The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP026953	Staphylococcus aureus strain FDAARGOS_48 chromosome, complete genome	2834575	159117	168160	2834575	tRNA	uncultured_Mediterranean_phage(50.0%)	7	NA	NA
AVG48672.1|159117_159636_-	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	46.5	5.6e-29
AVG48673.1|159657_161931_-	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	29.3	8.1e-64
AVG48674.1|162133_164413_-	protein translocase subunit SecDF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	35.8	1.8e-31
AVG48675.1|164687_164948_-	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	35.3	8.2e-05
AVG48676.1|164966_166106_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	44.7	5.4e-85
AVG48677.1|166128_167154_-|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
AVG48678.1|167155_168160_-	Holliday junction branch migration DNA helicase RuvB	NA	B3GAM6	uncultured_virus	29.1	1.7e-05
>prophage 2
CP026953	Staphylococcus aureus strain FDAARGOS_48 chromosome, complete genome	2834575	282188	353407	2834575	protease,tRNA	Staphylococcus_phage(95.74%)	67	NA	NA
AVG48783.1|282188_282833_-|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
AVG48784.1|282847_283639_-	phosphotransferase	NA	NA	NA	NA	NA
AVG48785.1|284188_285037_-	D-amino-acid transaminase	NA	NA	NA	NA	NA
AVG48786.1|285040_286450_-	dipeptidase PepV	NA	NA	NA	NA	NA
AVG48787.1|287007_287430_-	YtxH domain-containing protein	NA	NA	NA	NA	NA
AVG48788.1|287446_288142_-	rRNA pseudouridine synthase	NA	NA	NA	NA	NA
AVG48789.1|288138_289800_-	polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
AVG48790.1|290206_291475_+	NAD(P)/FAD-dependent oxidoreductase	NA	A0A2H4PQX1	Staphylococcus_phage	99.1	9.1e-57
AVG48791.1|291591_298152_-	YSIRK signal domain/LPXTG anchor domain surface protein	NA	A0A2H4PQU6	Staphylococcus_phage	98.3	6.1e-306
AVG48792.1|298477_298789_-	rhodanese-like domain-containing protein	NA	A0A2H4PQR9	Staphylococcus_phage	99.0	4.8e-52
AVG48793.1|298810_301228_-|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	99.5	0.0e+00
AVG48794.1|301515_302697_-	MFS transporter	NA	A0A2H4PQR6	Staphylococcus_phage	99.7	7.3e-218
AVG48795.1|302806_303760_+	TIGR01212 family radical SAM protein	NA	A0A2H4PQV5	Staphylococcus_phage	100.0	2.2e-79
AVG48796.1|303756_304320_+	methyltransferase domain-containing protein	NA	A0A2H4PQV0	Staphylococcus_phage	99.5	8.3e-103
AVG48797.1|304442_304844_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
AVG48798.1|305415_306243_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
AVG48799.1|306245_306365_-	hypothetical protein	NA	NA	NA	NA	NA
AVG48800.1|306476_307478_+	proline dehydrogenase	NA	A0A2H4PQT6	Staphylococcus_phage	99.4	2.6e-184
AVG48801.1|307599_308064_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	100.0	4.5e-70
AVG48802.1|308076_309258_-	riboflavin biosynthesis protein RibBA	NA	A0A2H4PQS2	Staphylococcus_phage	99.5	5.6e-226
AVG48803.1|309268_309901_-	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	98.6	5.5e-111
AVG51215.1|309907_310939_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	98.8	4.0e-196
AVG48804.1|311431_312934_-	pyridine nucleotide-disulfide oxidoreductase	NA	A0A2H4PQX2	Staphylococcus_phage	98.6	1.9e-29
AVG48805.1|313456_313771_+	ArsR family transcriptional regulator	NA	A0A2H4PQT4	Staphylococcus_phage	98.1	9.8e-53
AVG48806.1|313770_315063_+	arsenical efflux pump membrane protein ArsB	NA	A0A2H4PQU3	Staphylococcus_phage	99.5	5.0e-228
AVG48807.1|315149_316004_-	autolysin	NA	Q4ZCC7	Staphylococcus_virus	38.6	9.8e-39
AVG48808.1|316279_316504_-	hypothetical protein	NA	NA	NA	NA	NA
AVG48809.1|316702_317173_+	RNA polymerase sigma factor SigS	NA	A0A2H4PQT5	Staphylococcus_phage	98.1	8.8e-82
AVG48810.1|317285_317729_+	competence protein ComK	NA	NA	NA	NA	NA
AVG48811.1|317715_318159_-	hypothetical protein	NA	A0A2H4PQT8	Staphylococcus_phage	98.6	2.4e-57
AVG48812.1|318454_319090_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
AVG48813.1|319529_320243_-	transaldolase	NA	M1PR54	Cyanophage	35.3	5.5e-19
AVG48814.1|320502_320805_+	hypothetical protein	NA	NA	NA	NA	NA
AVG48815.1|321060_321426_+	fluoride efflux transporter CrcB	NA	A0A2H4PQR0	Staphylococcus_phage	100.0	3.6e-59
AVG48816.1|321422_321776_+	camphor resistance protein CrcB	NA	A0A2H4PQQ7	Staphylococcus_phage	94.0	3.8e-21
AVG48817.1|323378_324212_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	99.3	7.8e-158
AVG48818.1|324423_325332_-	NERD domain-containing protein	NA	A0A2H4PQQ8	Staphylococcus_phage	100.0	3.4e-138
AVG48819.1|325453_326650_-	S-adenosylmethionine synthase	NA	A0A2H4PQS6	Staphylococcus_phage	99.5	4.3e-218
AVG48820.1|327021_328614_+	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	100.0	0.0e+00
AVG51216.1|328991_329738_-	S9 family peptidase	NA	A0A2H4PQM6	Staphylococcus_phage	98.8	1.4e-142
AVG48821.1|329742_330216_-	nucleoside triphosphatase YtkD	NA	A0A2H4PQM4	Staphylococcus_phage	98.7	7.2e-84
AVG48822.1|330281_330539_+	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	100.0	7.2e-46
AVG48823.1|330535_331537_-	o-succinylbenzoate synthase	NA	A0A2H4PQM0	Staphylococcus_phage	97.0	2.6e-184
AVG48824.1|331541_333020_-	2-succinylbenzoate-CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	97.6	2.8e-283
AVG51217.1|333178_333634_-	DUF4909 domain-containing protein	NA	A0A2H4PQN7	Staphylococcus_phage	99.3	3.6e-80
AVG48825.1|333936_334587_+	calcium-binding protein	NA	A0A2H4PQM8	Staphylococcus_phage	94.0	2.9e-51
AVG48826.1|334667_335663_+	DUF4352 domain-containing protein	NA	A0A2H4PQN2	Staphylococcus_phage	97.9	2.6e-67
AVG48827.1|335737_336364_+	hypothetical protein	NA	A0A2H4PQM7	Staphylococcus_phage	79.3	2.0e-73
AVG48828.1|336404_336746_+	DUF3969 domain-containing protein	NA	A0A2H4PQN6	Staphylococcus_phage	94.7	1.1e-54
AVG48829.1|336846_337419_+	hypothetical protein	NA	A0A2H4PQN4	Staphylococcus_phage	93.1	2.3e-23
AVG48830.1|338991_339093_+	hypothetical protein	NA	NA	NA	NA	NA
AVG48831.1|340168_341398_-	restriction endonuclease subunit S	NA	A0A2H4PQP5	Staphylococcus_phage	64.7	4.0e-134
AVG48832.1|341390_343130_-	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	100.0	2.4e-289
AVG48833.1|343110_343245_-	hypothetical protein	NA	NA	NA	NA	NA
AVG48834.1|343307_344027_-|protease	serine protease SplF	protease	A0A2H4PQP1	Staphylococcus_phage	99.6	1.9e-131
AVG48835.1|344128_344236_+	hypothetical protein	NA	NA	NA	NA	NA
AVG48836.1|344184_344904_-|protease	serine protease SplD	protease	A0A2H4PQP9	Staphylococcus_phage	99.6	4.6e-130
AVG48837.1|345024_345744_-|protease	serine protease	protease	A0A2H4PQP7	Staphylococcus_phage	98.3	6.6e-129
AVG48838.1|345801_346524_-|protease	serine protease SplB	protease	A0A2H4PQN0	Staphylococcus_phage	98.3	3.5e-130
AVG48839.1|346648_347356_-|protease	serine protease SplA	protease	A0A2H4PQN3	Staphylococcus_phage	97.0	7.9e-127
AVG48840.1|347791_348010_-	hypothetical protein	NA	NA	NA	NA	NA
AVG48841.1|348319_348901_+	DUF4888 domain-containing protein	NA	A0A2H4PQH6	Staphylococcus_phage	64.2	2.8e-53
AVG48842.1|349373_349592_-	hypothetical protein	NA	A0A2H4PQH0	Staphylococcus_phage	80.6	2.0e-25
AVG48843.1|349847_350321_+	hypothetical protein	NA	NA	NA	NA	NA
AVG48844.1|350325_351117_+	DUF1828 domain-containing protein	NA	NA	NA	NA	NA
AVG48845.1|351486_352470_-	bi-component leukocidin LukED subunit D	NA	A0A2H4PQH7	Staphylococcus_phage	99.4	1.8e-185
AVG48846.1|352471_353407_-	beta-channel forming cytolysin	NA	A0A2H4PQI5	Staphylococcus_phage	100.0	1.4e-174
>prophage 3
CP026953	Staphylococcus aureus strain FDAARGOS_48 chromosome, complete genome	2834575	447228	544105	2834575	portal,tail,protease,transposase,capsid,integrase,tRNA,terminase,holin,head	Staphylococcus_phage(83.13%)	121	443665:443689	553241:553265
443665:443689	attL	ACCCCAACTTGCATTGTCTGTAGAA	NA	NA	NA	NA
AVG48932.1|447228_447531_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase GatCAB subunit C	tRNA	NA	NA	NA	NA
AVG48933.1|447897_449436_+	sodium:proline symporter	NA	NA	NA	NA	NA
AVG48934.1|449524_450724_-	CamS family sex pheromone protein	NA	NA	NA	NA	NA
AVG48935.1|450736_452740_-	DNA ligase (NAD(+)) LigA	NA	A0A0K2QQN8	Ralstonia_phage	36.2	1.2e-114
AVG48936.1|452743_454936_-	DNA helicase PcrA	NA	A7KV33	Bacillus_phage	42.2	1.0e-135
AVG48937.1|454932_455625_-	geranylgeranylglyceryl/heptaprenylglyceryl phosphate synthase	NA	NA	NA	NA	NA
AVG48938.1|455796_456099_-	hypothetical protein	NA	NA	NA	NA	NA
AVG48939.1|456207_457503_-	adenylosuccinate lyase	NA	A0A1B3B081	Gordonia_phage	32.9	1.6e-16
AVG48940.1|458362_459529_+|protease	cysteine protease staphopain A	protease	NA	NA	NA	NA
AVG48941.1|459559_459886_+	staphostatin A	NA	NA	NA	NA	NA
AVG48942.1|460177_460351_-	NETI motif-containing protein	NA	NA	NA	NA	NA
AVG48943.1|460331_460934_-	DUF2179 domain-containing protein	NA	NA	NA	NA	NA
AVG48944.1|461204_462026_-	NAD(+) synthetase	NA	G3MA24	Bacillus_virus	52.7	2.3e-69
AVG48945.1|462018_463488_-	nicotinate phosphoribosyltransferase	NA	G3MA18	Bacillus_virus	45.1	5.9e-108
AVG48946.1|463671_464748_+	nitric oxide synthase oxygenase	NA	NA	NA	NA	NA
AVG48947.1|464767_465562_+	ACT domain-containing protein	NA	NA	NA	NA	NA
AVG48948.1|465633_465741_+	hypothetical protein	NA	NA	NA	NA	NA
AVG48949.1|465751_467314_-	sodium-dependent dicarboxylate transporter SdcS	NA	NA	NA	NA	NA
AVG48950.1|467518_468616_-	pectate lyase	NA	U5PWM6	Bacillus_phage	34.3	1.3e-46
AVG48951.1|468984_469545_+	cysteine hydrolase	NA	G3MA16	Bacillus_virus	41.2	2.0e-32
AVG48952.1|469597_470527_+	manganese-dependent inorganic pyrophosphatase	NA	NA	NA	NA	NA
AVG48953.1|470719_470893_-	hypothetical protein	NA	NA	NA	NA	NA
AVG48954.1|470944_472324_+	aldehyde dehydrogenase	NA	NA	NA	NA	NA
AVG48955.1|472443_473472_-	hypothetical protein	NA	NA	NA	NA	NA
AVG48956.1|473930_474311_-	penicillinase repressor BlaI	NA	NA	NA	NA	NA
AVG48957.1|474300_476058_-	beta-lactam sensor/signal transducer BlaR1	NA	NA	NA	NA	NA
AVG48958.1|476164_477010_+	penicillin-hydrolyzing class A beta-lactamase BlaZ	NA	A0A1B0VBP7	Salmonella_phage	33.9	4.4e-31
AVG48959.1|477314_477734_+	YolD-like family protein	NA	U3PG23	Staphylococcus_phage	53.5	3.1e-30
AVG48960.1|479150_479516_-|transposase	transposase	transposase	NA	NA	NA	NA
AVG51222.1|479524_481552_-|transposase	transposase	transposase	NA	NA	NA	NA
AVG48961.1|481590_482742_-|transposase	transposase	transposase	P97010	Streptococcus_pyogenes_phage	31.6	1.8e-11
AVG48962.1|483764_483938_-	hypothetical protein	NA	NA	NA	NA	NA
AVG48963.1|484388_485429_+	linear amide C-N hydrolase	NA	NA	NA	NA	NA
AVG48964.1|485485_486328_-	hypothetical protein	NA	NA	NA	NA	NA
AVG48965.1|486324_486882_-	DUF1700 domain-containing protein	NA	NA	NA	NA	NA
AVG48966.1|486941_487466_-	hypothetical protein	NA	NA	NA	NA	NA
AVG48967.1|487586_488150_+	thioredoxin family protein	NA	NA	NA	NA	NA
AVG48968.1|488215_488956_-	phenol-soluble modulin export ABC transporter permease subunit PmtD	NA	NA	NA	NA	NA
AVG48969.1|488955_489828_-	phenol-soluble modulin export ABC transporter ATP-binding protein PmtC	NA	A0A2H4PQG7	Staphylococcus_phage	36.0	1.0e-27
AVG48970.1|489824_490505_-	phenol-soluble modulin export ABC transporter permease subunit PmtB	NA	NA	NA	NA	NA
AVG48971.1|490505_491402_-	phenol-soluble modulin export ABC transporter ATP-binding protein PmtA	NA	A0A2H4PQG7	Staphylococcus_phage	30.2	5.0e-17
AVG48972.1|491398_491779_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AVG48973.1|492036_492213_-	hypothetical protein	NA	NA	NA	NA	NA
AVG48974.1|492455_492554_-	hypothetical protein	NA	NA	NA	NA	NA
AVG48975.1|492753_494040_+	aspartate aminotransferase	NA	NA	NA	NA	NA
AVG48976.1|494318_494609_-	MAP domain-containing protein	NA	NA	NA	NA	NA
AVG48977.1|494619_496053_-	MAP domain-containing protein	NA	NA	NA	NA	NA
AVG48978.1|496438_496639_+	hypothetical protein	NA	A0A1P8L6A7	Staphylococcus_phage	100.0	3.4e-27
AVG48979.1|497010_497190_+	hypothetical protein	NA	A0A1W6JQ29	Staphylococcus_phage	100.0	2.2e-25
AVG48980.1|497213_497522_+	hypothetical protein	NA	M9NTD8	Staphylococcus_phage	77.5	9.3e-24
AVG48981.1|497500_497761_+	hypothetical protein	NA	M9NS66	Staphylococcus_phage	100.0	2.3e-23
AVG48982.1|497813_498164_-	inhibitor	NA	A7TWS0	Staphylococcus_phage	100.0	7.5e-54
AVG48983.1|498846_499296_+	chemotaxis inhibitory protein	NA	A0A075LZI2	Staphylococcus_phage	100.0	8.7e-79
AVG48984.1|499590_499845_-	amidase	NA	Q4ZCK0	Staphylococcus_virus	90.7	3.4e-11
AVG48985.1|499771_499927_+	amidase	NA	NA	NA	NA	NA
AVG48986.1|500373_500865_-	kinase	NA	A7TWR8	Staphylococcus_phage	100.0	8.0e-86
AVG48987.1|501055_501811_-	CHAP domain-containing protein	NA	D2JLG5	Staphylococcus_phage	100.0	3.4e-152
AVG48988.1|501822_502077_-|holin	phage holin	holin	D2JLG4	Staphylococcus_phage	100.0	4.1e-41
AVG48989.1|502128_502236_+	hypothetical protein	NA	NA	NA	NA	NA
AVG48990.1|502288_502465_-|holin	putative holin-like toxin	holin	D2JLG3	Staphylococcus_phage	96.6	6.5e-22
AVG48991.1|502607_502982_-	hypothetical protein	NA	G4KNR3	Staphylococcus_phage	100.0	3.3e-39
AVG48992.1|503037_503325_-	hypothetical protein	NA	C5I682	Staphylococcus_phage	100.0	9.9e-44
AVG48993.1|503370_503523_-	hypothetical protein	NA	A0A1W6JPL6	Staphylococcus_phage	100.0	7.6e-19
AVG48994.1|503515_507298_-	hypothetical protein	NA	A0A068A201	Staphylococcus_phage	99.8	0.0e+00
AVG48995.1|507313_508798_-|tail	phage tail protein	tail	A0A2I6PDJ0	Staphylococcus_phage	100.0	1.2e-297
AVG48996.1|508794_513324_-|tail	phage tail tape measure protein	tail	W5R8I2	Staphylococcus_phage	95.0	0.0e+00
AVG48997.1|513568_513919_-	hypothetical protein	NA	G4KNQ8	Staphylococcus_phage	100.0	7.8e-59
AVG48998.1|513968_514193_-	hypothetical protein	NA	A0A075LYE8	Staphylococcus_phage	100.0	3.0e-32
AVG48999.1|514234_514879_-|tail	phage tail protein	tail	G4KNQ7	Staphylococcus_phage	100.0	6.5e-120
AVG49000.1|514879_515287_-	hypothetical protein	NA	G4KNQ6	Staphylococcus_phage	100.0	7.1e-72
AVG49001.1|515283_515688_-	hypothetical protein	NA	G4KNQ5	Staphylococcus_phage	100.0	4.3e-69
AVG49002.1|515684_516047_-|head,tail	phage head-tail adapter protein	head,tail	G4KNQ4	Staphylococcus_phage	100.0	4.4e-65
AVG49003.1|516030_516315_-|head,tail	phage head-tail adapter protein	head,tail	A0A2I6PDJ5	Staphylococcus_phage	100.0	2.3e-45
AVG49004.1|516304_516589_-	hypothetical protein	NA	A0A2I6PDJ3	Staphylococcus_phage	100.0	1.8e-45
AVG49005.1|516608_517754_-|capsid	phage major capsid protein	capsid	G4KNQ3	Staphylococcus_phage	100.0	9.6e-215
AVG49006.1|517777_518515_-|protease	Clp protease ClpP	protease	G4KNQ2	Staphylococcus_phage	100.0	1.8e-129
AVG49007.1|518498_519686_-|portal	phage portal protein	portal	G4KNQ1	Staphylococcus_phage	100.0	4.6e-220
AVG49008.1|519701_521363_-|terminase	terminase large subunit	terminase	A0A2I6PDJ8	Staphylococcus_phage	98.6	0.0e+00
AVG49009.1|521359_521704_-	hypothetical protein	NA	G4KNP9	Staphylococcus_phage	100.0	9.4e-57
AVG49010.1|521833_522133_-	HNH endonuclease	NA	A0EWY8	Staphylococcus_phage	100.0	4.6e-52
AVG49011.1|522364_522781_-	transcriptional regulator	NA	G4KNP7	Staphylococcus_phage	100.0	1.3e-76
AVG49012.1|522808_523009_-	hypothetical protein	NA	A0A2I6PDV9	Staphylococcus_phage	100.0	1.4e-28
AVG49013.1|523008_523158_-	transcriptional regulator	NA	A0A1W6JPZ2	Staphylococcus_phage	100.0	4.8e-18
AVG49014.1|523154_523541_-	hypothetical protein	NA	A0A1X9IGZ2	Staphylococcus_phage	100.0	3.0e-64
AVG49015.1|523533_523770_-	hypothetical protein	NA	A0A2I6PEM4	Staphylococcus_phage	100.0	2.8e-36
AVG49016.1|523762_523966_-	hypothetical protein	NA	A0A2I6PEQ8	Staphylococcus_phage	100.0	3.4e-30
AVG49017.1|523962_524169_-	DUF1381 domain-containing protein	NA	A0A2I6PEM9	Staphylococcus_phage	100.0	1.6e-19
AVG49018.1|524205_524739_-	dUTPase	NA	A0A2I6PEN6	Staphylococcus_phage	98.3	3.3e-93
AVG49019.1|525360_525612_-	DUF1024 domain-containing protein	NA	G4KNP4	Staphylococcus_phage	96.4	4.1e-38
AVG49020.1|525604_525955_-	acetyltransferase	NA	A0A0F6N3K4	Staphylococcus_phage	90.0	2.2e-45
AVG49021.1|525963_526206_-	hypothetical protein	NA	A0A1P8L6E3	Staphylococcus_phage	97.5	1.1e-40
AVG49022.1|526209_526578_-	hypothetical protein	NA	A0A0H4J337	Staphylococcus_phage	98.4	6.3e-51
AVG49023.1|527004_527223_-	hypothetical protein	NA	A0A1P8L6E4	Staphylococcus_phage	100.0	1.4e-37
AVG49024.1|527229_528099_-	DnaD domain protein	NA	A0EWX4	Staphylococcus_phage	96.6	5.9e-132
AVG49025.1|528128_528599_-	single-stranded DNA-binding protein	NA	S4V682	Staphylococcus_phage	96.2	3.1e-79
AVG49026.1|528599_529217_-	MBL fold metallo-hydrolase	NA	A0A1W6JPL3	Staphylococcus_phage	99.4	3.5e-86
AVG49027.1|529297_530218_-	recombinase	NA	A0A2I6PDH5	Staphylococcus_phage	100.0	2.3e-166
AVG49028.1|530219_532163_-	ATPase	NA	I1W619	Staphylococcus_phage	98.6	0.0e+00
AVG49029.1|532171_532435_-	hypothetical protein	NA	A0A2I6PDG2	Staphylococcus_phage	100.0	7.7e-43
AVG49030.1|532443_532704_-	DUF1108 domain-containing protein	NA	A0EWW8	Staphylococcus_phage	96.5	4.4e-43
AVG49031.1|532708_533011_-	hypothetical protein	NA	A0A0F6N3N3	Staphylococcus_phage	97.0	1.0e-46
AVG49032.1|533103_533265_-	DUF1270 domain-containing protein	NA	Q4ZAZ7	Staphylococcus_virus	100.0	2.5e-20
AVG49033.1|533261_533582_-	DUF771 domain-containing protein	NA	A0A1W6JPI1	Staphylococcus_phage	100.0	7.4e-56
AVG49034.1|533611_533830_-	hypothetical protein	NA	A0A068A2A3	Staphylococcus_phage	98.6	4.3e-31
AVG49035.1|533826_534153_-	hypothetical protein	NA	G4KNN2	Staphylococcus_phage	100.0	5.4e-54
AVG49036.1|534202_534526_+	hypothetical protein	NA	A0ZS13	Staphylococcus_virus	99.1	6.5e-52
AVG49037.1|534479_534719_-	hypothetical protein	NA	A0ZS12	Staphylococcus_virus	100.0	2.9e-33
AVG49038.1|534777_534981_+	hypothetical protein	NA	A0A2H4JBA9	uncultured_Caudovirales_phage	66.1	9.5e-17
AVG49039.1|535097_535841_-	oxidoreductase	NA	A0A0H3U319	Staphylococcus_phage	100.0	2.3e-137
AVG49040.1|535891_536221_+	hypothetical protein	NA	A0A0H3U4Z1	Staphylococcus_phage	99.1	3.9e-52
AVG49041.1|536209_536425_-	DUF2829 domain-containing protein	NA	A0A0H3U4C7	Staphylococcus_phage	100.0	4.8e-35
AVG49042.1|536440_536704_-	XRE family transcriptional regulator	NA	A0A2I6PF09	Staphylococcus_phage	100.0	7.2e-41
AVG49043.1|536700_536874_-	transcriptional regulator	NA	NA	NA	NA	NA
AVG49044.1|536836_537550_+	XRE family transcriptional regulator	NA	M9NUL0	Staphylococcus_phage	99.6	3.5e-130
AVG49045.1|537565_538498_+	ATP-dependent helicase	NA	A0A2I6PEZ7	Staphylococcus_phage	99.7	2.8e-172
AVG49046.1|538503_538845_+	hypothetical protein	NA	A0A2I6PF04	Staphylococcus_phage	100.0	4.6e-56
AVG49047.1|539048_539231_+	hypothetical protein	NA	M9NSW6	Staphylococcus_phage	100.0	4.1e-27
AVG49048.1|539330_539795_+	hypothetical protein	NA	A0EWV3	Staphylococcus_phage	100.0	1.1e-28
AVG49049.1|539853_540891_+|integrase	site-specific integrase	integrase	A0EWV2	Staphylococcus_phage	99.7	1.5e-179
AVG49050.1|542011_543028_-	bi-component leukocidin LukGH subunit G	NA	A0A1X9IGW5	Staphylococcus_phage	30.2	6.7e-26
AVG49051.1|543049_544105_-	bi-component leukocidin LukGH subunit H	NA	A0A1X9IGW5	Staphylococcus_phage	34.3	2.8e-35
553241:553265	attR	ACCCCAACTTGCATTGTCTGTAGAA	NA	NA	NA	NA
>prophage 4
CP026953	Staphylococcus aureus strain FDAARGOS_48 chromosome, complete genome	2834575	1613175	1657547	2834575	portal,tail,protease,capsid,integrase,terminase,holin,head	Staphylococcus_phage(92.86%)	70	1613065:1613082	1657625:1657642
1613065:1613082	attL	ATCATACAAGGATGGGAT	NA	NA	NA	NA
AVG50028.1|1613175_1614381_-|integrase	site-specific integrase	integrase	A0A1X9H094	Staphylococcus_phage	98.8	2.1e-220
AVG50029.1|1614506_1615121_+	ATPase	NA	A7TW88	Staphylococcus_phage	100.0	7.9e-107
AVG50030.1|1615117_1615264_-	hypothetical protein	NA	A0A2I6PEK8	Staphylococcus_phage	89.6	1.1e-14
AVG50031.1|1615353_1615749_-	hypothetical protein	NA	I1W601	Staphylococcus_phage	100.0	1.4e-69
AVG50032.1|1615777_1616212_-	hypothetical protein	NA	A0A2I6PEM0	Staphylococcus_phage	99.3	3.5e-24
AVG50033.1|1616229_1616691_-	toxin	NA	A0A2K9VBR7	Staphylococcus_phage	100.0	1.2e-83
AVG50034.1|1616703_1617018_-	XRE family transcriptional regulator	NA	A0A0N9BAW4	Staphylococcus_phage	100.0	9.8e-53
AVG50035.1|1617169_1617406_+	XRE family transcriptional regulator	NA	A0A2I6PD81	Staphylococcus_phage	100.0	1.5e-37
AVG50036.1|1617419_1618196_+	transcriptional regulator	NA	A0A2I6PD87	Staphylococcus_phage	99.6	1.4e-140
AVG50037.1|1618224_1618368_+	hypothetical protein	NA	W5R8I6	Staphylococcus_phage	100.0	2.5e-16
AVG50038.1|1618357_1618567_-	hypothetical protein	NA	W5R9J5	Staphylococcus_phage	100.0	1.2e-30
AVG50039.1|1618622_1618868_+	DUF2829 domain-containing protein	NA	A0A2I6PF15	Staphylococcus_phage	100.0	5.1e-41
AVG50040.1|1618836_1619202_-	hypothetical protein	NA	A0A2I6PF07	Staphylococcus_phage	99.2	1.2e-62
AVG50041.1|1619256_1619472_+	hypothetical protein	NA	A0A2I6PF01	Staphylococcus_phage	100.0	1.9e-31
AVG50042.1|1619496_1619760_+	helix-turn-helix domain-containing protein	NA	A7TWG0	Staphylococcus_phage	100.0	5.7e-46
AVG50043.1|1619773_1619935_+	DUF1270 domain-containing protein	NA	A0A2H4PQQ1	Staphylococcus_phage	98.1	1.2e-19
AVG50044.1|1620026_1620287_+	DUF1108 domain-containing protein	NA	Q4ZDA1	Staphylococcus_virus	100.0	1.2e-43
AVG50045.1|1620296_1620518_+	DUF2483 domain-containing protein	NA	A7TWM6	Staphylococcus_phage	100.0	3.2e-34
AVG50046.1|1620510_1621134_+	DUF1071 domain-containing protein	NA	A0A2H4PQQ6	Staphylococcus_phage	100.0	1.4e-114
AVG50047.1|1621133_1621562_+	single-stranded DNA-binding protein	NA	B2ZYV4	Staphylococcus_phage	100.0	3.9e-60
AVG50048.1|1621575_1622250_+	hypothetical protein	NA	A0A0E3XBQ6	Staphylococcus_phage	98.2	5.8e-127
AVG50049.1|1622356_1623205_-	DUF4393 domain-containing protein	NA	W5R9J9	Staphylococcus_phage	99.6	1.1e-159
AVG50050.1|1623268_1623982_+	helix-turn-helix domain-containing protein	NA	A0A1J0MGB2	Staphylococcus_phage	79.3	9.2e-91
AVG50051.1|1623991_1624771_+	DNA replication protein DnaC	NA	Q9G022	Staphylococcus_virus	100.0	2.4e-145
AVG50052.1|1624938_1625160_+	hypothetical protein	NA	A7TWN4	Staphylococcus_phage	100.0	1.3e-35
AVG50053.1|1625578_1625764_+	DUF3113 domain-containing protein	NA	A0A0H3U473	Staphylococcus_phage	100.0	4.1e-27
AVG50054.1|1625764_1626382_+	hypothetical protein	NA	A0A0H3U4U9	Staphylococcus_phage	100.0	4.2e-84
AVG50055.1|1626381_1626636_+	DUF3310 domain-containing protein	NA	Q6R831	Staphylococcus_virus	100.0	1.3e-42
AVG50056.1|1626635_1626884_+	hypothetical protein	NA	A0A2K9VBX5	Staphylococcus_phage	100.0	1.2e-40
AVG50057.1|1626897_1627104_+	hypothetical protein	NA	A0A0N9BAW9	Staphylococcus_phage	100.0	3.0e-34
AVG50058.1|1627106_1627511_+	hypothetical protein	NA	A0A0E3T8H9	Staphylococcus_phage	100.0	4.2e-72
AVG50059.1|1627507_1627702_+	hypothetical protein	NA	A0A0E3XCV8	Staphylococcus_phage	100.0	2.5e-27
AVG50060.1|1628066_1628456_+	acetyltransferase	NA	I1W604	Staphylococcus_phage	100.0	1.4e-69
AVG50061.1|1628448_1628697_+	DUF1024 domain-containing protein	NA	A0A2I6PEP2	Staphylococcus_phage	98.8	1.8e-38
AVG50062.1|1628689_1629226_+	dUTPase	NA	A0A2I6PEN6	Staphylococcus_phage	100.0	1.6e-95
AVG50063.1|1629262_1629469_+	DUF1381 domain-containing protein	NA	A0A2I6PEM9	Staphylococcus_phage	100.0	1.6e-19
AVG50064.1|1629465_1629669_+	hypothetical protein	NA	A0A2I6PEQ8	Staphylococcus_phage	100.0	3.4e-30
AVG50065.1|1629661_1629898_+	hypothetical protein	NA	A0A2I6PEM4	Staphylococcus_phage	100.0	2.8e-36
AVG50066.1|1629881_1630277_+	hypothetical protein	NA	A7TWI1	Staphylococcus_phage	99.2	8.2e-65
AVG50067.1|1630273_1630426_+	transcriptional regulator	NA	A0A2I6PEM5	Staphylococcus_phage	100.0	2.0e-19
AVG50068.1|1630493_1630694_+	DUF1514 domain-containing protein	NA	A0A2I6PEP5	Staphylococcus_phage	100.0	4.9e-26
AVG50069.1|1630720_1630927_-	hypothetical protein	NA	A0A1X9IGZ9	Staphylococcus_phage	100.0	7.6e-30
AVG50070.1|1630981_1632253_+	hypothetical protein	NA	A0A2I6PEP4	Staphylococcus_phage	96.3	6.0e-133
AVG50071.1|1632265_1632703_+	transcriptional regulator	NA	A0A2I6PDN2	Staphylococcus_phage	100.0	6.1e-77
AVG50072.1|1632864_1633179_+	HNH endonuclease	NA	A0A2I6PDR3	Staphylococcus_phage	100.0	8.5e-57
AVG50073.1|1633304_1633610_+|terminase	phage terminase small subunit P27 family	terminase	A0A2I6PDN6	Staphylococcus_phage	100.0	3.7e-49
AVG50074.1|1633599_1635291_+|terminase	terminase large subunit	terminase	A0A2I6PDP8	Staphylococcus_phage	99.8	0.0e+00
AVG50075.1|1635295_1636534_+|portal	phage portal protein	portal	A0A2I6PEA6	Staphylococcus_phage	100.0	6.9e-235
AVG50076.1|1636517_1637291_+|protease	Clp protease ClpP	protease	A0A2I6PE26	Staphylococcus_phage	100.0	4.9e-138
AVG51270.1|1637302_1638466_+|capsid	phage major capsid protein	capsid	A0A2I6PE62	Staphylococcus_phage	100.0	3.6e-217
AVG50077.1|1638534_1638813_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2I6PE36	Staphylococcus_phage	100.0	2.1e-46
AVG50078.1|1638824_1639157_+	hypothetical protein	NA	A0A2I6PDD6	Staphylococcus_phage	100.0	6.2e-58
AVG50079.1|1639153_1639555_+	hypothetical protein	NA	A0A2I6PDD3	Staphylococcus_phage	100.0	6.2e-68
AVG50080.1|1639555_1639951_+	DUF3168 domain-containing protein	NA	A0A2I6PDD8	Staphylococcus_phage	100.0	2.6e-66
AVG50081.1|1639985_1640627_+|tail	phage tail protein	tail	A0A2I6PE59	Staphylococcus_phage	100.0	1.0e-120
AVG50082.1|1640718_1641174_+|tail	phage tail protein	tail	A0A2I6PER6	Staphylococcus_phage	100.0	5.7e-78
AVG50083.1|1641231_1641582_+	hypothetical protein	NA	A0A2I6PEQ2	Staphylococcus_phage	100.0	1.1e-55
AVG50084.1|1641623_1641782_+	hypothetical protein	NA	A0A2I6PES8	Staphylococcus_phage	100.0	1.2e-19
AVG50085.1|1641795_1647996_+|tail	phage tail tape measure protein	tail	A0A1X9IGU9	Staphylococcus_phage	99.9	0.0e+00
AVG50086.1|1647995_1648820_+|tail	phage tail family protein	tail	A0A2I6PER3	Staphylococcus_phage	100.0	4.1e-159
AVG50087.1|1648828_1650412_+	peptidase	NA	Q8SDP1	Staphylococcus_virus	100.0	7.1e-309
AVG50088.1|1650411_1650702_+	hypothetical protein	NA	A0A2I6PF46	Staphylococcus_phage	100.0	2.1e-49
AVG50089.1|1650717_1652628_+	hypothetical protein	NA	A0A2I6PF35	Staphylococcus_phage	99.8	0.0e+00
AVG50090.1|1652627_1654094_+	DUF2479 domain-containing protein	NA	A0A2I6PEI6	Staphylococcus_phage	99.0	2.4e-271
AVG50091.1|1654093_1654483_+	hypothetical protein	NA	A0A2I6PER1	Staphylococcus_phage	100.0	2.2e-62
AVG50092.1|1654475_1654640_+	XkdX family protein	NA	A0A2I6PES4	Staphylococcus_phage	100.0	4.9e-24
AVG50093.1|1654685_1654985_+	DUF2951 domain-containing protein	NA	M9QRV2	Staphylococcus_phage	98.0	5.9e-31
AVG50094.1|1655120_1655423_+|holin	phage holin	holin	A0A2I6PET6	Staphylococcus_phage	100.0	7.0e-48
AVG50095.1|1655434_1656889_+	CHAP domain-containing protein	NA	B7T0L1	Staphylococcus_virus	98.6	2.5e-284
AVG50096.1|1657247_1657547_+	hypothetical protein	NA	A7TWL2	Staphylococcus_phage	94.7	8.4e-46
1657625:1657642	attR	ATCATACAAGGATGGGAT	NA	NA	NA	NA
>prophage 5
CP026953	Staphylococcus aureus strain FDAARGOS_48 chromosome, complete genome	2834575	2071367	2082018	2834575		uncultured_Caudovirales_phage(62.5%)	12	NA	NA
AVG50483.1|2071367_2072873_-	peptide MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	32.2	2.0e-58
AVG50484.1|2072953_2073199_-	hypothetical protein	NA	NA	NA	NA	NA
AVG50485.1|2073228_2073729_-	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	E7DN65	Pneumococcus_phage	71.5	5.9e-52
AVG50486.1|2073748_2074615_-	EamA/RhaT family transporter	NA	NA	NA	NA	NA
AVG50487.1|2074999_2075266_+	ribonucleoside-diphosphate reductase	NA	NA	NA	NA	NA
AVG50488.1|2075415_2075814_+	protein NrdI	NA	A0A2H4J545	uncultured_Caudovirales_phage	72.0	1.2e-52
AVG50489.1|2075776_2077882_+	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	A0A2H4J2N6	uncultured_Caudovirales_phage	91.7	0.0e+00
AVG50490.1|2077999_2078971_+	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	A0A2H4J4P3	uncultured_Caudovirales_phage	91.3	4.2e-171
AVG50491.1|2079151_2079307_+	hypothetical protein	NA	NA	NA	NA	NA
AVG51288.1|2079345_2080317_+	iron ABC transporter permease	NA	A0A2H4IY97	uncultured_Caudovirales_phage	78.9	4.3e-139
AVG50492.1|2080303_2081260_+	iron ABC transporter permease	NA	A0A2H4J116	uncultured_Caudovirales_phage	57.8	1.2e-05
AVG50493.1|2081256_2082018_+	iron ABC transporter ATP-binding protein	NA	Q9EMR9	Amsacta_moorei_entomopoxvirus	31.6	6.5e-18
>prophage 6
CP026953	Staphylococcus aureus strain FDAARGOS_48 chromosome, complete genome	2834575	2167550	2213192	2834575	portal,tail,plate,capsid,integrase,terminase,holin,head	Staphylococcus_phage(83.82%)	70	2165638:2165654	2199103:2199119
2165638:2165654	attL	GAAATTAGATAAAAACA	NA	NA	NA	NA
AVG50583.1|2167550_2168792_+	cysteine desulfurase	NA	Q2XUY6	environmental_halophage	44.8	8.2e-111
AVG50584.1|2168781_2169246_+	SUF system NifU family Fe-S cluster assembly protein	NA	NA	NA	NA	NA
AVG50585.1|2169396_2170794_+	Fe-S cluster assembly protein SufB	NA	NA	NA	NA	NA
AVG50586.1|2170861_2171911_-|integrase	site-specific integrase	integrase	A1KWY3	Staphylococcus_virus	99.7	4.5e-203
AVG50587.1|2172023_2172203_+	excisionase	NA	A0EWN7	Staphylococcus_virus	100.0	8.3e-25
AVG50588.1|2172182_2173115_-	hypothetical protein	NA	A0EWN8	Staphylococcus_virus	100.0	3.9e-174
AVG50589.1|2173146_2173608_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A0H4J322	Staphylococcus_phage	81.7	1.6e-64
AVG50590.1|2173619_2173952_-	XRE family transcriptional regulator	NA	A0A1J0MFC1	Staphylococcus_phage	73.6	4.7e-37
AVG50591.1|2174144_2174384_+	XRE family transcriptional regulator	NA	A0A2H4J9X2	uncultured_Caudovirales_phage	96.2	2.6e-37
AVG50592.1|2174398_2175187_+	phage antirepressor	NA	R9QSV3	Staphylococcus_phage	100.0	1.2e-144
AVG50593.1|2175203_2175398_+	hypothetical protein	NA	Q4ZDS1	Staphylococcus_virus	90.5	4.6e-21
AVG50594.1|2175428_2175572_+	hypothetical protein	NA	A0A2I6PDG0	Staphylococcus_phage	91.3	1.8e-14
AVG50595.1|2175592_2176150_-	hypothetical protein	NA	A0A2H4IYS4	uncultured_Caudovirales_phage	54.5	1.7e-47
AVG50596.1|2176220_2176442_+	hypothetical protein	NA	A0A0F6N3I2	Staphylococcus_phage	97.3	9.6e-31
AVG50597.1|2176434_2176596_+	DUF1270 domain-containing protein	NA	A0A2H4PQQ1	Staphylococcus_phage	100.0	3.3e-20
AVG50598.1|2176687_2176948_+	DUF1108 domain-containing protein	NA	Q4ZBM7	Staphylococcus_phage	100.0	1.2e-43
AVG50599.1|2176957_2177179_+	DUF2483 domain-containing protein	NA	A7TWM6	Staphylococcus_phage	100.0	3.2e-34
AVG50600.1|2177171_2177795_+	DUF1071 domain-containing protein	NA	A0A2H4PQQ6	Staphylococcus_phage	100.0	1.4e-114
AVG50601.1|2177794_2178223_+	single-stranded DNA-binding protein	NA	B2ZYV4	Staphylococcus_phage	100.0	3.9e-60
AVG50602.1|2178236_2178911_+	hypothetical protein	NA	R4IH15	Staphylococcus_phage	96.9	1.4e-125
AVG50603.1|2179049_2179331_-	hypothetical protein	NA	A0A1W6JPU7	Staphylococcus_phage	100.0	2.6e-49
AVG51291.1|2179396_2180167_+	replication protein	NA	G4KNP0	Staphylococcus_phage	100.0	6.4e-122
AVG50604.1|2180176_2180956_+	DNA replication protein DnaC	NA	G4KNP1	Staphylococcus_phage	100.0	3.8e-146
AVG50605.1|2180949_2181108_+	hypothetical protein	NA	A0A2H4PQI7	Staphylococcus_phage	100.0	4.5e-22
AVG50606.1|2181120_2181342_+	hypothetical protein	NA	A0A0H3U2V4	Staphylococcus_phage	100.0	2.2e-35
AVG50607.1|2181351_2181756_+	DUF1064 domain-containing protein	NA	A1KX76	Staphylococcus_virus	100.0	9.6e-69
AVG50608.1|2181760_2181946_+	hypothetical protein	NA	A0A0F6N3K7	Staphylococcus_phage	100.0	1.1e-27
AVG50609.1|2181946_2182252_+	hypothetical protein	NA	A0A0F6N4H9	Staphylococcus_phage	100.0	1.7e-49
AVG50610.1|2182379_2182736_+	hypothetical protein	NA	A0A0F6N3E3	Staphylococcus_phage	99.2	1.9e-60
AVG50611.1|2182739_2182982_+	hypothetical protein	NA	A0A0F6N3E1	Staphylococcus_phage	100.0	6.6e-41
AVG50612.1|2182990_2183362_+	acetyltransferase	NA	A0A0F6N3K4	Staphylococcus_phage	100.0	3.6e-54
AVG50613.1|2183354_2183609_+	DUF1024 domain-containing protein	NA	A0A0H3U469	Staphylococcus_phage	100.0	5.0e-39
AVG50614.1|2183758_2184295_+	dUTPase	NA	A0A0H3U2Z8	Staphylococcus_phage	99.4	2.7e-95
AVG50615.1|2184331_2184538_+	DUF1381 domain-containing protein	NA	A0A0F6N4I4	Staphylococcus_phage	100.0	1.1e-20
AVG50616.1|2184534_2184729_+	hypothetical protein	NA	S4SX95	Staphylococcus_phage	100.0	7.9e-29
AVG50617.1|2184725_2184929_+	hypothetical protein	NA	B2ZYX5	Staphylococcus_phage	98.5	8.8e-31
AVG50618.1|2184921_2185095_+	transcriptional regulator	NA	A0A0F6N3E7	Staphylococcus_phage	100.0	2.2e-22
AVG50619.1|2185095_2185242_+	hypothetical protein	NA	B2ZYX7	Staphylococcus_phage	100.0	2.2e-15
AVG50620.1|2185265_2185688_+	DUF1492 domain-containing protein	NA	A0A0F6N3E5	Staphylococcus_phage	100.0	1.2e-74
AVG51292.1|2185875_2186370_+|terminase	terminase small subunit	terminase	A0A0F6N3K6	Staphylococcus_phage	100.0	7.8e-89
AVG50621.1|2186372_2187668_+|terminase	PBSX family phage terminase large subunit	terminase	A0A0F6N3L3	Staphylococcus_phage	100.0	3.0e-257
AVG50622.1|2187678_2189217_+|portal	phage portal protein	portal	A0A0F6N4I8	Staphylococcus_phage	100.0	2.4e-293
AVG50623.1|2189223_2190219_+|head	phage head morphogenesis protein	head	A0A0F6N3F1	Staphylococcus_phage	100.0	2.0e-184
AVG50624.1|2190291_2190462_+	hypothetical protein	NA	A0A0F6N3E9	Staphylococcus_phage	100.0	1.5e-23
AVG50625.1|2190570_2191191_+	DUF4355 domain-containing protein	NA	S4V984	Staphylococcus_phage	98.5	1.7e-69
AVG50626.1|2191204_2192179_+|capsid	phage major capsid protein	capsid	E0Y3L0	Staphylococcus_virus	100.0	2.2e-183
AVG50627.1|2192200_2192488_+	hypothetical protein	NA	S4V6D9	Staphylococcus_phage	98.9	1.4e-45
AVG50628.1|2192496_2192829_+|head,tail	phage head-tail adapter protein	head,tail	A0A0F6N3F4	Staphylococcus_phage	100.0	5.5e-54
AVG50629.1|2192825_2193128_+	hypothetical protein	NA	A4ZFB6	Staphylococcus_virus	100.0	1.1e-50
AVG50630.1|2193127_2193475_+	hypothetical protein	NA	A0A0F6N3F5	Staphylococcus_phage	100.0	4.1e-60
AVG50631.1|2193486_2193870_+	hypothetical protein	NA	B2ZYZ0	Staphylococcus_phage	100.0	2.6e-68
AVG50632.1|2194531_2194897_+|tail	phage tail protein	tail	A0A0F6N4J9	Staphylococcus_phage	99.2	1.8e-58
AVG50633.1|2194926_2195271_+	hypothetical protein	NA	A0A0F6N3F7	Staphylococcus_phage	100.0	2.5e-57
AVG50634.1|2195287_2198755_+	hypothetical protein	NA	A0A0F6N3F9	Staphylococcus_phage	100.0	4.2e-245
AVG50635.1|2198767_2199715_+|tail	phage tail family protein	tail	A0A0F6N3L4	Staphylococcus_phage	100.0	2.8e-183
2199103:2199119	attR	GAAATTAGATAAAAACA	NA	NA	NA	NA
AVG50636.1|2199723_2201622_+	peptidase	NA	A0A0F6N3M1	Staphylococcus_phage	100.0	0.0e+00
AVG50637.1|2201636_2203547_+	hypothetical protein	NA	A0A0F6N4K2	Staphylococcus_phage	99.8	0.0e+00
AVG50638.1|2203546_2205370_+|plate	phage baseplate upper protein	plate	A0A0F6N3G2	Staphylococcus_phage	99.8	0.0e+00
AVG50639.1|2205369_2205747_+	hypothetical protein	NA	A0A0F6N3G4	Staphylococcus_phage	100.0	1.5e-60
AVG50640.1|2205750_2205924_+	XkdX family protein	NA	A0A0F6N3L7	Staphylococcus_phage	100.0	6.6e-27
AVG51293.1|2205963_2206263_+	hypothetical protein	NA	A0A0F6N3M6	Staphylococcus_phage	100.0	9.9e-47
AVG50641.1|2206399_2208298_+	CHAP domain-containing protein	NA	A0A0F6N4K6	Staphylococcus_phage	100.0	0.0e+00
AVG50642.1|2208310_2209549_+	DUF2479 domain-containing protein	NA	E0Y3M8	Staphylococcus_virus	99.3	5.0e-209
AVG50643.1|2209554_2209950_+	hypothetical protein	NA	A0A2H4PQP8	Staphylococcus_phage	99.2	1.8e-67
AVG50644.1|2210005_2210281_+|holin	phage holin	holin	A0A0F6N3M0	Staphylococcus_phage	100.0	8.6e-45
AVG50645.1|2210267_2211680_+	CHAP domain-containing protein	NA	A0A0F6N3N1	Staphylococcus_phage	100.0	5.8e-286
AVG50646.1|2211739_2212297_-	hypothetical protein	NA	A0A0F6N4L1	Staphylococcus_phage	100.0	7.4e-96
AVG50647.1|2212671_2212824_+	hypothetical protein	NA	A0A0F6N3H2	Staphylococcus_phage	100.0	3.1e-20
AVG50648.1|2212894_2213005_+	hypothetical protein	NA	W5R8J7	Staphylococcus_phage	100.0	1.7e-12
AVG50649.1|2212991_2213192_+	hypothetical protein	NA	W5R9N2	Staphylococcus_phage	100.0	3.7e-29
>prophage 7
CP026953	Staphylococcus aureus strain FDAARGOS_48 chromosome, complete genome	2834575	2296276	2349400	2834575	bacteriocin,protease,tRNA,holin	Streptococcus_phage(28.57%)	55	NA	NA
AVG50728.1|2296276_2297266_-|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
AVG50729.1|2297559_2297955_+	transcriptional regulator Spx	NA	NA	NA	NA	NA
AVG50730.1|2298325_2299045_+	adaptor protein MecA	NA	NA	NA	NA	NA
AVG50731.1|2299165_2300152_+	competence protein CoiA	NA	NA	NA	NA	NA
AVG50732.1|2300199_2302008_+	oligoendopeptidase F	NA	A0A1X9I5X5	Streptococcus_phage	24.5	5.5e-47
AVG50733.1|2302467_2303274_-	DsbA family protein	NA	NA	NA	NA	NA
AVG50734.1|2303296_2303662_-	globin	NA	NA	NA	NA	NA
AVG50735.1|2303765_2304359_-	CYTH domain-containing protein	NA	NA	NA	NA	NA
AVG50736.1|2304544_2304892_+	hypothetical protein	NA	NA	NA	NA	NA
AVG50737.1|2304908_2305544_+	GTP pyrophosphokinase family protein	NA	NA	NA	NA	NA
AVG50738.1|2305560_2306370_+	NAD(+) kinase	NA	NA	NA	NA	NA
AVG50739.1|2306366_2307221_+	RluA family pseudouridine synthase	NA	NA	NA	NA	NA
AVG50740.1|2307241_2308627_+	magnesium transporter	NA	NA	NA	NA	NA
AVG50741.1|2308636_2310481_+	sodium:proton antiporter	NA	NA	NA	NA	NA
AVG50742.1|2310758_2311529_+	enoyl-[acyl-carrier-protein] reductase FabI	NA	NA	NA	NA	NA
AVG50743.1|2311725_2312811_-	AI-2E family transporter	NA	NA	NA	NA	NA
AVG50744.1|2313152_2314721_+	alanine:cation symporter family protein	NA	NA	NA	NA	NA
AVG50745.1|2314865_2315624_+	esterase family protein	NA	NA	NA	NA	NA
AVG50746.1|2315817_2316327_+	hypothetical protein	NA	NA	NA	NA	NA
AVG50747.1|2316439_2317648_-	MFS transporter	NA	NA	NA	NA	NA
AVG50748.1|2317607_2318783_-	diacylglycerol beta-glucosyltransferase	NA	NA	NA	NA	NA
AVG50749.1|2319215_2320700_+	UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--L- lysine ligase	NA	NA	NA	NA	NA
AVG50750.1|2320680_2320941_+	hypothetical protein	NA	NA	NA	NA	NA
AVG50751.1|2320940_2322503_+	peptide chain release factor 3	NA	A0A1S5SF82	Streptococcus_phage	28.2	2.2e-36
AVG50752.1|2322804_2323608_+	hypothetical protein	NA	S5MAL1	Bacillus_phage	40.5	1.6e-30
AVG50753.1|2323826_2326151_+	PDZ domain-containing protein	NA	W5SAB9	Pithovirus	27.4	2.8e-11
AVG50754.1|2326167_2327526_+	Ktr system potassium uptake protein D	NA	NA	NA	NA	NA
AVG50755.1|2327664_2329176_+	bifunctional metallophosphatase/5'-nucleotidase	NA	NA	NA	NA	NA
AVG50756.1|2329662_2330232_-	competence protein ComK	NA	NA	NA	NA	NA
AVG50757.1|2330441_2330660_+	IDEAL domain-containing protein	NA	NA	NA	NA	NA
AVG50758.1|2330740_2331727_-	lipoate--protein ligase	NA	NA	NA	NA	NA
AVG50759.1|2331925_2332102_+	DUF2187 domain-containing protein	NA	NA	NA	NA	NA
AVG50760.1|2332116_2332719_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
AVG51295.1|2333018_2333096_+|holin	putative holin-like toxin	holin	NA	NA	NA	NA
AVG50761.1|2333634_2333736_+	hypothetical protein	NA	NA	NA	NA	NA
AVG51296.1|2333745_2334018_+|bacteriocin	lactococcin 972 family bacteriocin	bacteriocin	NA	NA	NA	NA
AVG50762.1|2334061_2336026_+	DUF1430 domain-containing protein	NA	NA	NA	NA	NA
AVG50763.1|2336028_2336349_+	hypothetical protein	NA	NA	NA	NA	NA
AVG50764.1|2336345_2336987_+|bacteriocin	bacteriocin ABC transporter ATP-binding protein	bacteriocin	G9BWD6	Planktothrix_phage	33.0	1.7e-19
AVG50765.1|2337074_2337365_-	hypothetical protein	NA	NA	NA	NA	NA
AVG50766.1|2337505_2337643_+	poly(glycerol-phosphate) alpha-glucosyltransferase	NA	NA	NA	NA	NA
AVG50767.1|2337731_2338088_-	DoxX family protein	NA	NA	NA	NA	NA
AVG50768.1|2338575_2339535_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AVG50769.1|2339580_2339712_-	hypothetical protein	NA	NA	NA	NA	NA
AVG50770.1|2339775_2340066_-	NINE protein	NA	A0A060AN66	Enterococcus_phage	38.0	7.5e-07
AVG50771.1|2340155_2340707_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AVG50772.1|2340758_2341697_-	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
AVG50773.1|2341847_2341952_+	hypothetical protein	NA	NA	NA	NA	NA
AVG50774.1|2342028_2343240_+	isochorismate synthase	NA	NA	NA	NA	NA
AVG50775.1|2343226_2344900_+	2-succinyl-5-enolpyruvyl-6-hydroxy-3- cyclohexene-1-carboxylate synthase	NA	NA	NA	NA	NA
AVG50776.1|2344886_2345690_+	2-succinyl-6-hydroxy-2, 4-cyclohexadiene-1-carboxylate synthase	NA	NA	NA	NA	NA
AVG50777.1|2345682_2346504_+	1,4-dihydroxy-2-naphthoyl-CoA synthase	NA	NA	NA	NA	NA
AVG50778.1|2346741_2347071_-	staphostatin B	NA	NA	NA	NA	NA
AVG50779.1|2347108_2348290_-|protease	cysteine protease staphopain B	protease	NA	NA	NA	NA
AVG50780.1|2348371_2349400_-|protease	serine protease	protease	A0A2H4PQP7	Staphylococcus_phage	32.3	6.3e-16
>prophage 8
CP026953	Staphylococcus aureus strain FDAARGOS_48 chromosome, complete genome	2834575	2368444	2376917	2834575		Synechococcus_phage(33.33%)	9	NA	NA
AVG50796.1|2368444_2368927_+	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	44.7	6.2e-22
AVG50797.1|2368913_2370038_+	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
AVG50798.1|2370041_2370746_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	M4R1E8	Synechococcus_phage	42.1	7.3e-48
AVG50799.1|2370745_2371009_+	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
AVG50800.1|2371010_2371682_+	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
AVG50801.1|2371674_2373864_+	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	39.8	3.5e-141
AVG50802.1|2373842_2375327_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	31.7	1.9e-45
AVG50803.1|2375319_2376348_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	41.7	3.4e-62
AVG50804.1|2376350_2376917_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	40.1	6.1e-29
