The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP026071	Staphylococcus aureus strain NRS143 chromosome, complete genome	2861652	0	3615	2861652		Geobacillus_virus(100.0%)	4	NA	NA
AUU60254.1|346_1057_-	purine-nucleoside phosphorylase	NA	NA	NA	NA	NA
AUU60255.1|1371_2034_+	2-deoxyribose-5-phosphate aldolase	NA	NA	NA	NA	NA
AUU60256.1|2201_2330_-	hypothetical protein	NA	NA	NA	NA	NA
AUU60257.1|2313_3615_+	pyrimidine-nucleoside phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	58.7	1.4e-132
>prophage 2
CP026071	Staphylococcus aureus strain NRS143 chromosome, complete genome	2861652	11548	13159	2861652		Only_Syngen_Nebraska_virus(100.0%)	1	NA	NA
AUU60266.1|11548_13159_+	CTP synthetase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	49.6	2.7e-146
>prophage 3
CP026071	Staphylococcus aureus strain NRS143 chromosome, complete genome	2861652	20962	28715	2861652		Bacillus_virus(25.0%)	9	NA	NA
AUU60275.1|20962_21562_+	thymidine kinase	NA	G3MBK1	Bacillus_virus	42.9	6.2e-32
AUU60276.1|21562_22639_+	peptide chain release factor 1	NA	NA	NA	NA	NA
AUU60277.1|22625_23462_+	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
AUU60278.1|23494_24592_+	threonylcarbamoyl-AMP synthase	NA	A0A291ATS8	Pandoravirus	35.6	3.6e-41
AUU60279.1|24588_25008_+	protein-tyrosine-phosphatase	NA	NA	NA	NA	NA
AUU60280.1|25114_25639_+	TIGR01440 family protein	NA	NA	NA	NA	NA
AUU60281.1|25665_26904_+	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	53.0	8.2e-103
AUU60282.1|26931_27561_+	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
AUU60283.1|27584_28715_+	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SAG5	Catovirus	31.1	1.0e-27
>prophage 4
CP026071	Staphylococcus aureus strain NRS143 chromosome, complete genome	2861652	39432	39828	2861652		Bacillus_phage(100.0%)	1	NA	NA
AUU60297.1|39432_39828_+	single-stranded DNA-binding protein	NA	A0A1B1PAE7	Bacillus_phage	36.8	3.0e-14
>prophage 5
CP026071	Staphylococcus aureus strain NRS143 chromosome, complete genome	2861652	45937	46585	2861652		Moumouvirus(100.0%)	1	NA	NA
AUU60306.1|45937_46585_-	HD domain-containing protein	NA	H2ED17	Moumouvirus	27.0	4.7e-09
>prophage 6
CP026071	Staphylococcus aureus strain NRS143 chromosome, complete genome	2861652	54777	56298	2861652		Diachasmimorpha_longicaudata_entomopoxvirus(100.0%)	1	NA	NA
AUU60314.1|54777_56298_+	DEAD/DEAH box family ATP-dependent RNA helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.9	2.0e-58
>prophage 7
CP026071	Staphylococcus aureus strain NRS143 chromosome, complete genome	2861652	61972	64000	2861652		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
AUU60319.1|61972_64000_+	potassium-transporting ATPase subunit B	NA	M1HBF8	Paramecium_bursaria_Chlorella_virus	23.6	3.9e-25
>prophage 8
CP026071	Staphylococcus aureus strain NRS143 chromosome, complete genome	2861652	69150	72534	2861652		Clostridium_botulinum_C_phage(50.0%)	6	NA	NA
AUU60327.1|69150_69513_+	mRNA interferase MazF	NA	Q332J9	Clostridium_botulinum_C_phage	32.8	4.2e-07
AUU60328.1|69477_69711_-	hypothetical protein	NA	NA	NA	NA	NA
AUU60329.1|69861_70863_+	serine/threonine protein phosphatase	NA	NA	NA	NA	NA
AUU60330.1|70981_71308_+	anti-anti-sigma factor	NA	NA	NA	NA	NA
AUU60331.1|71309_71789_+	anti-sigma B factor RsbW	NA	NA	NA	NA	NA
AUU60332.1|71763_72534_+	RNA polymerase sigma factor SigB	NA	A0A0A0RNH9	Bacillus_phage	34.9	1.3e-21
>prophage 9
CP026071	Staphylococcus aureus strain NRS143 chromosome, complete genome	2861652	86647	195415	2861652	integrase,head,tRNA,protease,transposase,tail,coat,holin,portal,terminase,capsid	Staphylococcus_phage(85.0%)	138	131009:131038	181918:181947
AUU60341.1|86647_88177_-	2-isopropylmalate synthase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	28.6	9.4e-08
AUU60342.1|88206_89211_-	ketol-acid reductoisomerase	NA	NA	NA	NA	NA
AUU60343.1|89347_89602_-	acetolactate synthase 1 regulatory subunit	NA	NA	NA	NA	NA
AUU60344.1|89601_91371_-	acetolactate synthase, large subunit, biosynthetic type	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	30.1	4.1e-63
AUU60345.1|91398_93087_-	dihydroxy-acid dehydratase	NA	NA	NA	NA	NA
AUU60346.1|93404_93560_-	hypothetical protein	NA	NA	NA	NA	NA
AUU62903.1|93624_94059_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE	tRNA	NA	NA	NA	NA
AUU60347.1|94039_94702_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
AUU60348.1|94674_95139_+	ribosomal-protein-alanine N-acetyltransferase	NA	NA	NA	NA	NA
AUU60349.1|95131_96157_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	40.9	9.0e-63
AUU60350.1|96470_98081_-	MutS family DNA mismatch repair protein	NA	A0A0N9R0S5	Chrysochromulina_ericina_virus	27.4	5.1e-20
AUU60351.1|98175_98304_+	hypothetical protein	NA	NA	NA	NA	NA
AUU60352.1|98448_100377_-	ABC transporter ATP-binding protein	NA	A0A2K9L0W2	Tupanvirus	30.1	3.2e-53
AUU60353.1|100629_101265_+	redox-sensing transcriptional repressor Rex	NA	NA	NA	NA	NA
AUU62904.1|101621_102650_+	YeeE/YedE family protein	NA	NA	NA	NA	NA
AUU60354.1|102709_102934_+	oxidoreductase	NA	NA	NA	NA	NA
AUU60355.1|103142_104393_+	ammonium transporter	NA	H8ZJB2	Ostreococcus_tauri_virus	31.2	9.0e-41
AUU60356.1|104576_105527_+	LacI family transcriptional regulator	NA	NA	NA	NA	NA
AUU62905.1|105675_107160_+	sucrose-6-phosphate hydrolase	NA	S6ATV4	Bacillus_phage	25.8	5.2e-19
AUU60357.1|107156_108116_+	carbohydrate kinase	NA	NA	NA	NA	NA
AUU60358.1|108489_109206_-	DNA-binding response regulator	NA	A0A2H4J4Z6	uncultured_Caudovirales_phage	32.6	2.3e-25
AUU62906.1|109224_110460_-	GHKL domain-containing protein	NA	NA	NA	NA	NA
AUU60359.1|110541_110682_-	cyclic lactone autoinducer peptide	NA	NA	NA	NA	NA
AUU60360.1|110685_111249_-	accessory gene regulator AgrB	NA	NA	NA	NA	NA
AUU60361.1|111484_111619_+	delta-lysin family phenol-soluble modulin	NA	NA	NA	NA	NA
AUU60362.1|112221_113007_-	carbon-nitrogen family hydrolase	NA	NA	NA	NA	NA
AUU60363.1|113367_113994_-	nitroreductase family protein	NA	NA	NA	NA	NA
AUU60364.1|114190_115405_+	hypothetical protein	NA	NA	NA	NA	NA
AUU60365.1|115429_116173_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
AUU60366.1|116347_116632_+	co-chaperone GroES	NA	A0A221S386	uncultured_virus	46.2	4.7e-14
AUU60367.1|116707_118324_+	molecular chaperone GroEL	NA	A0A240F779	uncultured_virus	54.7	2.6e-157
AUU60368.1|118392_119565_-|integrase	site-specific integrase	integrase	A0A1W6JQD3	Staphylococcus_phage	98.2	3.5e-220
AUU60369.1|119578_120253_-	XRE family transcriptional regulator	NA	A0A2H4JGT9	uncultured_Caudovirales_phage	45.8	1.6e-39
AUU60370.1|120425_120644_+	XRE family transcriptional regulator	NA	A0A2H4JB11	uncultured_Caudovirales_phage	66.7	1.3e-19
AUU60371.1|120648_120966_+	helix-turn-helix domain-containing protein	NA	A0A1W6JQE0	Staphylococcus_phage	98.1	9.2e-51
AUU60372.1|120962_121118_+	pathogenicity island protein	NA	NA	NA	NA	NA
AUU60373.1|121102_121306_+	pathogenicity island protein	NA	A0A1W6JQF4	Staphylococcus_phage	97.0	7.5e-30
AUU60374.1|121307_121691_+	pathogenicity island protein	NA	A0A1W6JQI7	Staphylococcus_phage	96.1	9.7e-63
AUU60375.1|121691_122009_+	DUF1474 domain-containing protein	NA	A0A1W6JQH0	Staphylococcus_phage	58.2	1.6e-18
AUU60376.1|122072_122942_+	mobile element-associated protein	NA	Q4ZE74	Staphylococcus_phage	99.3	7.9e-169
AUU60377.1|122955_124665_+	DUF927 domain-containing protein	NA	Q4ZE73	Staphylococcus_phage	99.6	0.0e+00
AUU60378.1|124976_125357_+	hypothetical protein	NA	Q4ZE71	Staphylococcus_phage	99.2	9.0e-69
AUU60379.1|125353_125995_+	pathogenicity island protein	NA	Q4ZE67	Staphylococcus_phage	94.8	3.5e-113
AUU60380.1|126530_126872_+	pathogenicity island protein	NA	Q4ZE66	Staphylococcus_phage	98.2	7.1e-57
AUU60381.1|126883_127462_+	pathogenicity island protein	NA	A0A2H4JBG0	uncultured_Caudovirales_phage	38.4	1.4e-28
AUU60382.1|127479_127698_+	hypothetical protein	NA	NA	NA	NA	NA
AUU60383.1|127748_128276_+|coat	spore coat protein	coat	A0A1W6JQH7	Staphylococcus_phage	97.1	3.5e-87
AUU60384.1|128278_128620_+	pathogenicity island protein	NA	A0A1W6JQM3	Staphylococcus_phage	100.0	1.7e-58
AUU60385.1|128616_129186_+|terminase	terminase small subunit	terminase	Q4ZE85	Staphylococcus_phage	98.4	3.5e-101
AUU60386.1|129340_130045_-	toxin	NA	NA	NA	NA	NA
AUU60387.1|130463_130691_+	DUF3102 domain-containing protein	NA	A0A2H4JAH5	uncultured_Caudovirales_phage	46.1	7.1e-13
131009:131038	attL	AGGCAGGTACTTCGGTACTTGCCTATTTTT	NA	NA	NA	NA
AUU60388.1|131545_132481_-	permease	NA	NA	NA	NA	NA
AUU60389.1|133599_133779_+	hypothetical protein	NA	NA	NA	NA	NA
AUU60390.1|133775_134072_+	hypothetical protein	NA	C8CH40	Staphylococcus_phage	40.4	6.7e-11
AUU60391.1|134421_134643_-|transposase	transposase	transposase	NA	NA	NA	NA
AUU60392.1|134979_136287_-	TrkH family potassium uptake protein	NA	NA	NA	NA	NA
AUU60393.1|136725_137949_-	succinyl-diaminopimelate desuccinylase	NA	NA	NA	NA	NA
AUU60394.1|138380_139436_+	succinyl-diaminopimelate desuccinylase	NA	A0A2I6PER8	Staphylococcus_phage	34.6	7.9e-38
AUU60395.1|139457_140477_+	gamma-hemolysin subunit B	NA	A0A2I6PEU3	Staphylococcus_phage	39.6	3.4e-54
AUU60396.1|140733_141576_-	sphingomyelin phosphodiesterase	NA	A0A1P8L6H7	Staphylococcus_phage	99.3	2.8e-155
AUU60397.1|141616_142654_-|integrase	site-specific integrase	integrase	A0EWV2	Staphylococcus_phage	100.0	9.1e-180
AUU60398.1|142712_143177_-	hypothetical protein	NA	A0EWV3	Staphylococcus_phage	100.0	1.1e-28
AUU60399.1|143276_143459_-	hypothetical protein	NA	M9NSW6	Staphylococcus_phage	100.0	4.1e-27
AUU60400.1|143662_144004_-	hypothetical protein	NA	A0A2I6PF04	Staphylococcus_phage	99.1	1.7e-55
AUU60401.1|144009_144942_-	ATP-dependent helicase	NA	A0A2I6PEZ7	Staphylococcus_phage	100.0	5.7e-173
AUU60402.1|144957_145671_-	XRE family transcriptional regulator	NA	M9NUL0	Staphylococcus_phage	100.0	1.2e-130
AUU60403.1|145633_145807_+	transcriptional regulator	NA	NA	NA	NA	NA
AUU60404.1|145803_146067_+	XRE family transcriptional regulator	NA	A0A2I6PF09	Staphylococcus_phage	100.0	7.2e-41
AUU60405.1|146082_146298_+	DUF2829 domain-containing protein	NA	A0EWV9	Staphylococcus_phage	100.0	6.3e-35
AUU60406.1|146286_146616_-	hypothetical protein	NA	M9NS98	Staphylococcus_phage	100.0	2.7e-53
AUU60407.1|146666_147419_+	oxidoreductase	NA	M9NTH5	Staphylococcus_phage	100.0	1.1e-139
AUU60408.1|147434_147632_+	hypothetical protein	NA	Q8SDM8	Staphylococcus_phage	100.0	7.0e-33
AUU60409.1|147662_147803_+	hypothetical protein	NA	A0A2I6PDG0	Staphylococcus_phage	100.0	1.9e-16
AUU60410.1|147817_148450_-	hypothetical protein	NA	A7TW95	Staphylococcus_phage	100.0	1.5e-113
AUU60411.1|148508_148829_+	DUF771 domain-containing protein	NA	A0A2I6PDH6	Staphylococcus_phage	100.0	1.5e-56
AUU60412.1|148825_148987_+	DUF1270 domain-containing protein	NA	D2JGJ6	Staphylococcus_phage	100.0	4.3e-20
AUU60413.1|149081_149408_+	hypothetical protein	NA	W5RAK4	Staphylococcus_phage	100.0	1.2e-53
AUU62907.1|149388_149649_+	DUF1108 domain-containing protein	NA	A0EWW8	Staphylococcus_phage	100.0	8.9e-44
AUU60414.1|149657_149921_+	hypothetical protein	NA	A0A2I6PDG2	Staphylococcus_phage	100.0	7.7e-43
AUU62908.1|149929_151873_+	ATPase	NA	A0EWX0	Staphylococcus_phage	100.0	0.0e+00
AUU60415.1|151874_152795_+	recombinase	NA	S4SUN6	Staphylococcus_phage	100.0	2.3e-166
AUU60416.1|152875_153493_+	MBL fold metallo-hydrolase	NA	S4SWA4	Staphylococcus_phage	100.0	9.1e-87
AUU60417.1|153493_153964_+	single-stranded DNA-binding protein	NA	A0EWX3	Staphylococcus_phage	100.0	7.4e-81
AUU60418.1|153993_154878_+	DnaD domain protein	NA	A0EWX4	Staphylococcus_phage	100.0	5.4e-141
AUU60419.1|154884_155103_+	hypothetical protein	NA	A0A2I6PDG4	Staphylococcus_phage	98.6	1.2e-36
AUU60420.1|155433_155802_+	hypothetical protein	NA	W5RAK8	Staphylococcus_phage	100.0	8.2e-51
AUU60421.1|155805_156048_+	hypothetical protein	NA	A0EWX8	Staphylococcus_phage	100.0	3.9e-41
AUU60422.1|156219_156471_+	DUF1024 domain-containing protein	NA	A0EWY0	Staphylococcus_phage	100.0	1.9e-38
AUU60423.1|156460_156643_+	hypothetical protein	NA	A0EWY1	Staphylococcus_phage	100.0	2.6e-26
AUU60424.1|156635_157178_+	dUTP pyrophosphatase	NA	A0EWY2	Staphylococcus_phage	100.0	1.1e-96
AUU60425.1|157214_157421_+	DUF1381 domain-containing protein	NA	A0A0H3U2R7	Staphylococcus_phage	100.0	1.3e-29
AUU60426.1|157417_157804_+	hypothetical protein	NA	W5R986	Staphylococcus_phage	100.0	3.0e-64
AUU60427.1|157800_157950_+	transcriptional regulator	NA	A0A1W6JPZ2	Staphylococcus_phage	100.0	4.8e-18
AUU60428.1|157949_158150_+	hypothetical protein	NA	A0A2I6PDV9	Staphylococcus_phage	100.0	1.4e-28
AUU60429.1|158177_158594_+	transcriptional regulator	NA	G4KNP7	Staphylococcus_phage	100.0	1.3e-76
AUU60430.1|158825_159125_+	HNH endonuclease	NA	A0EWY8	Staphylococcus_phage	100.0	4.6e-52
AUU60431.1|159254_159599_+	hypothetical protein	NA	G4KNP9	Staphylococcus_phage	100.0	9.4e-57
AUU60432.1|159595_161257_+|terminase	terminase large subunit	terminase	A0A2I6PDJ8	Staphylococcus_phage	100.0	0.0e+00
AUU60433.1|161272_162460_+|portal	phage portal protein	portal	A0A2I6PDI1	Staphylococcus_phage	100.0	1.0e-219
AUU60434.1|162443_163181_+|protease	Clp protease ClpP	protease	G4KNQ2	Staphylococcus_phage	100.0	1.8e-129
AUU60435.1|163204_164350_+|capsid	phage major capsid protein	capsid	G4KNQ3	Staphylococcus_phage	100.0	9.6e-215
AUU60436.1|164369_164630_+	hypothetical protein	NA	A0A0H3U504	Staphylococcus_phage	100.0	6.4e-42
AUU60437.1|164642_164927_+|head,tail	phage head-tail adapter protein	head,tail	A0A2I6PDJ5	Staphylococcus_phage	100.0	2.3e-45
AUU60438.1|164910_165273_+|head,tail	phage head-tail adapter protein	head,tail	G4KNQ4	Staphylococcus_phage	100.0	4.4e-65
AUU60439.1|165269_165674_+	hypothetical protein	NA	G4KNQ5	Staphylococcus_phage	100.0	4.3e-69
AUU60440.1|165670_166078_+	hypothetical protein	NA	G4KNQ6	Staphylococcus_phage	99.3	1.6e-71
AUU60441.1|166078_166723_+|tail	phage tail protein	tail	A0EWZ9	Staphylococcus_phage	100.0	3.8e-120
AUU60442.1|166764_166989_+	hypothetical protein	NA	A0A075LYE8	Staphylococcus_phage	100.0	3.0e-32
AUU60443.1|167038_167389_+	hypothetical protein	NA	G4KNQ8	Staphylococcus_phage	100.0	7.8e-59
AUU60444.1|167633_172163_+|tail	phage tail tape measure protein	tail	A0EX03	Staphylococcus_phage	99.9	0.0e+00
AUU60445.1|172159_173644_+|tail	phage tail protein	tail	A0EX04	Staphylococcus_phage	100.0	4.5e-297
AUU60446.1|173659_177445_+	hypothetical protein	NA	A0EX05	Staphylococcus_phage	100.0	0.0e+00
AUU60447.1|177434_177587_+	hypothetical protein	NA	D2JLG0	Staphylococcus_phage	100.0	5.2e-20
AUU60448.1|177633_177921_+	hypothetical protein	NA	G4KNR2	Staphylococcus_phage	100.0	9.9e-44
AUU60449.1|177976_178351_+	hypothetical protein	NA	G4KNR3	Staphylococcus_phage	100.0	3.3e-39
AUU60450.1|178459_178654_+	hypothetical protein	NA	NA	NA	NA	NA
AUU60451.1|178771_179545_+	exotoxin	NA	A0EX09	Staphylococcus_phage	100.0	2.2e-146
AUU62909.1|179653_179830_+|holin	putative holin-like toxin	holin	D2JLG3	Staphylococcus_phage	98.3	2.2e-22
AUU60452.1|179882_179990_-	hypothetical protein	NA	NA	NA	NA	NA
AUU60453.1|180041_180296_+|holin	phage holin	holin	D2JLG4	Staphylococcus_phage	100.0	4.1e-41
AUU60454.1|180307_181063_+	CHAP domain-containing protein	NA	D2JLG5	Staphylococcus_phage	100.0	3.4e-152
AUU60455.1|181253_181745_+	staphylokinase	NA	A0A1X9H028	Staphylococcus_phage	100.0	9.5e-87
AUU60456.1|182271_182730_+	amidase	NA	R9QTN8	Staphylococcus_phage	98.7	4.9e-85
181918:181947	attR	AGGCAGGTACTTCGGTACTTGCCTATTTTT	NA	NA	NA	NA
AUU60457.1|182824_183274_-	chemotaxis inhibitory protein	NA	A0A1P8L6A8	Staphylococcus_phage	100.0	1.1e-78
AUU60458.1|183959_184310_+	inhibitor	NA	A0A1P8L6B0	Staphylococcus_phage	100.0	7.5e-54
AUU60459.1|184362_184623_-	hypothetical protein	NA	M9NS66	Staphylococcus_phage	100.0	2.3e-23
AUU60460.1|184601_184910_-	hypothetical protein	NA	M9NTD8	Staphylococcus_phage	100.0	3.2e-40
AUU60461.1|184933_185113_-	hypothetical protein	NA	A0A1W6JQ29	Staphylococcus_phage	100.0	2.2e-25
AUU60462.1|185484_185685_-	hypothetical protein	NA	A0A1P8L6A7	Staphylococcus_phage	95.4	4.9e-26
AUU60463.1|186070_188140_+	protein map	NA	NA	NA	NA	NA
AUU60464.1|188437_190084_+|transposase	IS1182-like element ISSau3 family transposase	transposase	A0ZS58	Staphylococcus_virus	99.8	7.9e-295
AUU60465.1|190331_191618_-	aspartate aminotransferase	NA	NA	NA	NA	NA
AUU60466.1|191817_191916_+	hypothetical protein	NA	NA	NA	NA	NA
AUU60467.1|192157_192334_+	hypothetical protein	NA	NA	NA	NA	NA
AUU60468.1|192591_192972_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AUU60469.1|192968_193865_+	phenol-soluble modulin export ABC transporter ATP-binding protein PmtA	NA	A0A2H4PQG7	Staphylococcus_phage	30.2	1.1e-16
AUU60470.1|193865_194546_+	phenol-soluble modulin export ABC transporter permease subunit PmtB	NA	NA	NA	NA	NA
AUU60471.1|194542_195415_+	phenol-soluble modulin export ABC transporter ATP-binding protein PmtC	NA	A0A2H4PQG7	Staphylococcus_phage	35.2	6.1e-28
>prophage 10
CP026071	Staphylococcus aureus strain NRS143 chromosome, complete genome	2861652	200660	201062	2861652		Staphylococcus_phage(100.0%)	1	NA	NA
AUU60479.1|200660_201062_-	YolD-like family protein	NA	U3PG23	Staphylococcus_phage	42.9	6.0e-23
>prophage 11
CP026071	Staphylococcus aureus strain NRS143 chromosome, complete genome	2861652	205259	207290	2861652		Bacillus_virus(50.0%)	2	NA	NA
AUU60484.1|205259_205820_-	cysteine hydrolase	NA	G3MA16	Bacillus_virus	41.2	2.0e-32
AUU60485.1|206192_207290_+	pectate lyase	NA	U5PWM6	Bacillus_phage	34.6	8.7e-48
>prophage 12
CP026071	Staphylococcus aureus strain NRS143 chromosome, complete genome	2861652	211320	213604	2861652		Bacillus_virus(100.0%)	2	NA	NA
AUU60490.1|211320_212790_+	nicotinate phosphoribosyltransferase	NA	G3MA18	Bacillus_virus	44.5	8.5e-107
AUU60491.1|212782_213604_+	NAD(+) synthetase	NA	G3MA24	Bacillus_virus	52.7	2.3e-69
>prophage 13
CP026071	Staphylococcus aureus strain NRS143 chromosome, complete genome	2861652	217295	224073	2861652		Gordonia_phage(33.33%)	5	NA	NA
AUU60496.1|217295_218591_+	adenylosuccinate lyase	NA	A0A1B3B081	Gordonia_phage	32.9	1.6e-16
AUU60497.1|218699_219002_+	hypothetical protein	NA	NA	NA	NA	NA
AUU60498.1|219184_219877_+	geranylgeranylglyceryl/heptaprenylglyceryl phosphate synthase	NA	NA	NA	NA	NA
AUU60499.1|219873_222066_+	DNA helicase PcrA	NA	A7KV33	Bacillus_phage	42.2	1.0e-135
AUU60500.1|222069_224073_+	DNA ligase (NAD(+)) LigA	NA	A0A0K2QQN8	Ralstonia_phage	36.1	9.8e-114
>prophage 14
CP026071	Staphylococcus aureus strain NRS143 chromosome, complete genome	2861652	231302	236330	2861652		Catovirus(33.33%)	5	NA	NA
AUU60507.1|231302_232250_+	diacylglycerol kinase	NA	A0A1V0SBJ0	Catovirus	27.8	1.5e-16
AUU60508.1|232330_233692_+	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	43.0	1.5e-102
AUU60509.1|233861_234392_+	DUF3267 domain-containing protein	NA	NA	NA	NA	NA
AUU60510.1|234638_235709_+	DNA polymerase IV	NA	NA	NA	NA	NA
AUU60511.1|235775_236330_-	DNA polymerase III subunit epsilon	NA	B5WZL1	Staphylococcus_phage	35.7	1.2e-29
>prophage 15
CP026071	Staphylococcus aureus strain NRS143 chromosome, complete genome	2861652	239783	240197	2861652		Staphylococcus_phage(100.0%)	1	NA	NA
AUU62910.1|239783_240197_+	hypothetical protein	NA	A0A1Q1PVU5	Staphylococcus_phage	38.5	3.0e-17
>prophage 16
CP026071	Staphylococcus aureus strain NRS143 chromosome, complete genome	2861652	245178	245808	2861652		Bacillus_phage(100.0%)	1	NA	NA
AUU60523.1|245178_245808_+	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	30.8	8.1e-06
>prophage 17
CP026071	Staphylococcus aureus strain NRS143 chromosome, complete genome	2861652	261289	263026	2861652		Bacillus_phage(100.0%)	1	NA	NA
AUU60541.1|261289_263026_+	multidrug ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	30.4	1.7e-53
>prophage 18
CP026071	Staphylococcus aureus strain NRS143 chromosome, complete genome	2861652	279503	280232	2861652		Planktothrix_phage(100.0%)	1	NA	NA
AUU60548.1|279503_280232_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	42.7	1.0e-36
>prophage 19
CP026071	Staphylococcus aureus strain NRS143 chromosome, complete genome	2861652	290887	291232	2861652		Streptococcus_phage(100.0%)	1	NA	NA
AUU60560.1|290887_291232_+	YlbF/YmcA family competence regulator	NA	A0A1X9I5Y8	Streptococcus_phage	29.7	7.5e-06
>prophage 20
CP026071	Staphylococcus aureus strain NRS143 chromosome, complete genome	2861652	300820	301561	2861652		Staphylococcus_phage(100.0%)	1	NA	NA
AUU60568.1|300820_301561_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.8	1.2e-24
>prophage 21
CP026071	Staphylococcus aureus strain NRS143 chromosome, complete genome	2861652	309442	313704	2861652		Staphylococcus_phage(80.0%)	5	NA	NA
AUU60575.1|309442_310207_+	exotoxin	NA	A0A1X9H080	Staphylococcus_phage	40.8	1.5e-33
AUU60576.1|310488_311208_+	exotoxin	NA	A0A1X9H080	Staphylococcus_phage	34.6	4.9e-23
AUU60577.1|311242_311971_+	exotoxin	NA	A0A1X9H080	Staphylococcus_phage	39.8	1.3e-28
AUU60578.1|312124_312910_+	exotoxin	NA	A0A097PAT7	Streptococcus_pyogenes_phage	42.7	2.9e-45
AUU60579.1|312948_313704_+	exotoxin	NA	A0A075M4C7	Staphylococcus_phage	40.8	2.3e-39
>prophage 22
CP026071	Staphylococcus aureus strain NRS143 chromosome, complete genome	2861652	316958	387251	2861652	protease,tRNA	Staphylococcus_phage(93.18%)	67	NA	NA
AUU60583.1|316958_318305_-	DUF4041 domain-containing protein	NA	M1NRY5	Streptococcus_phage	51.1	2.5e-65
AUU60584.1|318551_319067_-	hypothetical protein	NA	NA	NA	NA	NA
AUU60585.1|319535_319781_-	hypothetical protein	NA	NA	NA	NA	NA
AUU60586.1|320081_320801_+|protease	serine protease SplC	protease	A0A2H4PQP7	Staphylococcus_phage	93.7	6.4e-124
AUU60587.1|320924_321641_+|protease	serine protease	protease	A0A2H4PQN5	Staphylococcus_phage	62.6	5.5e-83
AUU60588.1|322686_323403_+|protease	serine protease SplE	protease	A0A2H4PQN5	Staphylococcus_phage	97.1	6.6e-129
AUU60589.1|323572_324292_+|protease	serine protease	protease	A0A2H4PQP1	Staphylococcus_phage	98.3	1.0e-129
AUU60590.1|324471_326211_+	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	98.6	3.2e-286
AUU60591.1|326203_327358_+	restriction endonuclease subunit S	NA	A0A2H4PQP5	Staphylococcus_phage	36.3	7.8e-39
AUU60592.1|327394_329212_+	NTPase	NA	NA	NA	NA	NA
AUU60593.1|329473_329773_-	secretion protein	NA	NA	NA	NA	NA
AUU60594.1|329787_331398_-	lipase	NA	NA	NA	NA	NA
AUU60595.1|331440_331890_+	DUF1433 domain-containing protein	NA	NA	NA	NA	NA
AUU62913.1|332117_332477_+	DUF1433 domain-containing protein	NA	NA	NA	NA	NA
AUU60596.1|332602_335023_-	hyaluronate lyase	NA	NA	NA	NA	NA
AUU60597.1|335989_336433_+	DUF1433 domain-containing protein	NA	NA	NA	NA	NA
AUU60598.1|336432_336876_+	DUF1433 domain-containing protein	NA	NA	NA	NA	NA
AUU60599.1|337050_337152_-	hypothetical protein	NA	NA	NA	NA	NA
AUU60600.1|337514_337739_+	hypothetical protein	NA	NA	NA	NA	NA
AUU60601.1|337820_338267_+	DUF1433 domain-containing protein	NA	NA	NA	NA	NA
AUU60602.1|338459_339029_+	ImmA/IrrE family metallo-endopeptidase	NA	A0A2H4PQN8	Staphylococcus_phage	54.8	2.2e-39
AUU60603.1|339028_340396_+	FRG domain-containing protein	NA	NA	NA	NA	NA
AUU60604.1|340544_341117_-	hypothetical protein	NA	A0A2H4PQN4	Staphylococcus_phage	94.8	3.2e-25
AUU60605.1|341214_341559_-	DUF3969 domain-containing protein	NA	A0A2H4PQN6	Staphylococcus_phage	94.7	5.1e-55
AUU60606.1|341599_342226_-	hypothetical protein	NA	A0A2H4PQM7	Staphylococcus_phage	84.1	4.5e-81
AUU60607.1|342301_343297_-	DUF4352 domain-containing protein	NA	A0A2H4PQN2	Staphylococcus_phage	97.2	3.8e-74
AUU60608.1|343377_344028_-	calcium-binding protein	NA	A0A2H4PQM8	Staphylococcus_phage	88.4	1.0e-51
AUU62914.1|344330_344786_+	DUF4909 domain-containing protein	NA	A0A2H4PQN7	Staphylococcus_phage	94.5	3.5e-75
AUU60609.1|344944_346423_+	2-succinylbenzoate-CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	97.2	2.4e-282
AUU60610.1|346427_347429_+	o-succinylbenzoate synthase	NA	A0A2H4PQM0	Staphylococcus_phage	96.7	8.5e-183
AUU60611.1|347425_347683_-	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	100.0	7.2e-46
AUU60612.1|347748_348222_+	nucleoside triphosphatase YtkD	NA	A0A2H4PQM4	Staphylococcus_phage	98.1	9.5e-84
AUU62915.1|348226_348973_+	S9 family peptidase	NA	A0A2H4PQM6	Staphylococcus_phage	97.2	3.3e-139
AUU60613.1|349265_350858_-	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	99.8	0.0e+00
AUU60614.1|351229_352423_+	S-adenosylmethionine synthase	NA	A0A2H4PQS6	Staphylococcus_phage	99.5	4.3e-218
AUU60615.1|352547_353456_+	NERD domain-containing protein	NA	A0A2H4PQQ8	Staphylococcus_phage	99.7	9.8e-138
AUU60616.1|353667_354501_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	99.6	1.2e-158
AUU60617.1|354750_355104_-	camphor resistance protein CrcB	NA	A0A2H4PQQ7	Staphylococcus_phage	97.4	4.2e-20
AUU60618.1|355100_355466_-	fluoride efflux transporter CrcB	NA	A0A2H4PQR0	Staphylococcus_phage	100.0	3.6e-59
AUU60619.1|355720_356023_-	hypothetical protein	NA	NA	NA	NA	NA
AUU60620.1|356281_356995_+	transaldolase	NA	M1PR54	Cyanophage	35.3	5.5e-19
AUU60621.1|357452_358073_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
AUU60622.1|358239_358875_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
AUU60623.1|359172_359616_+	hypothetical protein	NA	A0A2H4PQT8	Staphylococcus_phage	77.4	2.4e-49
AUU60624.1|359602_360046_-	competence protein ComK	NA	NA	NA	NA	NA
AUU60625.1|360158_360629_-	RNA polymerase sigma factor SigS	NA	A0A2H4PQT5	Staphylococcus_phage	85.8	7.7e-70
AUU60626.1|360827_361052_+	hypothetical protein	NA	NA	NA	NA	NA
AUU60627.1|361327_362182_+	autolysin	NA	Q4ZCC7	Staphylococcus_virus	38.6	9.8e-39
AUU60628.1|362268_363561_-	arsenical efflux pump membrane protein ArsB	NA	A0A2H4PQU3	Staphylococcus_phage	95.1	2.6e-216
AUU60629.1|363560_363875_-	ArsR family transcriptional regulator	NA	A0A2H4PQT4	Staphylococcus_phage	97.1	1.7e-52
AUU60630.1|364517_366020_+	pyridine nucleotide-disulfide oxidoreductase	NA	A0A2H4PQX2	Staphylococcus_phage	98.6	5.0e-30
AUU62916.1|366512_367544_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	98.3	5.8e-195
AUU60631.1|367550_368183_+	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	99.0	8.4e-112
AUU60632.1|368193_369375_+	riboflavin biosynthesis protein RibBA	NA	A0A2H4PQS2	Staphylococcus_phage	99.7	6.6e-227
AUU60633.1|369387_369852_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	97.4	1.9e-68
AUU60634.1|369973_370975_-	proline dehydrogenase	NA	A0A2H4PQT6	Staphylococcus_phage	99.1	5.0e-183
AUU62917.1|370883_371075_+	hypothetical protein	NA	NA	NA	NA	NA
AUU60635.1|371086_371206_+	hypothetical protein	NA	NA	NA	NA	NA
AUU60636.1|371208_372036_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
AUU60637.1|372608_373010_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
AUU60638.1|373128_373692_-	methyltransferase domain-containing protein	NA	A0A2H4PQV0	Staphylococcus_phage	95.7	1.1e-99
AUU60639.1|373688_374642_-	TIGR01212 family radical SAM protein	NA	A0A2H4PQV5	Staphylococcus_phage	99.3	6.4e-79
AUU60640.1|374752_375934_+	MFS transporter	NA	A0A2H4PQR6	Staphylococcus_phage	99.7	9.6e-218
AUU60641.1|376222_378640_+|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	98.8	0.0e+00
AUU60642.1|378661_378973_+	rhodanese-like domain-containing protein	NA	A0A2H4PQR9	Staphylococcus_phage	96.1	4.5e-50
AUU60643.1|379296_385866_+	DUF1542 domain-containing protein	NA	A0A2H4PQU6	Staphylococcus_phage	88.7	1.7e-295
AUU60644.1|385982_387251_-	NAD(P)/FAD-dependent oxidoreductase	NA	A0A2H4PQX1	Staphylococcus_phage	99.1	5.9e-56
>prophage 23
CP026071	Staphylococcus aureus strain NRS143 chromosome, complete genome	2861652	395388	399325	2861652		Salmonella_phage(50.0%)	4	NA	NA
AUU60652.1|395388_396234_-	BlaZ family penicillin-hydrolyzing class A beta-lactamase PC1	NA	A0A1B0VBP7	Salmonella_phage	34.0	1.5e-31
AUU60653.1|396340_398098_+	BlaR1 family beta-lactam sensor/signal transducer	NA	NA	NA	NA	NA
AUU60654.1|398087_398468_+	penicillinase repressor BlaI	NA	NA	NA	NA	NA
AUU60655.1|398731_399325_+	HTH domain-containing protein	NA	A0A0A7NPV4	Enterobacteria_phage	51.1	1.1e-41
>prophage 24
CP026071	Staphylococcus aureus strain NRS143 chromosome, complete genome	2861652	404908	410278	2861652		Staphylococcus_phage(50.0%)	3	NA	NA
AUU60662.1|404908_405766_+	DUF1444 domain-containing protein	NA	A0A2H4PQY3	Staphylococcus_phage	100.0	6.8e-72
AUU60663.1|405794_406433_+	DUF4479 domain-containing protein	NA	NA	NA	NA	NA
AUU60664.1|406453_410278_+	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	47.0	2.6e-83
>prophage 25
CP026071	Staphylococcus aureus strain NRS143 chromosome, complete genome	2861652	418850	420557	2861652		Staphylococcus_phage(100.0%)	1	NA	NA
AUU60674.1|418850_420557_+	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	99.8	2.1e-274
>prophage 26
CP026071	Staphylococcus aureus strain NRS143 chromosome, complete genome	2861652	427161	429792	2861652	tRNA	Cronobacter_phage(50.0%)	2	NA	NA
AUU60678.1|427161_428424_+|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	42.1	2.7e-85
AUU60679.1|428517_429792_-	PDZ domain-containing protein	NA	A0A1B1IRD3	uncultured_Mediterranean_phage	29.0	1.7e-10
>prophage 27
CP026071	Staphylococcus aureus strain NRS143 chromosome, complete genome	2861652	433560	437696	2861652		Staphylococcus_phage(50.0%)	4	NA	NA
AUU60684.1|433560_435165_-	phosphoglycerate dehydrogenase	NA	A0A2H4PQU8	Staphylococcus_phage	100.0	1.2e-114
AUU60685.1|435151_436312_-	alanine--glyoxylate aminotransferase family protein	NA	NA	NA	NA	NA
AUU60686.1|436426_436873_-	OsmC family peroxiredoxin	NA	NA	NA	NA	NA
AUU60687.1|436952_437696_+	glycerophosphodiester phosphodiesterase	NA	M1HTS7	Paramecium_bursaria_Chlorella_virus	29.9	8.3e-18
>prophage 28
CP026071	Staphylococcus aureus strain NRS143 chromosome, complete genome	2861652	455278	458476	2861652		Streptomyces_phage(100.0%)	1	NA	NA
AUU60704.1|455278_458476_+	DNA polymerase III subunit alpha	NA	A0A2L1IZ23	Streptomyces_phage	30.7	5.5e-135
>prophage 29
CP026071	Staphylococcus aureus strain NRS143 chromosome, complete genome	2861652	463408	465166	2861652		Staphylococcus_phage(100.0%)	1	NA	NA
AUU60709.1|463408_465166_+	pyruvate kinase	NA	A0A2H4PQU5	Staphylococcus_phage	100.0	3.3e-41
>prophage 30
CP026071	Staphylococcus aureus strain NRS143 chromosome, complete genome	2861652	470049	478214	2861652		Feldmannia_irregularis_virus(25.0%)	5	NA	NA
AUU60714.1|470049_470751_+	DNA-binding response regulator	NA	Q6XM27	Feldmannia_irregularis_virus	28.7	1.6e-07
AUU62919.1|470753_472415_+	sensor histidine kinase	NA	W8CYF6	Bacillus_phage	39.0	1.7e-34
AUU60715.1|472915_474403_+	hypothetical protein	NA	NA	NA	NA	NA
AUU60716.1|474695_477326_+	DNA polymerase I	NA	A8E2B3	Enterococcus_phage	32.7	1.8e-46
AUU60717.1|477341_478214_+	bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase	NA	G3MA33	Bacillus_virus	39.1	2.6e-42
>prophage 31
CP026071	Staphylococcus aureus strain NRS143 chromosome, complete genome	2861652	482128	493282	2861652	protease,tRNA	Brevibacillus_phage(20.0%)	13	NA	NA
AUU60722.1|482128_483049_+	primosomal protein DnaI	NA	S5MU12	Brevibacillus_phage	29.4	8.1e-31
AUU60723.1|483141_483237_+	hypothetical protein	NA	NA	NA	NA	NA
AUU60724.1|483461_485399_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L6B6	Tupanvirus	36.0	7.8e-116
AUU60725.1|485825_487319_+	amino acid permease	NA	NA	NA	NA	NA
AUU62920.1|487547_488075_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	33.1	5.3e-11
AUU60726.1|488103_488304_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
AUU60727.1|488350_488707_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
AUU60728.1|488670_488772_-	hypothetical protein	NA	NA	NA	NA	NA
AUU60729.1|488848_489457_+	NUDIX domain-containing protein	NA	A0A060AB76	Staphylococcus_phage	36.4	1.7e-21
AUU60730.1|489475_490405_+	hypothetical protein	NA	NA	NA	NA	NA
AUU60731.1|490409_490520_+	hypothetical protein	NA	NA	NA	NA	NA
AUU60732.1|490567_491869_+	trigger factor	NA	NA	NA	NA	NA
AUU60733.1|492019_493282_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	61.7	1.1e-139
>prophage 32
CP026071	Staphylococcus aureus strain NRS143 chromosome, complete genome	2861652	502848	505479	2861652	tRNA	Catovirus(100.0%)	1	NA	NA
AUU60744.1|502848_505479_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0S951	Catovirus	40.4	3.7e-153
>prophage 33
CP026071	Staphylococcus aureus strain NRS143 chromosome, complete genome	2861652	515594	551192	2861652	protease,tRNA	uncultured_Mediterranean_phage(18.75%)	31	NA	NA
AUU60759.1|515594_516599_+	Holliday junction branch migration DNA helicase RuvB	NA	B3GAM6	uncultured_virus	29.1	1.7e-05
AUU60760.1|516600_517626_+|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
AUU60761.1|517648_518788_+|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	44.7	5.4e-85
AUU60762.1|518806_519067_+	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	35.3	8.2e-05
AUU60763.1|519341_521621_+	protein translocase subunit SecDF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	35.8	1.8e-31
AUU60764.1|521823_524097_+	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	29.3	6.2e-64
AUU60765.1|524118_524637_+	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	46.5	5.6e-29
AUU60766.1|525064_527254_+	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	A0A2I2L310	Orpheovirus	37.7	6.9e-12
AUU60767.1|527265_527718_+|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
AUU60768.1|527714_528590_+	cell wall amidase	NA	A0A0N9SGH1	Paenibacillus_phage	33.7	4.7e-12
AUU60769.1|529050_530313_+|tRNA	histidine--tRNA ligase	tRNA	NA	NA	NA	NA
AUU60770.1|530328_532095_+|tRNA	aspartate--tRNA ligase	tRNA	A0A2K9L0E9	Tupanvirus	27.3	1.3e-16
AUU60771.1|532427_532556_+	hypothetical protein	NA	NA	NA	NA	NA
AUU60772.1|532555_533329_+|tRNA	tRNA threonylcarbamoyladenosine dehydratase	tRNA	NA	NA	NA	NA
AUU60773.1|533489_534764_-	replication-associated recombination protein A	NA	A0A127AWE7	Bacillus_phage	50.9	6.3e-106
AUU60774.1|534848_535271_+	transcriptional regulator	NA	NA	NA	NA	NA
AUU60775.1|535370_535553_+	CsbD family protein	NA	NA	NA	NA	NA
AUU60776.1|535592_535739_+	hypothetical protein	NA	NA	NA	NA	NA
AUU60777.1|535975_536989_-	LLM class flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
AUU60778.1|537298_538441_+	cysteine desulfurase	NA	A0A1X7QGF3	Faustovirus	29.3	8.3e-33
AUU60779.1|538441_539560_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
AUU60780.1|540241_540910_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
AUU60781.1|540911_543389_+	ATP-dependent RecD-like DNA helicase	NA	A0A0K2FLP8	Brevibacillus_phage	29.0	1.1e-66
AUU60782.1|543731_546362_+|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	34.4	3.2e-64
AUU60783.1|546424_546685_+	IreB family regulatory phosphoprotein	NA	NA	NA	NA	NA
AUU60784.1|546688_547117_+	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
AUU60785.1|547131_547440_+	DUF1292 domain-containing protein	NA	NA	NA	NA	NA
AUU60786.1|547724_548363_+	O-methyltransferase	NA	A0A2P1JQT7	Mycobacterium_phage	28.8	1.6e-09
AUU60787.1|548365_549289_+	U32 family peptidase	NA	NA	NA	NA	NA
AUU60788.1|549300_550569_+|protease	collagenase-like protease	protease	Q6DW11	Phage_TP	31.7	4.0e-36
AUU60789.1|550568_551192_+	uridine kinase	NA	A0A1V0SAA3	Catovirus	41.1	2.8e-35
>prophage 34
CP026071	Staphylococcus aureus strain NRS143 chromosome, complete genome	2861652	558265	560387	2861652		Lactococcus_phage(50.0%)	4	NA	NA
AUU60798.1|558265_559087_+	Fic family protein	NA	Q9AZ49	Lactococcus_phage	33.7	1.1e-34
AUU60799.1|559441_559621_+	hypothetical protein	NA	NA	NA	NA	NA
AUU60800.1|559634_560138_+	enterotoxin	NA	NA	NA	NA	NA
AUU60801.1|560180_560387_+	carboxylate--amine ligase	NA	A0A1X9H080	Staphylococcus_phage	40.8	8.7e-10
>prophage 35
CP026071	Staphylococcus aureus strain NRS143 chromosome, complete genome	2861652	567656	573820	2861652		Bacillus_phage(33.33%)	5	NA	NA
AUU60813.1|567656_568118_+	ComE operon protein 2	NA	A7KUY9	Bacillus_phage	58.8	3.6e-35
AUU60814.1|568176_570324_+	DNA internalization-related competence protein ComEC/Rec2	NA	Q332C0	Clostridium_botulinum_C_phage	32.2	9.1e-33
AUU60815.1|570380_571355_+	DNA polymerase III subunit delta	NA	NA	NA	NA	NA
AUU60816.1|571399_571651_-	30S ribosomal protein S20	NA	NA	NA	NA	NA
AUU60817.1|571996_573820_+	elongation factor 4	NA	A0A1S5SF82	Streptococcus_phage	25.1	6.1e-22
>prophage 36
CP026071	Staphylococcus aureus strain NRS143 chromosome, complete genome	2861652	577255	580363	2861652		Micromonas_pusilla_virus(50.0%)	2	NA	NA
AUU60821.1|577255_579088_+	molecular chaperone DnaK	NA	G8DDB7	Micromonas_pusilla_virus	46.5	4.4e-137
AUU60822.1|579223_580363_+	molecular chaperone DnaJ	NA	A0A1V0SBY2	Catovirus	26.5	6.8e-27
>prophage 37
CP026071	Staphylococcus aureus strain NRS143 chromosome, complete genome	2861652	586832	587780	2861652		Rhizobium_phage(100.0%)	1	NA	NA
AUU60829.1|586832_587780_+	PhoH family protein	NA	L7TP00	Rhizobium_phage	46.8	4.9e-47
>prophage 38
CP026071	Staphylococcus aureus strain NRS143 chromosome, complete genome	2861652	590834	604562	2861652	tRNA	Klosneuvirus(25.0%)	13	NA	NA
AUU60834.1|590834_592226_-|tRNA	glycine--tRNA ligase	tRNA	A0A1V0SIF1	Klosneuvirus	27.4	4.7e-46
AUU60835.1|592560_593184_+	transcriptional regulator	NA	NA	NA	NA	NA
AUU60836.1|593194_594013_+	phosphoenolpyruvate synthase regulatory protein	NA	NA	NA	NA	NA
AUU60837.1|594073_595873_+	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	36.0	3.5e-54
AUU60838.1|596096_597203_+	RNA polymerase sigma factor SigA	NA	A0A2I7SAT0	Vibrio_phage	38.1	1.1e-37
AUU60839.1|597333_598011_+|tRNA	tRNA (adenine-N(1))-methyltransferase	tRNA	NA	NA	NA	NA
AUU60840.1|598013_599114_+	Nif3-like dinuclear metal center hexameric protein	NA	A0A1S5V250	Saudi_moumouvirus	30.6	3.0e-08
AUU60841.1|599227_600574_+	ATP-dependent helicase	NA	A0A1V0SIR5	Klosneuvirus	34.0	1.4e-55
AUU60842.1|600583_601474_+	endonuclease	NA	A0A2H4UU70	Bodo_saltans_virus	33.1	2.0e-26
AUU60843.1|601599_602385_+	metal ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.3	8.0e-19
AUU60844.1|602426_603290_+	metal ABC transporter permease	NA	NA	NA	NA	NA
AUU60845.1|603276_603687_+	transcriptional repressor	NA	NA	NA	NA	NA
AUU60846.1|603962_604562_+	superoxide dismutase	NA	Q56AR7	Bacillus_thuringiensis_phage	54.7	9.2e-60
>prophage 39
CP026071	Staphylococcus aureus strain NRS143 chromosome, complete genome	2861652	610734	611358	2861652		Streptococcus_phage(100.0%)	1	NA	NA
AUU60854.1|610734_611358_+	MBL fold metallo-hydrolase	NA	A0A1X9I5D3	Streptococcus_phage	37.1	1.6e-30
>prophage 40
CP026071	Staphylococcus aureus strain NRS143 chromosome, complete genome	2861652	616902	619714	2861652		Prochlorococcus_phage(100.0%)	2	NA	NA
AUU60864.1|616902_618249_+	aminomethyl-transferring glycine dehydrogenase	NA	E3SN07	Prochlorococcus_phage	39.9	2.1e-64
AUU60865.1|618241_619714_+	glycine dehydrogenase	NA	E3SN07	Prochlorococcus_phage	41.1	1.4e-80
>prophage 41
CP026071	Staphylococcus aureus strain NRS143 chromosome, complete genome	2861652	627234	633804	2861652		Indivirus(66.67%)	6	NA	NA
AUU60876.1|627234_628572_+	exodeoxyribonuclease 7 large subunit	NA	A0A1V0SD82	Indivirus	37.7	1.6e-43
AUU60877.1|628564_628795_+	exodeoxyribonuclease 7 small subunit	NA	NA	NA	NA	NA
AUU60878.1|628772_629654_+	polyprenyl synthetase family protein	NA	A0A1V0SE37	Indivirus	25.8	5.8e-10
AUU60879.1|630084_630537_+	arginine repressor	NA	NA	NA	NA	NA
AUU60880.1|630552_632232_+	DNA repair protein RecN	NA	NA	NA	NA	NA
AUU60881.1|632382_633804_+	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	26.1	2.5e-39
>prophage 42
CP026071	Staphylococcus aureus strain NRS143 chromosome, complete genome	2861652	640632	642039	2861652		Synechococcus_phage(100.0%)	1	NA	NA
AUU60889.1|640632_642039_+	phosphogluconate dehydrogenase (NADP(+)-dependent, decarboxylating)	NA	A0A222YX62	Synechococcus_phage	31.1	4.3e-31
>prophage 43
CP026071	Staphylococcus aureus strain NRS143 chromosome, complete genome	2861652	649386	650871	2861652		Cyanophage(100.0%)	1	NA	NA
AUU60897.1|649386_650871_-	glucose-6-phosphate dehydrogenase	NA	M4SIY3	Cyanophage	37.8	2.4e-80
>prophage 44
CP026071	Staphylococcus aureus strain NRS143 chromosome, complete genome	2861652	656535	666033	2861652		Brevibacillus_phage(25.0%)	9	NA	NA
AUU60905.1|656535_657423_+	site-specific tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	31.1	5.6e-37
AUU60906.1|657500_658007_-	DUF309 domain-containing protein	NA	NA	NA	NA	NA
AUU60907.1|658098_658830_+	segregation and condensation protein A	NA	NA	NA	NA	NA
AUU60908.1|658822_659365_+	SMC-Scp complex subunit ScpB	NA	NA	NA	NA	NA
AUU60909.1|659357_660095_+	rRNA pseudouridine synthase	NA	NA	NA	NA	NA
AUU60910.1|660227_660953_+	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	43.0	3.5e-45
AUU60911.1|660933_662685_+	two-component sensor histidine kinase	NA	A0A1V0SGX0	Hokovirus	33.6	1.7e-21
AUU60912.1|662936_663869_+	hypothetical protein	NA	NA	NA	NA	NA
AUU60913.1|663855_666033_+	hypothetical protein	NA	B5WZK7	Staphylococcus_phage	40.5	1.7e-31
>prophage 45
CP026071	Staphylococcus aureus strain NRS143 chromosome, complete genome	2861652	669292	671971	2861652		Bacillus_phage(50.0%)	3	NA	NA
AUU60918.1|669292_669541_-	ferredoxin	NA	A0A127AYY7	Bacillus_phage	48.0	8.3e-15
AUU60919.1|669648_670602_+	hypothetical protein	NA	NA	NA	NA	NA
AUU60920.1|670591_671971_+	ATP-dependent DNA helicase RecQ	NA	L7RCS0	Acanthamoeba_polyphaga_moumouvirus	33.3	2.9e-56
>prophage 46
CP026071	Staphylococcus aureus strain NRS143 chromosome, complete genome	2861652	681378	686519	2861652		Bacillus_phage(25.0%)	7	NA	NA
AUU60932.1|681378_681651_+	DNA-binding protein HU	NA	A7KV42	Bacillus_phage	73.3	4.2e-28
AUU60933.1|681840_682155_-	hypothetical protein	NA	NA	NA	NA	NA
AUU60934.1|682081_682654_+	heptaprenyl pyrophosphate synthase subunit A	NA	NA	NA	NA	NA
AUU60935.1|682656_683382_+	demethylmenaquinone methyltransferase	NA	NA	NA	NA	NA
AUU62925.1|683398_684343_+	heptaprenyl diphosphate synthase	NA	A0A1V0SE37	Indivirus	24.4	1.3e-10
AUU60936.1|684434_684884_+	nucleoside-diphosphate kinase	NA	D2E8E1	Anguillid_herpesvirus	43.8	2.4e-28
AUU60937.1|685352_686519_+	chorismate synthase	NA	A0A291AU41	Pandoravirus	32.3	1.5e-34
>prophage 47
CP026071	Staphylococcus aureus strain NRS143 chromosome, complete genome	2861652	690181	690757	2861652		Bacillus_virus(100.0%)	1	NA	NA
AUU60941.1|690181_690757_+	IDEAL domain-containing protein	NA	G3MAV7	Bacillus_virus	27.2	4.6e-08
>prophage 48
CP026071	Staphylococcus aureus strain NRS143 chromosome, complete genome	2861652	694129	701636	2861652	tRNA	unidentified_phage(25.0%)	5	NA	NA
AUU60945.1|694129_695332_+	CCA-adding enzyme	NA	H7BUW3	unidentified_phage	42.5	1.4e-35
AUU60946.1|695318_696290_+	biotin--[acetyl-CoA-carboxylase] ligase	NA	NA	NA	NA	NA
AUU60947.1|696313_699007_+	ATP-dependent helicase DinG	NA	A0A1X9I5C8	Streptococcus_phage	34.4	8.2e-47
AUU60948.1|699328_700621_+|tRNA	asparagine--tRNA ligase	tRNA	A0A2P1EMB4	Moumouvirus	30.0	4.3e-54
AUU60949.1|700949_701636_+	DnaD domain protein	NA	Q938N2	Temperate_phage	32.6	5.5e-08
>prophage 49
CP026071	Staphylococcus aureus strain NRS143 chromosome, complete genome	2861652	705327	705954	2861652		Bacillus_phage(100.0%)	1	NA	NA
AUU60953.1|705327_705954_-	Holliday junction resolvase RecU	NA	A0A1C8E9C3	Bacillus_phage	35.5	1.7e-24
>prophage 50
CP026071	Staphylococcus aureus strain NRS143 chromosome, complete genome	2861652	715417	716296	2861652		Bacillus_phage(100.0%)	1	NA	NA
AUU60963.1|715417_716296_+	5'-3' exonuclease	NA	S5M4P0	Bacillus_phage	29.5	1.4e-19
>prophage 51
CP026071	Staphylococcus aureus strain NRS143 chromosome, complete genome	2861652	754888	765345	2861652	protease,transposase	Staphylococcus_phage(50.0%)	14	NA	NA
AUU60970.1|754888_755593_-	hypothetical protein	NA	A0A2H4J2N7	uncultured_Caudovirales_phage	23.3	1.9e-11
AUU60971.1|755810_756032_+	zinc-finger domain-containing protein	NA	NA	NA	NA	NA
AUU60972.1|756043_756295_+	scaffolding protein	NA	NA	NA	NA	NA
AUU60973.1|756332_757457_+	virulence factor C	NA	NA	NA	NA	NA
AUU60974.1|757472_757910_+	BrxA/BrxB family bacilliredoxin	NA	NA	NA	NA	NA
AUU60975.1|758333_759290_+	thymidylate synthase	NA	A0A0N9SH48	Staphylococcus_phage	85.2	1.6e-167
AUU60976.1|759489_759969_+	dihydrofolate reductase	NA	A0A0N9S8H6	Staphylococcus_phage	79.9	2.0e-73
AUU60977.1|759983_760823_+	fatty acid-binding protein DegV	NA	A0A0N9SI50	Staphylococcus_phage	76.5	5.1e-48
AUU60978.1|760908_761442_+	peptide-methionine (S)-S-oxide reductase	NA	NA	NA	NA	NA
AUU60979.1|761434_761863_+	peptide-methionine (R)-S-oxide reductase	NA	NA	NA	NA	NA
AUU60980.1|761874_762375_+	glucose-specific phosphotransferase enzyme IIA component	NA	NA	NA	NA	NA
AUU60981.1|762374_762596_+	hypothetical protein	NA	NA	NA	NA	NA
AUU60982.1|762668_763616_-|transposase	IS30 family transposase ISSau1	transposase	Q9MBM9	Staphylococcus_prophage	100.0	1.1e-184
AUU60983.1|763854_765345_+|protease	serine protease	protease	A0A0R6PIZ1	Moraxella_phage	30.5	1.7e-22
>prophage 52
CP026071	Staphylococcus aureus strain NRS143 chromosome, complete genome	2861652	768753	770765	2861652		Bacillus_phage(50.0%)	2	NA	NA
AUU60987.1|768753_769413_+	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	33.8	1.1e-34
AUU60988.1|769409_770765_+	two-component sensor histidine kinase	NA	A0A1V0SGX0	Hokovirus	27.8	3.5e-14
>prophage 53
CP026071	Staphylococcus aureus strain NRS143 chromosome, complete genome	2861652	777133	777925	2861652		Halovirus(100.0%)	1	NA	NA
AUU60993.1|777133_777925_+	MoxR family ATPase	NA	R4TG24	Halovirus	34.2	3.3e-12
>prophage 54
CP026071	Staphylococcus aureus strain NRS143 chromosome, complete genome	2861652	781460	786486	2861652		Lactobacillus_phage(33.33%)	8	NA	NA
AUU60996.1|781460_782597_-	tellurite resistance protein TelA	NA	A0A291I9K4	Lactobacillus_phage	28.3	7.4e-34
AUU60997.1|782628_783258_-	5-bromo-4-chloroindolyl phosphate hydrolase	NA	NA	NA	NA	NA
AUU60998.1|783276_783546_-	acylphosphatase	NA	NA	NA	NA	NA
AUU60999.1|783707_784016_+	DUF1033 domain-containing protein	NA	NA	NA	NA	NA
AUU61000.1|783963_784152_-	hypothetical protein	NA	NA	NA	NA	NA
AUU61001.1|784186_784387_+	cold-shock protein CspA	NA	Q9AZD3	Lactococcus_phage	66.2	8.4e-18
AUU61002.1|784583_784985_+	protein msa	NA	NA	NA	NA	NA
AUU61003.1|785220_786486_-	diaminopimelate decarboxylase	NA	A0A0P0YM38	Yellowstone_lake_phycodnavirus	23.0	4.0e-12
>prophage 55
CP026071	Staphylococcus aureus strain NRS143 chromosome, complete genome	2861652	794328	795930	2861652		Klosneuvirus(100.0%)	1	NA	NA
AUU61011.1|794328_795930_-	ABC transporter ATP-binding protein	NA	A0A1V0SKJ1	Klosneuvirus	25.7	5.5e-51
>prophage 56
CP026071	Staphylococcus aureus strain NRS143 chromosome, complete genome	2861652	800355	803809	2861652		Indivirus(50.0%)	3	NA	NA
AUU61016.1|800355_801207_+	phosphate ABC transporter ATP-binding protein	NA	A0A1V0SE00	Indivirus	29.7	6.8e-16
AUU61017.1|801213_801855_+	phosphate transport system regulatory protein PhoU	NA	NA	NA	NA	NA
AUU61018.1|801994_803809_-	oligoendopeptidase F	NA	A0A1X9I5X5	Streptococcus_phage	47.3	2.3e-154
>prophage 57
CP026071	Staphylococcus aureus strain NRS143 chromosome, complete genome	2861652	807223	807925	2861652		Tupanvirus(100.0%)	1	NA	NA
AUU61024.1|807223_807925_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.8	2.0e-13
>prophage 58
CP026071	Staphylococcus aureus strain NRS143 chromosome, complete genome	2861652	815406	817759	2861652		Acinetobacter_phage(100.0%)	2	NA	NA
AUU61031.1|815406_816189_-	indole-3-glycerol-phosphate synthase	NA	A0A0P0IR83	Acinetobacter_phage	36.7	1.2e-27
AUU61032.1|817192_817759_-	glutamine amidotransferase	NA	A0A0P0IKJ1	Acinetobacter_phage	31.8	1.7e-23
>prophage 59
CP026071	Staphylococcus aureus strain NRS143 chromosome, complete genome	2861652	822077	825643	2861652	transposase	Bacillus_phage(50.0%)	3	NA	NA
AUU61036.1|822077_823340_-	DNA repair protein	NA	O64031	Bacillus_phage	44.3	1.7e-95
AUU61037.1|823487_823673_+	tautomerase	NA	NA	NA	NA	NA
AUU61038.1|823996_825643_+|transposase	IS1182 family transposase ISSau3	transposase	A0ZS58	Staphylococcus_virus	100.0	3.5e-295
>prophage 60
CP026071	Staphylococcus aureus strain NRS143 chromosome, complete genome	2861652	834912	839306	2861652		Bacillus_phage(50.0%)	2	NA	NA
AUU61047.1|834912_837315_-	DNA topoisomerase IV subunit A	NA	A0A172JHV7	Bacillus_phage	32.2	1.1e-92
AUU62927.1|837314_839306_-	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	40.5	8.0e-116
>prophage 61
CP026071	Staphylococcus aureus strain NRS143 chromosome, complete genome	2861652	844923	846570	2861652		Vibrio_phage(100.0%)	1	NA	NA
AUU61052.1|844923_846570_-	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	24.5	1.9e-22
>prophage 62
CP026071	Staphylococcus aureus strain NRS143 chromosome, complete genome	2861652	850239	851361	2861652		Staphylococcus_phage(100.0%)	1	NA	NA
AUU61055.1|850239_851361_-	exonuclease sbcCD subunit D	NA	A0A1X9I9U0	Staphylococcus_phage	22.1	2.1e-09
>prophage 63
CP026071	Staphylococcus aureus strain NRS143 chromosome, complete genome	2861652	855510	861166	2861652		Phage_Wrath(25.0%)	7	NA	NA
AUU61062.1|855510_856134_+	LexA repressor	NA	A0A1B2APZ1	Phage_Wrath	63.8	3.5e-17
AUU61063.1|856513_857377_-	CAP domain-containing protein	NA	U5Q0C0	Bacillus_phage	41.5	1.2e-15
AUU61064.1|857450_857555_+	hypothetical protein	NA	NA	NA	NA	NA
AUU61065.1|857551_858529_-	guanosine monophosphate reductase	NA	Q4ZCY7	Staphylococcus_virus	99.7	8.0e-186
AUU61066.1|858685_858955_-	30S ribosomal protein S14	NA	NA	NA	NA	NA
AUU61067.1|859408_859558_-	50S ribosomal protein L33	NA	NA	NA	NA	NA
AUU61068.1|859648_861166_-	catalase	NA	A0A2K9L0T1	Tupanvirus	43.8	2.7e-92
>prophage 64
CP026071	Staphylococcus aureus strain NRS143 chromosome, complete genome	2861652	871302	875578	2861652		Bacillus_phage(50.0%)	7	NA	NA
AUU61077.1|871302_871836_-	thermonuclease	NA	A0A1P8CWK6	Bacillus_phage	43.5	3.4e-21
AUU61078.1|871974_872163_+	hypothetical protein	NA	NA	NA	NA	NA
AUU61079.1|872172_872376_-	hypothetical protein	NA	NA	NA	NA	NA
AUU61080.1|872275_872878_-	DNA-binding response regulator	NA	NA	NA	NA	NA
AUU61081.1|872874_873966_-	sensor histidine kinase	NA	NA	NA	NA	NA
AUU61082.1|873969_874701_-	ABC transporter permease	NA	NA	NA	NA	NA
AUU61083.1|874669_875578_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	27.6	9.8e-21
>prophage 65
CP026071	Staphylococcus aureus strain NRS143 chromosome, complete genome	2861652	879532	879868	2861652	head	Staphylococcus_phage(100.0%)	1	NA	NA
AUU61088.1|879532_879868_-|head	phage head morphogenesis protein	head	A0A1J0MFV1	Staphylococcus_phage	60.4	2.6e-27
>prophage 66
CP026071	Staphylococcus aureus strain NRS143 chromosome, complete genome	2861652	883805	890411	2861652	transposase,capsid	Staphylococcus_phage(80.0%)	8	NA	NA
AUU61097.1|883805_884471_-|capsid	phage capsid protein	capsid	A0A1J0MF61	Staphylococcus_phage	53.5	2.1e-60
AUU61098.1|884531_884783_-	hypothetical protein	NA	NA	NA	NA	NA
AUU61099.1|886303_886720_-	hypothetical protein	NA	NA	NA	NA	NA
AUU61100.1|887146_888094_+|transposase	IS30 family transposase ISSau1	transposase	Q9MBM9	Staphylococcus_prophage	100.0	1.1e-184
AUU61101.1|888305_888491_-	hypothetical protein	NA	A0A0F6N3H3	Staphylococcus_phage	78.7	2.4e-19
AUU61102.1|888883_888994_-	hypothetical protein	NA	NA	NA	NA	NA
AUU61103.1|889695_889902_-	hypothetical protein	NA	A0A2H4PQT0	Staphylococcus_phage	56.7	1.9e-12
AUU61104.1|890198_890411_-	hypothetical protein	NA	A0A1W6JNK0	Staphylococcus_phage	72.5	3.6e-19
>prophage 67
CP026071	Staphylococcus aureus strain NRS143 chromosome, complete genome	2861652	897793	904667	2861652		Staphylococcus_phage(66.67%)	6	NA	NA
AUU61112.1|897793_899152_+	cell division protein FtsK	NA	A0A1S5SFB5	Streptococcus_phage	29.9	4.0e-42
AUU61113.1|899156_901004_+	hypothetical protein	NA	NA	NA	NA	NA
AUU61114.1|900993_902040_+	CHAP domain-containing protein	NA	A0A1X9I9L1	Staphylococcus_phage	36.9	8.1e-19
AUU61115.1|902046_902637_+	hypothetical protein	NA	NA	NA	NA	NA
AUU61116.1|902692_903049_+	hypothetical protein	NA	NA	NA	NA	NA
AUU61117.1|904469_904667_-	hypothetical protein	NA	A0A1W6JNK0	Staphylococcus_phage	48.4	1.7e-10
>prophage 68
CP026071	Staphylococcus aureus strain NRS143 chromosome, complete genome	2861652	909738	910215	2861652		Fowlpox_virus(100.0%)	1	NA	NA
AUU61122.1|909738_910215_+	glutathione peroxidase	NA	Q70H87	Fowlpox_virus	38.0	1.2e-22
>prophage 69
CP026071	Staphylococcus aureus strain NRS143 chromosome, complete genome	2861652	916158	922640	2861652		Acanthocystis_turfacea_Chlorella_virus(33.33%)	4	NA	NA
AUU61128.1|916158_916977_-	aquaporin family protein	NA	M1H4F4	Acanthocystis_turfacea_Chlorella_virus	35.1	3.1e-26
AUU61129.1|917451_917994_-	glycerol-3-phosphate responsive antiterminator	NA	NA	NA	NA	NA
AUU61130.1|917999_920009_-	DNA mismatch repair protein MutL	NA	A0A1B2LRQ5	Wolbachia_phage	30.1	6.9e-59
AUU61131.1|920021_922640_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	23.7	3.8e-41
>prophage 70
CP026071	Staphylococcus aureus strain NRS143 chromosome, complete genome	2861652	932054	933098	2861652		Bacillus_phage(100.0%)	1	NA	NA
AUU61141.1|932054_933098_-	DNA recombination/repair protein RecA	NA	A0A0S2MVG1	Bacillus_phage	69.2	9.3e-124
>prophage 71
CP026071	Staphylococcus aureus strain NRS143 chromosome, complete genome	2861652	937297	942841	2861652		Bacillus_virus(33.33%)	4	NA	NA
AUU61147.1|937297_938584_-	insulinase family protein	NA	G3MBJ8	Bacillus_virus	27.9	6.7e-15
AUU61148.1|938583_939849_-	insulinase family protein	NA	A0A1X9I714	Streptococcus_phage	26.8	1.2e-40
AUU61149.1|939879_940593_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AUU62932.1|940597_942841_-	DNA translocase FtsK	NA	S5VNE3	Mycobacterium_phage	47.7	6.9e-84
>prophage 72
CP026071	Staphylococcus aureus strain NRS143 chromosome, complete genome	2861652	947981	959796	2861652	tRNA	Klosneuvirus(33.33%)	10	NA	NA
AUU61154.1|947981_948953_-	riboflavin biosynthesis protein RibF	NA	A0A1V0SJE1	Klosneuvirus	32.1	1.7e-07
AUU61155.1|948967_949885_-|tRNA	tRNA pseudouridine(55) synthase TruB	tRNA	NA	NA	NA	NA
AUU61156.1|950054_950405_-	30S ribosome-binding factor RbfA	NA	NA	NA	NA	NA
AUU61157.1|950791_952909_-	translation initiation factor IF-2	NA	E3T4N3	Cafeteria_roenbergensis_virus	25.1	2.4e-25
AUU61158.1|952913_953231_-	hypothetical protein	NA	NA	NA	NA	NA
AUU61159.1|953227_953512_-	DUF448 domain-containing protein	NA	NA	NA	NA	NA
AUU61160.1|953532_954708_-	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
AUU61161.1|954728_955196_-	ribosome maturation factor	NA	NA	NA	NA	NA
AUU62933.1|955175_955376_+	hypothetical protein	NA	NA	NA	NA	NA
AUU62934.1|955485_959796_-	PolC-type DNA polymerase III	NA	A0A0A8WJ41	Clostridium_phage	41.2	3.5e-23
>prophage 73
CP026071	Staphylococcus aureus strain NRS143 chromosome, complete genome	2861652	964069	964840	2861652		Flavobacterium_phage(100.0%)	1	NA	NA
AUU61165.1|964069_964840_-	isoprenyl transferase	NA	R9W0U9	Flavobacterium_phage	41.5	7.3e-25
>prophage 74
CP026071	Staphylococcus aureus strain NRS143 chromosome, complete genome	2861652	969614	983286	2861652	tRNA	Erwinia_phage(16.67%)	11	NA	NA
AUU61173.1|969614_971018_-	HslU--HslV peptidase ATPase subunit	NA	A0A1B2IDZ7	Erwinia_phage	25.6	6.4e-27
AUU61174.1|971083_971629_-	HslU--HslV peptidase proteolytic subunit	NA	NA	NA	NA	NA
AUU61175.1|971625_972522_-	tyrosine recombinase XerC	NA	A0A0K2CP59	Brevibacillus_phage	31.9	6.1e-31
AUU61176.1|972939_974247_-|tRNA	FADH(2)-oxidizing methylenetetrahydrofolate--tRNA-(uracil(54)-C(5))- methyltransferase TrmFO	tRNA	NA	NA	NA	NA
AUU61177.1|974402_976478_-	type I DNA topoisomerase	NA	A0A1V0SCS0	Indivirus	39.2	1.7e-105
AUU61178.1|976651_977392_-	DNA-protecting protein DprA	NA	NA	NA	NA	NA
AUU61179.1|977696_978941_-	FemA/FemB family glycyltransferase FmhC	NA	NA	NA	NA	NA
AUU61180.1|978968_980087_-	LysM peptidoglycan-binding domain-containing protein	NA	A0A1W6JQB6	Staphylococcus_phage	61.1	9.5e-50
AUU61181.1|980313_981222_-	succinyl-CoA ligase subunit alpha	NA	A0A2K9L1S3	Tupanvirus	33.2	2.3e-17
AUU61182.1|981243_982410_-	succinyl-CoA ligase subunit beta	NA	NA	NA	NA	NA
AUU61183.1|982518_983286_-	ribonuclease HII	NA	G9E3X7	Emiliania_huxleyi_virus	44.1	2.5e-25
>prophage 75
CP026071	Staphylococcus aureus strain NRS143 chromosome, complete genome	2861652	996670	998791	2861652		Acanthamoeba_polyphaga_mimivirus(33.33%)	4	NA	NA
AUU61194.1|996670_997402_-	ribonuclease 3	NA	A0A0G2Y7P9	Acanthamoeba_polyphaga_mimivirus	28.8	5.9e-24
AUU61195.1|997517_997751_-	acyl carrier protein	NA	E3SSM9	Prochlorococcus_phage	63.3	1.6e-07
AUU61196.1|997772_997877_+	hypothetical protein	NA	NA	NA	NA	NA
AUU61197.1|998056_998791_-	3-oxoacyl-[acyl-carrier-protein] reductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	30.3	3.1e-17
>prophage 76
CP026071	Staphylococcus aureus strain NRS143 chromosome, complete genome	2861652	1009161	1011156	2861652		Moumouvirus(100.0%)	1	NA	NA
AUU61208.1|1009161_1011156_-	serine/threonine protein kinase Stk1	NA	M1PCM5	Moumouvirus	34.8	5.5e-24
>prophage 77
CP026071	Staphylococcus aureus strain NRS143 chromosome, complete genome	2861652	1014303	1015239	2861652	tRNA	Prochlorococcus_phage(100.0%)	1	NA	NA
AUU61212.1|1014303_1015239_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	28.0	4.7e-10
>prophage 78
CP026071	Staphylococcus aureus strain NRS143 chromosome, complete genome	2861652	1020248	1022505	2861652		Methanothermobacter_phage(50.0%)	3	NA	NA
AUU61216.1|1020248_1021448_-	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	32.9	1.2e-42
AUU61217.1|1021663_1021882_-	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
AUU61218.1|1021881_1022505_-	guanylate kinase	NA	A0A143DIC6	Abalone_herpesvirus	34.1	6.1e-22
>prophage 79
CP026071	Staphylococcus aureus strain NRS143 chromosome, complete genome	2861652	1025819	1026431	2861652		Pandoravirus(100.0%)	1	NA	NA
AUU61222.1|1025819_1026431_-	orotate phosphoribosyltransferase	NA	S4VS55	Pandoravirus	33.8	1.6e-27
>prophage 80
CP026071	Staphylococcus aureus strain NRS143 chromosome, complete genome	2861652	1030398	1035009	2861652		Halovirus(33.33%)	4	NA	NA
AUU61225.1|1030398_1031499_-	carbamoyl-phosphate synthase small chain	NA	R4TGJ8	Halovirus	36.7	9.6e-63
AUU61226.1|1031500_1032775_-	dihydroorotase	NA	NA	NA	NA	NA
AUU61227.1|1032792_1033674_-	aspartate carbamoyltransferase	NA	A0A1J0F9B8	Only_Syngen_Nebraska_virus	33.9	4.6e-31
AUU61228.1|1033701_1035009_-	uracil permease	NA	Q9KX94	Enterobacteria_phage	34.0	3.3e-54
>prophage 81
CP026071	Staphylococcus aureus strain NRS143 chromosome, complete genome	2861652	1039940	1042694	2861652	tRNA	Orpheovirus(100.0%)	1	NA	NA
AUU61233.1|1039940_1042694_-|tRNA	isoleucine--tRNA ligase	tRNA	A0A2I2L3Y0	Orpheovirus	28.0	2.1e-90
>prophage 82
CP026071	Staphylococcus aureus strain NRS143 chromosome, complete genome	2861652	1062050	1062248	2861652		Staphylococcus_phage(100.0%)	1	NA	NA
AUU61251.1|1062050_1062248_-	DNA-binding protein	NA	A0A0K1LL29	Staphylococcus_phage	85.2	1.2e-19
>prophage 83
CP026071	Staphylococcus aureus strain NRS143 chromosome, complete genome	2861652	1071159	1073335	2861652	transposase	Staphylococcus_virus(100.0%)	2	NA	NA
AUU61259.1|1071159_1072806_-|transposase	IS1182 family transposase ISSau3	transposase	A0ZS58	Staphylococcus_virus	100.0	3.5e-295
AUU61260.1|1073107_1073335_-	hypothetical protein	NA	Q4ZBW5	Staphylococcus_virus	67.7	1.9e-18
>prophage 84
CP026071	Staphylococcus aureus strain NRS143 chromosome, complete genome	2861652	1076795	1077146	2861652		Staphylococcus_phage(100.0%)	1	NA	NA
AUU61265.1|1076795_1077146_-	fibrinogen-binding protein	NA	A7TWS0	Staphylococcus_phage	50.0	1.9e-20
>prophage 85
CP026071	Staphylococcus aureus strain NRS143 chromosome, complete genome	2861652	1088580	1093138	2861652		Staphylococcus_phage(33.33%)	3	NA	NA
AUU61280.1|1088580_1088895_-	thiol reductase thioredoxin	NA	A0A1X9I9P5	Staphylococcus_phage	46.6	6.6e-25
AUU61281.1|1089067_1091416_-	endonuclease MutS2	NA	F2QAF8	Phaeocystis_pouchetii_virus	25.1	7.2e-15
AUU61282.1|1091425_1093138_-	DNA polymerase/3'-5' exonuclease PolX	NA	A0A2H4UV14	Bodo_saltans_virus	24.0	6.8e-15
>prophage 86
CP026071	Staphylococcus aureus strain NRS143 chromosome, complete genome	2861652	1098016	1101178	2861652	transposase,tRNA	Orpheovirus(50.0%)	3	NA	NA
AUU61287.1|1098016_1099075_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2I2L4E3	Orpheovirus	35.5	1.9e-31
AUU61288.1|1099455_1100196_-	RNA methyltransferase	NA	NA	NA	NA	NA
AUU61289.1|1100230_1101178_-|transposase	IS30 family transposase ISSau1	transposase	Q9MBM9	Staphylococcus_prophage	100.0	1.1e-184
>prophage 87
CP026071	Staphylococcus aureus strain NRS143 chromosome, complete genome	2861652	1112128	1115039	2861652		uncultured_Mediterranean_phage(50.0%)	5	NA	NA
AUU61302.1|1112128_1112611_-	phosphopantetheine adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	46.2	2.6e-28
AUU61303.1|1112612_1113155_-	16S rRNA (guanine(966)-N(2))-methyltransferase RsmD	NA	NA	NA	NA	NA
AUU61304.1|1113224_1113614_+	hypothetical protein	NA	NA	NA	NA	NA
AUU61305.1|1113616_1113871_-	DUF2129 domain-containing protein	NA	NA	NA	NA	NA
AUU61306.1|1114109_1115039_+	glycerophosphodiester phosphodiesterase	NA	M1I1K8	Paramecium_bursaria_Chlorella_virus	26.2	6.5e-12
>prophage 88
CP026071	Staphylococcus aureus strain NRS143 chromosome, complete genome	2861652	1136680	1140323	2861652		Mycoplasma_phage(50.0%)	4	NA	NA
AUU61327.1|1136680_1137775_-	spermidine/putrescine import ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	44.3	1.4e-37
AUU61328.1|1137787_1138327_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AUU61329.1|1138470_1138746_-	hypothetical protein	NA	NA	NA	NA	NA
AUU61330.1|1138916_1140323_-	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	28.9	6.1e-46
>prophage 89
CP026071	Staphylococcus aureus strain NRS143 chromosome, complete genome	2861652	1144964	1145516	2861652		Synechococcus_phage(100.0%)	1	NA	NA
AUU61335.1|1144964_1145516_+	peptide deformylase	NA	E3SLL2	Synechococcus_phage	42.2	1.6e-13
>prophage 90
CP026071	Staphylococcus aureus strain NRS143 chromosome, complete genome	2861652	1151630	1156010	2861652		Bacillus_virus(50.0%)	5	NA	NA
AUU61343.1|1151630_1151864_+	glutaredoxin family protein	NA	G3MBF0	Bacillus_virus	38.7	1.3e-09
AUU61344.1|1152100_1153819_-	phosphoenolpyruvate--protein phosphotransferase	NA	NA	NA	NA	NA
AUU61345.1|1153821_1154088_-	phosphocarrier protein HPr	NA	NA	NA	NA	NA
AUU61346.1|1154241_1154784_-	DUF697 domain-containing protein	NA	NA	NA	NA	NA
AUU61347.1|1154837_1156010_-	class I SAM-dependent rRNA methyltransferase	NA	W6LLI2	Streptococcus_phage	42.6	1.5e-74
>prophage 91
CP026071	Staphylococcus aureus strain NRS143 chromosome, complete genome	2861652	1159189	1173952	2861652		Prochlorococcus_phage(22.22%)	15	NA	NA
AUU61352.1|1159189_1160590_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	25.7	1.4e-10
AUU61353.1|1160582_1161389_+	energy-coupling factor transporter transmembrane protein EcfT	NA	NA	NA	NA	NA
AUU61354.1|1161507_1161693_+	hypothetical protein	NA	NA	NA	NA	NA
AUU61355.1|1161656_1162904_-	phosphoribosylamine--glycine ligase	NA	NA	NA	NA	NA
AUU61356.1|1162925_1164404_-	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/inosine monophosphate cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	51.5	9.2e-77
AUU61357.1|1164418_1164985_-	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	40.1	3.6e-29
AUU61358.1|1164987_1166016_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	41.4	7.6e-62
AUU61359.1|1166008_1167493_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	31.4	8.5e-46
AUU61360.1|1167471_1169661_-	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	39.2	5.1e-140
AUU61361.1|1169653_1170325_-	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
AUU61362.1|1170326_1170590_-	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
AUU61363.1|1170589_1171294_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	M4R1E8	Synechococcus_phage	41.6	7.3e-48
AUU61364.1|1171297_1172422_-	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
AUU61365.1|1172408_1172891_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	44.7	8.0e-22
AUU61366.1|1173091_1173952_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase	NA	A0A249XZQ2	Enterococcus_phage	38.8	1.2e-39
>prophage 92
CP026071	Staphylococcus aureus strain NRS143 chromosome, complete genome	2861652	1184189	1187963	2861652		Staphylococcus_phage(100.0%)	1	NA	NA
AUU61377.1|1184189_1187963_+	bifunctional autolysin	NA	A0A1J0MFB0	Staphylococcus_phage	38.0	1.1e-54
>prophage 93
CP026071	Staphylococcus aureus strain NRS143 chromosome, complete genome	2861652	1191629	1262798	2861652	transposase,protease,tRNA,bacteriocin,holin	Streptococcus_phage(15.38%)	69	NA	NA
AUU61383.1|1191629_1192703_+|protease	serine protease	protease	A0A2H4PQP7	Staphylococcus_phage	31.7	1.1e-15
AUU61384.1|1192784_1193966_+|protease	cysteine protease staphopain B	protease	NA	NA	NA	NA
AUU61385.1|1194003_1194333_+	staphostatin B	NA	NA	NA	NA	NA
AUU61386.1|1194568_1195390_-	1,4-dihydroxy-2-naphthoyl-CoA synthase	NA	NA	NA	NA	NA
AUU61387.1|1195382_1196186_-	2-succinyl-6-hydroxy-2, 4-cyclohexadiene-1-carboxylate synthase	NA	NA	NA	NA	NA
AUU61388.1|1196172_1197846_-	2-succinyl-5-enolpyruvyl-6-hydroxy-3- cyclohexene-1-carboxylate synthase	NA	NA	NA	NA	NA
AUU62942.1|1197832_1199044_-	isochorismate synthase	NA	NA	NA	NA	NA
AUU62943.1|1199147_1199225_-	hypothetical protein	NA	NA	NA	NA	NA
AUU61389.1|1199375_1200314_+	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
AUU61390.1|1200365_1200917_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AUU61391.1|1201006_1201297_+	NINE protein	NA	A0A060AN66	Enterococcus_phage	38.0	2.6e-07
AUU61392.1|1201360_1201492_+	hypothetical protein	NA	NA	NA	NA	NA
AUU61393.1|1201538_1202498_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUU61394.1|1202988_1203345_+	DoxX family protein	NA	NA	NA	NA	NA
AUU61395.1|1203433_1204915_-	glycosyl transferase family 1	NA	NA	NA	NA	NA
AUU61396.1|1204920_1205208_-	hypothetical protein	NA	NA	NA	NA	NA
AUU61397.1|1205548_1205839_+	hypothetical protein	NA	NA	NA	NA	NA
AUU61398.1|1206564_1206885_-	hypothetical protein	NA	NA	NA	NA	NA
AUU61399.1|1206887_1208852_-	DUF1430 domain-containing protein	NA	NA	NA	NA	NA
AUU62944.1|1208895_1209168_-|bacteriocin	lactococcin 972 family bacteriocin	bacteriocin	NA	NA	NA	NA
AUU61400.1|1209177_1209279_-	hypothetical protein	NA	NA	NA	NA	NA
AUU62945.1|1209817_1209895_-|holin	putative holin-like toxin	holin	NA	NA	NA	NA
AUU61401.1|1210195_1210798_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
AUU61402.1|1210812_1210989_-	DUF2187 domain-containing protein	NA	NA	NA	NA	NA
AUU61403.1|1211187_1212174_+	lipoate--protein ligase	NA	NA	NA	NA	NA
AUU61404.1|1212254_1212473_-	IDEAL domain-containing protein	NA	NA	NA	NA	NA
AUU61405.1|1212682_1213252_+	competence protein ComK	NA	NA	NA	NA	NA
AUU61406.1|1213740_1215252_-	bifunctional metallophosphatase/5'-nucleotidase	NA	NA	NA	NA	NA
AUU61407.1|1215390_1216749_-	Ktr system potassium uptake protein D	NA	NA	NA	NA	NA
AUU61408.1|1216765_1219090_-	PDZ domain-containing protein	NA	W5SAB9	Pithovirus	26.8	4.0e-10
AUU61409.1|1219308_1220112_-	hypothetical protein	NA	S5MAL1	Bacillus_phage	40.5	1.6e-30
AUU61410.1|1220413_1221976_-	peptide chain release factor 3	NA	A0A1S5SF82	Streptococcus_phage	28.2	2.2e-36
AUU61411.1|1221975_1222236_-	hypothetical protein	NA	NA	NA	NA	NA
AUU61412.1|1222216_1223701_-	UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--L- lysine ligase	NA	NA	NA	NA	NA
AUU61413.1|1224132_1225308_+	diacylglycerol beta-glucosyltransferase	NA	NA	NA	NA	NA
AUU61414.1|1225267_1226476_+	MFS transporter	NA	NA	NA	NA	NA
AUU61415.1|1226588_1227098_-	hypothetical protein	NA	NA	NA	NA	NA
AUU61416.1|1227839_1228691_-	base excision DNA repair protein	NA	NA	NA	NA	NA
AUU61417.1|1228692_1229418_-	hypothetical protein	NA	NA	NA	NA	NA
AUU61418.1|1229583_1230342_-	esterase family protein	NA	NA	NA	NA	NA
AUU61419.1|1230484_1232053_-	alanine:cation symporter family protein	NA	NA	NA	NA	NA
AUU61420.1|1232394_1233480_+	AI-2E family transporter	NA	NA	NA	NA	NA
AUU61421.1|1233675_1234446_-	enoyl-[acyl-carrier-protein] reductase FabI	NA	NA	NA	NA	NA
AUU61422.1|1234723_1236568_-	sodium:proton antiporter	NA	NA	NA	NA	NA
AUU61423.1|1236577_1237963_-	magnesium transporter	NA	NA	NA	NA	NA
AUU61424.1|1237983_1238838_-	RluA family pseudouridine synthase	NA	NA	NA	NA	NA
AUU61425.1|1238834_1239644_-	NAD(+) kinase	NA	NA	NA	NA	NA
AUU61426.1|1239660_1240296_-	GTP pyrophosphokinase	NA	NA	NA	NA	NA
AUU61427.1|1240312_1240660_-	hypothetical protein	NA	NA	NA	NA	NA
AUU61428.1|1240845_1241439_+	CYTH domain-containing protein	NA	NA	NA	NA	NA
AUU61429.1|1241542_1241908_+	globin	NA	NA	NA	NA	NA
AUU61430.1|1241930_1242737_+	hypothetical protein	NA	NA	NA	NA	NA
AUU61431.1|1243196_1245005_-	oligoendopeptidase F	NA	A0A1X9I5X5	Streptococcus_phage	24.5	9.3e-47
AUU61432.1|1245052_1246039_-	competence protein CoiA	NA	NA	NA	NA	NA
AUU61433.1|1246159_1246879_-	adaptor protein MecA	NA	NA	NA	NA	NA
AUU61434.1|1247249_1247645_-	transcriptional regulator Spx	NA	NA	NA	NA	NA
AUU61435.1|1247939_1248929_+|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
AUU61436.1|1248955_1250602_-|transposase	IS1182-like element ISSau3 family transposase	transposase	A0ZS58	Staphylococcus_virus	99.3	7.4e-293
AUU61437.1|1250897_1252464_+|transposase	IS3-like element ISSau2 family transposase	transposase	A0A0C5AEA5	Paenibacillus_phage	51.8	1.0e-49
AUU61438.1|1252553_1253435_-	ABC transporter permease	NA	NA	NA	NA	NA
AUU61439.1|1253446_1254097_-	peptide ABC transporter permease	NA	NA	NA	NA	NA
AUU61440.1|1254089_1255070_-	dipeptide ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	34.1	2.7e-16
AUU61441.1|1255072_1256059_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.0	1.8e-15
AUU61442.1|1256109_1257579_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUU61443.1|1257693_1258641_+|transposase	IS30 family transposase ISSau1	transposase	Q9MBM9	Staphylococcus_prophage	100.0	1.1e-184
AUU61444.1|1258632_1258899_-	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUU61445.1|1259110_1260766_-	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUU61446.1|1260784_1261726_-	peptide ABC transporter ATP-binding protein	NA	F2Y1V6	Organic_Lake_phycodnavirus	26.9	9.3e-06
AUU61447.1|1261715_1262798_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.1	2.4e-18
>prophage 94
CP026071	Staphylococcus aureus strain NRS143 chromosome, complete genome	2861652	1271392	1278203	2861652		Micromonas_sp._RCC1109_virus(33.33%)	4	NA	NA
AUU61458.1|1271392_1272538_-	2-isopropylmalate synthase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	26.0	1.5e-05
AUU61459.1|1272648_1273518_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUU61460.1|1273576_1276186_-	chaperone protein ClpB	NA	A0A223W0B1	Agrobacterium_phage	34.3	5.5e-117
AUU61461.1|1276388_1278203_-	acyltransferase	NA	B5WZU0	Pseudomonas_phage	33.9	8.8e-37
>prophage 95
CP026071	Staphylococcus aureus strain NRS143 chromosome, complete genome	2861652	1281468	1288928	2861652	transposase	Staphylococcus_virus(50.0%)	4	NA	NA
AUU61465.1|1281468_1283115_-|transposase	IS1182-like element ISSau3 family transposase	transposase	A0ZS58	Staphylococcus_virus	99.8	1.8e-294
AUU61466.1|1283491_1283881_-	hypothetical protein	NA	NA	NA	NA	NA
AUU61467.1|1284206_1285109_-	FAA hydrolase family protein	NA	NA	NA	NA	NA
AUU61468.1|1285274_1288928_-	helicase-exonuclease AddAB subunit AddA	NA	A7KV33	Bacillus_phage	24.3	7.7e-24
>prophage 96
CP026071	Staphylococcus aureus strain NRS143 chromosome, complete genome	2861652	1299083	1306019	2861652		Staphylococcus_phage(33.33%)	6	NA	NA
AUU61476.1|1299083_1300013_+	glycerophosphodiester phosphodiesterase	NA	A0A220BYK6	Staphylococcus_phage	37.5	1.8e-38
AUU61477.1|1300293_1301538_-	NAD-specific glutamate dehydrogenase	NA	NA	NA	NA	NA
AUU61478.1|1301646_1302837_-	Ornithine aminotransferase 2	NA	A0A1V0SKB7	Klosneuvirus	30.0	1.3e-33
AUU61479.1|1303144_1304272_-	NADH-dependent flavin oxidoreductase	NA	NA	NA	NA	NA
AUU61480.1|1304633_1305011_-	general stress protein	NA	NA	NA	NA	NA
AUU61481.1|1305425_1306019_-	peptidylprolyl isomerase	NA	A0A076FI46	Aureococcus_anophage	41.3	1.1e-25
>prophage 97
CP026071	Staphylococcus aureus strain NRS143 chromosome, complete genome	2861652	1315953	1319581	2861652		Mycoplasma_phage(50.0%)	3	NA	NA
AUU61492.1|1315953_1317429_-	aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	34.9	1.2e-47
AUU61493.1|1317559_1318768_-	NADH dehydrogenase	NA	NA	NA	NA	NA
AUU61494.1|1319221_1319581_-	iron-sulfur cluster assembly accessory protein	NA	A0A2H4N7M3	Lake_Baikal_phage	38.6	2.1e-14
>prophage 98
CP026071	Staphylococcus aureus strain NRS143 chromosome, complete genome	2861652	1323624	1326293	2861652		Pseudomonas_phage(50.0%)	2	NA	NA
AUU61501.1|1323624_1324839_-	D-alanyl-lipoteichoic acid biosynthesis protein DltB	NA	A0A125RNP0	Pseudomonas_phage	26.1	8.5e-20
AUU61502.1|1324835_1326293_-	D-alanine--poly(phosphoribitol) ligase	NA	A0A2K9L3I8	Tupanvirus	28.3	5.8e-39
>prophage 99
CP026071	Staphylococcus aureus strain NRS143 chromosome, complete genome	2861652	1339504	1343027	2861652		environmental_halophage(50.0%)	3	NA	NA
AUU61519.1|1339504_1340746_-	cysteine desulfurase	NA	Q2XUY6	environmental_halophage	44.5	1.1e-110
AUU61520.1|1340860_1342168_-	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
AUU61521.1|1342265_1343027_-	Fe-S cluster assembly ATPase SufC	NA	A0A1V0SE00	Indivirus	23.3	4.4e-06
>prophage 100
CP026071	Staphylococcus aureus strain NRS143 chromosome, complete genome	2861652	1346859	1347885	2861652		Planktothrix_phage(100.0%)	1	NA	NA
AUU61526.1|1346859_1347885_-	methionine import ATP-binding protein MetN 2	NA	G9BWD6	Planktothrix_phage	36.8	7.2e-28
>prophage 101
CP026071	Staphylococcus aureus strain NRS143 chromosome, complete genome	2861652	1350994	1356173	2861652		Streptococcus_phage(50.0%)	8	NA	NA
AUU61530.1|1350994_1351351_-	arsenate reductase family protein	NA	M1PLC0	Streptococcus_phage	46.6	4.7e-19
AUU61531.1|1351494_1351815_+	thioredoxin	NA	A0A1X9I9P5	Staphylococcus_phage	36.4	3.1e-06
AUU61532.1|1351964_1352504_-	nitroreductase	NA	NA	NA	NA	NA
AUU61533.1|1352586_1353303_-	3-dehydroquinase	NA	W6LP76	Streptococcus_phage	29.7	6.8e-17
AUU61534.1|1353450_1353873_+	organic hydroperoxide resistance protein	NA	NA	NA	NA	NA
AUU61535.1|1354271_1354766_+	N-acetyltransferase	NA	NA	NA	NA	NA
AUU61536.1|1354922_1355540_+	amino acid transporter	NA	NA	NA	NA	NA
AUU62948.1|1355612_1356173_-	histidine phosphatase family protein	NA	A0A1X9IGJ2	Lactococcus_phage	40.9	3.8e-31
>prophage 102
CP026071	Staphylococcus aureus strain NRS143 chromosome, complete genome	2861652	1359578	1360822	2861652		Lactococcus_phage(50.0%)	2	NA	NA
AUU61544.1|1359578_1359779_-	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	70.8	1.4e-20
AUU61545.1|1360135_1360822_-	thermonuclease	NA	A0A1P8CWK6	Bacillus_phage	54.2	3.8e-33
>prophage 103
CP026071	Staphylococcus aureus strain NRS143 chromosome, complete genome	2861652	1370295	1379053	2861652		Staphylococcus_phage(50.0%)	8	NA	NA
AUU61552.1|1370295_1371024_+	DUF5067 domain-containing protein	NA	H9A0X8	Staphylococcus_phage	36.8	4.8e-18
AUU61553.1|1371311_1371926_-	stage II sporulation protein M	NA	NA	NA	NA	NA
AUU61554.1|1372891_1373356_-	SsrA-binding protein	NA	W5RAM5	Staphylococcus_phage	100.0	1.5e-81
AUU61555.1|1373377_1375750_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	38.8	1.9e-92
AUU61556.1|1375783_1376524_-	carboxylesterase	NA	NA	NA	NA	NA
AUU61557.1|1376652_1376886_-	protein-export membrane protein SecG	NA	NA	NA	NA	NA
AUU61558.1|1376952_1377411_-	hypothetical protein	NA	NA	NA	NA	NA
AUU61559.1|1377748_1379053_-	enolase	NA	W6LP63	Streptococcus_phage	80.7	6.7e-196
>prophage 104
CP026071	Staphylococcus aureus strain NRS143 chromosome, complete genome	2861652	1389741	1395557	2861652	protease	Streptococcus_phage(40.0%)	6	NA	NA
AUU61568.1|1389741_1390329_-|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	55.3	8.2e-53
AUU61569.1|1390897_1391842_-	DNA-binding protein WhiA	NA	Q7AWZ3	Streptococcus_phage	40.6	3.1e-54
AUU61570.1|1391950_1392946_-	YvcK family protein	NA	A1IMD5	Streptococcus_phage	41.9	4.8e-53
AUU61571.1|1392942_1393854_-	RNase adaptor protein RapZ	NA	A0A0R8VB27	Thermobifida_phage	36.1	1.1e-08
AUU62949.1|1394133_1394295_+	nitrogen fixation protein NifR	NA	NA	NA	NA	NA
AUU61572.1|1394621_1395557_-	thioredoxin-disulfide reductase	NA	G3MA85	Bacillus_virus	49.2	8.4e-84
>prophage 105
CP026071	Staphylococcus aureus strain NRS143 chromosome, complete genome	2861652	1399954	1402801	2861652		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
AUU61577.1|1399954_1402801_-	excinuclease ABC subunit A	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	57.2	0.0e+00
>prophage 106
CP026071	Staphylococcus aureus strain NRS143 chromosome, complete genome	2861652	1406119	1406959	2861652		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
AUU61581.1|1406119_1406959_-	peptidase M23	NA	A0A2H4J675	uncultured_Caudovirales_phage	42.2	3.5e-12
>prophage 107
CP026071	Staphylococcus aureus strain NRS143 chromosome, complete genome	2861652	1413397	1419102	2861652		Streptococcus_phage(66.67%)	5	NA	NA
AUU61587.1|1413397_1414480_-	DNA/RNA helicase	NA	A0A1X9I5S6	Streptococcus_phage	35.8	1.2e-44
AUU61588.1|1414843_1415710_-	DegV family protein	NA	NA	NA	NA	NA
AUU61589.1|1415853_1416495_+	YigZ family protein	NA	A0A1X9I5T8	Streptococcus_phage	48.3	4.0e-37
AUU61590.1|1416658_1417714_-	undecaprenyl/decaprenyl-phosphate alpha-N-acetylglucosaminyl 1-phosphate transferase	NA	NA	NA	NA	NA
AUU61591.1|1418031_1419102_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	33.5	1.3e-16
>prophage 108
CP026071	Staphylococcus aureus strain NRS143 chromosome, complete genome	2861652	1428379	1451350	2861652		uncultured_Caudovirales_phage(35.71%)	20	NA	NA
AUU61602.1|1428379_1429141_-	iron ABC transporter ATP-binding protein	NA	Q9EMR9	Amsacta_moorei_entomopoxvirus	30.1	7.2e-17
AUU61603.1|1429137_1430094_-	iron ABC transporter permease	NA	A0A2H4J116	uncultured_Caudovirales_phage	60.0	5.5e-06
AUU61604.1|1430080_1431052_-	iron ABC transporter permease	NA	A0A2H4IY97	uncultured_Caudovirales_phage	80.2	7.8e-141
AUU61605.1|1431428_1432400_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	A0A2H4J4P3	uncultured_Caudovirales_phage	91.3	4.2e-171
AUU61606.1|1432519_1434625_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	A0A2H4J2N6	uncultured_Caudovirales_phage	91.7	0.0e+00
AUU61607.1|1434587_1434986_-	protein NrdI	NA	A0A2H4J545	uncultured_Caudovirales_phage	72.0	1.2e-52
AUU61608.1|1435253_1435403_-	ribonucleoside-diphosphate reductase	NA	NA	NA	NA	NA
AUU61609.1|1435787_1436654_+	EamA/RhaT family transporter	NA	NA	NA	NA	NA
AUU61610.1|1436673_1437174_+	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	E7DN65	Pneumococcus_phage	66.2	2.7e-52
AUU61611.1|1437203_1437452_+	hypothetical protein	NA	NA	NA	NA	NA
AUU61612.1|1437513_1439019_+	peptide ABC transporter permease	NA	A0A0P0IY73	Acinetobacter_phage	32.2	2.0e-58
AUU61613.1|1439096_1439198_-	hypothetical protein	NA	NA	NA	NA	NA
AUU61614.1|1439288_1440206_+	lipid kinase	NA	A0A1V0SBJ0	Catovirus	22.0	8.2e-07
AUU61615.1|1440757_1441300_-	5'(3')-deoxyribonucleotidase	NA	NA	NA	NA	NA
AUU61616.1|1441458_1442517_-	histidinol-phosphate transaminase	NA	A0A0H3TLT9	Faustovirus	26.5	5.7e-20
AUU61617.1|1442756_1444271_-	glycine/betaine ABC transporter permease	NA	NA	NA	NA	NA
AUU61618.1|1444263_1445241_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	33.8	1.1e-25
AUU61619.1|1445461_1447243_-	DNA helicase RecQ	NA	A0A2P1EM61	Moumouvirus	37.0	6.5e-77
AUU61620.1|1447254_1449138_-	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	30.8	8.8e-56
AUU61621.1|1449409_1451350_-	lipoteichoic acid synthase	NA	W6LM83	Streptococcus_phage	39.5	1.3e-110
>prophage 109
CP026071	Staphylococcus aureus strain NRS143 chromosome, complete genome	2861652	1454489	1464335	2861652		Pandoravirus(12.5%)	12	NA	NA
AUU61626.1|1454489_1455641_-	anthranilate synthase component I family protein	NA	S4VNU7	Pandoravirus	36.1	2.1e-23
AUU61627.1|1455624_1456218_-	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	44.0	6.8e-39
AUU61628.1|1456568_1457237_+	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	57.5	9.6e-66
AUU61629.1|1457238_1457658_+	6-carboxytetrahydropterin synthase QueD	NA	S4U060	uncultured_phage	28.7	6.3e-07
AUU61630.1|1457661_1458375_+	7-carboxy-7-deazaguanine synthase QueE	NA	A0A1U9WRB6	Streptococcus_virus	43.5	6.5e-52
AUU61631.1|1458473_1459058_+	hypothetical protein	NA	NA	NA	NA	NA
AUU61632.1|1459337_1459778_+	hypothetical protein	NA	NA	NA	NA	NA
AUU61633.1|1460119_1460593_+	DoxX family protein	NA	NA	NA	NA	NA
AUU61634.1|1460567_1461254_+	DNA-binding response regulator	NA	NA	NA	NA	NA
AUU61635.1|1461253_1462309_+	two-component sensor histidine kinase	NA	A0A1V0SGX0	Hokovirus	29.8	3.6e-14
AUU61636.1|1462380_1463364_-	glycosyltransferase	NA	A0A192Y8W7	Salmonella_phage	43.0	7.3e-62
AUU61637.1|1463495_1464335_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	42.3	5.1e-56
>prophage 110
CP026071	Staphylococcus aureus strain NRS143 chromosome, complete genome	2861652	1471497	1522007	2861652	bacteriocin,transposase,tRNA	Staphylococcus_phage(31.25%)	50	NA	NA
AUU61643.1|1471497_1471980_-|tRNA	Cys-tRNA(Pro) deacylase	tRNA	NA	NA	NA	NA
AUU62950.1|1472153_1472606_-	hypothetical protein	NA	NA	NA	NA	NA
AUU61644.1|1472902_1474069_-	multidrug efflux MFS transporter NorA	NA	NA	NA	NA	NA
AUU61645.1|1474278_1474701_+	DUF296 domain-containing protein	NA	NA	NA	NA	NA
AUU61646.1|1474887_1475505_+	DUF1361 domain-containing protein	NA	NA	NA	NA	NA
AUU61647.1|1475438_1475786_+	hypothetical protein	NA	NA	NA	NA	NA
AUU61648.1|1475940_1477314_-	deoxyribodipyrimidine photo-lyase	NA	A0A167RC11	Powai_lake_megavirus	34.1	1.2e-46
AUU61649.1|1477399_1478953_-	hypothetical protein	NA	NA	NA	NA	NA
AUU61650.1|1479235_1479523_-	hypothetical protein	NA	NA	NA	NA	NA
AUU61651.1|1479557_1480466_-	oxidoreductase	NA	NA	NA	NA	NA
AUU61652.1|1480568_1481495_-	GTP-binding protein	NA	NA	NA	NA	NA
AUU61653.1|1481721_1482165_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
AUU61654.1|1482291_1483965_-	amino acid ABC transporter ATP-binding/permease protein	NA	W8CYL7	Bacillus_phage	24.2	2.0e-11
AUU61655.1|1483961_1485593_-	cysteine ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	28.2	2.3e-12
AUU61656.1|1485811_1486687_+	undecaprenyl-diphosphatase	NA	NA	NA	NA	NA
AUU61657.1|1486858_1487542_+	hypothetical protein	NA	NA	NA	NA	NA
AUU61658.1|1487544_1488003_+	YaiI/YqxD family protein	NA	NA	NA	NA	NA
AUU61659.1|1488004_1488571_+	TIGR00730 family Rossman fold protein	NA	A0A1G5S9X4	Enterococcus_phage	36.9	6.1e-21
AUU61660.1|1488665_1489208_-	N-acetyltransferase	NA	NA	NA	NA	NA
AUU61661.1|1489287_1489587_-	hypothetical protein	NA	NA	NA	NA	NA
AUU61662.1|1489724_1490114_-	hypothetical protein	NA	NA	NA	NA	NA
AUU61663.1|1490180_1490624_-	N-acetyltransferase	NA	NA	NA	NA	NA
AUU61664.1|1490750_1491440_+	hypothetical protein	NA	NA	NA	NA	NA
AUU61665.1|1492102_1492777_-|transposase	IS6 family transposase ISSau6	transposase	A0A0N9RU54	Staphylococcus_phage	88.4	1.3e-113
AUU61666.1|1492871_1493249_+|transposase	transposase	transposase	NA	NA	NA	NA
AUU61667.1|1493486_1493852_+	ArsR family transcriptional regulator	NA	E4ZFI8	Streptococcus_phage	47.8	8.5e-24
AUU61668.1|1493844_1496025_+	cadmium-transporting ATPase	NA	E4ZFI9	Streptococcus_phage	63.7	9.3e-251
AUU61669.1|1496387_1498034_+|transposase	IS5/IS1182 family transposase	transposase	A0ZS58	Staphylococcus_virus	98.5	6.9e-291
AUU61670.1|1498100_1499534_-	copper oxidase	NA	NA	NA	NA	NA
AUU61671.1|1499548_1501594_-	copper-transporting P-type ATPase B	NA	E4ZFI9	Streptococcus_phage	29.2	2.3e-65
AUU61672.1|1501860_1502436_+	HTH domain-containing protein	NA	A0A0A7NPV4	Enterobacteria_phage	51.7	2.9e-42
AUU61673.1|1502770_1503766_-	putative sulfate exporter family transporter	NA	NA	NA	NA	NA
AUU61674.1|1503890_1504712_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUU61675.1|1505334_1505658_+	glyoxalase	NA	NA	NA	NA	NA
AUU61676.1|1508089_1508833_+	DUF536 domain-containing protein	NA	NA	NA	NA	NA
AUU61677.1|1509692_1510034_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AUU61678.1|1510120_1510981_-	replication initiation protein	NA	NA	NA	NA	NA
AUU61679.1|1511345_1511846_-	recombinase	NA	NA	NA	NA	NA
AUU61680.1|1511912_1512239_-	recombinase	NA	NA	NA	NA	NA
AUU61681.1|1512178_1512556_-	recombinase	NA	NA	NA	NA	NA
AUU61682.1|1512710_1514357_-|transposase	IS1182 family transposase ISSau3	transposase	A0ZS58	Staphylococcus_virus	100.0	3.5e-295
AUU61683.1|1514718_1515345_-|bacteriocin	bacteriocin ABC transporter ATP-binding protein	bacteriocin	G3M9Y6	Bacillus_virus	33.7	6.1e-22
AUU61684.1|1515356_1515668_-	hypothetical protein	NA	NA	NA	NA	NA
AUU61685.1|1515671_1517606_-	DUF1430 domain-containing protein	NA	NA	NA	NA	NA
AUU61686.1|1517680_1517974_-|bacteriocin	lactococcin 972 family bacteriocin	bacteriocin	NA	NA	NA	NA
AUU61687.1|1518353_1518749_-	protein ArsC	NA	A0A2H4PQT9	Staphylococcus_phage	86.3	8.5e-62
AUU61688.1|1518766_1520056_-	arsenical efflux pump membrane protein ArsB	NA	A0A2H4PQU3	Staphylococcus_phage	81.1	5.6e-187
AUU61689.1|1520055_1520370_-	transcriptional regulator	NA	A0A2H4PQT4	Staphylococcus_phage	73.1	4.7e-39
AUU61690.1|1521085_1521298_+	hypothetical protein	NA	NA	NA	NA	NA
AUU61691.1|1521332_1522007_-|transposase	IS6 family transposase ISSau6	transposase	A0A0N9RU54	Staphylococcus_phage	88.4	1.3e-113
>prophage 111
CP026071	Staphylococcus aureus strain NRS143 chromosome, complete genome	2861652	1527310	1527784	2861652		Pandoravirus(100.0%)	1	NA	NA
AUU61697.1|1527310_1527784_-	cupin	NA	A0A291AU44	Pandoravirus	38.7	4.6e-14
>prophage 112
CP026071	Staphylococcus aureus strain NRS143 chromosome, complete genome	2861652	1533033	1533831	2861652		Lactobacillus_virus(100.0%)	1	NA	NA
AUU61702.1|1533033_1533831_+	LysM peptidoglycan-binding domain-containing protein	NA	C1KFN7	Lactobacillus_virus	35.8	2.1e-06
>prophage 113
CP026071	Staphylococcus aureus strain NRS143 chromosome, complete genome	2861652	1538552	1539314	2861652		Planktothrix_phage(100.0%)	1	NA	NA
AUU61706.1|1538552_1539314_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.0	3.2e-33
>prophage 114
CP026071	Staphylococcus aureus strain NRS143 chromosome, complete genome	2861652	1543679	1544723	2861652		Acanthamoeba_polyphaga_moumouvirus(100.0%)	1	NA	NA
AUU61713.1|1543679_1544723_-	alpha/beta hydrolase	NA	L7RDF8	Acanthamoeba_polyphaga_moumouvirus	27.1	3.8e-16
>prophage 115
CP026071	Staphylococcus aureus strain NRS143 chromosome, complete genome	2861652	1551245	1552043	2861652		Planktothrix_phage(100.0%)	1	NA	NA
AUU61721.1|1551245_1552043_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.7	1.1e-18
>prophage 116
CP026071	Staphylococcus aureus strain NRS143 chromosome, complete genome	2861652	1555270	1559229	2861652		Bacillus_phage(33.33%)	3	NA	NA
AUU61725.1|1555270_1556998_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	43.3	9.7e-110
AUU61726.1|1557418_1558714_+	DUF1958 domain-containing protein	NA	B6DZZ7	Stx2-converting_phage	26.9	2.0e-14
AUU61727.1|1558830_1559229_-	glycerol-3-phosphate cytidylyltransferase	NA	A0A222YWT0	Streptomyces_phage	39.9	3.2e-16
>prophage 117
CP026071	Staphylococcus aureus strain NRS143 chromosome, complete genome	2861652	1566162	1566906	2861652		Indivirus(100.0%)	1	NA	NA
AUU61735.1|1566162_1566906_+	metal ABC transporter ATP-binding protein	NA	A0A1V0SE00	Indivirus	29.7	8.9e-12
>prophage 118
CP026071	Staphylococcus aureus strain NRS143 chromosome, complete genome	2861652	1579771	1580332	2861652		Streptococcus_phage(100.0%)	1	NA	NA
AUU61747.1|1579771_1580332_-	recombinase	NA	Q7Y4J2	Streptococcus_phage	31.3	1.3e-18
>prophage 119
CP026071	Staphylococcus aureus strain NRS143 chromosome, complete genome	2861652	1593357	1596711	2861652		Tupanvirus(50.0%)	3	NA	NA
AUU61759.1|1593357_1594368_-	zinc-dependent alcohol dehydrogenase	NA	A0A2K9L339	Tupanvirus	27.3	5.6e-33
AUU62955.1|1594866_1595388_-	hypothetical protein	NA	NA	NA	NA	NA
AUU61760.1|1595415_1596711_-	HD domain-containing protein	NA	E3T4P8	Cafeteria_roenbergensis_virus	27.9	1.2e-24
>prophage 120
CP026071	Staphylococcus aureus strain NRS143 chromosome, complete genome	2861652	1604242	1605565	2861652		Erysipelothrix_phage(100.0%)	1	NA	NA
AUU61768.1|1604242_1605565_+	dihydrolipoamide dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	46.8	8.2e-109
>prophage 121
CP026071	Staphylococcus aureus strain NRS143 chromosome, complete genome	2861652	1616869	1617526	2861652		Elephant_endotheliotropic_herpesvirus(100.0%)	1	NA	NA
AUU61782.1|1616869_1617526_-	uracil-DNA glycosylase	NA	U5U4C1	Elephant_endotheliotropic_herpesvirus	46.4	6.4e-46
>prophage 122
CP026071	Staphylococcus aureus strain NRS143 chromosome, complete genome	2861652	1621193	1624515	2861652		Staphylococcus_phage(50.0%)	3	NA	NA
AUU61788.1|1621193_1622570_-	long-chain fatty acid--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	23.9	1.5e-20
AUU61789.1|1622569_1622863_-	hypothetical protein	NA	NA	NA	NA	NA
AUU61790.1|1623114_1624515_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	33.0	9.4e-55
>prophage 123
CP026071	Staphylococcus aureus strain NRS143 chromosome, complete genome	2861652	1647911	1651851	2861652	transposase	Enterococcus_phage(50.0%)	4	NA	NA
AUU61807.1|1647911_1648574_+	deoxynucleoside kinase	NA	A0A0M3UL55	Enterococcus_phage	37.4	1.4e-24
AUU61808.1|1648689_1649373_-	HAD family hydrolase	NA	NA	NA	NA	NA
AUU61809.1|1649623_1650700_-	branched chain amino acid aminotransferase	NA	NA	NA	NA	NA
AUU61810.1|1650903_1651851_-|transposase	IS30 family transposase ISSau1	transposase	Q9MBM9	Staphylococcus_prophage	100.0	1.1e-184
>prophage 124
CP026071	Staphylococcus aureus strain NRS143 chromosome, complete genome	2861652	1656236	1657424	2861652		Emiliania_huxleyi_virus(100.0%)	1	NA	NA
AUU61814.1|1656236_1657424_-	glycine C-acetyltransferase	NA	V5LQ39	Emiliania_huxleyi_virus	30.6	1.5e-45
>prophage 125
CP026071	Staphylococcus aureus strain NRS143 chromosome, complete genome	2861652	1660451	1671405	2861652		Streptococcus_phage(33.33%)	6	NA	NA
AUU61817.1|1660451_1662533_-	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	28.3	2.7e-66
AUU61818.1|1662655_1663126_-	30S ribosomal protein S7	NA	NA	NA	NA	NA
AUU61819.1|1663191_1663605_-	30S ribosomal protein S12	NA	NA	NA	NA	NA
AUU61820.1|1663702_1663957_-	50S ribosomal protein L7ae-like protein	NA	NA	NA	NA	NA
AUU62958.1|1664093_1667690_-	DNA-directed RNA polymerase subunit beta'	NA	R4TQM7	Phaeocystis_globosa_virus	24.6	4.3e-67
AUU61821.1|1667853_1671405_-	DNA-directed RNA polymerase subunit beta	NA	A0A1B1ISA9	uncultured_Mediterranean_phage	24.2	6.1e-50
>prophage 126
CP026071	Staphylococcus aureus strain NRS143 chromosome, complete genome	2861652	1675088	1679871	2861652	tRNA	Bacillus_virus(50.0%)	8	NA	NA
AUU61827.1|1675088_1675637_-	transcription termination/antitermination protein NusG	NA	G3MAW2	Bacillus_virus	33.5	8.6e-12
AUU61828.1|1675649_1675832_-	protein translocase subunit SecE	NA	NA	NA	NA	NA
AUU61829.1|1675887_1676031_-	50S ribosomal protein L33	NA	NA	NA	NA	NA
AUU61830.1|1676145_1676715_-	RNA polymerase sigma factor	NA	NA	NA	NA	NA
AUU61831.1|1676795_1677320_-	NYN domain-containing protein	NA	NA	NA	NA	NA
AUU61832.1|1677319_1678066_-	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
AUU61833.1|1678073_1678478_-	ribonuclease III	NA	NA	NA	NA	NA
AUU61834.1|1678470_1679871_-|tRNA	cysteine--tRNA ligase	tRNA	A0A1V0SAQ2	Catovirus	32.0	2.5e-55
>prophage 127
CP026071	Staphylococcus aureus strain NRS143 chromosome, complete genome	2861652	1685882	1688339	2861652	protease	Escherichia_phage(100.0%)	1	NA	NA
AUU61839.1|1685882_1688339_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpC	protease	A0A1C3S747	Escherichia_phage	41.2	1.4e-133
>prophage 128
CP026071	Staphylococcus aureus strain NRS143 chromosome, complete genome	2861652	1707423	1717881	2861652	tRNA	Catovirus(16.67%)	10	NA	NA
AUU61848.1|1707423_1708911_-|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	41.1	2.1e-92
AUU61849.1|1708963_1709056_-	hypothetical protein	NA	NA	NA	NA	NA
AUU61850.1|1709449_1709926_-	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
AUU61851.1|1709922_1710288_-	dihydroneopterin aldolase	NA	NA	NA	NA	NA
AUU61852.1|1710265_1711069_-	dihydropteroate synthase	NA	A0A0B5J4J5	Pandoravirus	29.0	6.7e-21
AUU61853.1|1711284_1712217_-	cysteine synthase A	NA	A0A1X9I5K7	Streptococcus_phage	65.7	3.7e-108
AUU61854.1|1712395_1713277_-	redox-regulated molecular chaperone Hsp33	NA	NA	NA	NA	NA
AUU61855.1|1713690_1715784_-	ATP-dependent metallopeptidase FtsH/Yme1/Tma family protein	NA	E5EQ50	Micromonas_sp._RCC1109_virus	42.7	4.0e-110
AUU61856.1|1716041_1716581_-	hypoxanthine-guanine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	29.8	6.5e-12
AUU61857.1|1716585_1717881_-|tRNA	tRNA(Ile)-lysidine synthetase	tRNA	A0A1V0SI91	Klosneuvirus	24.3	8.2e-13
>prophage 129
CP026071	Staphylococcus aureus strain NRS143 chromosome, complete genome	2861652	1727137	1729602	2861652		Hokovirus(50.0%)	2	NA	NA
AUU61867.1|1727137_1728103_-	ribose-phosphate pyrophosphokinase	NA	A0A1V0SHF7	Hokovirus	35.4	6.1e-45
AUU61868.1|1728249_1729602_-	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A2K9L821	Tupanvirus	30.4	1.1e-23
>prophage 130
CP026071	Staphylococcus aureus strain NRS143 chromosome, complete genome	2861652	1735486	1738584	2861652	tRNA	Hokovirus(50.0%)	2	NA	NA
AUU61878.1|1735486_1737460_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SEZ7	Hokovirus	32.6	3.2e-93
AUU61879.1|1737744_1738584_-	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	45.8	2.7e-57
>prophage 131
CP026071	Staphylococcus aureus strain NRS143 chromosome, complete genome	2861652	1742490	1743108	2861652		Streptococcus_phage(100.0%)	1	NA	NA
AUU61886.1|1742490_1743108_-	thymidylate kinase	NA	M1PSC7	Streptococcus_phage	48.3	9.2e-47
>prophage 132
CP026071	Staphylococcus aureus strain NRS143 chromosome, complete genome	2861652	1751952	1753650	2861652		Streptococcus_virus(100.0%)	1	NA	NA
AUU61890.1|1751952_1753650_-	DNA polymerase III subunit gamma/tau	NA	A0A1U9WR94	Streptococcus_virus	42.3	1.9e-54
>prophage 133
CP026071	Staphylococcus aureus strain NRS143 chromosome, complete genome	2861652	1770287	1776524	2861652		Lactobacillus_phage(33.33%)	6	NA	NA
AUU61903.1|1770287_1771292_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A0A7NU10	Lactobacillus_phage	41.1	1.4e-23
AUU61904.1|1771625_1772468_-	methionine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUU61905.1|1772504_1773164_-	ABC transporter permease	NA	NA	NA	NA	NA
AUU61906.1|1773167_1774193_-	methionine import ATP-binding protein MetN 1	NA	G9BWD6	Planktothrix_phage	37.3	1.4e-31
AUU61907.1|1774483_1775626_-	cystathionine gamma-synthase	NA	NA	NA	NA	NA
AUU61908.1|1775618_1776524_-	cysteine synthase family protein	NA	A0A1W6JIM2	Lactococcus_phage	39.4	7.2e-48
>prophage 134
CP026071	Staphylococcus aureus strain NRS143 chromosome, complete genome	2861652	1800060	1802842	2861652		Staphylococcus_phage(100.0%)	2	NA	NA
AUU61930.1|1800060_1801293_-	restriction endonuclease subunit S	NA	A0A2H4PQP5	Staphylococcus_phage	35.9	2.7e-45
AUU61931.1|1801285_1802842_-	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	98.5	1.7e-286
>prophage 135
CP026071	Staphylococcus aureus strain NRS143 chromosome, complete genome	2861652	1814329	1814656	2861652	transposase	Staphylococcus_phage(100.0%)	1	NA	NA
AUU62967.1|1814329_1814656_+|transposase	IS3 family transposase	transposase	A0A2H4PQU1	Staphylococcus_phage	85.4	4.3e-11
>prophage 136
CP026071	Staphylococcus aureus strain NRS143 chromosome, complete genome	2861652	1817963	1820996	2861652		Hokovirus(50.0%)	2	NA	NA
AUU61946.1|1817963_1819505_-	GMP synthase (glutamine-hydrolyzing)	NA	A0A1V0SH76	Hokovirus	32.6	1.2e-23
AUU61947.1|1819529_1820996_-	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	40.5	5.2e-96
>prophage 137
CP026071	Staphylococcus aureus strain NRS143 chromosome, complete genome	2861652	1830096	1831620	2861652		Enterococcus_phage(100.0%)	1	NA	NA
AUU61956.1|1830096_1831620_+	alkyl hydroperoxide reductase subunit F	NA	A0A249XZT7	Enterococcus_phage	33.2	5.5e-40
>prophage 138
CP026071	Staphylococcus aureus strain NRS143 chromosome, complete genome	2861652	1840772	1861778	2861652	protease,coat,terminase	Staphylococcus_phage(80.95%)	31	NA	NA
AUU61967.1|1840772_1841285_-	hypothetical protein	NA	Q4ZE83	Staphylococcus_phage	100.0	1.4e-69
AUU61968.1|1841402_1841840_-	DUF3102 domain-containing protein	NA	A0A2H4JAH5	uncultured_Caudovirales_phage	58.2	9.8e-27
AUU61969.1|1841981_1842950_-|protease	CAAX protease	protease	A0A0H4U080	Erysipelothrix_phage	27.3	2.7e-24
AUU61970.1|1843226_1843796_-|terminase	terminase small subunit	terminase	Q4ZE85	Staphylococcus_phage	98.4	4.6e-101
AUU62970.1|1843792_1844005_-	pathogenicity island family protein	NA	Q4ZE86	Staphylococcus_phage	98.6	1.9e-31
AUU61971.1|1844136_1844664_-|coat	spore coat protein	coat	Q4ZE87	Staphylococcus_phage	100.0	6.8e-91
AUU61972.1|1844716_1845370_-	hypothetical protein	NA	Q4ZE82	Staphylococcus_phage	99.5	7.6e-116
AUU61973.1|1845400_1845745_-	pathogenicity island protein	NA	Q4ZE66	Staphylococcus_phage	91.7	1.3e-50
AUU61974.1|1846452_1847094_-	pathogenicity island protein	NA	Q4ZE67	Staphylococcus_phage	92.5	4.7e-110
AUU61975.1|1847090_1847471_-	hypothetical protein	NA	Q4ZE71	Staphylococcus_phage	96.8	1.7e-67
AUU61976.1|1847780_1849490_-	DUF927 domain-containing protein	NA	Q4ZE73	Staphylococcus_phage	92.8	8.2e-303
AUU61977.1|1849503_1850373_-	mobile element-associated protein	NA	Q4ZE74	Staphylococcus_phage	96.2	5.3e-165
AUU61978.1|1850437_1850764_-	DUF1474 domain-containing protein	NA	Q4ZE75	Staphylococcus_phage	96.3	3.5e-53
AUU61979.1|1850764_1851148_-	pathogenicity island protein	NA	A0A1W6JQI7	Staphylococcus_phage	96.1	4.8e-62
AUU61980.1|1851149_1851353_-	pathogenicity island protein	NA	A0A1W6JQF4	Staphylococcus_phage	98.5	2.0e-30
AUU61981.1|1851319_1851493_-	pathogenicity island protein	NA	NA	NA	NA	NA
AUU61982.1|1851504_1851777_-	pathogenicity island protein	NA	Q4ZE77	Staphylococcus_phage	94.4	1.2e-43
AUU62971.1|1851777_1851942_-	DNA-binding protein	NA	NA	NA	NA	NA
AUU61983.1|1852090_1852714_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AUU61984.1|1854202_1854922_+	growth inhibitor PemK	NA	Q4ZE81	Staphylococcus_phage	29.8	3.7e-23
AUU61985.1|1855153_1855396_-	30S ribosomal protein S18	NA	NA	NA	NA	NA
AUU61986.1|1855447_1855951_-	single-stranded DNA-binding protein	NA	A0A1W6JPL9	Staphylococcus_phage	74.7	1.2e-60
AUU61987.1|1855971_1856268_-	30S ribosomal protein S6	NA	NA	NA	NA	NA
AUU61988.1|1856258_1856528_+	hypothetical protein	NA	NA	NA	NA	NA
AUU61989.1|1856511_1856703_+	hypothetical protein	NA	U3PCX8	Staphylococcus_phage	80.0	4.9e-23
AUU61990.1|1856788_1857886_-	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
AUU61991.1|1857897_1858101_-	DUF951 domain-containing protein	NA	NA	NA	NA	NA
AUU61992.1|1858130_1859012_-	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
AUU61993.1|1859165_1860011_-	chromosome partitioning protein ParB	NA	A0A1C9EHW0	Gordonia_phage	34.4	1.6e-12
AUU61994.1|1860128_1860467_-	hypothetical protein	NA	NA	NA	NA	NA
AUU61995.1|1860674_1861778_+	cystathionine gamma-synthase	NA	A0A0B5JD48	Pandoravirus	28.0	3.9e-11
>prophage 139
CP026071	Staphylococcus aureus strain NRS143 chromosome, complete genome	2861652	1871699	1872542	2861652		Anomala_cuprea_entomopoxvirus(100.0%)	1	NA	NA
AUU62003.1|1871699_1872542_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	28.2	4.5e-12
>prophage 140
CP026071	Staphylococcus aureus strain NRS143 chromosome, complete genome	2861652	1893952	1896687	2861652		Bodo_saltans_virus(50.0%)	3	NA	NA
AUU62025.1|1893952_1894975_-	lipoate--protein ligase	NA	A0A2H4UVX5	Bodo_saltans_virus	28.1	6.7e-10
AUU62026.1|1894952_1895897_-	deacetylase SIR2	NA	NA	NA	NA	NA
AUU62027.1|1895886_1896687_-	hypothetical protein	NA	A0A2K9L8X2	Tupanvirus	44.4	1.5e-41
>prophage 141
CP026071	Staphylococcus aureus strain NRS143 chromosome, complete genome	2861652	1900939	1941843	2861652	integrase,protease,tail,portal,holin,head,terminase,capsid	Staphylococcus_phage(86.15%)	67	1917958:1917974	1947398:1947414
AUU62033.1|1900939_1901239_-	hypothetical protein	NA	A7TWL2	Staphylococcus_phage	95.7	9.9e-47
AUU62034.1|1901551_1902307_-	CHAP domain-containing protein	NA	D2JLG5	Staphylococcus_phage	100.0	3.4e-152
AUU62035.1|1902318_1902573_-|holin	phage holin	holin	D2JLG4	Staphylococcus_phage	100.0	4.1e-41
AUU62036.1|1902624_1902732_+	hypothetical protein	NA	NA	NA	NA	NA
AUU62037.1|1902784_1902961_-|holin	putative holin-like toxin	holin	D2JLG3	Staphylococcus_phage	96.6	6.5e-22
AUU62038.1|1903110_1903407_-	DUF2951 domain-containing protein	NA	D2JLG2	Staphylococcus_phage	100.0	2.9e-46
AUU62039.1|1903464_1903752_-	hypothetical protein	NA	D2JLG1	Staphylococcus_phage	100.0	1.3e-43
AUU62040.1|1903798_1903951_-	hypothetical protein	NA	D2JLG0	Staphylococcus_phage	100.0	5.2e-20
AUU62041.1|1903940_1907726_-	hypothetical protein	NA	A0EX05	Staphylococcus_phage	100.0	0.0e+00
AUU62042.1|1907741_1909232_-|tail	phage tail protein	tail	R9QST9	Staphylococcus_phage	98.6	7.9e-294
AUU62043.1|1909231_1913899_-|tail	phage tail tape measure protein	tail	A0A1V0E5H1	Staphylococcus_phage	84.6	0.0e+00
AUU62044.1|1913954_1914077_-	hypothetical protein	NA	D2JLF6	Staphylococcus_phage	97.5	2.6e-14
AUU62045.1|1914136_1914583_-	hypothetical protein	NA	O80053	Staphylococcus_phage	93.2	5.6e-70
AUU62046.1|1914647_1915601_-|tail	phage tail protein	tail	A7TWD0	Staphylococcus_phage	95.0	6.9e-166
AUU62047.1|1915601_1915982_-	hypothetical protein	NA	D2JLF3	Staphylococcus_phage	81.7	8.7e-56
AUU62048.1|1915978_1916356_-	hypothetical protein	NA	D2JLF2	Staphylococcus_phage	86.4	6.2e-54
AUU62049.1|1916355_1916688_-|head,tail	head-tail adaptor protein	head,tail	D2JLF1	Staphylococcus_phage	83.6	3.3e-51
AUU62050.1|1916677_1917010_-|head,tail	phage head-tail adapter protein	head,tail	A7TWQ4	Staphylococcus_phage	80.9	4.6e-45
AUU62051.1|1917018_1917177_-	hypothetical protein	NA	D2JLE9	Staphylococcus_phage	88.5	3.9e-18
AUU62052.1|1917213_1918449_-|capsid	phage major capsid protein	capsid	Q8SDK8	Staphylococcus_phage	79.2	8.6e-169
1917958:1917974	attL	GCTAGGTGCTTTTTTAA	NA	NA	NA	NA
AUU62974.1|1918535_1919120_-|head,protease	HK97 family phage prohead protease	head,protease	D2JLE7	Staphylococcus_phage	95.9	3.0e-103
AUU62975.1|1919538_1920735_-|portal	phage portal protein	portal	D2JLE6	Staphylococcus_phage	87.7	3.8e-198
AUU62053.1|1920797_1921001_-	hypothetical protein	NA	D2JLE5	Staphylococcus_phage	75.4	4.3e-17
AUU62054.1|1921014_1922709_-|terminase	terminase	terminase	D2JLE4	Staphylococcus_phage	90.6	3.4e-301
AUU62055.1|1922708_1923179_-|terminase	phage terminase small subunit P27 family	terminase	D2JLE3	Staphylococcus_phage	93.5	2.6e-78
AUU62056.1|1923272_1923638_-	HNH endonuclease	NA	A0A1J0MFT4	Staphylococcus_phage	72.7	1.5e-49
AUU62057.1|1923644_1924097_-	hypothetical protein	NA	D2JLE1	Staphylococcus_phage	88.0	3.3e-70
AUU62058.1|1924211_1924700_-	hypothetical protein	NA	D2JLE0	Staphylococcus_phage	100.0	3.8e-72
AUU62059.1|1924606_1924819_+	hypothetical protein	NA	NA	NA	NA	NA
AUU62060.1|1924722_1924923_-	DUF1514 domain-containing protein	NA	D2JLD9	Staphylococcus_phage	100.0	1.4e-28
AUU62976.1|1925730_1925880_-	transcriptional regulator	NA	A0A1W6JPZ2	Staphylococcus_phage	98.0	6.3e-18
AUU62061.1|1925879_1926272_-	hypothetical protein	NA	A7TWI1	Staphylococcus_phage	97.7	1.2e-63
AUU62062.1|1926255_1926492_-	hypothetical protein	NA	A0A0N7E0U3	Staphylococcus_phage	100.0	1.3e-36
AUU62063.1|1926488_1926698_-	hypothetical protein	NA	Q4ZBS5	Staphylococcus_virus	98.6	1.7e-29
AUU62064.1|1926672_1926861_-	DUF1381 domain-containing protein	NA	A0A2I6PDV0	Staphylococcus_phage	100.0	2.1e-26
AUU62065.1|1926877_1927051_-	hypothetical protein	NA	A0A2I6PEA8	Staphylococcus_phage	100.0	3.6e-25
AUU62066.1|1927087_1927624_-	dUTPase	NA	A0A1P8L6E0	Staphylococcus_phage	99.4	6.1e-95
AUU62067.1|1927616_1927865_-	DUF1024 domain-containing protein	NA	A7TWB0	Staphylococcus_phage	96.3	1.6e-37
AUU62068.1|1927879_1928128_-	hypothetical protein	NA	A0A2I6PDI0	Staphylococcus_phage	96.3	1.0e-41
AUU62069.1|1928128_1928488_-	hypothetical protein	NA	Q8SDV7	Staphylococcus_phage	99.2	7.7e-62
AUU62070.1|1928499_1928757_-	XRE family transcriptional regulator	NA	Q4ZBU1	Staphylococcus_virus	100.0	4.1e-41
AUU62071.1|1928757_1928943_-	hypothetical protein	NA	Q8SDV9	Staphylococcus_phage	100.0	2.4e-27
AUU62072.1|1928947_1929352_-	DUF1064 domain-containing protein	NA	A0A059T5A5	Staphylococcus_phage	97.0	3.5e-71
AUU62073.1|1929362_1929584_-	hypothetical protein	NA	Q4ZA48	Staphylococcus_virus	98.6	4.9e-35
AUU62074.1|1929586_1929802_-	hypothetical protein	NA	Q4ZBU5	Staphylococcus_virus	98.6	1.8e-34
AUU62075.1|1929798_1931040_-	damage-inducible protein	NA	Q4ZCW6	Staphylococcus_virus	99.8	5.7e-229
AUU62076.1|1931036_1931393_-	hypothetical protein	NA	B7T0A8	Staphylococcus_virus	97.5	2.2e-61
AUU62077.1|1931392_1932211_-	DnaD domain protein	NA	Q8SDW2	Staphylococcus_phage	98.5	1.2e-105
AUU62078.1|1932182_1932875_-	hypothetical protein	NA	Q4ZAZ0	Staphylococcus_virus	98.7	6.8e-131
AUU62977.1|1932887_1933388_-	single-strand DNA-binding protein	NA	A7TWM8	Staphylococcus_phage	100.0	7.2e-90
AUU62079.1|1933471_1934251_-	chromosomal replication initiator DnaA	NA	Q8SDW5	Staphylococcus_phage	100.0	2.5e-142
AUU62080.1|1934251_1934788_-	hypothetical protein	NA	A0A2I6PD93	Staphylococcus_phage	100.0	1.7e-81
AUU62081.1|1934800_1935121_-	hypothetical protein	NA	Q8SDW6	Staphylococcus_phage	97.2	2.5e-51
AUU62082.1|1935041_1935371_-	hypothetical protein	NA	D2JGJ7	Staphylococcus_phage	100.0	1.4e-33
AUU62083.1|1935463_1935625_-	DUF1270 domain-containing protein	NA	A7TWM3	Staphylococcus_phage	100.0	8.6e-21
AUU62084.1|1935637_1935901_-	helix-turn-helix domain-containing protein	NA	A7TWG0	Staphylococcus_phage	100.0	5.7e-46
AUU62085.1|1935925_1936141_-	hypothetical protein	NA	A0A2I6PF01	Staphylococcus_phage	100.0	1.9e-31
AUU62086.1|1936195_1936561_+	hypothetical protein	NA	A0A2I6PF07	Staphylococcus_phage	100.0	2.4e-63
AUU62087.1|1936529_1936775_-	DUF2829 domain-containing protein	NA	A0A2I6PF15	Staphylococcus_phage	100.0	5.1e-41
AUU62088.1|1936814_1937039_-	hypothetical protein	NA	A0A0F6N4M2	Staphylococcus_phage	100.0	3.2e-34
AUU62089.1|1937039_1937819_-	phage antirepressor	NA	M1RZB2	Staphylococcus_phage	98.0	5.8e-139
AUU62090.1|1937975_1938284_-	hypothetical protein	NA	S4V9P0	Staphylococcus_phage	100.0	1.3e-49
AUU62091.1|1938298_1938517_-	XRE family transcriptional regulator	NA	Q8SDX1	Staphylococcus_phage	100.0	2.9e-35
AUU62092.1|1938658_1939378_+	XRE family transcriptional regulator	NA	Q8SDX2	Staphylococcus_phage	100.0	9.8e-133
AUU62093.1|1939576_1939759_+	hypothetical protein	NA	A0A2I6PDR4	Staphylococcus_phage	100.0	5.3e-27
AUU62094.1|1939904_1940528_-	hypothetical protein	NA	B7T0F3	Staphylococcus_virus	100.0	2.0e-105
AUU62095.1|1940637_1941843_+|integrase	site-specific integrase	integrase	A7YGM7	Staphylococcus_virus	99.8	2.9e-222
1947398:1947414	attR	GCTAGGTGCTTTTTTAA	NA	NA	NA	NA
>prophage 142
CP026071	Staphylococcus aureus strain NRS143 chromosome, complete genome	2861652	1956016	1956694	2861652		Planktothrix_phage(100.0%)	1	NA	NA
AUU62108.1|1956016_1956694_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	39.4	1.2e-31
>prophage 143
CP026071	Staphylococcus aureus strain NRS143 chromosome, complete genome	2861652	1970746	1975195	2861652		Mycobacterium_phage(100.0%)	1	NA	NA
AUU62127.1|1970746_1975195_-	protein EssC	NA	V5UPA0	Mycobacterium_phage	23.7	1.7e-28
>prophage 144
CP026071	Staphylococcus aureus strain NRS143 chromosome, complete genome	2861652	1985799	1987461	2861652		Staphylococcus_phage(50.0%)	2	NA	NA
AUU62137.1|1985799_1986459_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	32.0	5.8e-23
AUU62138.1|1986510_1987461_-	glycine-glycine endopeptidase LytM	NA	V5R8R0	Arthrobacter_phage	42.7	1.5e-16
>prophage 145
CP026071	Staphylococcus aureus strain NRS143 chromosome, complete genome	2861652	1996268	1997705	2861652		Pandoravirus(100.0%)	1	NA	NA
AUU62148.1|1996268_1997705_-	6-phospho-beta-glucosidase	NA	A0A0B5JD41	Pandoravirus	26.0	1.3e-30
>prophage 146
CP026071	Staphylococcus aureus strain NRS143 chromosome, complete genome	2861652	2004213	2008757	2861652		Enterobacteria_phage(50.0%)	3	NA	NA
AUU62156.1|2004213_2005953_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	31.5	2.0e-62
AUU62157.1|2006218_2006893_-	iron-sulfur cluster repair di-iron protein ScdA	NA	NA	NA	NA	NA
AUU62158.1|2007032_2008757_-	glycosyltransferase family 2 protein	NA	A0A1V0SAH6	Catovirus	37.4	2.1e-11
>prophage 147
CP026071	Staphylococcus aureus strain NRS143 chromosome, complete genome	2861652	2026885	2028415	2861652		Vibrio_phage(100.0%)	1	NA	NA
AUU62172.1|2026885_2028415_+	PTS glucose transporter subunit IIB	NA	A0A2I7SAJ6	Vibrio_phage	52.0	5.3e-11
>prophage 148
CP026071	Staphylococcus aureus strain NRS143 chromosome, complete genome	2861652	2038100	2039606	2861652		Staphylococcus_phage(100.0%)	1	NA	NA
AUU62183.1|2038100_2039606_+	long-chain fatty acid--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	25.9	6.0e-39
>prophage 149
CP026071	Staphylococcus aureus strain NRS143 chromosome, complete genome	2861652	2050567	2055926	2861652		Tetraselmis_virus(50.0%)	3	NA	NA
AUU62192.1|2050567_2052817_-	formate acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	45.1	1.7e-186
AUU62193.1|2053404_2054373_+	iron ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUU62194.1|2054369_2055926_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	27.2	5.8e-13
>prophage 150
CP026071	Staphylococcus aureus strain NRS143 chromosome, complete genome	2861652	2066237	2068296	2861652		Planktothrix_phage(50.0%)	2	NA	NA
AUU62204.1|2066237_2067335_-	sugar ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.6	1.4e-24
AUU62205.1|2067717_2068296_-	M23 family peptidase	NA	A0A2K9VGT1	Pontimonas_phage	43.0	1.6e-13
>prophage 151
CP026071	Staphylococcus aureus strain NRS143 chromosome, complete genome	2861652	2076107	2077700	2861652		Planktothrix_phage(100.0%)	1	NA	NA
AUU62211.1|2076107_2077700_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	33.6	5.4e-22
>prophage 152
CP026071	Staphylococcus aureus strain NRS143 chromosome, complete genome	2861652	2093792	2094977	2861652		Klosneuvirus(100.0%)	1	NA	NA
AUU62223.1|2093792_2094977_+	ornithine aminotransferase 1	NA	A0A1V0SKB7	Klosneuvirus	29.6	2.4e-35
>prophage 153
CP026071	Staphylococcus aureus strain NRS143 chromosome, complete genome	2861652	2099835	2110119	2861652		Tupanvirus(50.0%)	3	NA	NA
AUU62983.1|2099835_2107011_-	non-ribosomal peptide synthetase	NA	A0A2K9KZV5	Tupanvirus	29.9	3.4e-68
AUU62228.1|2107457_2108708_-	MFS transporter	NA	NA	NA	NA	NA
AUU62984.1|2109093_2110119_-	formate dehydrogenase	NA	A0A1V0SBV6	Catovirus	33.9	2.9e-29
>prophage 154
CP026071	Staphylococcus aureus strain NRS143 chromosome, complete genome	2861652	2113655	2116654	2861652		Bacillus_virus(50.0%)	4	NA	NA
AUU62233.1|2113655_2114396_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	40.6	6.5e-39
AUU62234.1|2114737_2115250_-	DUF4242 domain-containing protein	NA	NA	NA	NA	NA
AUU62235.1|2115429_2115633_+	hypothetical protein	NA	NA	NA	NA	NA
AUU62236.1|2115694_2116654_-	cation transporter	NA	A0A1V0SED0	Indivirus	33.6	2.8e-10
>prophage 155
CP026071	Staphylococcus aureus strain NRS143 chromosome, complete genome	2861652	2119995	2122480	2861652		Catovirus(50.0%)	2	NA	NA
AUU62240.1|2119995_2121141_-	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SAG5	Catovirus	26.4	3.2e-24
AUU62241.1|2121217_2122480_-	nucleotide sugar dehydrogenase	NA	A0A127AXI2	Bacillus_phage	24.8	4.3e-22
>prophage 156
CP026071	Staphylococcus aureus strain NRS143 chromosome, complete genome	2861652	2129497	2136062	2861652		Catovirus(50.0%)	6	NA	NA
AUU62249.1|2129497_2130622_-	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SJE0	Klosneuvirus	59.6	3.9e-128
AUU62250.1|2130625_2131735_-	capsular biosynthesis protein	NA	NA	NA	NA	NA
AUU62251.1|2131747_2132776_-	KR domain-containing protein	NA	A0A1V0SAI8	Catovirus	35.3	1.1e-41
AUU62252.1|2132765_2134589_-	hypothetical protein	NA	A0A1V0SAI8	Catovirus	29.4	3.0e-29
AUU62253.1|2134608_2135373_-	capsular biosynthesis protein	NA	NA	NA	NA	NA
AUU62254.1|2135375_2136062_-	capsular biosynthesis protein	NA	A0A1X9I5D6	Streptococcus_phage	36.1	8.2e-28
>prophage 157
CP026071	Staphylococcus aureus strain NRS143 chromosome, complete genome	2861652	2140085	2141261	2861652		Clostridium_phage(100.0%)	1	NA	NA
AUU62257.1|2140085_2141261_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A0A7RTT7	Clostridium_phage	27.9	5.2e-30
>prophage 158
CP026071	Staphylococcus aureus strain NRS143 chromosome, complete genome	2861652	2146719	2147493	2861652		Staphylococcus_phage(100.0%)	1	NA	NA
AUU62262.1|2146719_2147493_+	phosphonates import ATP-binding protein PhnC	NA	A0A2H4PQG7	Staphylococcus_phage	26.1	6.4e-13
>prophage 159
CP026071	Staphylococcus aureus strain NRS143 chromosome, complete genome	2861652	2155379	2155979	2861652		Bacillus_thuringiensis_phage(100.0%)	1	NA	NA
AUU62271.1|2155379_2155979_-	Superoxide dismutase [Mn/Fe] 2	NA	Q56AR7	Bacillus_thuringiensis_phage	50.2	7.6e-54
>prophage 160
CP026071	Staphylococcus aureus strain NRS143 chromosome, complete genome	2861652	2160913	2166008	2861652		Catovirus(50.0%)	6	NA	NA
AUU62276.1|2160913_2161894_-	NAD-dependent dehydratase	NA	A0A1V0SAI6	Catovirus	37.3	1.3e-47
AUU62277.1|2162228_2163005_-	diacetyl reductase ((S)-acetoin forming)	NA	NA	NA	NA	NA
AUU62278.1|2163215_2163842_-	MFS transporter	NA	NA	NA	NA	NA
AUU62279.1|2163908_2164100_+	hypothetical protein	NA	NA	NA	NA	NA
AUU62280.1|2164037_2164802_-	siderophore biosynthesis protein SbnI	NA	NA	NA	NA	NA
AUU62281.1|2164805_2166008_-	siderophore biosynthesis PLP-dependent protein	NA	A0A2K9L4I2	Tupanvirus	21.3	5.1e-09
>prophage 161
CP026071	Staphylococcus aureus strain NRS143 chromosome, complete genome	2861652	2174274	2178484	2861652		Lactococcus_phage(50.0%)	4	NA	NA
AUU62288.1|2174274_2175255_-	siderophore biosynthesis protein SbnA	NA	A0A1W6JHY1	Lactococcus_phage	35.6	2.1e-40
AUU62289.1|2175485_2176478_+	iron-siderophore ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUU62290.1|2176493_2177489_+	iron ABC transporter permease	NA	NA	NA	NA	NA
AUU62291.1|2177485_2178484_+	iron ABC transporter permease	NA	A0A2H4IY97	uncultured_Caudovirales_phage	27.2	2.6e-14
>prophage 162
CP026071	Staphylococcus aureus strain NRS143 chromosome, complete genome	2861652	2210555	2215890	2861652	transposase	Acidithiobacillus_phage(33.33%)	5	NA	NA
AUU62313.1|2210555_2212256_-	AAA family ATPase	NA	K4I1H4	Acidithiobacillus_phage	26.8	4.1e-20
AUU62990.1|2212545_2212920_-	hypothetical protein	NA	NA	NA	NA	NA
AUU62314.1|2213105_2214053_+|transposase	IS30 family transposase ISSau1	transposase	Q9MBM9	Staphylococcus_prophage	100.0	1.1e-184
AUU62315.1|2214057_2214573_-	hypothetical protein	NA	NA	NA	NA	NA
AUU62991.1|2214760_2215890_-	DDE domain-containing protein	NA	A0A2I7SC85	Paenibacillus_phage	54.0	6.4e-78
>prophage 163
CP026071	Staphylococcus aureus strain NRS143 chromosome, complete genome	2861652	2221770	2231766	2861652		Bacillus_phage(40.0%)	8	NA	NA
AUU62319.1|2221770_2222571_-	MBL fold metallo-hydrolase	NA	A0A0C5AJ83	Bacteriophage	35.9	1.0e-37
AUU62320.1|2222958_2223747_-	hypothetical protein	NA	NA	NA	NA	NA
AUU62321.1|2223747_2225082_-	hypothetical protein	NA	NA	NA	NA	NA
AUU62322.1|2225074_2226901_-	cell wall metabolism sensor histidine kinase WalK	NA	W8CYF6	Bacillus_phage	31.3	2.8e-30
AUU62323.1|2226913_2227615_-	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	39.2	3.5e-42
AUU62324.1|2228804_2230088_-	adenylosuccinate synthetase	NA	L7Y4J5	Megavirus	34.6	1.8e-68
AUU62325.1|2230088_2230316_+	hypothetical protein	NA	NA	NA	NA	NA
AUU62326.1|2230365_2231766_-	replicative DNA helicase	NA	A0A1P8VVQ6	Streptococcus_phage	48.1	5.4e-111
>prophage 164
CP026071	Staphylococcus aureus strain NRS143 chromosome, complete genome	2861652	2238448	2247484	2861652	tRNA	Bacillus_virus(50.0%)	6	NA	NA
AUU62333.1|2238448_2239735_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	51.2	2.7e-88
AUU62334.1|2239724_2239913_+	hypothetical protein	NA	NA	NA	NA	NA
AUU62335.1|2240112_2241627_-	histidine ammonia-lyase	NA	A0A1V0S940	Catovirus	38.4	4.4e-90
AUU62336.1|2241952_2242765_+	NAD(P)H-hydrate dehydratase	NA	NA	NA	NA	NA
AUU62337.1|2242852_2245513_-	DNA gyrase subunit A	NA	G3M9Z5	Bacillus_virus	35.8	4.6e-119
AUU62338.1|2245549_2247484_-	DNA gyrase subunit B	NA	G3M9Z3	Bacillus_virus	44.9	4.4e-143
>prophage 165
CP026071	Staphylococcus aureus strain NRS143 chromosome, complete genome	2861652	2257571	2260871	2861652		Faecalibacterium_phage(33.33%)	5	NA	NA
AUU62348.1|2257571_2258411_+	nucleoid occlusion protein	NA	A0A2K9V477	Faecalibacterium_phage	23.4	1.4e-05
AUU62349.1|2258905_2259259_+	DUF3147 domain-containing protein	NA	NA	NA	NA	NA
AUU62350.1|2259326_2259722_+	DUF3147 domain-containing protein	NA	NA	NA	NA	NA
AUU62351.1|2259974_2260544_+	XRE family transcriptional regulator	NA	D2XQ11	Bacillus_virus	34.8	2.8e-05
AUU62352.1|2260670_2260871_-	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	69.8	3.4e-19
>prophage 166
CP026071	Staphylococcus aureus strain NRS143 chromosome, complete genome	2861652	2266664	2267423	2861652		Planktothrix_phage(100.0%)	1	NA	NA
AUU62358.1|2266664_2267423_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	39.5	9.0e-36
>prophage 167
CP026071	Staphylococcus aureus strain NRS143 chromosome, complete genome	2861652	2284566	2286279	2861652		Planktothrix_phage(100.0%)	1	NA	NA
AUU62373.1|2284566_2286279_+	heme ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.0	5.4e-20
>prophage 168
CP026071	Staphylococcus aureus strain NRS143 chromosome, complete genome	2861652	2291907	2292921	2861652		Faustovirus(100.0%)	1	NA	NA
AUU62379.1|2291907_2292921_+	histidinol-phosphate aminotransferase family protein	NA	A0A1X7QHI1	Faustovirus	22.2	8.2e-08
>prophage 169
CP026071	Staphylococcus aureus strain NRS143 chromosome, complete genome	2861652	2305311	2306004	2861652		Streptococcus_phage(100.0%)	1	NA	NA
AUU62392.1|2305311_2306004_+	capsular biosynthesis protein	NA	A0A1X9I5D6	Streptococcus_phage	38.0	2.2e-28
>prophage 170
CP026071	Staphylococcus aureus strain NRS143 chromosome, complete genome	2861652	2329879	2331739	2861652		Enterococcus_phage(100.0%)	1	NA	NA
AUU62412.1|2329879_2331739_-	CHAP domain-containing protein	NA	A0A249Y0X5	Enterococcus_phage	37.3	9.7e-15
>prophage 171
CP026071	Staphylococcus aureus strain NRS143 chromosome, complete genome	2861652	2357432	2359183	2861652		Ectocarpus_siliculosus_virus(50.0%)	2	NA	NA
AUU62433.1|2357432_2358320_+	sensor histidine kinase	NA	Q8QNA2	Ectocarpus_siliculosus_virus	22.5	7.4e-05
AUU62434.1|2358427_2359183_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.9	1.8e-31
>prophage 172
CP026071	Staphylococcus aureus strain NRS143 chromosome, complete genome	2861652	2362620	2363118	2861652		Canarypox_virus(100.0%)	1	NA	NA
AUU62439.1|2362620_2363118_+	glutathione peroxidase	NA	Q6VZR0	Canarypox_virus	33.1	2.4e-21
>prophage 173
CP026071	Staphylococcus aureus strain NRS143 chromosome, complete genome	2861652	2368168	2370552	2861652		Enterococcus_phage(100.0%)	2	NA	NA
AUU62445.1|2368168_2370019_+	anaerobic ribonucleoside-triphosphate reductase	NA	A0A0C5KKX3	Enterococcus_phage	63.9	1.3e-234
AUU62446.1|2370015_2370552_+	anaerobic ribonucleoside-triphosphate reductase activating protein	NA	A0A288TZV3	Enterococcus_phage	47.5	1.1e-40
>prophage 174
CP026071	Staphylococcus aureus strain NRS143 chromosome, complete genome	2861652	2375428	2385539	2861652	holin	Klosneuvirus(50.0%)	9	NA	NA
AUU62452.1|2375428_2377138_+|holin	oxygen-dependent choline dehydrogenase	holin	A0A1V0SI18	Klosneuvirus	32.3	3.8e-58
AUU62453.1|2377415_2377628_+	hypothetical protein	NA	NA	NA	NA	NA
AUU62454.1|2377907_2378351_+	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
AUU62455.1|2378544_2380143_+	acyl--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	36.6	2.6e-77
AUU62456.1|2380202_2380403_-	hypothetical protein	NA	NA	NA	NA	NA
AUU62457.1|2380829_2382326_+	malate:quinone oxidoreductase	NA	NA	NA	NA	NA
AUU62458.1|2382518_2383409_-	class I fructose-bisphosphate aldolase	NA	A0A0K0KVJ8	Prochlorococcus_phage	29.2	1.2e-07
AUU62459.1|2383531_2383948_-	hypothetical protein	NA	NA	NA	NA	NA
AUU62460.1|2384201_2385539_+	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	26.7	6.7e-18
>prophage 175
CP026071	Staphylococcus aureus strain NRS143 chromosome, complete genome	2861652	2413694	2416894	2861652		Staphylococcus_phage(50.0%)	2	NA	NA
AUU62490.1|2413694_2414396_+	transglycosylase IsaA	NA	Q4Z8Z7	Staphylococcus_phage	46.8	2.1e-39
AUU62491.1|2415082_2416894_+	O-acetyltransferase OatA	NA	A0A1R3Y5Q6	Salmonella_virus	31.5	1.3e-35
>prophage 176
CP026071	Staphylococcus aureus strain NRS143 chromosome, complete genome	2861652	2425333	2429719	2861652		Acanthocystis_turfacea_Chlorella_virus(50.0%)	3	NA	NA
AUU62498.1|2425333_2426332_+	lactate dehydrogenase	NA	M1HKI4	Acanthocystis_turfacea_Chlorella_virus	30.2	2.6e-35
AUU62499.1|2426421_2426628_-	copper resistance protein CopZ	NA	NA	NA	NA	NA
AUU62500.1|2427310_2429719_-	copper-exporting P-type ATPase A	NA	A0A218MNH6	uncultured_virus	40.8	2.9e-128
>prophage 177
CP026071	Staphylococcus aureus strain NRS143 chromosome, complete genome	2861652	2438960	2441950	2861652	protease	Enterobacteria_phage(50.0%)	2	NA	NA
AUU62509.1|2438960_2441066_-|protease	ATP-dependent Clp protease ATP-binding subunit	protease	H6X3M6	Enterobacteria_phage	37.5	6.9e-118
AUU62510.1|2441428_2441950_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	42.3	2.4e-27
>prophage 178
CP026071	Staphylococcus aureus strain NRS143 chromosome, complete genome	2861652	2448374	2454757	2861652		Yellowstone_lake_phycodnavirus(33.33%)	5	NA	NA
AUU62517.1|2448374_2450114_+	pyruvate oxidase	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	24.1	6.0e-35
AUU62518.1|2450413_2452480_+	PTS glucoside EIICBA component	NA	A0A2I7SAJ6	Vibrio_phage	43.3	8.3e-07
AUU62519.1|2452859_2453270_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
AUU62520.1|2453311_2453668_+	thioredoxin	NA	NA	NA	NA	NA
AUU62521.1|2453788_2454757_+	alpha/beta hydrolase	NA	A0A167RJ59	Powai_lake_megavirus	26.5	3.1e-12
>prophage 179
CP026071	Staphylococcus aureus strain NRS143 chromosome, complete genome	2861652	2463581	2464574	2861652		Acanthocystis_turfacea_Chlorella_virus(100.0%)	1	NA	NA
AUU62531.1|2463581_2464574_-	lactate dehydrogenase	NA	M1HKI4	Acanthocystis_turfacea_Chlorella_virus	32.7	9.7e-38
>prophage 180
CP026071	Staphylococcus aureus strain NRS143 chromosome, complete genome	2861652	2473990	2474686	2861652		Staphylococcus_phage(100.0%)	1	NA	NA
AUU62540.1|2473990_2474686_-	lantibiotic ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	37.6	2.0e-37
>prophage 181
CP026071	Staphylococcus aureus strain NRS143 chromosome, complete genome	2861652	2493144	2502124	2861652	transposase	Bacillus_phage(50.0%)	7	NA	NA
AUU62552.1|2493144_2494711_+|transposase	IS3-like element ISSau2 family transposase	transposase	A0A0C5AEA5	Paenibacillus_phage	51.8	1.0e-49
AUU62553.1|2494948_2495815_+	UTP--glucose-1-phosphate uridylyltransferase	NA	A0A127AW70	Bacillus_phage	52.6	4.4e-79
AUU62554.1|2495941_2496250_-	hypothetical protein	NA	NA	NA	NA	NA
AUU62555.1|2496393_2496660_-	hypothetical protein	NA	NA	NA	NA	NA
AUU62556.1|2496943_2498752_-	phospho-sugar mutase	NA	A0A1X9I671	Streptococcus_phage	37.5	1.0e-93
AUU62557.1|2498868_2499261_+	(deoxy)nucleoside triphosphate pyrophosphohydrolase	NA	NA	NA	NA	NA
AUU62558.1|2499262_2502124_+	DUF3427 domain-containing protein	NA	Q5YA94	Bacillus_phage	27.9	1.2e-27
>prophage 182
CP026071	Staphylococcus aureus strain NRS143 chromosome, complete genome	2861652	2512940	2513759	2861652		Acanthamoeba_polyphaga_moumouvirus(100.0%)	1	NA	NA
AUU62570.1|2512940_2513759_+	short-chain dehydrogenase	NA	L7RG25	Acanthamoeba_polyphaga_moumouvirus	26.8	1.9e-10
>prophage 183
CP026071	Staphylococcus aureus strain NRS143 chromosome, complete genome	2861652	2521824	2523382	2861652		Planktothrix_phage(50.0%)	2	NA	NA
AUU62578.1|2521824_2522640_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.8	6.1e-14
AUU62579.1|2522632_2523382_+	peptide ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.2	8.1e-21
>prophage 184
CP026071	Staphylococcus aureus strain NRS143 chromosome, complete genome	2861652	2529615	2534042	2861652		Bacillus_phage(50.0%)	4	NA	NA
AUU62585.1|2529615_2530278_+	methionine ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	34.5	2.2e-17
AUU62586.1|2530270_2531047_+	iron export ABC transporter permease subunit FetB	NA	NA	NA	NA	NA
AUU62587.1|2531440_2532628_+	MFS transporter	NA	NA	NA	NA	NA
AUU62588.1|2532689_2534042_-	carboxylesterase/lipase family protein	NA	A0A0B5J865	Pandoravirus	34.2	3.0e-13
>prophage 185
CP026071	Staphylococcus aureus strain NRS143 chromosome, complete genome	2861652	2537435	2538662	2861652		Mycoplasma_phage(100.0%)	1	NA	NA
AUU62592.1|2537435_2538662_+	osmoprotectant	NA	Q6GZ03	Mycoplasma_phage	50.5	6.6e-20
>prophage 186
CP026071	Staphylococcus aureus strain NRS143 chromosome, complete genome	2861652	2557038	2563245	2861652		Bacillus_phage(66.67%)	6	NA	NA
AUU62610.1|2557038_2558181_-	glycerate kinase	NA	W6LM47	Streptococcus_phage	43.9	2.6e-55
AUU62611.1|2558448_2558835_+	GtrA family protein	NA	NA	NA	NA	NA
AUU62612.1|2558968_2559076_+	hypothetical protein	NA	NA	NA	NA	NA
AUU62613.1|2559102_2559210_+	hypothetical protein	NA	NA	NA	NA	NA
AUU62614.1|2559723_2561487_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	24.7	1.6e-35
AUU62615.1|2561511_2563245_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	25.7	1.5e-30
>prophage 187
CP026071	Staphylococcus aureus strain NRS143 chromosome, complete genome	2861652	2566706	2572460	2861652		Staphylococcus_phage(75.0%)	6	NA	NA
AUU62620.1|2566706_2567822_+	8-amino-7-oxononanoate synthase	NA	V5LQ39	Emiliania_huxleyi_virus	24.9	7.1e-21
AUU62621.1|2567832_2568525_+	6-carboxyhexanoate--CoA ligase	NA	NA	NA	NA	NA
AUU62622.1|2568535_2569003_+	hypothetical protein	NA	NA	NA	NA	NA
AUU62623.1|2569054_2570032_-	bi-component gamma-hemolysin HlgAB/HlgCB subunit B	NA	A0A2H4PQH7	Staphylococcus_phage	76.2	2.4e-142
AUU62624.1|2570033_2570981_-	bi-component gamma-hemolysin HlgCB subunit C	NA	A0A2I6PER8	Staphylococcus_phage	77.5	2.1e-138
AUU62625.1|2571530_2572460_-	bi-component gamma-hemolysin HlgAB subunit A	NA	A0A2H4PQI5	Staphylococcus_phage	71.4	1.5e-120
>prophage 188
CP026071	Staphylococcus aureus strain NRS143 chromosome, complete genome	2861652	2580353	2581085	2861652		Bacillus_virus(100.0%)	1	NA	NA
AUU62635.1|2580353_2581085_+	amino acid ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	34.3	1.3e-23
>prophage 189
CP026071	Staphylococcus aureus strain NRS143 chromosome, complete genome	2861652	2597948	2599508	2861652		Escherichia_phage(100.0%)	1	NA	NA
AUU62651.1|2597948_2599508_+	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	46.8	3.4e-21
>prophage 190
CP026071	Staphylococcus aureus strain NRS143 chromosome, complete genome	2861652	2610238	2611885	2861652	transposase	Staphylococcus_virus(100.0%)	1	NA	NA
AUU62663.1|2610238_2611885_+|transposase	IS1182 family transposase ISSau3	transposase	A0ZS58	Staphylococcus_virus	100.0	3.5e-295
>prophage 191
CP026071	Staphylococcus aureus strain NRS143 chromosome, complete genome	2861652	2622826	2623861	2861652		Bacillus_virus(100.0%)	1	NA	NA
AUU62675.1|2622826_2623861_+	thioredoxin reductase	NA	G3MA85	Bacillus_virus	26.2	1.7e-16
>prophage 192
CP026071	Staphylococcus aureus strain NRS143 chromosome, complete genome	2861652	2634324	2640881	2861652		Staphylococcus_phage(25.0%)	8	NA	NA
AUU62682.1|2634324_2635053_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	33.2	6.7e-28
AUU62683.1|2635186_2635750_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
AUU62684.1|2635926_2636382_-	DUF3021 domain-containing protein	NA	NA	NA	NA	NA
AUU62685.1|2636378_2636822_-	LytTR family transcriptional regulator	NA	NA	NA	NA	NA
AUU62686.1|2636984_2638358_-	two-component sensor histidine kinase	NA	A0A1V0SGX0	Hokovirus	29.3	1.1e-12
AUU62687.1|2638350_2639025_-	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	44.7	8.0e-52
AUU62688.1|2639160_2640216_+	heme ABC transporter permease	NA	NA	NA	NA	NA
AUU62689.1|2640215_2640881_+	hemin ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	40.3	7.2e-37
>prophage 193
CP026071	Staphylococcus aureus strain NRS143 chromosome, complete genome	2861652	2644618	2645827	2861652		Salmonella_phage(100.0%)	1	NA	NA
AUU62693.1|2644618_2645827_+	Bcr/CflA family drug resistance efflux transporter	NA	S4TR35	Salmonella_phage	26.5	3.0e-33
>prophage 194
CP026071	Staphylococcus aureus strain NRS143 chromosome, complete genome	2861652	2658483	2659383	2861652		Brazilian_cedratvirus(100.0%)	1	NA	NA
AUU62706.1|2658483_2659383_+	DUF4162 domain-containing protein	NA	A0A2R8FG22	Brazilian_cedratvirus	28.2	2.7e-15
>prophage 195
CP026071	Staphylococcus aureus strain NRS143 chromosome, complete genome	2861652	2666740	2667160	2861652		Bacillus_phage(100.0%)	1	NA	NA
AUU62715.1|2666740_2667160_-	metallothiol transferase FosB	NA	Q2LI91	Bacillus_phage	61.9	7.7e-37
>prophage 196
CP026071	Staphylococcus aureus strain NRS143 chromosome, complete genome	2861652	2672851	2673733	2861652		Diadromus_pulchellus_ascovirus(100.0%)	1	NA	NA
AUU62719.1|2672851_2673733_+	KR domain-containing protein	NA	F2NZ40	Diadromus_pulchellus_ascovirus	46.3	1.7e-62
>prophage 197
CP026071	Staphylococcus aureus strain NRS143 chromosome, complete genome	2861652	2681612	2682248	2861652		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
AUU62726.1|2681612_2682248_+	HAD family hydrolase	NA	A7J6N1	Paramecium_bursaria_Chlorella_virus	27.6	7.1e-10
>prophage 198
CP026071	Staphylococcus aureus strain NRS143 chromosome, complete genome	2861652	2690684	2692251	2861652	transposase	Paenibacillus_phage(100.0%)	1	NA	NA
AUU62736.1|2690684_2692251_+|transposase	IS3-like element ISSau2 family transposase	transposase	A0A0C5AEA5	Paenibacillus_phage	51.8	1.0e-49
>prophage 199
CP026071	Staphylococcus aureus strain NRS143 chromosome, complete genome	2861652	2696915	2701182	2861652		Staphylococcus_phage(50.0%)	5	NA	NA
AUU63011.1|2696915_2697554_+	autolysin	NA	A0A1W6JQU5	Staphylococcus_phage	47.4	4.5e-36
AUU62740.1|2697862_2698090_+	hypothetical protein	NA	NA	NA	NA	NA
AUU62741.1|2698162_2699287_+	hypothetical protein	NA	A0A2K9L3K5	Tupanvirus	22.8	1.6e-12
AUU62742.1|2699378_2700332_-	hydroxyacid dehydrogenase	NA	A0A1V0SBV6	Catovirus	29.2	5.8e-32
AUU62743.1|2700690_2701182_-	CHAP domain-containing protein	NA	A0A2R3ZXQ4	Staphylococcus_phage	39.3	2.0e-07
>prophage 200
CP026071	Staphylococcus aureus strain NRS143 chromosome, complete genome	2861652	2705102	2705912	2861652		Staphylococcus_phage(100.0%)	1	NA	NA
AUU62747.1|2705102_2705912_-	CHAP domain-containing protein	NA	A0A2R3ZXQ4	Staphylococcus_phage	41.3	9.4e-07
>prophage 201
CP026071	Staphylococcus aureus strain NRS143 chromosome, complete genome	2861652	2724885	2725491	2861652		Pithovirus(100.0%)	1	NA	NA
AUU62768.1|2724885_2725491_+	molybdenum ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	30.6	3.8e-13
>prophage 202
CP026071	Staphylococcus aureus strain NRS143 chromosome, complete genome	2861652	2737458	2740626	2861652		Leptospira_phage(100.0%)	1	NA	NA
AUU62786.1|2737458_2740626_+	multidrug transporter	NA	S5VTK5	Leptospira_phage	22.0	4.3e-63
>prophage 203
CP026071	Staphylococcus aureus strain NRS143 chromosome, complete genome	2861652	2763805	2767415	2861652	transposase	Paenibacillus_phage(33.33%)	3	NA	NA
AUU62825.1|2763805_2765373_-|transposase	IS3-like element ISSau2 family transposase	transposase	A0A0C5AEA5	Paenibacillus_phage	51.8	1.0e-49
AUU62826.1|2765748_2766558_+	energy-coupling factor transporter ATPase	NA	G9BWD6	Planktothrix_phage	30.8	1.4e-18
AUU62827.1|2766554_2767415_+	energy-coupling factor transporter ATPase	NA	A0A2H4PQG7	Staphylococcus_phage	23.9	7.4e-10
>prophage 204
CP026071	Staphylococcus aureus strain NRS143 chromosome, complete genome	2861652	2770456	2779019	2861652		Mycobacterium_phage(33.33%)	8	NA	NA
AUU62832.1|2770456_2771893_+	ATP-dependent DNA helicase RecG	NA	A0A088F7M4	Mycobacterium_phage	31.2	5.5e-58
AUU62833.1|2772141_2772321_+	hypothetical protein	NA	NA	NA	NA	NA
AUU62834.1|2772970_2773153_+	hypothetical protein	NA	NA	NA	NA	NA
AUU62835.1|2773622_2775287_+	acetolactate synthase AlsS	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	25.9	4.7e-45
AUU62836.1|2775323_2776028_+	acetolactate decarboxylase	NA	NA	NA	NA	NA
AUU62837.1|2776418_2776844_-	MAP domain-containing protein	NA	NA	NA	NA	NA
AUU62838.1|2777138_2777954_+	hydrolase	NA	NA	NA	NA	NA
AUU62839.1|2778164_2779019_+	M23 family peptidase	NA	E5G070	Clostridium_phage	34.8	1.3e-06
>prophage 205
CP026071	Staphylococcus aureus strain NRS143 chromosome, complete genome	2861652	2782397	2785460	2861652		Staphylococcus_phage(50.0%)	5	NA	NA
AUU62843.1|2782397_2783246_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	38.4	1.3e-43
AUU62844.1|2783466_2783592_+	hypothetical protein	NA	NA	NA	NA	NA
AUU62845.1|2783546_2783840_+	hypothetical protein	NA	NA	NA	NA	NA
AUU62846.1|2783853_2784462_+	DUF3885 domain-containing protein	NA	NA	NA	NA	NA
AUU62847.1|2784719_2785460_-	NAD-dependent protein deacylase	NA	A0A2I2L319	Orpheovirus	30.3	7.3e-14
>prophage 206
CP026071	Staphylococcus aureus strain NRS143 chromosome, complete genome	2861652	2791780	2793193	2861652		Pandoravirus(100.0%)	1	NA	NA
AUU62855.1|2791780_2793193_+	6-phospho-beta-galactosidase	NA	A0A0B5JD41	Pandoravirus	28.7	1.9e-47
>prophage 207
CP026071	Staphylococcus aureus strain NRS143 chromosome, complete genome	2861652	2797161	2798724	2861652		Vibrio_phage(100.0%)	1	NA	NA
AUU62859.1|2797161_2798724_+	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	24.6	3.5e-18
>prophage 208
CP026071	Staphylococcus aureus strain NRS143 chromosome, complete genome	2861652	2808927	2809896	2861652		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
AUU62870.1|2808927_2809896_+	iron-dicitrate transporter subunit FecD	NA	A0A2H4IY97	uncultured_Caudovirales_phage	28.8	1.0e-15
>prophage 209
CP026071	Staphylococcus aureus strain NRS143 chromosome, complete genome	2861652	2825696	2826605	2861652		Klosneuvirus(100.0%)	1	NA	NA
AUU62878.1|2825696_2826605_+	arginase	NA	A0A1V0SJM8	Klosneuvirus	32.7	1.2e-26
>prophage 210
CP026071	Staphylococcus aureus strain NRS143 chromosome, complete genome	2861652	2843847	2851265	2861652	integrase,transposase	Paramecium_bursaria_Chlorella_virus(33.33%)	8	NA	NA
AUU62887.1|2843847_2845653_+	glutamine--fructose-6-phosphate aminotransferase	NA	M1H1Z3	Paramecium_bursaria_Chlorella_virus	38.6	2.6e-97
AUU62888.1|2845884_2846667_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	30.1	5.7e-09
AUU62889.1|2846734_2847592_+	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
AUU62890.1|2847721_2847814_-	erm Leader peptide	NA	NA	NA	NA	NA
AUU63017.1|2848250_2848409_-|integrase	integrase	integrase	NA	NA	NA	NA
AUU62891.1|2848473_2848656_+	hypothetical protein	NA	NA	NA	NA	NA
AUU62892.1|2849088_2849193_+	hypothetical protein	NA	NA	NA	NA	NA
AUU62893.1|2849618_2851265_-|transposase	IS1182-like element ISSau3 family transposase	transposase	A0ZS58	Staphylococcus_virus	99.8	7.9e-295
>prophage 211
CP026071	Staphylococcus aureus strain NRS143 chromosome, complete genome	2861652	2859771	2860215	2861652		Clostridium_phage(100.0%)	1	NA	NA
AUU62902.1|2859771_2860215_+	DNA starvation/stationary phase protection protein	NA	A0A0A7RTZ1	Clostridium_phage	53.7	5.6e-38
