The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP026968	Staphylococcus aureus strain FDAARGOS_1 chromosome, complete genome	2840018	178638	223010	2840018	integrase,holin,terminase,portal,head,tail,capsid,protease	Staphylococcus_phage(92.86%)	70	178528:178545	223088:223105
178528:178545	attL	ATCATACAAGGATGGGAT	NA	NA	NA	NA
AVG68251.1|178638_179844_-|integrase	site-specific integrase	integrase	A0A1X9H094	Staphylococcus_phage	98.8	2.1e-220
AVG68252.1|179969_180584_+	ATPase	NA	A7TW88	Staphylococcus_phage	100.0	7.9e-107
AVG68253.1|180580_180727_-	hypothetical protein	NA	A0A2I6PEK8	Staphylococcus_phage	89.6	1.1e-14
AVG68254.1|180816_181212_-	hypothetical protein	NA	I1W601	Staphylococcus_phage	100.0	1.4e-69
AVG68255.1|181240_181675_-	hypothetical protein	NA	A0A2I6PEM0	Staphylococcus_phage	99.3	3.5e-24
AVG68256.1|181692_182154_-	toxin	NA	A0A2K9VBR7	Staphylococcus_phage	100.0	1.2e-83
AVG68257.1|182166_182481_-	XRE family transcriptional regulator	NA	A0A0N9BAW4	Staphylococcus_phage	100.0	9.8e-53
AVG68258.1|182632_182869_+	XRE family transcriptional regulator	NA	A0A2I6PD81	Staphylococcus_phage	100.0	1.5e-37
AVG68259.1|182882_183659_+	transcriptional regulator	NA	A0A2I6PD87	Staphylococcus_phage	99.6	1.4e-140
AVG68260.1|183687_183831_+	hypothetical protein	NA	W5R8I6	Staphylococcus_phage	100.0	2.5e-16
AVG68261.1|183820_184030_-	hypothetical protein	NA	W5R9J5	Staphylococcus_phage	100.0	1.2e-30
AVG68262.1|184085_184331_+	DUF2829 domain-containing protein	NA	A0A2I6PF15	Staphylococcus_phage	100.0	5.1e-41
AVG68263.1|184299_184665_-	hypothetical protein	NA	A0A2I6PF07	Staphylococcus_phage	99.2	1.2e-62
AVG68264.1|184719_184935_+	hypothetical protein	NA	A0A2I6PF01	Staphylococcus_phage	100.0	1.9e-31
AVG68265.1|184959_185223_+	helix-turn-helix domain-containing protein	NA	A7TWG0	Staphylococcus_phage	100.0	5.7e-46
AVG68266.1|185236_185398_+	DUF1270 domain-containing protein	NA	A0A2H4PQQ1	Staphylococcus_phage	98.1	1.2e-19
AVG68267.1|185489_185750_+	DUF1108 domain-containing protein	NA	Q4ZDA1	Staphylococcus_virus	100.0	1.2e-43
AVG68268.1|185759_185981_+	DUF2483 domain-containing protein	NA	A7TWM6	Staphylococcus_phage	100.0	3.2e-34
AVG68269.1|185973_186597_+	DUF1071 domain-containing protein	NA	A0A2H4PQQ6	Staphylococcus_phage	100.0	1.4e-114
AVG68270.1|186596_187025_+	single-stranded DNA-binding protein	NA	B2ZYV4	Staphylococcus_phage	100.0	3.9e-60
AVG68271.1|187038_187713_+	hypothetical protein	NA	A0A0E3XBQ6	Staphylococcus_phage	98.2	5.8e-127
AVG68272.1|187819_188668_-	DUF4393 domain-containing protein	NA	W5R9J9	Staphylococcus_phage	99.6	1.1e-159
AVG68273.1|188731_189445_+	helix-turn-helix domain-containing protein	NA	A0A1J0MGB2	Staphylococcus_phage	79.3	9.2e-91
AVG68274.1|189454_190234_+	DNA replication protein DnaC	NA	Q9G022	Staphylococcus_virus	100.0	2.4e-145
AVG68275.1|190401_190623_+	hypothetical protein	NA	A7TWN4	Staphylococcus_phage	100.0	1.3e-35
AVG68276.1|191041_191227_+	DUF3113 domain-containing protein	NA	A0A0H3U473	Staphylococcus_phage	100.0	4.1e-27
AVG68277.1|191227_191845_+	hypothetical protein	NA	A0A0H3U4U9	Staphylococcus_phage	100.0	4.2e-84
AVG68278.1|191844_192099_+	DUF3310 domain-containing protein	NA	Q6R831	Staphylococcus_virus	100.0	1.3e-42
AVG68279.1|192098_192347_+	hypothetical protein	NA	A0A2K9VBX5	Staphylococcus_phage	100.0	1.2e-40
AVG68280.1|192360_192567_+	hypothetical protein	NA	A0A0N9BAW9	Staphylococcus_phage	100.0	3.0e-34
AVG68281.1|192569_192974_+	hypothetical protein	NA	A0A0E3T8H9	Staphylococcus_phage	100.0	4.2e-72
AVG68282.1|192970_193165_+	hypothetical protein	NA	A0A0E3XCV8	Staphylococcus_phage	100.0	2.5e-27
AVG68283.1|193529_193919_+	acetyltransferase	NA	I1W604	Staphylococcus_phage	100.0	1.4e-69
AVG68284.1|193911_194160_+	DUF1024 domain-containing protein	NA	A0A2I6PEP2	Staphylococcus_phage	98.8	1.8e-38
AVG68285.1|194152_194689_+	dUTPase	NA	A0A2I6PEN6	Staphylococcus_phage	100.0	1.6e-95
AVG68286.1|194725_194932_+	DUF1381 domain-containing protein	NA	A0A2I6PEM9	Staphylococcus_phage	100.0	1.6e-19
AVG68287.1|194928_195132_+	hypothetical protein	NA	A0A2I6PEQ8	Staphylococcus_phage	100.0	3.4e-30
AVG68288.1|195124_195361_+	hypothetical protein	NA	A0A2I6PEM4	Staphylococcus_phage	100.0	2.8e-36
AVG68289.1|195344_195740_+	hypothetical protein	NA	A7TWI1	Staphylococcus_phage	99.2	8.2e-65
AVG68290.1|195736_195889_+	transcriptional regulator	NA	A0A2I6PEM5	Staphylococcus_phage	100.0	2.0e-19
AVG68291.1|195956_196157_+	DUF1514 domain-containing protein	NA	A0A2I6PEP5	Staphylococcus_phage	100.0	4.9e-26
AVG68292.1|196183_196390_-	hypothetical protein	NA	A0A1X9IGZ9	Staphylococcus_phage	100.0	7.6e-30
AVG68293.1|196444_197716_+	hypothetical protein	NA	A0A2I6PEP4	Staphylococcus_phage	96.3	6.0e-133
AVG68294.1|197728_198166_+	transcriptional regulator	NA	A0A2I6PDN2	Staphylococcus_phage	100.0	6.1e-77
AVG68295.1|198327_198642_+	HNH endonuclease	NA	A0A2I6PDR3	Staphylococcus_phage	100.0	8.5e-57
AVG68296.1|198767_199073_+|terminase	phage terminase small subunit P27 family	terminase	A0A2I6PDN6	Staphylococcus_phage	100.0	3.7e-49
AVG68297.1|199062_200754_+|terminase	terminase large subunit	terminase	A0A2I6PDP8	Staphylococcus_phage	99.8	0.0e+00
AVG68298.1|200758_201997_+|portal	phage portal protein	portal	A0A2I6PEA6	Staphylococcus_phage	100.0	6.9e-235
AVG68299.1|201980_202754_+|protease	Clp protease ClpP	protease	A0A2I6PE26	Staphylococcus_phage	100.0	4.9e-138
AVG68300.1|202765_203929_+|capsid	phage major capsid protein	capsid	A0A2I6PE62	Staphylococcus_phage	100.0	3.6e-217
AVG68301.1|203997_204276_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2I6PE36	Staphylococcus_phage	100.0	2.1e-46
AVG68302.1|204287_204620_+	hypothetical protein	NA	A0A2I6PDD6	Staphylococcus_phage	100.0	6.2e-58
AVG68303.1|204616_205018_+	hypothetical protein	NA	A0A2I6PDD3	Staphylococcus_phage	100.0	6.2e-68
AVG68304.1|205018_205414_+	DUF3168 domain-containing protein	NA	A0A2I6PDD8	Staphylococcus_phage	100.0	2.6e-66
AVG68305.1|205448_206090_+|tail	phage tail protein	tail	A0A2I6PE59	Staphylococcus_phage	100.0	1.0e-120
AVG68306.1|206181_206637_+|tail	phage tail protein	tail	A0A2I6PER6	Staphylococcus_phage	100.0	5.7e-78
AVG68307.1|206694_207045_+	hypothetical protein	NA	A0A2I6PEQ2	Staphylococcus_phage	100.0	1.1e-55
AVG68308.1|207086_207245_+	hypothetical protein	NA	A0A2I6PES8	Staphylococcus_phage	100.0	1.2e-19
AVG68309.1|207258_213459_+|tail	phage tail tape measure protein	tail	A0A1X9IGU9	Staphylococcus_phage	99.9	0.0e+00
AVG68310.1|213458_214283_+|tail	phage tail family protein	tail	A0A2I6PER3	Staphylococcus_phage	100.0	4.1e-159
AVG68311.1|214291_215875_+	peptidase	NA	Q8SDP1	Staphylococcus_virus	100.0	7.1e-309
AVG68312.1|215874_216165_+	hypothetical protein	NA	A0A2I6PF46	Staphylococcus_phage	100.0	2.1e-49
AVG68313.1|216180_218091_+	hypothetical protein	NA	A0A2I6PF35	Staphylococcus_phage	99.8	0.0e+00
AVG68314.1|218090_219557_+	DUF2479 domain-containing protein	NA	A0A2I6PEI6	Staphylococcus_phage	99.0	2.4e-271
AVG68315.1|219556_219946_+	hypothetical protein	NA	A0A2I6PER1	Staphylococcus_phage	100.0	2.2e-62
AVG68316.1|219938_220103_+	XkdX family protein	NA	A0A2I6PES4	Staphylococcus_phage	100.0	4.9e-24
AVG68317.1|220148_220448_+	DUF2951 domain-containing protein	NA	M9QRV2	Staphylococcus_phage	98.0	5.9e-31
AVG68318.1|220583_220886_+|holin	phage holin	holin	A0A2I6PET6	Staphylococcus_phage	100.0	7.0e-48
AVG68319.1|220897_222352_+	CHAP domain-containing protein	NA	B7T0L1	Staphylococcus_virus	98.6	2.5e-284
AVG68320.1|222710_223010_+	hypothetical protein	NA	A7TWL2	Staphylococcus_phage	94.7	8.4e-46
223088:223105	attR	ATCATACAAGGATGGGAT	NA	NA	NA	NA
>prophage 2
CP026968	Staphylococcus aureus strain FDAARGOS_1 chromosome, complete genome	2840018	618295	626116	2840018		Hokovirus(16.67%)	10	NA	NA
AVG68683.1|618295_619351_-	two-component sensor histidine kinase	NA	A0A1V0SGX0	Hokovirus	29.8	3.6e-14
AVG68684.1|619350_620037_-	DNA-binding response regulator	NA	NA	NA	NA	NA
AVG68685.1|620011_620485_-	DoxX family protein	NA	NA	NA	NA	NA
AVG68686.1|620827_621268_-	hypothetical protein	NA	NA	NA	NA	NA
AVG68687.1|621547_622132_-	hypothetical protein	NA	NA	NA	NA	NA
AVG68688.1|622230_622944_-	7-carboxy-7-deazaguanine synthase QueE	NA	A0A1U9WRB6	Streptococcus_virus	43.5	6.5e-52
AVG68689.1|622947_623367_-	6-carboxytetrahydropterin synthase QueD	NA	S4U060	uncultured_phage	28.7	6.3e-07
AVG68690.1|623368_624037_-	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	57.5	9.6e-66
AVG68691.1|624387_624981_+	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	42.9	4.4e-38
AVG68692.1|624964_626116_+	anthranilate synthase component I family protein	NA	S4VNU7	Pandoravirus	35.7	6.0e-23
>prophage 3
CP026968	Staphylococcus aureus strain FDAARGOS_1 chromosome, complete genome	2840018	642043	652694	2840018		uncultured_Caudovirales_phage(62.5%)	12	NA	NA
AVG68707.1|642043_643549_-	peptide MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	32.2	2.0e-58
AVG68708.1|643629_643875_-	hypothetical protein	NA	NA	NA	NA	NA
AVG68709.1|643904_644405_-	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	E7DN65	Pneumococcus_phage	71.5	5.9e-52
AVG68710.1|644424_645291_-	EamA/RhaT family transporter	NA	NA	NA	NA	NA
AVG68711.1|645675_645942_+	ribonucleoside-diphosphate reductase	NA	NA	NA	NA	NA
AVG68712.1|646091_646490_+	protein NrdI	NA	A0A2H4J545	uncultured_Caudovirales_phage	72.0	1.2e-52
AVG68713.1|646452_648558_+	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	A0A2H4J2N6	uncultured_Caudovirales_phage	91.7	0.0e+00
AVG68714.1|648675_649647_+	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	A0A2H4J4P3	uncultured_Caudovirales_phage	91.3	4.2e-171
AVG68715.1|649827_649983_+	hypothetical protein	NA	NA	NA	NA	NA
AVG70834.1|650021_650993_+	iron ABC transporter permease	NA	A0A2H4IY97	uncultured_Caudovirales_phage	78.9	4.3e-139
AVG68716.1|650979_651936_+	iron ABC transporter permease	NA	A0A2H4J116	uncultured_Caudovirales_phage	57.8	1.2e-05
AVG68717.1|651932_652694_+	iron ABC transporter ATP-binding protein	NA	Q9EMR9	Amsacta_moorei_entomopoxvirus	31.6	6.5e-18
>prophage 4
CP026968	Staphylococcus aureus strain FDAARGOS_1 chromosome, complete genome	2840018	738226	783868	2840018	integrase,holin,terminase,portal,head,tail,capsid,plate	Staphylococcus_phage(82.35%)	70	736314:736330	769779:769795
736314:736330	attL	GAAATTAGATAAAAACA	NA	NA	NA	NA
AVG68807.1|738226_739468_+	cysteine desulfurase	NA	Q2XUY6	environmental_halophage	44.8	8.2e-111
AVG68808.1|739457_739922_+	SUF system NifU family Fe-S cluster assembly protein	NA	NA	NA	NA	NA
AVG68809.1|740072_741470_+	Fe-S cluster assembly protein SufB	NA	NA	NA	NA	NA
AVG68810.1|741537_742587_-|integrase	site-specific integrase	integrase	A1KWY3	Staphylococcus_virus	99.7	4.5e-203
AVG68811.1|742699_742879_+	excisionase	NA	A0EWN7	Staphylococcus_virus	100.0	8.3e-25
AVG68812.1|742858_743791_-	hypothetical protein	NA	A0EWN8	Staphylococcus_virus	100.0	3.9e-174
AVG68813.1|743822_744284_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A0H4J322	Staphylococcus_phage	81.7	1.6e-64
AVG68814.1|744295_744628_-	XRE family transcriptional regulator	NA	A0A1J0MFC1	Staphylococcus_phage	73.6	4.7e-37
AVG68815.1|744820_745060_+	XRE family transcriptional regulator	NA	A0A2H4J9X2	uncultured_Caudovirales_phage	96.2	2.6e-37
AVG68816.1|745074_745863_+	phage antirepressor	NA	R9QSV3	Staphylococcus_phage	100.0	1.2e-144
AVG68817.1|745879_746074_+	hypothetical protein	NA	Q4ZDS1	Staphylococcus_virus	90.5	4.6e-21
AVG68818.1|746104_746248_+	hypothetical protein	NA	A0A2I6PDG0	Staphylococcus_phage	91.3	1.8e-14
AVG68819.1|746268_746826_-	hypothetical protein	NA	A0A2H4IYS4	uncultured_Caudovirales_phage	54.5	1.7e-47
AVG68820.1|746896_747118_+	hypothetical protein	NA	A0A0F6N3I2	Staphylococcus_phage	97.3	9.6e-31
AVG68821.1|747110_747272_+	DUF1270 domain-containing protein	NA	A0A2H4PQQ1	Staphylococcus_phage	100.0	3.3e-20
AVG68822.1|747363_747624_+	DUF1108 domain-containing protein	NA	Q4ZBM7	Staphylococcus_phage	100.0	1.2e-43
AVG68823.1|747633_747855_+	DUF2483 domain-containing protein	NA	A7TWM6	Staphylococcus_phage	100.0	3.2e-34
AVG68824.1|747847_748471_+	DUF1071 domain-containing protein	NA	A0A2H4PQQ6	Staphylococcus_phage	100.0	1.4e-114
AVG68825.1|748470_748899_+	single-stranded DNA-binding protein	NA	B2ZYV4	Staphylococcus_phage	100.0	3.9e-60
AVG68826.1|748912_749587_+	hypothetical protein	NA	R4IH15	Staphylococcus_phage	96.9	1.4e-125
AVG68827.1|749725_750007_-	hypothetical protein	NA	A0A1W6JPU7	Staphylococcus_phage	100.0	2.6e-49
AVG70837.1|750072_750843_+	replication protein	NA	G4KNP0	Staphylococcus_phage	100.0	6.4e-122
AVG68828.1|750852_751632_+	DNA replication protein DnaC	NA	Q4ZD93	Staphylococcus_virus	99.6	1.1e-145
AVG68829.1|751625_751784_+	hypothetical protein	NA	A0A2H4PQI7	Staphylococcus_phage	100.0	4.5e-22
AVG68830.1|751796_752018_+	hypothetical protein	NA	A0A0H3U2V4	Staphylococcus_phage	98.6	8.4e-35
AVG68831.1|752027_752432_+	DUF1064 domain-containing protein	NA	A1KX76	Staphylococcus_virus	99.3	1.6e-68
AVG68832.1|752436_752622_+	hypothetical protein	NA	A0A0F6N3K7	Staphylococcus_phage	100.0	1.1e-27
AVG68833.1|752622_752928_+	hypothetical protein	NA	A0A0F6N4H9	Staphylococcus_phage	100.0	1.7e-49
AVG68834.1|753055_753412_+	hypothetical protein	NA	A0A0F6N3E3	Staphylococcus_phage	99.2	1.9e-60
AVG68835.1|753415_753658_+	hypothetical protein	NA	A0A0F6N3E1	Staphylococcus_phage	98.8	1.9e-40
AVG68836.1|753666_754038_+	acetyltransferase	NA	A0A0F6N3K4	Staphylococcus_phage	100.0	3.6e-54
AVG68837.1|754030_754285_+	DUF1024 domain-containing protein	NA	A0A2I6PE79	Staphylococcus_phage	98.8	6.5e-39
AVG68838.1|754434_754971_+	dUTPase	NA	A0A2I6PEN6	Staphylococcus_phage	99.4	4.6e-95
AVG68839.1|755007_755214_+	DUF1381 domain-containing protein	NA	A0A0F6N4I4	Staphylococcus_phage	100.0	1.1e-20
AVG68840.1|755210_755405_+	hypothetical protein	NA	S4SX95	Staphylococcus_phage	100.0	7.9e-29
AVG68841.1|755401_755605_+	hypothetical protein	NA	B2ZYX5	Staphylococcus_phage	98.5	8.8e-31
AVG68842.1|755597_755771_+	transcriptional regulator	NA	A0A0F6N3E7	Staphylococcus_phage	100.0	2.2e-22
AVG68843.1|755771_755918_+	hypothetical protein	NA	B2ZYX7	Staphylococcus_phage	100.0	2.2e-15
AVG68844.1|755941_756364_+	DUF1492 domain-containing protein	NA	A0A0F6N3E5	Staphylococcus_phage	100.0	1.2e-74
AVG70838.1|756551_757046_+|terminase	terminase small subunit	terminase	A0A0F6N3K6	Staphylococcus_phage	100.0	7.8e-89
AVG68845.1|757048_758344_+|terminase	PBSX family phage terminase large subunit	terminase	A0A0F6N3L3	Staphylococcus_phage	100.0	3.0e-257
AVG68846.1|758354_759893_+|portal	phage portal protein	portal	A0A0F6N4I8	Staphylococcus_phage	100.0	2.4e-293
AVG68847.1|759899_760895_+|head	phage head morphogenesis protein	head	A0A0F6N3F1	Staphylococcus_phage	100.0	2.0e-184
AVG68848.1|760967_761138_+	hypothetical protein	NA	A0A0F6N3E9	Staphylococcus_phage	100.0	1.5e-23
AVG68849.1|761246_761867_+	DUF4355 domain-containing protein	NA	S4V984	Staphylococcus_phage	98.5	1.7e-69
AVG68850.1|761880_762855_+|capsid	phage major capsid protein	capsid	E0Y3L0	Staphylococcus_virus	100.0	2.2e-183
AVG68851.1|762876_763164_+	hypothetical protein	NA	S4V6D9	Staphylococcus_phage	98.9	1.4e-45
AVG68852.1|763172_763505_+|head,tail	phage head-tail adapter protein	head,tail	A0A0F6N3F4	Staphylococcus_phage	100.0	5.5e-54
AVG68853.1|763501_763804_+	hypothetical protein	NA	A4ZFB6	Staphylococcus_virus	100.0	1.1e-50
AVG68854.1|763803_764151_+	hypothetical protein	NA	A0A0F6N3F5	Staphylococcus_phage	100.0	4.1e-60
AVG68855.1|764162_764546_+	hypothetical protein	NA	B2ZYZ0	Staphylococcus_phage	100.0	2.6e-68
AVG68856.1|765207_765573_+|tail	phage tail protein	tail	A0A0F6N4J9	Staphylococcus_phage	99.2	1.8e-58
AVG68857.1|765602_765947_+	hypothetical protein	NA	A0A0F6N3F7	Staphylococcus_phage	100.0	2.5e-57
AVG68858.1|765963_769431_+	hypothetical protein	NA	A0A0F6N3F9	Staphylococcus_phage	100.0	4.2e-245
AVG68859.1|769443_770391_+|tail	phage tail family protein	tail	A0A0F6N3L4	Staphylococcus_phage	100.0	2.8e-183
769779:769795	attR	GAAATTAGATAAAAACA	NA	NA	NA	NA
AVG68860.1|770399_772298_+	peptidase	NA	A0A0F6N3M1	Staphylococcus_phage	100.0	0.0e+00
AVG68861.1|772312_774223_+	hypothetical protein	NA	A0A0F6N4K2	Staphylococcus_phage	99.8	0.0e+00
AVG68862.1|774222_776046_+|plate	phage baseplate upper protein	plate	A0A0F6N3G2	Staphylococcus_phage	99.8	0.0e+00
AVG68863.1|776045_776423_+	hypothetical protein	NA	A0A0F6N3G4	Staphylococcus_phage	100.0	1.5e-60
AVG68864.1|776426_776600_+	XkdX family protein	NA	A0A0F6N3L7	Staphylococcus_phage	100.0	6.6e-27
AVG70839.1|776639_776939_+	hypothetical protein	NA	A0A0F6N3M6	Staphylococcus_phage	100.0	9.9e-47
AVG68865.1|777075_778974_+	CHAP domain-containing protein	NA	A0A0F6N4K6	Staphylococcus_phage	100.0	0.0e+00
AVG68866.1|778986_780225_+	DUF2479 domain-containing protein	NA	E0Y3M8	Staphylococcus_virus	99.3	5.0e-209
AVG68867.1|780230_780626_+	hypothetical protein	NA	A0A2H4PQP8	Staphylococcus_phage	99.2	1.8e-67
AVG68868.1|780681_780957_+|holin	phage holin	holin	A0A0F6N3M0	Staphylococcus_phage	100.0	8.6e-45
AVG68869.1|780943_782356_+	CHAP domain-containing protein	NA	A0A0F6N3N1	Staphylococcus_phage	100.0	5.8e-286
AVG68870.1|782415_782973_-	hypothetical protein	NA	A0A0F6N4L1	Staphylococcus_phage	100.0	7.4e-96
AVG68871.1|783347_783500_+	hypothetical protein	NA	A0A0F6N3H2	Staphylococcus_phage	100.0	3.1e-20
AVG68872.1|783570_783681_+	hypothetical protein	NA	W5R8J7	Staphylococcus_phage	100.0	1.7e-12
AVG68873.1|783667_783868_+	hypothetical protein	NA	W5R9N2	Staphylococcus_phage	100.0	3.7e-29
>prophage 5
CP026968	Staphylococcus aureus strain FDAARGOS_1 chromosome, complete genome	2840018	866952	920076	2840018	tRNA,bacteriocin,holin,protease	Streptococcus_phage(28.57%)	55	NA	NA
AVG68952.1|866952_867942_-|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
AVG68953.1|868235_868631_+	transcriptional regulator Spx	NA	NA	NA	NA	NA
AVG68954.1|869001_869721_+	adaptor protein MecA	NA	NA	NA	NA	NA
AVG68955.1|869841_870828_+	competence protein CoiA	NA	NA	NA	NA	NA
AVG68956.1|870875_872684_+	oligoendopeptidase F	NA	A0A1X9I5X5	Streptococcus_phage	24.5	5.5e-47
AVG68957.1|873143_873950_-	DsbA family protein	NA	NA	NA	NA	NA
AVG68958.1|873972_874338_-	globin	NA	NA	NA	NA	NA
AVG68959.1|874441_875035_-	CYTH domain-containing protein	NA	NA	NA	NA	NA
AVG68960.1|875220_875568_+	hypothetical protein	NA	NA	NA	NA	NA
AVG68961.1|875584_876220_+	GTP pyrophosphokinase family protein	NA	NA	NA	NA	NA
AVG68962.1|876236_877046_+	NAD(+) kinase	NA	NA	NA	NA	NA
AVG68963.1|877042_877897_+	RluA family pseudouridine synthase	NA	NA	NA	NA	NA
AVG68964.1|877917_879303_+	magnesium transporter	NA	NA	NA	NA	NA
AVG68965.1|879312_881157_+	sodium:proton antiporter	NA	NA	NA	NA	NA
AVG68966.1|881434_882205_+	enoyl-[acyl-carrier-protein] reductase FabI	NA	NA	NA	NA	NA
AVG68967.1|882401_883487_-	AI-2E family transporter	NA	NA	NA	NA	NA
AVG68968.1|883828_885397_+	alanine:cation symporter family protein	NA	NA	NA	NA	NA
AVG68969.1|885541_886300_+	esterase family protein	NA	NA	NA	NA	NA
AVG68970.1|886493_887003_+	hypothetical protein	NA	NA	NA	NA	NA
AVG68971.1|887115_888324_-	MFS transporter	NA	NA	NA	NA	NA
AVG68972.1|888283_889459_-	diacylglycerol beta-glucosyltransferase	NA	NA	NA	NA	NA
AVG68973.1|889891_891376_+	UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--L- lysine ligase	NA	NA	NA	NA	NA
AVG68974.1|891356_891617_+	hypothetical protein	NA	NA	NA	NA	NA
AVG68975.1|891616_893179_+	peptide chain release factor 3	NA	A0A1S5SF82	Streptococcus_phage	28.2	2.2e-36
AVG68976.1|893480_894284_+	hypothetical protein	NA	S5MAL1	Bacillus_phage	40.5	1.6e-30
AVG68977.1|894502_896827_+	PDZ domain-containing protein	NA	W5SAB9	Pithovirus	27.4	2.8e-11
AVG68978.1|896843_898202_+	Ktr system potassium uptake protein D	NA	NA	NA	NA	NA
AVG68979.1|898340_899852_+	bifunctional metallophosphatase/5'-nucleotidase	NA	NA	NA	NA	NA
AVG68980.1|900338_900908_-	competence protein ComK	NA	NA	NA	NA	NA
AVG68981.1|901117_901336_+	IDEAL domain-containing protein	NA	NA	NA	NA	NA
AVG68982.1|901416_902403_-	lipoate--protein ligase	NA	NA	NA	NA	NA
AVG68983.1|902601_902778_+	DUF2187 domain-containing protein	NA	NA	NA	NA	NA
AVG68984.1|902792_903395_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
AVG70841.1|903694_903772_+|holin	putative holin-like toxin	holin	NA	NA	NA	NA
AVG68985.1|904310_904412_+	hypothetical protein	NA	NA	NA	NA	NA
AVG70842.1|904421_904694_+|bacteriocin	lactococcin 972 family bacteriocin	bacteriocin	NA	NA	NA	NA
AVG68986.1|904737_906702_+	DUF1430 domain-containing protein	NA	NA	NA	NA	NA
AVG68987.1|906704_907025_+	hypothetical protein	NA	NA	NA	NA	NA
AVG68988.1|907021_907663_+|bacteriocin	bacteriocin ABC transporter ATP-binding protein	bacteriocin	G9BWD6	Planktothrix_phage	33.0	1.7e-19
AVG68989.1|907750_908041_-	hypothetical protein	NA	NA	NA	NA	NA
AVG68990.1|908181_908319_+	poly(glycerol-phosphate) alpha-glucosyltransferase	NA	NA	NA	NA	NA
AVG68991.1|908407_908764_-	DoxX family protein	NA	NA	NA	NA	NA
AVG68992.1|909251_910211_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AVG68993.1|910256_910388_-	hypothetical protein	NA	NA	NA	NA	NA
AVG68994.1|910451_910742_-	NINE protein	NA	A0A060AN66	Enterococcus_phage	38.0	7.5e-07
AVG68995.1|910831_911383_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AVG68996.1|911434_912373_-	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
AVG68997.1|912523_912628_+	hypothetical protein	NA	NA	NA	NA	NA
AVG68998.1|912704_913916_+	isochorismate synthase	NA	NA	NA	NA	NA
AVG68999.1|913902_915576_+	2-succinyl-5-enolpyruvyl-6-hydroxy-3- cyclohexene-1-carboxylate synthase	NA	NA	NA	NA	NA
AVG69000.1|915562_916366_+	2-succinyl-6-hydroxy-2, 4-cyclohexadiene-1-carboxylate synthase	NA	NA	NA	NA	NA
AVG69001.1|916358_917180_+	1,4-dihydroxy-2-naphthoyl-CoA synthase	NA	NA	NA	NA	NA
AVG69002.1|917417_917747_-	staphostatin B	NA	NA	NA	NA	NA
AVG69003.1|917784_918966_-|protease	cysteine protease staphopain B	protease	NA	NA	NA	NA
AVG69004.1|919047_920076_-|protease	serine protease	protease	A0A2H4PQP7	Staphylococcus_phage	32.3	6.3e-16
>prophage 6
CP026968	Staphylococcus aureus strain FDAARGOS_1 chromosome, complete genome	2840018	939120	947593	2840018		Synechococcus_phage(33.33%)	9	NA	NA
AVG69020.1|939120_939603_+	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	44.7	6.2e-22
AVG69021.1|939589_940714_+	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
AVG69022.1|940717_941422_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	M4R1E8	Synechococcus_phage	42.1	7.3e-48
AVG69023.1|941421_941685_+	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
AVG69024.1|941686_942358_+	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
AVG69025.1|942350_944540_+	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	39.8	3.5e-141
AVG69026.1|944518_946003_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	31.7	1.9e-45
AVG69027.1|945995_947024_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	41.7	3.4e-62
AVG69028.1|947026_947593_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	40.1	6.1e-29
>prophage 7
CP026968	Staphylococcus aureus strain FDAARGOS_1 chromosome, complete genome	2840018	1564403	1573446	2840018	tRNA	uncultured_Mediterranean_phage(50.0%)	7	NA	NA
AVG69597.1|1564403_1564922_-	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	46.5	5.6e-29
AVG69598.1|1564943_1567217_-	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	29.3	8.1e-64
AVG69599.1|1567419_1569699_-	protein translocase subunit SecDF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	35.8	1.8e-31
AVG69600.1|1569973_1570234_-	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	35.3	8.2e-05
AVG69601.1|1570252_1571392_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	44.7	5.4e-85
AVG69602.1|1571414_1572440_-|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
AVG69603.1|1572441_1573446_-	Holliday junction branch migration DNA helicase RuvB	NA	B3GAM6	uncultured_virus	29.1	1.7e-05
>prophage 8
CP026968	Staphylococcus aureus strain FDAARGOS_1 chromosome, complete genome	2840018	1687474	1758693	2840018	tRNA,protease	Staphylococcus_phage(95.74%)	67	NA	NA
AVG69708.1|1687474_1688119_-|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
AVG69709.1|1688133_1688925_-	phosphotransferase	NA	NA	NA	NA	NA
AVG69710.1|1689474_1690323_-	D-amino-acid transaminase	NA	NA	NA	NA	NA
AVG69711.1|1690326_1691736_-	dipeptidase PepV	NA	NA	NA	NA	NA
AVG69712.1|1692293_1692716_-	YtxH domain-containing protein	NA	NA	NA	NA	NA
AVG69713.1|1692732_1693428_-	rRNA pseudouridine synthase	NA	NA	NA	NA	NA
AVG69714.1|1693424_1695086_-	polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
AVG69715.1|1695492_1696761_+	NAD(P)/FAD-dependent oxidoreductase	NA	A0A2H4PQX1	Staphylococcus_phage	99.1	9.1e-57
AVG69716.1|1696877_1703438_-	YSIRK signal domain/LPXTG anchor domain surface protein	NA	A0A2H4PQU6	Staphylococcus_phage	98.3	6.1e-306
AVG69717.1|1703763_1704075_-	rhodanese-like domain-containing protein	NA	A0A2H4PQR9	Staphylococcus_phage	99.0	4.8e-52
AVG69718.1|1704096_1706514_-|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	99.5	0.0e+00
AVG69719.1|1706801_1707983_-	MFS transporter	NA	A0A2H4PQR6	Staphylococcus_phage	99.7	7.3e-218
AVG69720.1|1708092_1709046_+	TIGR01212 family radical SAM protein	NA	A0A2H4PQV5	Staphylococcus_phage	100.0	2.2e-79
AVG69721.1|1709042_1709606_+	methyltransferase domain-containing protein	NA	A0A2H4PQV0	Staphylococcus_phage	99.5	8.3e-103
AVG69722.1|1709728_1710130_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
AVG69723.1|1710701_1711529_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
AVG69724.1|1711531_1711651_-	hypothetical protein	NA	NA	NA	NA	NA
AVG69725.1|1711762_1712764_+	proline dehydrogenase	NA	A0A2H4PQT6	Staphylococcus_phage	99.4	2.6e-184
AVG69726.1|1712885_1713350_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	100.0	4.5e-70
AVG69727.1|1713362_1714544_-	riboflavin biosynthesis protein RibBA	NA	A0A2H4PQS2	Staphylococcus_phage	99.5	5.6e-226
AVG69728.1|1714554_1715187_-	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	98.6	5.5e-111
AVG70867.1|1715193_1716225_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	98.8	4.0e-196
AVG69729.1|1716717_1718220_-	pyridine nucleotide-disulfide oxidoreductase	NA	A0A2H4PQX2	Staphylococcus_phage	98.6	1.9e-29
AVG69730.1|1718742_1719057_+	ArsR family transcriptional regulator	NA	A0A2H4PQT4	Staphylococcus_phage	98.1	9.8e-53
AVG69731.1|1719056_1720349_+	arsenical efflux pump membrane protein ArsB	NA	A0A2H4PQU3	Staphylococcus_phage	99.5	5.0e-228
AVG69732.1|1720435_1721290_-	autolysin	NA	Q4ZCC7	Staphylococcus_virus	38.6	9.8e-39
AVG69733.1|1721565_1721790_-	hypothetical protein	NA	NA	NA	NA	NA
AVG69734.1|1721988_1722459_+	RNA polymerase sigma factor SigS	NA	A0A2H4PQT5	Staphylococcus_phage	98.1	8.8e-82
AVG69735.1|1722571_1723015_+	competence protein ComK	NA	NA	NA	NA	NA
AVG69736.1|1723001_1723445_-	hypothetical protein	NA	A0A2H4PQT8	Staphylococcus_phage	98.6	2.4e-57
AVG69737.1|1723740_1724376_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
AVG69738.1|1724815_1725529_-	transaldolase	NA	M1PR54	Cyanophage	35.3	5.5e-19
AVG69739.1|1725788_1726091_+	hypothetical protein	NA	NA	NA	NA	NA
AVG69740.1|1726346_1726712_+	fluoride efflux transporter CrcB	NA	A0A2H4PQR0	Staphylococcus_phage	100.0	3.6e-59
AVG69741.1|1726708_1727062_+	camphor resistance protein CrcB	NA	A0A2H4PQQ7	Staphylococcus_phage	94.0	3.8e-21
AVG69742.1|1728664_1729498_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	99.3	7.8e-158
AVG69743.1|1729709_1730618_-	NERD domain-containing protein	NA	A0A2H4PQQ8	Staphylococcus_phage	100.0	3.4e-138
AVG69744.1|1730739_1731936_-	S-adenosylmethionine synthase	NA	A0A2H4PQS6	Staphylococcus_phage	99.5	4.3e-218
AVG69745.1|1732307_1733900_+	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	100.0	0.0e+00
AVG70868.1|1734277_1735024_-	S9 family peptidase	NA	A0A2H4PQM6	Staphylococcus_phage	98.8	1.4e-142
AVG69746.1|1735028_1735502_-	nucleoside triphosphatase YtkD	NA	A0A2H4PQM4	Staphylococcus_phage	98.7	7.2e-84
AVG69747.1|1735567_1735825_+	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	100.0	7.2e-46
AVG69748.1|1735821_1736823_-	o-succinylbenzoate synthase	NA	A0A2H4PQM0	Staphylococcus_phage	97.0	2.6e-184
AVG69749.1|1736827_1738306_-	2-succinylbenzoate-CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	97.6	2.8e-283
AVG70869.1|1738464_1738920_-	DUF4909 domain-containing protein	NA	A0A2H4PQN7	Staphylococcus_phage	99.3	3.6e-80
AVG69750.1|1739222_1739873_+	calcium-binding protein	NA	A0A2H4PQM8	Staphylococcus_phage	94.0	2.9e-51
AVG69751.1|1739953_1740949_+	DUF4352 domain-containing protein	NA	A0A2H4PQN2	Staphylococcus_phage	97.9	2.6e-67
AVG69752.1|1741023_1741650_+	hypothetical protein	NA	A0A2H4PQM7	Staphylococcus_phage	79.3	2.0e-73
AVG69753.1|1741690_1742032_+	DUF3969 domain-containing protein	NA	A0A2H4PQN6	Staphylococcus_phage	94.7	1.1e-54
AVG69754.1|1742132_1742705_+	hypothetical protein	NA	A0A2H4PQN4	Staphylococcus_phage	93.1	2.3e-23
AVG69755.1|1744277_1744379_+	hypothetical protein	NA	NA	NA	NA	NA
AVG69756.1|1745454_1746684_-	restriction endonuclease subunit S	NA	A0A2H4PQP5	Staphylococcus_phage	64.7	4.0e-134
AVG69757.1|1746676_1748416_-	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	100.0	2.4e-289
AVG69758.1|1748396_1748531_-	hypothetical protein	NA	NA	NA	NA	NA
AVG69759.1|1748593_1749313_-|protease	serine protease SplF	protease	A0A2H4PQP1	Staphylococcus_phage	99.6	1.9e-131
AVG69760.1|1749414_1749522_+	hypothetical protein	NA	NA	NA	NA	NA
AVG69761.1|1749470_1750190_-|protease	serine protease SplD	protease	A0A2H4PQP9	Staphylococcus_phage	99.6	4.6e-130
AVG69762.1|1750310_1751030_-|protease	serine protease	protease	A0A2H4PQP7	Staphylococcus_phage	98.3	6.6e-129
AVG69763.1|1751087_1751810_-|protease	serine protease SplB	protease	A0A2H4PQN0	Staphylococcus_phage	98.3	3.5e-130
AVG69764.1|1751934_1752642_-|protease	serine protease SplA	protease	A0A2H4PQN3	Staphylococcus_phage	97.0	7.9e-127
AVG69765.1|1753077_1753296_-	hypothetical protein	NA	NA	NA	NA	NA
AVG69766.1|1753605_1754187_+	DUF4888 domain-containing protein	NA	A0A2H4PQH6	Staphylococcus_phage	64.2	2.8e-53
AVG69767.1|1754659_1754878_-	hypothetical protein	NA	A0A2H4PQH0	Staphylococcus_phage	80.6	2.0e-25
AVG69768.1|1755133_1755607_+	hypothetical protein	NA	NA	NA	NA	NA
AVG69769.1|1755611_1756403_+	DUF1828 domain-containing protein	NA	NA	NA	NA	NA
AVG69770.1|1756772_1757756_-	bi-component leukocidin LukED subunit D	NA	A0A2H4PQH7	Staphylococcus_phage	99.4	1.8e-185
AVG69771.1|1757757_1758693_-	beta-channel forming cytolysin	NA	A0A2H4PQI5	Staphylococcus_phage	100.0	1.4e-174
>prophage 9
CP026968	Staphylococcus aureus strain FDAARGOS_1 chromosome, complete genome	2840018	1852514	1949391	2840018	tRNA,integrase,holin,transposase,terminase,head,portal,tail,capsid,protease	Staphylococcus_phage(83.13%)	121	1848951:1848975	1951336:1951360
1848951:1848975	attL	ACCCCAACTTGCATTGTCTGTAGAA	NA	NA	NA	NA
AVG69857.1|1852514_1852817_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase GatCAB subunit C	tRNA	NA	NA	NA	NA
AVG69858.1|1853183_1854722_+	sodium:proline symporter	NA	NA	NA	NA	NA
AVG69859.1|1854810_1856010_-	CamS family sex pheromone protein	NA	NA	NA	NA	NA
AVG69860.1|1856022_1858026_-	DNA ligase (NAD(+)) LigA	NA	A0A0K2QQN8	Ralstonia_phage	36.2	1.2e-114
AVG69861.1|1858029_1860222_-	DNA helicase PcrA	NA	A7KV33	Bacillus_phage	42.2	1.0e-135
AVG69862.1|1860218_1860911_-	geranylgeranylglyceryl/heptaprenylglyceryl phosphate synthase	NA	NA	NA	NA	NA
AVG69863.1|1861082_1861385_-	hypothetical protein	NA	NA	NA	NA	NA
AVG69864.1|1861493_1862789_-	adenylosuccinate lyase	NA	A0A1B3B081	Gordonia_phage	32.9	1.6e-16
AVG69865.1|1863648_1864815_+|protease	cysteine protease staphopain A	protease	NA	NA	NA	NA
AVG69866.1|1864845_1865172_+	staphostatin A	NA	NA	NA	NA	NA
AVG69867.1|1865463_1865637_-	NETI motif-containing protein	NA	NA	NA	NA	NA
AVG69868.1|1865617_1866220_-	DUF2179 domain-containing protein	NA	NA	NA	NA	NA
AVG69869.1|1866490_1867312_-	NAD(+) synthetase	NA	G3MA24	Bacillus_virus	52.7	2.3e-69
AVG69870.1|1867304_1868774_-	nicotinate phosphoribosyltransferase	NA	G3MA18	Bacillus_virus	45.1	5.9e-108
AVG69871.1|1868957_1870034_+	nitric oxide synthase oxygenase	NA	NA	NA	NA	NA
AVG69872.1|1870053_1870848_+	ACT domain-containing protein	NA	NA	NA	NA	NA
AVG69873.1|1870919_1871027_+	hypothetical protein	NA	NA	NA	NA	NA
AVG69874.1|1871037_1872600_-	sodium-dependent dicarboxylate transporter SdcS	NA	NA	NA	NA	NA
AVG69875.1|1872804_1873902_-	pectate lyase	NA	U5PWM6	Bacillus_phage	34.3	1.3e-46
AVG69876.1|1874270_1874831_+	cysteine hydrolase	NA	G3MA16	Bacillus_virus	41.2	2.0e-32
AVG69877.1|1874883_1875813_+	manganese-dependent inorganic pyrophosphatase	NA	NA	NA	NA	NA
AVG69878.1|1876005_1876179_-	hypothetical protein	NA	NA	NA	NA	NA
AVG69879.1|1876230_1877610_+	aldehyde dehydrogenase	NA	NA	NA	NA	NA
AVG69880.1|1877729_1878758_-	hypothetical protein	NA	NA	NA	NA	NA
AVG69881.1|1879216_1879597_-	penicillinase repressor BlaI	NA	NA	NA	NA	NA
AVG69882.1|1879586_1881344_-	beta-lactam sensor/signal transducer BlaR1	NA	NA	NA	NA	NA
AVG69883.1|1881450_1882296_+	penicillin-hydrolyzing class A beta-lactamase BlaZ	NA	A0A1B0VBP7	Salmonella_phage	33.9	4.4e-31
AVG69884.1|1882600_1883020_+	YolD-like family protein	NA	U3PG23	Staphylococcus_phage	53.5	3.1e-30
AVG69885.1|1884436_1884802_-|transposase	transposase	transposase	NA	NA	NA	NA
AVG70874.1|1884810_1886838_-|transposase	transposase	transposase	NA	NA	NA	NA
AVG69886.1|1886876_1888028_-|transposase	transposase	transposase	P97010	Streptococcus_pyogenes_phage	31.6	1.8e-11
AVG69887.1|1889050_1889224_-	hypothetical protein	NA	NA	NA	NA	NA
AVG69888.1|1889674_1890715_+	linear amide C-N hydrolase	NA	NA	NA	NA	NA
AVG69889.1|1890771_1891614_-	hypothetical protein	NA	NA	NA	NA	NA
AVG69890.1|1891610_1892168_-	DUF1700 domain-containing protein	NA	NA	NA	NA	NA
AVG69891.1|1892227_1892752_-	hypothetical protein	NA	NA	NA	NA	NA
AVG69892.1|1892872_1893436_+	thioredoxin family protein	NA	NA	NA	NA	NA
AVG69893.1|1893501_1894242_-	phenol-soluble modulin export ABC transporter permease subunit PmtD	NA	NA	NA	NA	NA
AVG69894.1|1894241_1895114_-	phenol-soluble modulin export ABC transporter ATP-binding protein PmtC	NA	A0A2H4PQG7	Staphylococcus_phage	36.0	1.0e-27
AVG69895.1|1895110_1895791_-	phenol-soluble modulin export ABC transporter permease subunit PmtB	NA	NA	NA	NA	NA
AVG69896.1|1895791_1896688_-	phenol-soluble modulin export ABC transporter ATP-binding protein PmtA	NA	A0A2H4PQG7	Staphylococcus_phage	30.2	5.0e-17
AVG69897.1|1896684_1897065_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AVG69898.1|1897322_1897499_-	hypothetical protein	NA	NA	NA	NA	NA
AVG69899.1|1897741_1897840_-	hypothetical protein	NA	NA	NA	NA	NA
AVG69900.1|1898039_1899326_+	aspartate aminotransferase	NA	NA	NA	NA	NA
AVG69901.1|1899604_1899895_-	MAP domain-containing protein	NA	NA	NA	NA	NA
AVG69902.1|1899905_1901339_-	MAP domain-containing protein	NA	NA	NA	NA	NA
AVG69903.1|1901724_1901925_+	hypothetical protein	NA	A0A1P8L6A7	Staphylococcus_phage	100.0	3.4e-27
AVG69904.1|1902296_1902476_+	hypothetical protein	NA	A0A1W6JQ29	Staphylococcus_phage	100.0	2.2e-25
AVG69905.1|1902499_1902808_+	hypothetical protein	NA	M9NTD8	Staphylococcus_phage	77.5	9.3e-24
AVG69906.1|1902786_1903047_+	hypothetical protein	NA	M9NS66	Staphylococcus_phage	100.0	2.3e-23
AVG69907.1|1903099_1903450_-	inhibitor	NA	A7TWS0	Staphylococcus_phage	100.0	7.5e-54
AVG69908.1|1904132_1904582_+	chemotaxis inhibitory protein	NA	A0A075LZI2	Staphylococcus_phage	100.0	8.7e-79
AVG69909.1|1904876_1905131_-	amidase	NA	Q4ZCK0	Staphylococcus_virus	90.7	3.4e-11
AVG69910.1|1905057_1905213_+	amidase	NA	NA	NA	NA	NA
AVG69911.1|1905659_1906151_-	kinase	NA	A7TWR8	Staphylococcus_phage	100.0	8.0e-86
AVG69912.1|1906341_1907097_-	CHAP domain-containing protein	NA	D2JLG5	Staphylococcus_phage	100.0	3.4e-152
AVG69913.1|1907108_1907363_-|holin	phage holin	holin	D2JLG4	Staphylococcus_phage	100.0	4.1e-41
AVG69914.1|1907414_1907522_+	hypothetical protein	NA	NA	NA	NA	NA
AVG69915.1|1907574_1907751_-|holin	putative holin-like toxin	holin	D2JLG3	Staphylococcus_phage	96.6	6.5e-22
AVG69916.1|1907893_1908268_-	hypothetical protein	NA	G4KNR3	Staphylococcus_phage	100.0	3.3e-39
AVG69917.1|1908323_1908611_-	hypothetical protein	NA	C5I682	Staphylococcus_phage	100.0	9.9e-44
AVG69918.1|1908656_1908809_-	hypothetical protein	NA	A0A1W6JPL6	Staphylococcus_phage	100.0	7.6e-19
AVG69919.1|1908801_1912584_-	hypothetical protein	NA	A0A068A201	Staphylococcus_phage	99.8	0.0e+00
AVG69920.1|1912599_1914084_-|tail	phage tail protein	tail	A0A2I6PDJ0	Staphylococcus_phage	100.0	1.2e-297
AVG69921.1|1914080_1918610_-|tail	phage tail tape measure protein	tail	W5R8I2	Staphylococcus_phage	95.0	0.0e+00
AVG69922.1|1918854_1919205_-	hypothetical protein	NA	G4KNQ8	Staphylococcus_phage	100.0	7.8e-59
AVG69923.1|1919254_1919479_-	hypothetical protein	NA	A0A075LYE8	Staphylococcus_phage	100.0	3.0e-32
AVG69924.1|1919520_1920165_-|tail	phage tail protein	tail	G4KNQ7	Staphylococcus_phage	100.0	6.5e-120
AVG69925.1|1920165_1920573_-	hypothetical protein	NA	G4KNQ6	Staphylococcus_phage	100.0	7.1e-72
AVG69926.1|1920569_1920974_-	hypothetical protein	NA	G4KNQ5	Staphylococcus_phage	100.0	4.3e-69
AVG69927.1|1920970_1921333_-|head,tail	phage head-tail adapter protein	head,tail	G4KNQ4	Staphylococcus_phage	100.0	4.4e-65
AVG69928.1|1921316_1921601_-|head,tail	phage head-tail adapter protein	head,tail	A0A2I6PDJ5	Staphylococcus_phage	100.0	2.3e-45
AVG69929.1|1921590_1921875_-	hypothetical protein	NA	A0A2I6PDJ3	Staphylococcus_phage	100.0	1.8e-45
AVG69930.1|1921894_1923040_-|capsid	phage major capsid protein	capsid	G4KNQ3	Staphylococcus_phage	100.0	9.6e-215
AVG69931.1|1923063_1923801_-|protease	Clp protease ClpP	protease	G4KNQ2	Staphylococcus_phage	100.0	1.8e-129
AVG69932.1|1923784_1924972_-|portal	phage portal protein	portal	G4KNQ1	Staphylococcus_phage	100.0	4.6e-220
AVG69933.1|1924987_1926649_-|terminase	terminase large subunit	terminase	A0A2I6PDJ8	Staphylococcus_phage	98.6	0.0e+00
AVG69934.1|1926645_1926990_-	hypothetical protein	NA	G4KNP9	Staphylococcus_phage	100.0	9.4e-57
AVG69935.1|1927119_1927419_-	HNH endonuclease	NA	A0EWY8	Staphylococcus_phage	100.0	4.6e-52
AVG69936.1|1927650_1928067_-	transcriptional regulator	NA	G4KNP7	Staphylococcus_phage	100.0	1.3e-76
AVG69937.1|1928094_1928295_-	hypothetical protein	NA	A0A2I6PDV9	Staphylococcus_phage	100.0	1.4e-28
AVG69938.1|1928294_1928444_-	transcriptional regulator	NA	A0A1W6JPZ2	Staphylococcus_phage	100.0	4.8e-18
AVG69939.1|1928440_1928827_-	hypothetical protein	NA	A0A1X9IGZ2	Staphylococcus_phage	100.0	3.0e-64
AVG69940.1|1928819_1929056_-	hypothetical protein	NA	A0A2I6PEM4	Staphylococcus_phage	100.0	2.8e-36
AVG69941.1|1929048_1929252_-	hypothetical protein	NA	A0A2I6PEQ8	Staphylococcus_phage	100.0	3.4e-30
AVG69942.1|1929248_1929455_-	DUF1381 domain-containing protein	NA	A0A2I6PEM9	Staphylococcus_phage	100.0	1.6e-19
AVG69943.1|1929491_1930025_-	dUTPase	NA	A0A2I6PEN6	Staphylococcus_phage	98.9	8.7e-94
AVG69944.1|1930646_1930898_-	DUF1024 domain-containing protein	NA	G4KNP4	Staphylococcus_phage	96.4	4.1e-38
AVG69945.1|1930890_1931241_-	acetyltransferase	NA	A0A0F6N3K4	Staphylococcus_phage	90.0	2.2e-45
AVG69946.1|1931249_1931492_-	hypothetical protein	NA	A0A1P8L6E3	Staphylococcus_phage	100.0	3.0e-41
AVG69947.1|1931495_1931864_-	hypothetical protein	NA	A0A0H4J337	Staphylococcus_phage	98.4	6.3e-51
AVG69948.1|1932290_1932509_-	hypothetical protein	NA	A0A1P8L6E4	Staphylococcus_phage	100.0	1.4e-37
AVG69949.1|1932515_1933385_-	DnaD domain protein	NA	A0EWX4	Staphylococcus_phage	96.6	5.9e-132
AVG69950.1|1933414_1933885_-	single-stranded DNA-binding protein	NA	S4V682	Staphylococcus_phage	96.2	3.1e-79
AVG69951.1|1933885_1934503_-	MBL fold metallo-hydrolase	NA	A0A1W6JPL3	Staphylococcus_phage	99.4	3.5e-86
AVG69952.1|1934583_1935504_-	recombinase	NA	A0A2I6PDH5	Staphylococcus_phage	100.0	2.3e-166
AVG69953.1|1935505_1937449_-	ATPase	NA	I1W619	Staphylococcus_phage	98.6	0.0e+00
AVG69954.1|1937457_1937721_-	hypothetical protein	NA	A0A2I6PDG2	Staphylococcus_phage	100.0	7.7e-43
AVG69955.1|1937729_1937990_-	DUF1108 domain-containing protein	NA	A0EWW8	Staphylococcus_phage	96.5	4.4e-43
AVG69956.1|1937994_1938297_-	hypothetical protein	NA	A0A0F6N3N3	Staphylococcus_phage	97.0	1.0e-46
AVG69957.1|1938389_1938551_-	DUF1270 domain-containing protein	NA	Q4ZAZ7	Staphylococcus_virus	100.0	2.5e-20
AVG69958.1|1938547_1938868_-	DUF771 domain-containing protein	NA	A0A1W6JPI1	Staphylococcus_phage	100.0	7.4e-56
AVG69959.1|1938897_1939116_-	hypothetical protein	NA	A0A068A2A3	Staphylococcus_phage	98.6	4.3e-31
AVG69960.1|1939112_1939439_-	hypothetical protein	NA	G4KNN2	Staphylococcus_phage	100.0	5.4e-54
AVG69961.1|1939488_1939812_+	hypothetical protein	NA	A0ZS13	Staphylococcus_virus	99.1	6.5e-52
AVG69962.1|1939765_1940005_-	hypothetical protein	NA	A0ZS12	Staphylococcus_virus	100.0	2.9e-33
AVG69963.1|1940063_1940267_+	hypothetical protein	NA	A0A2H4JBA9	uncultured_Caudovirales_phage	66.1	9.5e-17
AVG69964.1|1940383_1941127_-	oxidoreductase	NA	A0A0H3U319	Staphylococcus_phage	100.0	2.3e-137
AVG69965.1|1941177_1941507_+	hypothetical protein	NA	A0A0H3U4Z1	Staphylococcus_phage	99.1	3.9e-52
AVG69966.1|1941495_1941711_-	DUF2829 domain-containing protein	NA	A0A0H3U4C7	Staphylococcus_phage	100.0	4.8e-35
AVG69967.1|1941726_1941990_-	XRE family transcriptional regulator	NA	A0A2I6PF09	Staphylococcus_phage	100.0	7.2e-41
AVG69968.1|1941986_1942160_-	transcriptional regulator	NA	NA	NA	NA	NA
AVG69969.1|1942122_1942836_+	XRE family transcriptional regulator	NA	M9NUL0	Staphylococcus_phage	99.6	3.5e-130
AVG69970.1|1942851_1943784_+	ATP-dependent helicase	NA	A0A2I6PEZ7	Staphylococcus_phage	99.7	2.8e-172
AVG69971.1|1943789_1944131_+	hypothetical protein	NA	A0A2I6PF04	Staphylococcus_phage	100.0	4.6e-56
AVG69972.1|1944334_1944517_+	hypothetical protein	NA	M9NSW6	Staphylococcus_phage	100.0	4.1e-27
AVG69973.1|1944616_1945081_+	hypothetical protein	NA	A0EWV3	Staphylococcus_phage	100.0	1.1e-28
AVG69974.1|1945139_1946177_+|integrase	site-specific integrase	integrase	A0EWV2	Staphylococcus_phage	99.7	1.5e-179
AVG69975.1|1947297_1948314_-	bi-component leukocidin LukGH subunit G	NA	A0A1X9IGW5	Staphylococcus_phage	30.2	6.7e-26
AVG69976.1|1948335_1949391_-	bi-component leukocidin LukGH subunit H	NA	A0A1X9IGW5	Staphylococcus_phage	34.3	2.8e-35
1951336:1951360	attR	ACCCCAACTTGCATTGTCTGTAGAA	NA	NA	NA	NA
