20.0%)	59	NA	NA
AUT92919.1|3167599_3168109_-|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	49.2	2.0e-23
AUT92920.1|3168115_3168757_-	stringent starvation protein A	NA	NA	NA	NA	NA
AUT92921.1|3169392_3169785_-	30S ribosomal protein S9	NA	NA	NA	NA	NA
AUT92922.1|3169800_3170229_-	50S ribosomal protein L13	NA	NA	NA	NA	NA
AUT92923.1|3170678_3171797_-	cell division protein ZapE	NA	NA	NA	NA	NA
AUT92924.1|3171999_3172404_+	cytochrome D ubiquinol oxidase subunit III	NA	NA	NA	NA	NA
AUT92925.1|3172637_3174029_+|protease	serine endoprotease DegQ	protease	A0A1B1IT49	uncultured_Mediterranean_phage	29.8	3.2e-23
AUT92926.1|3174220_3175291_+|protease	serine endoprotease DegS	protease	A0A1B1IRD3	uncultured_Mediterranean_phage	36.5	3.4e-12
AUT92927.1|3175331_3176381_-	DUF2157 domain-containing protein	NA	NA	NA	NA	NA
AUT92928.1|3176586_3177849_-	UDP-N-acetylglucosamine 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
AUT92929.1|3177897_3178152_-	BolA family transcriptional regulator	NA	NA	NA	NA	NA
AUT92930.1|3178292_3178586_-	STAS domain-containing protein	NA	NA	NA	NA	NA
AUT92931.1|3178587_3179217_-	phospholipid-binding protein MlaC	NA	NA	NA	NA	NA
AUT92932.1|3179290_3179827_-	outer membrane lipid asymmetry maintenance protein MlaD	NA	NA	NA	NA	NA
AUT92933.1|3179830_3180610_-	ABC transporter permease	NA	NA	NA	NA	NA
AUT92934.1|3180613_3181426_-	phospholipid ABC transporter ATP-binding protein MlaF	NA	G3M9Y6	Bacillus_virus	32.2	3.0e-21
AUT93822.1|3181669_3182650_+	calcium/sodium antiporter	NA	NA	NA	NA	NA
AUT92935.1|3182668_3183643_+	arabinose-5-phosphate isomerase KdsD	NA	A0A2P0VNK5	Tetraselmis_virus	31.2	7.3e-38
AUT92936.1|3183670_3184228_+	3-deoxy-manno-octulosonate-8-phosphatase KdsC	NA	A0A140XBD6	Dickeya_phage	76.1	1.1e-51
AUT92937.1|3184245_3184824_+	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
AUT92938.1|3184804_3185338_+	lipopolysaccharide ABC transporter substrate-binding protein LptA	NA	NA	NA	NA	NA
AUT92939.1|3185344_3186070_+	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.4	3.2e-22
AUT92940.1|3186129_3187605_+	RNA polymerase sigma-54 factor	NA	NA	NA	NA	NA
AUT92941.1|3187628_3187916_+	ribosome hibernation promoting factor	NA	NA	NA	NA	NA
AUT92942.1|3188071_3188539_+	PTS IIA-like nitrogen regulatory protein PtsN	NA	NA	NA	NA	NA
AUT92943.1|3188623_3189478_+	RNase adaptor protein RapZ	NA	A0A0R8VB27	Thermobifida_phage	29.3	1.1e-05
AUT92944.1|3189474_3189747_+	phosphocarrier protein NPr	NA	NA	NA	NA	NA
AUT92945.1|3189921_3190332_+	nucleoside diphosphate kinase regulator	NA	NA	NA	NA	NA
AUT92946.1|3190437_3191766_-|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
AUT93823.1|3191952_3192513_+	DUF615 domain-containing protein	NA	NA	NA	NA	NA
AUT92947.1|3192603_3192885_-	ribonuclease inhibitor	NA	NA	NA	NA	NA
AUT92948.1|3192884_3193391_-	ribonuclease	NA	NA	NA	NA	NA
AUT92949.1|3193484_3194930_-|protease	metalloprotease TldD	protease	NA	NA	NA	NA
AUT92950.1|3194926_3195787_-	carbon-nitrogen hydrolase family protein	NA	NA	NA	NA	NA
AUT92951.1|3195783_3199587_-	TIGR02099 family protein	NA	NA	NA	NA	NA
AUT92952.1|3199631_3201101_-	ribonuclease G	NA	NA	NA	NA	NA
AUT92953.1|3201097_3201685_-	septum formation inhibitor Maf	NA	NA	NA	NA	NA
AUT92954.1|3201736_3202231_-	rod shape-determining protein MreD	NA	NA	NA	NA	NA
AUT92955.1|3202230_3203277_-	rod shape-determining protein MreC	NA	NA	NA	NA	NA
AUT92956.1|3203378_3204422_-	rod shape-determining protein	NA	F2Y0P3	Organic_Lake_phycodnavirus	21.8	5.1e-05
AUT92957.1|3205108_3206083_+	oxidoreductase	NA	NA	NA	NA	NA
AUT92958.1|3206516_3206960_+	type II 3-dehydroquinate dehydratase	NA	NA	NA	NA	NA
AUT92959.1|3206992_3207463_+	acetyl-CoA carboxylase biotin carboxyl carrier protein	NA	NA	NA	NA	NA
AUT92960.1|3207475_3208825_+	acetyl-CoA carboxylase biotin carboxylase subunit	NA	NA	NA	NA	NA
AUT92961.1|3209054_3209303_+	hypothetical protein	NA	NA	NA	NA	NA
AUT93824.1|3209292_3210738_+	sodium/panthothenate symporter	NA	NA	NA	NA	NA
AUT92962.1|3210762_3211644_+	50S ribosomal protein L11 methyltransferase	NA	NA	NA	NA	NA
AUT92963.1|3211965_3212937_+|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
AUT92964.1|3212957_3213254_+	Fis family transcriptional regulator	NA	NA	NA	NA	NA
AUT93825.1|3213294_3213630_-	DUF1240 domain-containing protein	NA	NA	NA	NA	NA
AUT92965.1|3214173_3214590_+	hypothetical protein	NA	NA	NA	NA	NA
AUT92966.1|3214620_3215586_-	acetyltransferase	NA	NA	NA	NA	NA
AUT92967.1|3215873_3217070_+	MFS transporter	NA	NA	NA	NA	NA
AUT92968.1|3217132_3217849_-	glycerophosphoryl diester phosphodiesterase	NA	NA	NA	NA	NA
AUT92969.1|3218024_3219329_+	sn-glycerol-3-phosphate ABC transporter substrate-binding protein UgpB	NA	NA	NA	NA	NA
AUT92970.1|3219396_3220281_+	sn-glycerol-3-phosphate ABC transporter permease UgpA	NA	NA	NA	NA	NA
AUT92971.1|3220280_3221129_+	sn-glycerol-3-phosphate ABC transporter permease UgpE	NA	NA	NA	NA	NA
AUT92972.1|3221130_3222225_+	sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	30.6	2.6e-20
AUT92973.1|3222714_3223467_+|protease	metalloprotease	protease	NA	NA	NA	NA
>prophage 14
CP026044	Proteus mirabilis strain FDAARGOS_60 chromosome, complete genome	4105573	3574344	3672160	4105573	tRNA,plate,tail,lysis,capsid,integrase,portal,head,holin	Salmonella_phage(31.82%)	100	3626754:3626813	3658936:3658998
AUT93287.1|3574344_3575442_+|tRNA	tRNA (uridine(54)-C5)-methyltransferase TrmA	tRNA	NA	NA	NA	NA
AUT93288.1|3575563_3575965_-	hypothetical protein	NA	NA	NA	NA	NA
AUT93289.1|3575964_3576645_-	HTH-type transcriptional repressor FabR	NA	NA	NA	NA	NA
AUT93290.1|3576845_3578243_+	Si-specific NAD(P)(+) transhydrogenase	NA	NA	NA	NA	NA
AUT93291.1|3578234_3579152_-	DNA-binding transcriptional regulator OxyR	NA	NA	NA	NA	NA
AUT93292.1|3579389_3580772_-	argininosuccinate lyase	NA	NA	NA	NA	NA
AUT93293.1|3580864_3582076_-	argininosuccinate synthase	NA	NA	NA	NA	NA
AUT93294.1|3582140_3582914_-	acetylglutamate kinase	NA	NA	NA	NA	NA
AUT93295.1|3582934_3583939_-	N-acetyl-gamma-glutamyl-phosphate reductase	NA	NA	NA	NA	NA
AUT93296.1|3584039_3585203_+	acetylornithine deacetylase	NA	NA	NA	NA	NA
AUT93297.1|3585294_3587019_-	ubiquinone-dependent pyruvate dehydrogenase	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	22.5	6.2e-24
AUT93298.1|3587583_3588405_+	DUF3100 domain-containing protein	NA	NA	NA	NA	NA
AUT93299.1|3588401_3588851_+	hypothetical protein	NA	NA	NA	NA	NA
AUT93300.1|3588850_3590032_+	amidohydrolase	NA	NA	NA	NA	NA
AUT93301.1|3590107_3591121_-	transcriptional regulator CysB	NA	NA	NA	NA	NA
AUT93302.1|3591890_3593393_+	proline/glycine betaine transporter ProP	NA	Q6JIH2	Burkholderia_virus	32.2	4.8e-57
AUT93303.1|3593403_3594834_+	deoxyribodipyrimidine photo-lyase	NA	A0A1V0SGL1	Hokovirus	33.4	2.1e-62
AUT93304.1|3594873_3595857_+	glycosyl transferase	NA	NA	NA	NA	NA
AUT93305.1|3595913_3598550_-	phosphoenolpyruvate carboxylase	NA	NA	NA	NA	NA
AUT93306.1|3599262_3599781_-	TIGR00645 family protein	NA	NA	NA	NA	NA
AUT93307.1|3599903_3602342_-	bifunctional aspartate kinase/homoserine dehydrogenase II	NA	NA	NA	NA	NA
AUT93308.1|3602351_3603512_-	cystathionine gamma-synthase	NA	NA	NA	NA	NA
AUT93309.1|3603797_3604115_+	met repressor	NA	NA	NA	NA	NA
AUT93310.1|3604902_3605115_-	50S ribosomal protein L31	NA	NA	NA	NA	NA
AUT93311.1|3605318_3607520_+	primosomal protein N'	NA	NA	NA	NA	NA
AUT93312.1|3607772_3608804_+	DNA-binding transcriptional regulator CytR	NA	NA	NA	NA	NA
AUT93313.1|3608874_3609669_+	cell division protein FtsN	NA	NA	NA	NA	NA
AUT93314.1|3609779_3610310_+	HslU--HslV peptidase proteolytic subunit	NA	NA	NA	NA	NA
AUT93315.1|3610322_3611663_+	HslU--HslV peptidase ATPase subunit	NA	A0A191ZC11	Erwinia_phage	27.1	8.7e-42
AUT93316.1|3611761_3612679_+	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
AUT93317.1|3612787_3613306_+	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
AUT93318.1|3613399_3613642_-	cell division protein ZapB	NA	NA	NA	NA	NA
AUT93319.1|3613938_3614754_+	aquaporin	NA	M1HJ75	Acanthocystis_turfacea_Chlorella_virus	28.4	2.9e-16
AUT93320.1|3614796_3616329_+	glycerol kinase	NA	NA	NA	NA	NA
AUT93321.1|3616438_3617623_-	multidrug transporter EmrD	NA	S4TR35	Salmonella_phage	24.2	2.0e-13
AUT93322.1|3617961_3618708_+	ferredoxin--NADP(+) reductase	NA	NA	NA	NA	NA
AUT93323.1|3618768_3619197_-	DUF805 domain-containing protein	NA	NA	NA	NA	NA
AUT93324.1|3619308_3619944_+	DUF1454 domain-containing protein	NA	NA	NA	NA	NA
AUT93325.1|3620050_3620821_+	triose-phosphate isomerase	NA	NA	NA	NA	NA
AUT93326.1|3620916_3621921_-	sulfate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUT93327.1|3622214_3623192_-	6-phosphofructokinase	NA	NA	NA	NA	NA
AUT93328.1|3623730_3624486_+	3-oxoacyl-ACP reductase FabG	NA	NA	NA	NA	NA
AUT93329.1|3624695_3625850_+	glycosyltransferase family 1 protein	NA	NA	NA	NA	NA
AUT93330.1|3625878_3626703_+	glycosyltransferase LpsA	NA	NA	NA	NA	NA
AUT93331.1|3626694_3626904_-	hypothetical protein	NA	NA	NA	NA	NA
3626754:3626813	attL	TAAAATATAATAGATAAAAAAAAGCCCCTCTCCAGAGGGGCTGCAAAAGACAGGGATGGT	NA	NA	NA	NA
AUT93332.1|3627011_3627719_+	hypothetical protein	NA	NA	NA	NA	NA
AUT93333.1|3628162_3628381_-	transcriptional regulator	NA	Q53ZE7	Salmonella_virus	70.3	1.7e-19
AUT93334.1|3628433_3629531_-	late control protein D	NA	E5G6Q3	Salmonella_phage	56.2	3.3e-111
AUT93335.1|3629530_3629995_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	61.4	3.3e-41
AUT93336.1|3629994_3632829_-|tail	phage tail tape measure protein	tail	A0A2H4JE61	uncultured_Caudovirales_phage	40.3	6.2e-106
AUT93835.1|3632821_3632995_-|tail	GpE family phage tail protein	tail	A0A2I8TV82	Erwinia_phage	49.1	2.8e-09
AUT93337.1|3632955_3633303_-|tail	phage tail assembly protein	tail	E5G6P9	Salmonella_phage	56.8	3.5e-19
AUT93338.1|3633322_3633838_-|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	56.1	8.5e-54
AUT93339.1|3633841_3635014_-|tail	phage tail protein	tail	A0A1S6KZY7	Salmonella_phage	71.1	6.5e-166
AUT93340.1|3635106_3635727_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	48.5	1.4e-31
AUT93836.1|3635726_3636443_-	hypothetical protein	NA	M1TAS6	Escherichia_phage	47.3	6.3e-31
AUT93341.1|3637542_3638154_-|tail	phage tail protein I	tail	F1BUP2	Erwinia_phage	67.9	1.2e-75
AUT93342.1|3638146_3639055_-|plate	baseplate assembly protein	plate	A0A0F7LCQ9	Escherichia_phage	66.9	7.3e-109
AUT93343.1|3639056_3639395_-|plate	baseplate assembly protein	plate	F1BUP4	Erwinia_phage	50.0	1.1e-25
AUT93344.1|3639391_3640018_-|plate	phage baseplate assembly protein V	plate	Q6K1H6	Salmonella_virus	59.8	4.5e-57
AUT93345.1|3640137_3640524_-	hypothetical protein	NA	NA	NA	NA	NA
AUT93346.1|3640591_3641230_-	phage virion morphogenesis protein	NA	A0A0M4RCU1	Salmonella_phage	35.8	2.6e-28
AUT93347.1|3641219_3641654_-|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	48.6	2.2e-31
AUT93348.1|3641628_3642141_-|lysis	lysis protein	lysis	A0A0K2FJD0	Enterobacteria_phage	36.3	5.0e-06
AUT93349.1|3642137_3642542_-	peptidase M15	NA	K4F776	Cronobacter_phage	57.4	6.1e-39
AUT93350.1|3642534_3642849_-|holin	holin	holin	NA	NA	NA	NA
AUT93351.1|3642868_3643075_-|tail	phage tail protein	tail	K4PAW7	Burkholderia_phage	52.9	1.3e-16
AUT93352.1|3643074_3643530_-|head	head protein	head	E5E3S2	Burkholderia_phage	45.9	6.4e-29
AUT93353.1|3643607_3644276_-	hypothetical protein	NA	F1BUQ7	Erwinia_phage	46.6	7.2e-45
AUT93354.1|3644275_3645421_-|capsid	phage major capsid protein, P2 family	capsid	A0A1S6KZZ3	Salmonella_phage	67.4	1.2e-127
AUT93355.1|3645436_3646246_-|capsid	capsid scaffolding protein	capsid	F1BUR1	Erwinia_phage	48.8	2.6e-65
AUT93356.1|3646418_3648173_+	oxidoreductase	NA	A0A1S6KZW3	Salmonella_phage	73.0	2.6e-259
AUT93357.1|3648172_3649201_+|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	68.7	3.2e-137
AUT93358.1|3649696_3651046_+	hypothetical protein	NA	R9TRQ8	Vibrio_phage	24.8	5.6e-20
AUT93359.1|3651108_3651789_-	hypothetical protein	NA	V9IQL5	Stenotrophomonas_phage	26.8	7.1e-16
AUT93360.1|3651790_3652003_-	hypothetical protein	NA	NA	NA	NA	NA
AUT93361.1|3651995_3654374_-	replication endonuclease	NA	Q7Y4B8	Escherichia_virus	47.6	1.3e-165
AUT93362.1|3654373_3654697_-	hypothetical protein	NA	NA	NA	NA	NA
AUT93363.1|3654696_3655524_-	DNA adenine methylase	NA	F1BUN1	Cronobacter_phage	47.8	1.4e-61
AUT93364.1|3655525_3655747_-	hypothetical protein	NA	F1BUS2	Erwinia_phage	52.1	2.6e-12
AUT93365.1|3655739_3655997_-	DUF2732 domain-containing protein	NA	NA	NA	NA	NA
AUT93366.1|3656014_3656407_-	hypothetical protein	NA	NA	NA	NA	NA
AUT93367.1|3656456_3656732_-	hypothetical protein	NA	NA	NA	NA	NA
AUT93368.1|3656890_3657079_-	hypothetical protein	NA	NA	NA	NA	NA
AUT93369.1|3657080_3657371_-	hypothetical protein	NA	A0A0M4RCW1	Salmonella_phage	63.5	1.1e-31
AUT93370.1|3657475_3657781_+	XRE family transcriptional regulator	NA	A0A0M5M1I9	Salmonella_phage	49.5	8.4e-17
AUT93371.1|3657847_3658819_+|integrase	integrase	integrase	A0A0M4RTQ0	Salmonella_phage	64.4	1.6e-117
AUT93372.1|3659095_3659662_-	hypothetical protein	NA	NA	NA	NA	NA
3658936:3658998	attR	TAAAATATAATAGATAAAAAAAAGCCCCTCTCCAGAGGGGCTGCAAAAGACAGGGATGGTGTC	NA	NA	NA	NA
AUT93373.1|3659845_3660544_+	DNA-binding response regulator	NA	Q6XM27	Feldmannia_irregularis_virus	31.1	8.1e-07
AUT93374.1|3660555_3661947_+	two-component system sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	27.3	3.4e-20
AUT93375.1|3662344_3663601_+	polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
AUT93376.1|3663608_3664700_+	EpsG family protein	NA	NA	NA	NA	NA
AUT93377.1|3664708_3665686_+	hypothetical protein	NA	NA	NA	NA	NA
AUT93378.1|3665682_3666618_+	glycosyltransferase	NA	NA	NA	NA	NA
AUT93379.1|3666601_3667450_+	glucuronosyltransferase	NA	A0A1V0SAH6	Catovirus	34.7	7.0e-13
AUT93837.1|3667485_3668325_+	hypothetical protein	NA	NA	NA	NA	NA
AUT93380.1|3668311_3669436_+	glycosyltransferase family 1 protein	NA	NA	NA	NA	NA
AUT93381.1|3669450_3670617_+	nucleotide sugar dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	57.4	4.5e-119
AUT93382.1|3670642_3671653_+	protein CapI	NA	A0A2K9L4U8	Tupanvirus	31.3	2.0e-38
AUT93383.1|3671656_3672160_+|tRNA	tRNA (uridine(34)/cytosine(34)/5- carboxymethylaminomethyluridine(34)-2'-O)- methyltransferase TrmL	tRNA	NA	NA	NA	NA
