The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP014051	Salmonella enterica strain LT2 chromosome, complete genome	4857490	1192363	1239407	4857490	tRNA,tail,plate	Burkholderia_phage(40.91%)	50	NA	NA
AMG25383.1|1192363_1193362_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
AMG25384.1|1193449_1194760_-	conjugal transfer protein	NA	NA	NA	NA	NA
AMG25385.1|1195006_1195522_+	transcriptional regulator Zur	NA	NA	NA	NA	NA
AMG25386.1|1195620_1195830_-	CsbD family protein	NA	NA	NA	NA	NA
AMG25387.2|1195851_1195965_-	hypothetical protein	NA	NA	NA	NA	NA
AMG25388.1|1195961_1197287_-	MATE family efflux transporter	NA	NA	NA	NA	NA
AMG25389.1|1197465_1198074_-	LexA repressor	NA	Q9G0C2	Lactococcus_phage	38.0	1.0e-13
AMG25390.1|1198182_1198551_-	diacylglycerol kinase	NA	NA	NA	NA	NA
AMG25391.1|1198721_1201142_+	glycerol-3-phosphate 1-O-acyltransferase	NA	NA	NA	NA	NA
AMG25392.1|1201240_1202113_-	4-hydroxybenzoate octaprenyltransferase	NA	NA	NA	NA	NA
AMG25393.1|1202126_1202624_-	chorismate--pyruvate lyase	NA	NA	NA	NA	NA
AMG25394.1|1202804_1203722_-	maltose operon protein MalM	NA	NA	NA	NA	NA
AMG25395.1|1203885_1205244_-	maltoporin	NA	NA	NA	NA	NA
AMG25396.1|1205332_1206442_-	maltose/maltodextrin import ATP-binding protein MalK	NA	Q6GZ03	Mycoplasma_phage	47.2	6.2e-17
AMG25397.1|1206803_1207994_+	maltose-binding periplasmic protein	NA	NA	NA	NA	NA
AMG25398.1|1208125_1209670_+	maltose ABC transporter permease MalF	NA	NA	NA	NA	NA
AMG25399.1|1209684_1210575_+	maltose ABC transporter permease	NA	NA	NA	NA	NA
AMG25400.1|1210740_1211151_-	phosphate-starvation-inducible protein PsiE	NA	NA	NA	NA	NA
AMG25401.1|1211293_1213390_-	YjbH domain-containing protein	NA	NA	NA	NA	NA
AMG25402.1|1213389_1214127_-	hypothetical protein	NA	NA	NA	NA	NA
AMG25403.1|1214123_1214762_-	YjbF family lipoprotein	NA	NA	NA	NA	NA
AMG25404.1|1214825_1215068_-	outer membrane protein	NA	NA	NA	NA	NA
AMG25405.1|1215511_1217161_-	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
AMG25406.1|1217505_1218855_+	lysine-sensitive aspartokinase 3	NA	NA	NA	NA	NA
AMG25407.1|1218987_1219335_-	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	51.5	4.9e-21
AMG25408.1|1219910_1220198_+	hypothetical protein	NA	Q6QIC8	Burkholderia_phage	49.1	2.3e-16
AMG25409.1|1220200_1220806_+	lytic transglycosylase domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	59.9	4.2e-60
AMG25410.1|1220818_1221133_+	hypothetical protein	NA	Q6QIC4	Burkholderia_phage	49.1	6.4e-20
AMG25411.1|1221292_1221748_+	hypothetical protein	NA	NA	NA	NA	NA
AMG25412.1|1221744_1221942_+	hypothetical protein	NA	Q6QIB1	Burkholderia_phage	52.9	8.6e-07
AMG25413.1|1221931_1223359_+|tail	phage tail sheath family protein	tail	A4JWK5	Burkholderia_virus	70.9	1.1e-194
AMG25414.1|1223358_1223883_+|tail	phage major tail tube protein	tail	Q6QIA9	Burkholderia_phage	69.5	2.8e-68
AMG25415.1|1223934_1224252_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
AVH82214.1|1224211_1224340_+|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
AMG25416.1|1224436_1226791_+|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	30.6	9.0e-66
AMG25417.1|1226790_1227744_+	methyl-accepting chemotaxis protein	NA	A4JWL1	Burkholderia_virus	50.8	2.3e-36
AMG25418.1|1227743_1227953_+	hypothetical protein	NA	A4JWL2	Burkholderia_virus	60.3	9.8e-17
AMG25419.1|1227940_1228984_+	phage protein D	NA	Q6QIA2	Burkholderia_phage	45.1	2.5e-76
AMG25420.1|1228993_1229716_+|plate	phage baseplate assembly protein V	plate	A0A067ZIM2	Vibrio_phage	41.0	3.3e-11
AMG25421.1|1230043_1230406_+	GtrA family protein	NA	I1TED9	Salmonella_phage	70.8	1.2e-43
AMG25422.1|1230402_1231332_+	glycosyltransferase	NA	S5FKN0	Shigella_phage	83.8	8.8e-150
AMG25423.1|1231331_1232879_+	hypothetical protein	NA	B9UDL6	Salmonella_phage	29.9	1.9e-48
AMG25424.1|1233042_1233402_+|plate	baseplate protein	plate	Q6QIA0	Burkholderia_phage	64.2	2.8e-35
AMG25425.1|1233392_1234508_+|plate	baseplate protein	plate	Q6QI99	Burkholderia_phage	52.2	1.8e-101
AMG25426.1|1234500_1235133_+|tail	phage tail protein I	tail	Q6QI98	Burkholderia_phage	56.4	6.6e-24
AMG25427.1|1235135_1236881_+|tail	phage tail protein	tail	A0A0M3ULF6	Salmonella_phage	52.2	3.2e-52
AMG25428.1|1236885_1237491_+	DUF4376 domain-containing protein	NA	NA	NA	NA	NA
AMG25429.1|1237487_1237943_+	hypothetical protein	NA	NA	NA	NA	NA
AMG25430.1|1238191_1238482_+	hypothetical protein	NA	NA	NA	NA	NA
AMG25431.1|1238678_1239407_+	hypothetical protein	NA	A0A077SLK3	Escherichia_phage	37.3	5.6e-35
>prophage 2
CP014051	Salmonella enterica strain LT2 chromosome, complete genome	4857490	2745489	2842073	4857490	transposase,plate,portal,integrase,capsid,tRNA,tail,head	Salmonella_phage(85.11%)	91	2779329:2779375	2813022:2813068
AMG26760.2|2745489_2746652_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	41.9	5.2e-51
AMG26762.1|2746930_2748913_+	DNA helicase	NA	NA	NA	NA	NA
AMG26763.1|2748909_2749548_+	hypothetical protein	NA	NA	NA	NA	NA
AVH82270.1|2751261_2751858_-|integrase	integrase	integrase	A0A1B5FPC6	Escherichia_phage	91.3	2.6e-99
AMG26767.2|2752435_2753719_+	hypothetical protein	NA	NA	NA	NA	NA
AMG26768.1|2753978_2755853_-	hypothetical protein	NA	NA	NA	NA	NA
AMG26769.1|2756018_2756894_-|integrase	integrase	integrase	NA	NA	NA	NA
AMG26770.1|2757828_2758011_-	hypothetical protein	NA	NA	NA	NA	NA
AMG26771.1|2758010_2759690_-	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AMG26772.1|2759912_2761454_+	PTS glucose transporter subunit IIABC	NA	NA	NA	NA	NA
AMG26773.1|2761583_2762426_+	cytoplasmic protein	NA	NA	NA	NA	NA
AMG28797.2|2762422_2762989_+	6-phospho-3-hexuloisomerase	NA	NA	NA	NA	NA
AMG26774.1|2763012_2763648_+	3-hexulose-6-phosphate synthase	NA	NA	NA	NA	NA
AMG26775.1|2763721_2764924_-	hexulose-6-phosphate synthase	NA	NA	NA	NA	NA
AMG26776.1|2765218_2766232_-	gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
AMG26777.1|2766242_2767223_-	PTS sorbitol transporter subunit IIB	NA	NA	NA	NA	NA
AMG26778.1|2767219_2767594_-	PTS sorbitol transporter	NA	NA	NA	NA	NA
AMG26779.1|2767590_2768112_-	PTS sorbitol transporter subunit IIC	NA	NA	NA	NA	NA
AMG26780.1|2768224_2768509_-	transcriptional regulator	NA	A0A2I7S995	Vibrio_phage	64.7	5.4e-18
AMG26781.2|2768603_2768960_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AMG26782.2|2769113_2769932_-	hypothetical protein	NA	NA	NA	NA	NA
AMG26783.1|2769976_2771260_-	ATPase	NA	NA	NA	NA	NA
AMG26784.1|2771762_2773832_-	DUF927 domain-containing protein	NA	A0A1B0VP75	Pseudomonas_phage	35.1	1.7e-73
AMG26785.1|2773867_2774083_-	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
AMG26786.2|2774533_2775361_+	hypothetical protein	NA	NA	NA	NA	NA
AMG26787.2|2775695_2776889_-	hypothetical protein	NA	NA	NA	NA	NA
AMG26788.2|2777278_2777872_-	hypothetical protein	NA	NA	NA	NA	NA
2779329:2779375	attL	TTTGGTGGAGCTGGCGGGAGTTGAACCCGCGTCCGAAATTCCTACAT	NA	NA	NA	NA
AMG26791.1|2779492_2780518_-|integrase	integrase	integrase	A0A1S6L016	Salmonella_phage	100.0	9.9e-203
AMG26792.1|2780521_2781154_-	phage repressor protein	NA	A0A1S6KZZ7	Salmonella_phage	58.6	1.4e-66
AMG26793.1|2781270_2781510_+	Rha family transcriptional regulator	NA	A0A1S6KZZ6	Salmonella_phage	98.7	8.8e-38
AMG26794.1|2781545_2782055_+	hypothetical protein	NA	A0A1S6L008	Salmonella_phage	92.9	5.1e-83
AMG26795.1|2782062_2782296_+	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	59.1	3.6e-12
AMG26796.1|2782243_2782702_-	hypothetical protein	NA	NA	NA	NA	NA
AMG26797.1|2782921_2783263_+	hypothetical protein	NA	E5G6L5	Salmonella_phage	85.0	4.2e-49
AMG26798.1|2783330_2783564_+	hypothetical protein	NA	A0A1S6L021	Salmonella_phage	84.4	2.0e-26
AMG26799.1|2783563_2783791_+	hypothetical protein	NA	A0A1S6L007	Salmonella_phage	93.3	1.3e-35
AMG26800.1|2783787_2784645_+	DNA adenine methylase	NA	A0A1S6L011	Salmonella_phage	80.4	2.7e-129
AMG26801.1|2784635_2787065_+	replication endonuclease from prophage-like region	NA	A0A1S6L028	Salmonella_phage	91.8	0.0e+00
AMG26802.1|2787217_2787406_+	hypothetical protein	NA	E5G6M0	Salmonella_phage	100.0	1.4e-27
AMG26803.2|2787344_2787650_+	DinI family protein	NA	E5G6M1	Salmonella_phage	100.0	4.7e-36
AVH82271.1|2787709_2788441_+	hypothetical protein	NA	NA	NA	NA	NA
AMG26804.2|2788654_2790406_+	AIPR family protein	NA	NA	NA	NA	NA
AMG26805.1|2790491_2791532_-|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	93.0	2.4e-188
AMG26806.1|2791531_2793298_-	oxidoreductase	NA	A0A1S6KZW3	Salmonella_phage	97.3	0.0e+00
AMG26807.1|2793440_2794274_+|capsid	capsid protein	capsid	E5G6M5	Salmonella_phage	100.0	3.1e-130
AMG26808.1|2794290_2795373_+|capsid	phage major capsid protein, P2 family	capsid	A0A1S6KZZ3	Salmonella_phage	97.7	1.6e-190
AMG26809.1|2795376_2796030_+	hypothetical protein	NA	A0A1S6KZX1	Salmonella_phage	98.6	4.6e-113
AMG26810.1|2796123_2796588_+|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	98.1	1.9e-84
AMG26811.1|2796587_2796791_+|tail	phage tail protein	tail	E5G6M9	Salmonella_phage	98.5	1.1e-33
AMG26812.1|2796794_2797010_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	100.0	5.9e-33
AMG26813.1|2796990_2797500_+	lysozyme	NA	A0A1S6KZY9	Salmonella_phage	97.6	3.5e-92
AMG26814.1|2797876_2798305_+	hypothetical protein	NA	A0A1S6KZX8	Salmonella_phage	95.0	2.6e-64
AMG26815.1|2798400_2798832_+|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	99.3	1.1e-75
AMG26816.1|2798824_2799271_+	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	89.0	1.9e-65
AMG26817.1|2799339_2799918_+|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	98.4	3.3e-107
AMG26818.1|2799914_2800274_+|plate	baseplate assembly protein	plate	E5G6N7	Salmonella_phage	98.3	8.0e-59
AMG26819.1|2800260_2801169_+|plate	baseplate assembly protein	plate	E5G6N8	Salmonella_phage	99.0	7.7e-159
AMG26820.1|2801161_2801767_+|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	98.0	4.1e-116
AMG26821.1|2801763_2803338_+|tail	phage tail protein	tail	A0A1S6KZZ8	Salmonella_phage	60.7	2.1e-156
AMG26822.2|2803307_2803925_+|tail	tail fiber assembly protein	tail	A0A1B0VCD0	Salmonella_phage	84.6	4.1e-95
AMG26823.1|2803928_2804336_-|tail	phage tail protein	tail	A0A1B0V844	Salmonella_phage	84.4	2.2e-60
AMG26824.2|2804342_2805422_-	hypothetical protein	NA	A0A1B0V7G4	Salmonella_phage	92.1	5.4e-183
AMG26825.1|2805391_2805949_+	recombinase family protein	NA	A0A1S6L009	Salmonella_phage	97.8	8.0e-98
AMG26826.1|2806051_2807224_+|tail	phage tail protein	tail	A0A1S6KZY7	Salmonella_phage	99.7	5.7e-223
AMG26827.1|2807233_2807749_+|tail	phage major tail tube protein	tail	A0A1S6L002	Salmonella_phage	98.8	7.9e-92
AMG26828.1|2807803_2808106_+|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	99.0	9.4e-45
AMG26829.1|2808120_2808240_+|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	97.4	8.8e-15
AMG26830.1|2808232_2811040_+|tail	phage tail tape measure protein	tail	A0A1S6L010	Salmonella_phage	99.7	0.0e+00
AMG26831.1|2811036_2811522_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	98.5	2.4e-66
AMG26832.1|2811518_2812619_+	late control protein D	NA	A0A1S6KZZ5	Salmonella_phage	98.1	3.4e-193
AMG26833.1|2812687_2812906_+	levansucrase regulator	NA	Q53ZE7	Salmonella_virus	100.0	2.1e-38
AMG26834.2|2813457_2814621_-	HlyD family type I secretion periplasmic adaptor subunit	NA	NA	NA	NA	NA
2813022:2813068	attR	TTTGGTGGAGCTGGCGGGAGTTGAACCCGCGTCCGAAATTCCTACAT	NA	NA	NA	NA
AMG26835.1|2814628_2816809_-	type I secretion system permease/ATPase	NA	F2Y302	Organic_Lake_phycodnavirus	34.0	1.3e-18
AMG26836.1|2816805_2818215_-	type I secretion protein TolC	NA	NA	NA	NA	NA
AMG26837.1|2818279_2829754_-	Ig-like domain repeat protein	NA	NA	NA	NA	NA
AMG28799.1|2830367_2830850_-	SsrA-binding protein	NA	W5RAM5	Staphylococcus_phage	47.4	5.2e-29
AMG26838.1|2830999_2831476_+	ubiquinone-binding protein	NA	NA	NA	NA	NA
AMG26839.1|2831465_2831756_+	RnfH family protein	NA	NA	NA	NA	NA
AMG26840.1|2831921_2832260_-	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
AMG26841.1|2832408_2834070_-	DNA repair protein RecN	NA	NA	NA	NA	NA
AMG26842.1|2834155_2835034_-	NAD(+) kinase	NA	NA	NA	NA	NA
AVH82390.1|2834965_2835160_+	molecular chaperone GrpE	NA	NA	NA	NA	NA
AMG26843.1|2835156_2835747_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
AMG26844.1|2835781_2836387_-	cytoplasmic protein	NA	NA	NA	NA	NA
AMG26845.1|2836507_2837749_-	DUF21 domain-containing protein	NA	NA	NA	NA	NA
AMG26846.1|2837813_2838605_-	inner membrane protein YpjD	NA	NA	NA	NA	NA
AVH82272.1|2838550_2838847_-	hypothetical protein	NA	NA	NA	NA	NA
AMG26847.1|2838770_2840132_+	signal recognition particle protein	NA	NA	NA	NA	NA
AMG26848.1|2840445_2840694_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
AMG26849.1|2840712_2841261_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
AMG26850.1|2841305_2842073_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
>prophage 3
CP014051	Salmonella enterica strain LT2 chromosome, complete genome	4857490	2868883	2943386	4857490	holin,protease,transposase,terminase,lysis,portal,integrase,capsid,tRNA,tail,head	Salmonella_phage(42.11%)	93	2860964:2860980	2949233:2949249
2860964:2860980	attL	CGCCTTATCCGGCCTAC	NA	NA	NA	NA
AMG26870.1|2868883_2869921_+|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
AMG26871.1|2870036_2870726_-	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	49.5	4.6e-55
AMG26872.1|2871044_2871428_+	autonomous glycyl radical cofactor GrcA	NA	Q7Y524	Enterobacteria_phage	74.0	6.1e-33
AMG26873.1|2871489_2872077_-	cysteine/O-acetylserine efflux protein	NA	NA	NA	NA	NA
AMG26874.2|2872179_2873079_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AMG26875.1|2873096_2874431_-	ATP-dependent RNA helicase SrmB	NA	A0A1B1IS59	uncultured_Mediterranean_phage	29.7	1.6e-43
AMG26876.1|2874561_2875299_+|tRNA	tRNA(1)(Val) (adenine(37)-N(6))-methyltransferase	tRNA	NA	NA	NA	NA
AMG26877.1|2875283_2876906_-	L-aspartate oxidase	NA	NA	NA	NA	NA
AVH82274.1|2876990_2877170_+	hypothetical protein	NA	NA	NA	NA	NA
AMG26878.1|2877330_2877906_+	RNA polymerase sigma factor RpoE	NA	NA	NA	NA	NA
AMG26879.1|2877937_2878588_+	anti-sigma-E factor RseA	NA	NA	NA	NA	NA
AMG26880.1|2878587_2879544_+	sigma-E factor regulatory protein RseB	NA	NA	NA	NA	NA
AMG26881.1|2879540_2880020_+	SoxR reducing system protein RseC	NA	NA	NA	NA	NA
AVH82275.1|2880049_2880166_+	transcriptional regulator	NA	NA	NA	NA	NA
AMG26882.1|2880517_2881747_+|integrase	integrase	integrase	H6WRW7	Salmonella_phage	94.4	2.9e-233
AMG26883.1|2881724_2882009_-	excisionase Xis	NA	H6WRW8	Salmonella_phage	86.2	3.1e-42
AMG26884.1|2882049_2882289_-	DUF4060 domain-containing protein	NA	S4TR31	Salmonella_phage	100.0	2.0e-37
AMG26885.2|2882331_2883489_-	enterohemolysin	NA	S4TTE8	Salmonella_phage	99.7	7.9e-217
AMG26886.1|2883451_2886379_-	exodeoxyribonuclease	NA	S4TNL0	Salmonella_phage	99.3	0.0e+00
AMG26887.2|2886505_2886856_-	DNA breaking-rejoining protein	NA	S4TSN6	Salmonella_phage	97.4	1.1e-60
AMG26888.1|2886877_2887036_-	hypothetical protein	NA	H6WRX3	Salmonella_phage	98.1	9.0e-23
AVH82276.1|2887028_2887289_-	hypothetical protein	NA	NA	NA	NA	NA
AMG26889.1|2887338_2887749_-	transcriptional regulator	NA	A0A1B5FPF4	Escherichia_phage	42.4	8.1e-07
AMG26890.1|2887868_2888108_+	helix-turn-helix domain-containing protein	NA	H6WRX5	Salmonella_phage	47.2	8.3e-12
AMG26891.2|2888073_2888448_+	hypothetical protein	NA	S4TTD7	Salmonella_phage	99.2	3.9e-64
AMG26892.1|2888532_2889516_+	hypothetical protein	NA	H6WRX7	Salmonella_phage	100.0	1.9e-163
AMG26893.1|2889518_2890268_+	DNA replication protein DnaC	NA	S4TNF5	Salmonella_phage	99.6	3.6e-138
AMG26894.1|2890278_2890626_+	DNA-binding protein	NA	H6WRX9	Salmonella_phage	89.6	5.4e-52
AMG26895.1|2890622_2890934_+	hypothetical protein	NA	A0A220NQV2	Salmonella_phage	97.2	7.2e-32
AMG26896.2|2891011_2891302_+	hypothetical protein	NA	NA	NA	NA	NA
AMG26897.1|2891593_2891827_+	DinI family protein	NA	H6WRY5	Salmonella_phage	98.7	2.1e-36
AMG26898.1|2891938_2892160_+	hypothetical protein	NA	NA	NA	NA	NA
AMG26899.1|2892242_2892845_+	hypothetical protein	NA	S4TTI0	Salmonella_phage	98.5	1.1e-108
AMG26900.1|2892844_2893051_+	hypothetical protein	NA	S4TNP0	Salmonella_phage	97.1	1.7e-34
AMG26901.1|2893053_2893665_+	recombination protein NinG	NA	A0A0M4RU10	Salmonella_phage	99.0	1.2e-91
AMG26902.1|2893661_2893802_+	YlcG family protein	NA	A0A0M5M7B2	Salmonella_phage	78.9	7.2e-08
AMG26903.1|2893798_2894476_+	antiterminator	NA	I6PDF8	Cronobacter_phage	54.0	7.7e-63
AVH82277.1|2894472_2894658_+	hypothetical protein	NA	NA	NA	NA	NA
AMG26904.1|2894748_2895312_+	hypothetical protein	NA	A0A0P0ZC44	Stx2-converting_phage	92.2	7.6e-56
AMG26905.1|2895818_2896007_+	hypothetical protein	NA	NA	NA	NA	NA
AMG26906.1|2896221_2896908_-|protease	type III secretion system effector protease GogA	protease	Q9MBM2	Phage_Gifsy-1	99.6	7.9e-132
AMG26907.2|2897183_2897513_+|holin	phage holin, lambda family	holin	A0A0M3ULK9	Salmonella_phage	100.0	5.8e-56
AMG26908.2|2897496_2897949_+	lysozyme	NA	A0A0M4R365	Salmonella_phage	97.3	5.1e-79
AMG26909.2|2897966_2898419_+|lysis	lysis protein	lysis	A0A0M4RD57	Salmonella_phage	92.7	2.9e-66
AMG26910.1|2898654_2899056_-	inhibitor of g-type lysozyme	NA	NA	NA	NA	NA
AVH82278.1|2899090_2899285_+	hypothetical protein	NA	NA	NA	NA	NA
AMG26911.1|2899342_2899888_+|terminase	terminase small subunit	terminase	A0A0U2S671	Escherichia_phage	80.6	1.5e-56
AMG26912.1|2899859_2901791_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	65.7	6.3e-259
AMG26913.1|2901774_2901978_+|tail	phage tail protein	tail	K7PM10	Enterobacteria_phage	73.8	1.9e-17
AMG26914.1|2901974_2903555_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	62.8	9.6e-189
AMG26915.1|2903544_2905041_+	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	52.2	8.1e-97
AMG26916.1|2905053_2905401_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	52.7	9.2e-20
AMG26917.1|2905455_2906484_+|capsid	minor capsid protein E	capsid	C6ZCY2	Enterobacteria_phage	61.1	1.7e-114
AMG26918.1|2906541_2906901_+	DNA packaging protein	NA	NA	NA	NA	NA
AMG26919.1|2906911_2907295_+|tail	phage tail protein	tail	A0A0K2FJB7	Enterobacteria_phage	55.6	9.2e-29
AMG26920.1|2907322_2907901_+|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	80.2	3.7e-82
AMG28800.2|2907949_2909200_-|transposase	transposase	transposase	Q9G0F2	Phage_Gifsy-1	100.0	7.8e-218
AMG26921.1|2909188_2909590_+|tail	phage tail protein	tail	Q9G0F3	Phage_Gifsy-1	100.0	8.1e-52
AMG26922.2|2909597_2910344_+|tail	phage tail protein	tail	A0A291AWU6	Escherichia_phage	76.9	1.9e-99
AMG26923.1|2910394_2910790_+|tail	phage minor tail protein G	tail	A5LH36	Enterobacteria_phage	56.5	2.3e-30
AMG26924.2|2910786_2911125_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	62.4	1.3e-31
AMG26925.1|2911096_2914192_+|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	62.3	6.1e-280
AMG26926.1|2914194_2914524_+|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	70.4	1.3e-42
AMG26927.1|2914533_2915232_+|tail	phage minor tail protein L	tail	A0A1B5FP81	Escherichia_phage	76.3	5.5e-104
AMG26928.2|2915238_2915976_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	85.0	5.2e-129
AMG26929.1|2915873_2916521_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	77.7	2.1e-89
AMG26930.1|2916582_2919945_+	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	79.7	0.0e+00
AMG26931.1|2919983_2920226_+	hypothetical protein	NA	NA	NA	NA	NA
AMG26932.1|2920279_2922652_+|tail	phage tail protein	tail	A0A0K2FIZ6	Escherichia_phage	65.6	1.1e-90
AMG26933.1|2922648_2923473_+|tail	phage tail protein	tail	A0A0M4QWS3	Salmonella_phage	92.0	1.2e-145
AMG26934.1|2923462_2924041_+|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	88.9	3.6e-93
AMG28801.2|2924137_2924365_-	phage virulence factor	NA	NA	NA	NA	NA
AVH82279.1|2924471_2924684_+	hypothetical protein	NA	S4TTF2	Salmonella_phage	90.6	3.8e-08
AVH82392.1|2924746_2924812_+	hypothetical protein	NA	NA	NA	NA	NA
AMG26935.1|2925476_2926022_-|transposase	transposase	transposase	NA	NA	NA	NA
AVH82280.1|2926268_2926406_-	hypothetical protein	NA	NA	NA	NA	NA
AMG26936.2|2926908_2928402_-	type III secretion system protein	NA	Q9MBM1	Phage_Gifsy-1	100.0	3.4e-260
AMG26937.1|2928806_2930606_+	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	24.9	7.2e-23
AMG26938.1|2930622_2931597_+	S26 family signal peptidase	NA	NA	NA	NA	NA
AMG28802.1|2931870_2932551_+	ribonuclease 3	NA	A0A2K9L5P0	Tupanvirus	31.8	7.4e-21
AMG26939.1|2932547_2933453_+	GTPase Era	NA	NA	NA	NA	NA
AMG26940.1|2933464_2934193_+	DNA repair protein RecO	NA	NA	NA	NA	NA
AMG26941.1|2934204_2934936_+	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
AMG26942.1|2934935_2935316_+	holo-ACP synthase	NA	NA	NA	NA	NA
AMG26943.1|2935427_2935688_-	ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	52.3	1.4e-17
AMG26944.1|2935725_2936652_-	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	24.4	3.0e-09
AMG26945.1|2936767_2937964_+	MFS transporter	NA	NA	NA	NA	NA
AMG26946.1|2937985_2938903_+	oxidoreductase	NA	NA	NA	NA	NA
AMG26947.1|2938941_2939790_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
AMG26948.1|2939905_2940799_+	N-acetylmuramic acid 6-phosphate etherase	NA	NA	NA	NA	NA
AMG26949.1|2940809_2942171_+	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
AMG26950.1|2942174_2942810_+	phosphatidylglycerophosphatase C	NA	NA	NA	NA	NA
AMG26951.1|2942834_2943386_+|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	NA	NA	NA	NA
2949233:2949249	attR	GTAGGCCGGATAAGGCG	NA	NA	NA	NA
>prophage 4
CP014051	Salmonella enterica strain LT2 chromosome, complete genome	4857490	3314127	3326418	4857490	holin,tail	Salmonella_phage(45.45%)	11	NA	NA
AMG27262.1|3314127_3316494_+	SPI-2 type III secretion system effector E3 ubiquitin transferase SspH2	NA	Q9MBL9	Phage_Gifsy-2	88.7	2.9e-72
AMG28812.1|3316822_3317812_+	DUF968 domain-containing protein	NA	A0A1C9IHZ5	Salmonella_phage	97.3	6.0e-189
AMG27264.2|3317826_3318195_+	antitermination protein Q	NA	A5LH77	Enterobacteria_phage	81.7	7.4e-52
AMG27265.1|3318223_3319555_-	NTPase	NA	R9TRQ8	Vibrio_phage	28.5	2.1e-19
AMG27266.1|3319851_3320181_+|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	94.6	3.9e-36
AVH82298.1|3320773_3322015_+	hypothetical protein	NA	Q8HAB4	Salmonella_phage	95.3	1.0e-52
AMG27268.1|3322017_3322545_+|tail	tail fiber assembly protein	tail	A0A1S6KZZ1	Salmonella_phage	31.3	3.1e-11
AMG27269.1|3322922_3323366_+|tail	tail assembly chaperone	tail	A0A0F7LDZ0	Escherichia_phage	43.9	1.4e-28
AMG27270.1|3323419_3325249_-	acyltransferase	NA	C6ZR20	Salmonella_phage	29.6	3.0e-61
AMG28813.2|3325596_3325887_-	DinI family protein	NA	S4TND2	Salmonella_phage	83.3	4.7e-25
AMG28814.2|3325914_3326418_+	DNA polymerase V	NA	Q1MVE7	Enterobacteria_phage	71.3	9.5e-50
>prophage 5
CP014051	Salmonella enterica strain LT2 chromosome, complete genome	4857490	3398470	3407641	4857490	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
AMG27335.1|3398470_3399418_+	ABC transporter ATP-binding protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	27.8	3.7e-10
AMG27336.1|3399401_3400133_+	ABC transporter permease	NA	NA	NA	NA	NA
AMG27337.1|3400113_3400221_-	hypothetical protein	NA	NA	NA	NA	NA
AMG27338.1|3400280_3401012_-	transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
AMG27339.1|3401234_3402920_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.1	6.2e-279
AMG27340.1|3402916_3403636_+	DNA-binding response regulator	NA	NA	NA	NA	NA
AMG27341.1|3403682_3404150_+	DUF1456 domain-containing protein	NA	Q9EYF4	Enterobacteria_phage	90.3	3.9e-74
AMG27342.1|3404206_3404737_-	hypothetical protein	NA	NA	NA	NA	NA
AMG27343.1|3404908_3405367_-	lipoprotein	NA	Q9EYF5	Enterobacteria_phage	72.5	8.4e-53
AMG27344.1|3405607_3407641_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.0e-54
>prophage 6
CP014051	Salmonella enterica strain LT2 chromosome, complete genome	4857490	3475949	3486455	4857490		Enterobacteria_phage(37.5%)	10	NA	NA
AMG27399.1|3475949_3477353_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	27.1	3.1e-21
AMG27400.1|3477530_3478424_+	UTP--glucose-1-phosphate uridylyltransferase	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
AMG27401.1|3478800_3479886_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.2e-102
AMG27402.1|3479885_3480785_+	NAD(P)-dependent oxidoreductase	NA	A0A291LA50	Escherichia_phage	36.3	1.4e-30
AMG28817.1|3480832_3481711_+	glucose-1-phosphate thymidylyltransferase	NA	I7I009	Enterobacteria_phage	65.5	9.3e-109
AMG27403.2|3481711_3482263_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.0	2.2e-52
AMG27404.1|3482268_3483261_+	protein RfbI	NA	NA	NA	NA	NA
AMG27405.1|3483257_3484031_+	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
AMG27406.1|3484035_3485115_+	CDP-glucose 4,6-dehydratase	NA	A0A222YY99	Synechococcus_phage	24.1	6.6e-16
AMG27407.1|3485141_3486455_+	LPS biosynthesis protein	NA	H8ZJ36	Ostreococcus_tauri_virus	35.1	7.0e-52
>prophage 7
CP014051	Salmonella enterica strain LT2 chromosome, complete genome	4857490	3572449	3583052	4857490		Morganella_phage(25.0%)	13	NA	NA
AMG27492.1|3572449_3572923_-	peptidase	NA	A0A0F6TJ61	Escherichia_coli_O157_typing_phage	77.6	7.1e-39
AMG27494.1|3573570_3573861_-	DUF4102 domain-containing protein	NA	H2BDA3	Pseudomonas_phage	49.1	3.0e-08
AMG27495.1|3574232_3575030_-	protein MtfA	NA	NA	NA	NA	NA
AVH82307.1|3575290_3575533_+	hypothetical protein	NA	NA	NA	NA	NA
AMG27496.1|3575510_3575672_+	hypothetical protein	NA	NA	NA	NA	NA
AMG27497.1|3575798_3576218_+	protein UmuD	NA	A0A1W6JNS2	Morganella_phage	60.5	8.5e-36
AMG27498.1|3576220_3577489_+	protein UmuC	NA	I6RSM4	Salmonella_phage	92.2	4.2e-227
AMG27499.1|3577943_3578156_+	cold-shock protein CspJ	NA	A0A1W6JNX5	Morganella_phage	70.0	3.9e-21
AVH82400.1|3578166_3578355_+	cold-shock protein	NA	NA	NA	NA	NA
AMG27500.1|3578615_3579812_-	porin OmpS1	NA	Q1MVN1	Enterobacteria_phage	56.1	1.8e-110
AMG27501.2|3580461_3580761_+	hypothetical protein	NA	NA	NA	NA	NA
AMG27502.1|3580852_3581548_+	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	27.1	2.8e-07
AMG27503.1|3581621_3583052_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	57.4	1.0e-104
>prophage 8
CP014051	Salmonella enterica strain LT2 chromosome, complete genome	4857490	3687096	3717322	4857490	protease,tail,integrase	Escherichia_phage(18.18%)	39	3690958:3690972	3709445:3709459
AMG27611.1|3687096_3687327_-	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	60.3	2.9e-14
AMG27612.1|3687464_3687839_+	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
AMG28822.2|3687839_3688715_+	hypothetical protein	NA	NA	NA	NA	NA
AMG27613.1|3688731_3689085_+	DUF2511 domain-containing protein	NA	NA	NA	NA	NA
AMG28823.2|3689142_3689262_+	hypothetical protein	NA	NA	NA	NA	NA
AVH82401.1|3689458_3690313_-|integrase	integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	50.9	3.6e-73
AMG27614.2|3690372_3690867_-	RecE	NA	A0A0U2I1R6	Escherichia_phage	68.9	8.2e-22
3690958:3690972	attL	CAGACATTTGCCCGC	NA	NA	NA	NA
AMG27615.1|3691056_3691287_+	lytic enzyme	NA	Q8HA86	Salmonella_phage	93.7	6.1e-28
AMG27616.1|3691340_3691874_+	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	48.3	1.4e-11
AMG27617.1|3692130_3692298_-	lytic enzyme	NA	NA	NA	NA	NA
AVH82310.1|3692362_3692551_-	hypothetical protein	NA	NA	NA	NA	NA
AMG27618.1|3693023_3693905_+|tail	phage tail protein	tail	A0A0M4RTP2	Salmonella_phage	76.0	2.2e-65
AMG27619.1|3694001_3694202_-	phage virulence factor	NA	NA	NA	NA	NA
AVH82311.1|3694392_3694509_-|tail	phage tail protein	tail	NA	NA	NA	NA
AVH82312.1|3694771_3694897_+	arsenic transporter	NA	NA	NA	NA	NA
AMG27620.1|3696044_3696659_-	disulfide bond formation protein B	NA	NA	NA	NA	NA
AMG28825.2|3696668_3696827_-	hypothetical protein	NA	NA	NA	NA	NA
AMG27621.1|3696959_3697874_-	protein PagO	NA	NA	NA	NA	NA
AVH82402.1|3698491_3698692_+	hypothetical protein	NA	NA	NA	NA	NA
AVH82313.1|3698982_3699240_+	hypothetical protein	NA	NA	NA	NA	NA
AMG27622.1|3699177_3699546_-|integrase	integrase	integrase	K7PHK0	Enterobacteria_phage	39.8	5.4e-18
AMG27623.1|3701009_3701150_-	hypothetical protein	NA	NA	NA	NA	NA
AVH82314.1|3701315_3701585_-	hypothetical protein	NA	Q6UAV5	Klebsiella_phage	39.0	1.5e-06
AVH82315.1|3701631_3701826_+	hypothetical protein	NA	NA	NA	NA	NA
AMG27625.1|3701954_3702374_+	N-acetyltransferase	NA	NA	NA	NA	NA
AMG27626.1|3702761_3703238_-	hypothetical protein	NA	NA	NA	NA	NA
AMG27627.1|3703567_3703963_-	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	32.8	9.2e-16
AMG27628.1|3704646_3705369_+	SPI-1 type III secretion system guanine nucleotide exchange factor SopE2	NA	NA	NA	NA	NA
AMG27629.1|3705653_3705818_+	hypothetical protein	NA	NA	NA	NA	NA
AMG27630.1|3706041_3706692_+	serine/threonine-protein phosphatase 1	NA	A0A222YWF0	Escherichia_phage	51.4	1.1e-58
AMG27631.1|3706710_3706902_-	DUF1482 domain-containing protein	NA	NA	NA	NA	NA
AMG27632.1|3707012_3707252_-	DUF1480 domain-containing protein	NA	NA	NA	NA	NA
AMG28826.1|3707366_3708806_-	16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF	NA	NA	NA	NA	NA
AMG27633.2|3708883_3711523_-	MCE family protein	NA	NA	NA	NA	NA
3709445:3709459	attR	GCGGGCAAATGTCTG	NA	NA	NA	NA
AMG27634.1|3711485_3712769_-	paraquat-inducible protein A	NA	NA	NA	NA	NA
AMG27635.2|3712810_3713395_+	GAF domain-containing protein	NA	NA	NA	NA	NA
AMG27636.1|3713492_3714179_+	RNA chaperone ProQ	NA	NA	NA	NA	NA
AMG27637.1|3714198_3716247_+|tail,protease	tail-specific protease	tail,protease	A0A0R6PIZ1	Moraxella_phage	33.5	8.0e-87
AMG27638.1|3716440_3717322_+|protease	protease HtpX	protease	NA	NA	NA	NA
>prophage 9
CP014051	Salmonella enterica strain LT2 chromosome, complete genome	4857490	4481161	4565896	4857490	holin,protease,terminase,lysis,portal,integrase,tRNA,tail	Salmonella_phage(44.64%)	96	4505255:4505274	4577042:4577061
AMG28358.1|4481161_4481842_+|protease	type III secretion system effector protease PipA	protease	Q9MBM0	Phage_Gifsy-2	70.6	8.3e-81
AVH82350.1|4482187_4482397_-	hypothetical protein	NA	NA	NA	NA	NA
AMG28359.1|4482462_4483122_+	transmembrane protein	NA	A0A2H4JFM9	uncultured_Caudovirales_phage	51.9	2.3e-43
AMG28360.1|4483208_4483538_+	sulfurtransferase TusE	NA	NA	NA	NA	NA
AMG28361.1|4483534_4483816_-	acylphosphatase	NA	NA	NA	NA	NA
AMG28362.1|4483864_4484644_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AMG28363.1|4484669_4485218_-	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
AMG28364.1|4485432_4486644_+	ribosomal RNA large subunit methyltransferase I	NA	NA	NA	NA	NA
AMG28365.1|4486701_4487019_+	heat-shock protein HspQ	NA	NA	NA	NA	NA
AMG28366.2|4487063_4487480_-	CoA-binding protein	NA	NA	NA	NA	NA
AMG28367.1|4487650_4488313_+	DUF2057 domain-containing protein	NA	NA	NA	NA	NA
AMG28368.1|4488407_4488866_+	methylglyoxal synthase	NA	NA	NA	NA	NA
AMG28369.1|4488901_4490956_-	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.6	8.5e-20
AMG28370.1|4491079_4491526_+	YccF domain-containing protein	NA	NA	NA	NA	NA
AMG28371.1|4491544_4493698_+	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
AMG28372.1|4493684_4494290_-	DNA transformation protein	NA	NA	NA	NA	NA
AMG28373.1|4494506_4495016_+	cell division inhibitor SulA	NA	NA	NA	NA	NA
AMG28860.1|4495372_4496425_+	outer membrane protein A	NA	NA	NA	NA	NA
AMG28374.1|4496496_4496949_-	macrodomain Ter protein	NA	NA	NA	NA	NA
AMG28375.1|4497134_4498895_+|protease	Lon protease family protein	protease	NA	NA	NA	NA
AMG28376.1|4498963_4499482_+	beta-hydroxydecanoyl-ACP dehydratase	NA	NA	NA	NA	NA
AMG28377.1|4499581_4499749_-	ribosome modulation factor	NA	NA	NA	NA	NA
AMG28378.1|4500004_4500568_-	hypothetical protein	NA	NA	NA	NA	NA
AMG28379.1|4500564_4502205_-	intermembrane transport protein PqiB	NA	NA	NA	NA	NA
AMG28380.1|4502209_4503463_-	paraquat-inducible protein A	NA	NA	NA	NA	NA
AMG28381.1|4503477_4505385_-	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.8	2.4e-53
4505255:4505274	attL	GTGGATTTCCCGGCGCCGTT	NA	NA	NA	NA
AMG28382.1|4505397_4507506_-	ribosomal RNA large subunit methyltransferase K/L	NA	NA	NA	NA	NA
AMG28383.1|4507604_4508714_+	MOSC domain-containing protein	NA	NA	NA	NA	NA
AMG28384.1|4508710_4509253_-	cell division protein ZapC	NA	NA	NA	NA	NA
AMG28385.1|4509418_4510429_-	dihydroorotate dehydrogenase (quinone)	NA	NA	NA	NA	NA
AMG28386.1|4510636_4513249_-	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.6	6.3e-20
AMG28387.1|4513675_4513867_+	DNA-damage-inducible protein I	NA	S4TNM0	Salmonella_phage	95.2	6.2e-26
AMG28388.1|4514137_4514824_+	virulence protein	NA	NA	NA	NA	NA
AMG28389.1|4514808_4515108_+	hypothetical protein	NA	NA	NA	NA	NA
AMG28390.1|4515176_4515803_+	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	63.2	1.4e-66
AMG28392.1|4516450_4517419_-	SPI-2 type III secretion system effector SseI	NA	Q9MBL9	Phage_Gifsy-2	99.7	7.9e-194
AMG28393.1|4517894_4518476_-|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	89.5	1.7e-95
AMG28394.1|4518475_4520914_-|tail	phage tail protein	tail	A0A0K2FIZ6	Escherichia_phage	63.4	2.9e-91
AMG28395.1|4520967_4521210_-	hypothetical protein	NA	NA	NA	NA	NA
AMG28396.2|4521248_4522124_-	DUF1983 domain-containing protein	NA	K7PKJ2	Enterobacteria_phage	77.1	1.1e-48
AMG28397.1|4522150_4524598_-	host specificity protein J	NA	Q687E8	Enterobacteria_phage	68.0	0.0e+00
AMG28398.1|4524669_4525374_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	62.6	9.2e-67
AMG28399.1|4525271_4526009_-|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	76.1	1.6e-114
AMG28400.1|4526018_4526714_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	66.7	1.3e-89
AMG28401.1|4526803_4527337_+	superoxide dismutase [Cu-Zn] SodC1	NA	Q9MC02	Salmonella_phage	54.0	1.8e-46
AMG28402.1|4527453_4527951_-	Ail/OmpX	NA	A0A1B0VBR9	Salmonella_phage	36.6	1.4e-16
AMG28861.2|4528049_4528382_-|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	61.5	3.3e-35
AMG28862.2|4528378_4531366_-|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	62.1	8.2e-266
AMG28403.2|4531445_4531775_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	50.9	5.0e-23
AMG28404.1|4531771_4532170_-|tail	phage minor tail protein G	tail	K7PLV8	Enterobacteria_phage	56.8	8.6e-30
AMG28405.1|4532215_4532965_-|tail	phage tail protein	tail	A0A291AWU6	Escherichia_phage	68.6	3.7e-90
AMG28406.1|4532976_4533378_-|tail	phage tail protein	tail	K7PHM6	Enterobacterial_phage	60.9	1.5e-42
AMG28407.1|4533374_4533941_-|tail	phage tail protein	tail	Q9G063	Phage_Gifsy-2	97.8	9.5e-14
AMG28408.1|4533921_4534221_-	ATP-binding protein	NA	K7PH43	Enterobacteria_phage	45.1	4.5e-15
AMG28409.1|4534213_4534537_-	recombinase RecA	NA	K7PLV6	Enterobacteria_phage	61.3	7.7e-29
AMG28863.2|4534627_4536709_-	peptidase S14	NA	A0A291AWT6	Escherichia_phage	69.5	4.8e-265
AMG28410.2|4536632_4538150_-|portal	phage portal protein	portal	A0A291AWU2	Escherichia_phage	65.1	1.5e-175
AMG28411.1|4538176_4538383_-	primosomal replication protein PriB/PriC domain protein	NA	A0A1W6JT66	Pseudomonas_phage	53.3	2.9e-05
AMG28412.2|4538379_4540518_-|terminase	phage terminase large subunit family protein	terminase	A5LH27	Enterobacteria_phage	72.6	3.4e-290
AMG28413.1|4540474_4541008_-	DNA breaking-rejoining protein	NA	A0A291AWV8	Escherichia_phage	48.1	1.0e-33
AMG28864.1|4541215_4541695_-|lysis	lysis protein	lysis	Q56118	Enterobacteria_phage	77.0	1.4e-55
AMG28414.2|4541712_4542165_-	lysozyme	NA	A0A0M4R365	Salmonella_phage	97.3	2.3e-79
AMG28415.2|4542148_4542478_-|holin	phage holin, lambda family	holin	A0A0M3ULK9	Salmonella_phage	100.0	5.8e-56
AMG28416.1|4542753_4543440_+|protease	type III secretion system effector protease GtgA	protease	Q9MBM0	Phage_Gifsy-2	100.0	2.1e-132
AMG28417.1|4543800_4544250_+	hypothetical protein	NA	NA	NA	NA	NA
AMG28418.1|4544385_4544511_-	hypothetical protein	NA	NA	NA	NA	NA
AMG28419.1|4544684_4545002_-	hypothetical protein	NA	NA	NA	NA	NA
AMG28420.1|4545068_4545866_-	antitermination protein	NA	A0A0M4S661	Salmonella_phage	99.6	2.3e-151
AMG28421.1|4545855_4546002_-	YlcG family protein	NA	A0A0M5M7B2	Salmonella_phage	97.9	4.3e-19
AMG28422.1|4545998_4546610_-	protein NinG	NA	A0A0M4RU10	Salmonella_phage	91.6	6.9e-79
AMG28423.1|4546612_4546819_-	hypothetical protein	NA	S4TNP0	Salmonella_phage	100.0	3.5e-35
AMG28424.1|4546818_4547421_-	hypothetical protein	NA	S4TTI0	Salmonella_phage	98.5	8.3e-109
AVH82351.1|4547503_4547725_-	hypothetical protein	NA	NA	NA	NA	NA
AMG28425.1|4547836_4548070_-	DinI family protein	NA	H6WRY5	Salmonella_phage	98.7	2.1e-36
AMG28426.2|4548361_4548652_-	hypothetical protein	NA	NA	NA	NA	NA
AMG28427.1|4548729_4549041_-	hypothetical protein	NA	A0A220NQV2	Salmonella_phage	97.2	7.2e-32
AMG28428.1|4549037_4549385_-	DNA-binding protein	NA	H6WRX9	Salmonella_phage	89.6	5.4e-52
AMG28429.1|4549395_4550145_-	DNA replication protein DnaC	NA	S4TNF5	Salmonella_phage	99.6	3.6e-138
AMG28430.1|4550147_4551131_-	hypothetical protein	NA	H6WRX7	Salmonella_phage	100.0	1.9e-163
AMG28431.2|4551215_4551590_-	hypothetical protein	NA	S4TTD7	Salmonella_phage	99.2	3.9e-64
AMG28432.1|4551555_4551795_-	helix-turn-helix domain-containing protein	NA	H6WRX5	Salmonella_phage	47.2	8.3e-12
AMG28433.1|4551914_4552325_+	transcriptional regulator	NA	A0A1B5FPF4	Escherichia_phage	42.4	8.1e-07
AVH82352.1|4552374_4552635_+	hypothetical protein	NA	NA	NA	NA	NA
AMG28434.1|4552627_4552786_+	hypothetical protein	NA	H6WRX3	Salmonella_phage	98.1	1.2e-22
AMG28435.2|4552807_4553107_+	DNA breaking-rejoining protein	NA	S4TSN6	Salmonella_phage	84.5	8.1e-49
AMG28436.1|4553233_4556119_+	exodeoxyribonuclease	NA	S4TNL0	Salmonella_phage	97.4	0.0e+00
AMG28437.2|4556081_4557239_+	enterohemolysin	NA	S4TTE8	Salmonella_phage	100.0	1.6e-217
AMG28438.1|4557281_4557521_+	DUF4060 domain-containing protein	NA	S4TR31	Salmonella_phage	100.0	2.0e-37
AMG28439.1|4557561_4557810_+	excisionase	NA	S4TND0	Salmonella_phage	100.0	4.7e-42
AMG28440.1|4557854_4559147_+|integrase	integrase	integrase	S4TSP2	Salmonella_phage	99.8	1.0e-252
AMG28441.1|4559341_4560544_+	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
AMG28442.1|4560621_4562058_-	sodium:alanine symporter family protein	NA	NA	NA	NA	NA
AMG28443.1|4562302_4563517_-	PLP-dependent lyase/thiolase	NA	NA	NA	NA	NA
AMG28444.1|4563603_4563837_+	hypothetical protein	NA	NA	NA	NA	NA
AMG28445.1|4563833_4564295_+	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
AMG28446.1|4564495_4565896_+|tRNA	asparagine--tRNA ligase	tRNA	A0A167RLM0	Powai_lake_megavirus	35.1	4.5e-81
4577042:4577061	attR	GTGGATTTCCCGGCGCCGTT	NA	NA	NA	NA
>prophage 10
CP014051	Salmonella enterica strain LT2 chromosome, complete genome	4857490	4592553	4696332	4857490	holin,protease,transposase,terminase,lysis,portal,integrase,tRNA,tail	Escherichia_phage(30.65%)	105	4584298:4584314	4700576:4700592
4584298:4584314	attL	ACCAGTTATCTTCGGCA	NA	NA	NA	NA
AMG28467.1|4592553_4593315_-|protease	metalloprotease	protease	NA	NA	NA	NA
AMG28468.1|4593457_4594741_-	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
AMG28469.1|4594811_4595900_-	3-phosphoserine/phosphohydroxythreonine aminotransferase	NA	M1Q1P2	Streptococcus_phage	46.5	1.2e-78
AMG28470.1|4596085_4596778_-	DUF421 domain-containing protein	NA	NA	NA	NA	NA
AMG28865.1|4596914_4598675_+	30S ribosomal protein S12 methylthiotransferase accessory protein YcaO	NA	NA	NA	NA	NA
AMG28471.1|4599079_4599937_+	formate transporter FocA	NA	NA	NA	NA	NA
AMG28472.1|4599996_4602279_+	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	42.0	1.1e-161
AMG28473.1|4602354_4603314_-	SPI-2 type III secretion system effector SopD2	NA	NA	NA	NA	NA
AVH82353.1|4603444_4603771_+	cytoplasmic protein	NA	NA	NA	NA	NA
AMG28474.2|4603862_4604687_+	pyruvate formate lyase 1-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	26.5	2.8e-22
AMG28475.1|4604979_4606401_-	amino acid permease	NA	NA	NA	NA	NA
AMG28476.1|4606618_4607767_-	MFS transporter	NA	NA	NA	NA	NA
AMG28478.1|4608116_4608980_-	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
AMG28479.1|4608981_4609599_-	dimethylsulfoxide reductase, chain B	NA	A0A077SL61	Escherichia_phage	59.6	4.3e-76
AMG28480.1|4609609_4612054_-	dimethylsulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	50.5	5.4e-223
AMG28481.1|4612290_4613583_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	44.5	8.6e-95
AMG28482.1|4613841_4615185_-	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	40.9	1.6e-80
AMG28483.1|4615194_4615806_-	outer membrane lipoprotein carrier protein LolA	NA	NA	NA	NA	NA
AMG28866.1|4615948_4620004_-	DNA translocase FtsK	NA	S5VNE3	Mycobacterium_phage	49.5	2.9e-88
AMG28484.1|4620138_4620633_-	leucine-responsive regulatory protein	NA	NA	NA	NA	NA
AVH82354.1|4620561_4620837_+	hypothetical protein	NA	NA	NA	NA	NA
AMG28485.1|4621178_4622147_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	45.5	1.1e-62
AMG28486.1|4622260_4624027_+	thiol reductant ABC exporter subunit CydD	NA	W8CYL7	Bacillus_phage	25.1	6.0e-22
AMG28487.1|4624027_4625749_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	W8CYL7	Bacillus_phage	23.5	8.4e-13
AMG28488.1|4625793_4626498_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
AMG28489.1|4626498_4626882_+	hypothetical protein	NA	NA	NA	NA	NA
AMG28490.1|4626809_4627028_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
AMG28491.1|4627118_4628030_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AMG28492.1|4628138_4628999_+	pirin family protein	NA	NA	NA	NA	NA
AMG28493.1|4629018_4629696_+	hydrolase	NA	NA	NA	NA	NA
AVH82355.1|4630032_4631287_+|transposase	IS3-like element ISSen1 family transposase	transposase	Q6H9S3	Enterobacteria_phage	33.9	5.4e-17
AMG28496.1|4631750_4632209_-|transposase	IS200/IS605 family transposase IS200F	transposase	I4AZI8	Saccharomonospora_phage	31.5	1.0e-13
AVH82356.1|4632165_4632348_-	hypothetical protein	NA	NA	NA	NA	NA
AMG28497.1|4632400_4634677_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	6.2e-165
AMG28498.1|4634707_4635028_-|protease	ATP-dependent Clp protease adaptor ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	4.5e-13
AMG28499.1|4635351_4635573_+	cold shock domain protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	9.3e-18
AVH82357.1|4635527_4635722_-	hypothetical protein	NA	NA	NA	NA	NA
AMG28500.1|4635702_4637649_-	macrolide ABC transporter permease/ATP-binding protein MacB	NA	G9BWD6	Planktothrix_phage	43.1	2.0e-39
AMG28501.1|4637645_4638764_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	38.9	1.4e-08
AMG28502.2|4638891_4639860_+	DUF535 domain-containing protein	NA	NA	NA	NA	NA
AMG28503.1|4639856_4641515_-	ATP-dependent endonuclease	NA	NA	NA	NA	NA
AVH82412.1|4641550_4641739_-	hypothetical protein	NA	NA	NA	NA	NA
AMG28504.1|4641716_4642616_+	DUF340 domain-containing protein	NA	NA	NA	NA	NA
AMG28505.1|4642759_4644412_+	hydroxylamine reductase	NA	NA	NA	NA	NA
AMG28506.1|4644423_4645392_+	NADH oxidoreductase	NA	NA	NA	NA	NA
AMG28507.1|4645549_4647268_+	ubiquinone-dependent pyruvate dehydrogenase	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	24.4	1.7e-29
AMG28508.1|4647306_4648308_+	low-specificity L-threonine aldolase	NA	NA	NA	NA	NA
AMG28509.1|4648318_4649752_+	DUF2867 domain-containing protein	NA	NA	NA	NA	NA
AMG28510.1|4649847_4650861_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
AMG28511.1|4650857_4651688_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1B0UZW5	Roseobacter_phage	30.7	1.8e-08
AMG28512.1|4651684_4652008_-	hypothetical protein	NA	NA	NA	NA	NA
AVH82358.1|4652993_4653215_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
AMG28514.2|4654048_4655287_+	sialidase	NA	NA	NA	NA	NA
AMG28515.1|4655357_4655933_-|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	86.8	5.2e-92
AMG28516.1|4655932_4658305_-|tail	phage tail protein	tail	A0A0K2FIZ6	Escherichia_phage	64.2	5.8e-89
AMG28517.2|4658348_4661795_-	host specificity protein J	NA	A0A0K2FI38	Escherichia_phage	69.8	0.0e+00
AMG28518.1|4661888_4662413_+	superoxide dismutase [Cu-Zn] SodC2	NA	Q9MC02	Salmonella_phage	100.0	1.3e-97
AMG28519.2|4662466_4663144_-|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	67.6	3.0e-67
AMG28520.1|4663041_4663776_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	77.4	2.7e-114
AMG28521.1|4663787_4664483_-|tail	phage minor tail protein L	tail	Q687F1	Enterobacteria_phage	71.4	3.2e-96
AMG28522.1|4664614_4665133_-	Ail/OmpX	NA	H6WZM8	Escherichia_phage	30.2	3.1e-11
AMG28523.1|4665259_4665589_-|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	68.5	2.2e-39
AMG28524.1|4665588_4668750_-|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	55.7	4.3e-257
AMG28525.2|4668721_4669039_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	65.1	1.6e-31
AMG28526.1|4669056_4669461_-|tail	phage minor tail protein G	tail	A5LH36	Enterobacteria_phage	54.1	6.3e-28
AMG28527.1|4669505_4670249_-|tail	phage tail protein	tail	A0A291AWU6	Escherichia_phage	75.6	6.2e-98
AMG28528.1|4670259_4670661_-|tail	phage tail protein	tail	A0A291AWY2	Escherichia_phage	66.9	4.9e-49
AMG28867.2|4670657_4671242_-|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	77.1	4.5e-75
AMG28529.1|4671245_4671521_-	DNA breaking-rejoining protein	NA	NA	NA	NA	NA
AMG28530.1|4671513_4671837_-	DUF2190 domain-containing protein	NA	K7PLV6	Enterobacteria_phage	63.2	1.0e-28
AMG28531.2|4671925_4674046_-	peptidase S14	NA	A5LH30	Enterobacteria_phage	72.1	1.3e-276
AMG28532.1|4673963_4675499_-|portal	phage portal protein	portal	K7PHM5	Enterobacterial_phage	63.1	3.7e-177
AMG28533.1|4675495_4675702_-	primosomal replication protein PriB/PriC domain protein	NA	A5LH28	Enterobacteria_phage	48.6	1.4e-07
AMG28534.1|4675698_4677807_-|terminase	phage terminase large subunit family protein	terminase	Q9EYD1	Enterobacteria_phage	70.6	1.5e-293
AMG28535.1|4677793_4678285_-	DNA breaking-rejoining protein	NA	Q9EYD0	Enterobacteria_phage	57.5	2.6e-44
AMG28868.1|4678339_4678561_+	hypothetical protein	NA	NA	NA	NA	NA
AMG28536.1|4678636_4678828_+	hypothetical protein	NA	NA	NA	NA	NA
AMG28537.1|4679119_4679605_-|lysis	lysis protein	lysis	Q8HA85	Salmonella_phage	93.8	5.7e-76
AMG28538.1|4679601_4680216_-	endolysin	NA	Q8HA86	Salmonella_phage	93.1	1.4e-108
AMG28539.1|4680218_4680563_-|holin	phage holin, lambda family	holin	Q8HA87	Salmonella_phage	100.0	5.3e-44
AMG28540.2|4681152_4681551_-	hypothetical protein	NA	NA	NA	NA	NA
AMG28541.1|4682608_4683001_+	hypothetical protein	NA	NA	NA	NA	NA
AMG28542.1|4683155_4683971_-	antitermination protein	NA	A0A1B5FPA5	Escherichia_phage	72.3	3.7e-112
AMG28543.1|4683967_4684828_-	helix-turn-helix domain containing protein	NA	A0A1B5FPA6	Escherichia_phage	84.6	1.0e-136
AMG28544.1|4684827_4685796_-	DNA primase	NA	A0A1B5FPA8	Escherichia_phage	95.3	1.9e-179
AMG28869.2|4685792_4687421_-	ATP-dependent helicase	NA	A0A1B5FPA4	Escherichia_phage	83.4	7.1e-272
AMG28545.1|4687533_4687902_-	hypothetical protein	NA	A0A1B5FPB1	Escherichia_phage	88.5	4.5e-57
AMG28546.2|4688142_4688439_-	hypothetical protein	NA	A0A1B5FPB9	Escherichia_phage	74.2	4.9e-30
AMG28547.1|4688401_4688656_-	XRE family transcriptional regulator	NA	A0A2H4JEY0	uncultured_Caudovirales_phage	52.9	7.5e-11
AMG28548.1|4688768_4689464_+	helix-turn-helix transcriptional regulator	NA	F1C5C2	Cronobacter_phage	67.5	7.4e-85
AMG28549.1|4689642_4689960_+	hypothetical protein	NA	A0A286S1T9	Klebsiella_phage	51.0	3.0e-17
AMG28550.1|4689952_4690147_+	hypothetical protein	NA	NA	NA	NA	NA
AMG28551.1|4690143_4690329_+	hypothetical protein	NA	NA	NA	NA	NA
AMG28552.1|4690516_4690726_+	hypothetical protein	NA	NA	NA	NA	NA
AMG28553.2|4690649_4691066_+	hypothetical protein	NA	A0A1B5FPB3	Escherichia_phage	55.7	1.4e-27
AMG28554.1|4691065_4691302_+	hypothetical protein	NA	A0A286SGR4	Klebsiella_phage	76.7	4.5e-26
AMG28555.1|4691291_4691687_+	hypothetical protein	NA	A0A286S1S2	Klebsiella_phage	74.6	6.7e-51
AMG28556.1|4691641_4692034_+	hypothetical protein	NA	F1C5A3	Cronobacter_phage	76.1	5.9e-23
AMG28558.1|4692272_4692497_+	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	65.3	1.9e-18
AMG28559.1|4692493_4692802_+	hypothetical protein	NA	A0A1B5FPC7	Escherichia_phage	80.8	2.1e-15
AVH82359.1|4692801_4693017_+	hypothetical protein	NA	NA	NA	NA	NA
AMG28870.1|4693167_4693410_+	excisionase	NA	G9L654	Escherichia_phage	62.8	1.8e-22
AMG28561.2|4693437_4694763_+|integrase	integrase	integrase	Q20GI2	Phage_258-320	65.9	3.2e-169
AMG28562.1|4694858_4695374_+	lipoprotein	NA	NA	NA	NA	NA
AMG28563.1|4695603_4696332_+	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	35.8	5.1e-28
4700576:4700592	attR	ACCAGTTATCTTCGGCA	NA	NA	NA	NA
>prophage 1
CP014050	Salmonella enterica strain LT2 plasmid unnamed, complete sequence	93933	77275	86571	93933	transposase	Escherichia_phage(28.57%)	12	NA	NA
AMG24349.2|77275_77692_+	hypothetical protein	NA	O64348	Escherichia_phage	42.9	8.2e-07
AMG24348.1|77875_78211_+	hypothetical protein	NA	NA	NA	NA	NA
AMG24326.1|78267_78834_+	DUF2913 domain-containing protein	NA	NA	NA	NA	NA
AMG24327.1|78865_79807_-|transposase	ISNCY family transposase	transposase	Q2A0A7	Sodalis_phage	54.3	2.0e-72
AMG24328.1|80221_81427_+	ParA family protein	NA	A0A077SL49	Escherichia_phage	69.3	1.5e-162
AMG24329.2|81423_82401_+	chromosome partitioning protein ParB	NA	A0A1B0V750	Salmonella_phage	53.2	5.2e-84
AMG24330.1|82482_83757_-	DNA polymerase V subunit UmuC	NA	F1C5A5	Cronobacter_phage	64.5	3.0e-156
AMG24331.1|83756_84179_-	protein SamA	NA	A0A1W6JNS2	Morganella_phage	51.6	1.0e-28
AVH82161.1|84689_85160_+	hypothetical protein	NA	NA	NA	NA	NA
AMG24332.1|85152_85509_+	hypothetical protein	NA	NA	NA	NA	NA
AMG24333.1|85557_85746_+	hypothetical protein	NA	NA	NA	NA	NA
AMG24334.1|85890_86571_+	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	36.4	1.6e-28
