The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP014064	Staphylococcus aureus strain FDAARGOS_159 chromosome, complete genome	2801196	119	7864	2801196	terminase,coat	Staphylococcus_phage(75.0%)	10	NA	NA
AMG40529.1|119_461_+	pathogenicity island protein	NA	Q4ZE66	Staphylococcus_phage	97.3	5.4e-57
AMG40530.1|472_1051_+	pathogenicity island protein	NA	A0A2H4JBG0	uncultured_Caudovirales_phage	39.5	1.3e-29
AMG40531.1|1068_1287_+	hypothetical protein	NA	NA	NA	NA	NA
AMG40532.1|1337_1865_+|coat	spore coat protein	coat	Q4ZE87	Staphylococcus_phage	97.1	3.7e-89
AVC42096.1|1996_2209_+	pathogenicity island family protein	NA	Q4ZE86	Staphylococcus_phage	97.1	3.2e-31
AMG40534.1|2205_2775_+|terminase	terminase small subunit	terminase	Q4ZE85	Staphylococcus_phage	96.3	1.5e-99
AMG40535.1|3972_4533_+	hypothetical protein	NA	NA	NA	NA	NA
AMG40536.1|4832_5387_-	hypothetical protein	NA	A0A1W6JQE5	Staphylococcus_phage	76.1	5.2e-73
AMG40537.1|6174_6975_+	exotoxin	NA	A0A097PAT7	Streptococcus_pyogenes_phage	43.8	6.1e-51
AMG40538.1|7141_7864_-	exotoxin	NA	A0A1X9H080	Staphylococcus_phage	34.9	1.6e-26
>prophage 2
CP014064	Staphylococcus aureus strain FDAARGOS_159 chromosome, complete genome	2801196	39675	87408	2801196	head,plate,terminase,capsid,holin,integrase,tail,portal	Staphylococcus_phage(72.46%)	72	35924:35940	64676:64692
35924:35940	attL	ATGCAAAAGAAAAAGCA	NA	NA	NA	NA
AMG40579.1|39675_40917_+	cysteine desulfurase	NA	Q2XUY6	environmental_halophage	44.8	8.2e-111
AMG40580.1|40906_41371_+	SUF system NifU family Fe-S cluster assembly protein	NA	NA	NA	NA	NA
AMG40581.1|41521_42919_+	Fe-S cluster assembly protein SufB	NA	NA	NA	NA	NA
AMG40582.1|42986_44036_-|integrase	site-specific integrase	integrase	A1KWY3	Staphylococcus_virus	99.7	4.5e-203
AMG40583.1|44148_44328_+	excisionase	NA	Q4ZBP0	Staphylococcus_phage	100.0	3.7e-25
AMG40584.1|44307_45240_-	hypothetical protein	NA	A0EX19	Staphylococcus_virus	100.0	6.7e-174
AMG40585.1|45271_45736_-	toxin	NA	A0A0N9BAX8	Staphylococcus_phage	98.1	4.6e-83
AMG40586.1|45748_46063_-	XRE family transcriptional regulator	NA	A0A0N9BAW4	Staphylococcus_phage	100.0	9.8e-53
AMG40587.1|46214_46451_+	transcriptional regulator	NA	A0A0N9BAY2	Staphylococcus_phage	100.0	1.5e-37
AMG40588.1|46464_46644_+	hypothetical protein	NA	A0A0N9BAV3	Staphylococcus_phage	100.0	1.7e-25
AMG40589.1|46744_47227_-	hypothetical protein	NA	A0A0N9BAX2	Staphylococcus_phage	100.0	1.1e-82
AMG40590.1|47286_48036_+	oxidoreductase	NA	Q4ZBF7	Staphylococcus_virus	100.0	1.5e-136
AMG40591.1|48051_48195_+	hypothetical protein	NA	W5R8I6	Staphylococcus_phage	100.0	2.5e-16
AMG40592.1|48204_48858_-	hypothetical protein	NA	Q4ZBF5	Staphylococcus_virus	100.0	4.5e-116
AMG40593.1|48928_49150_+	hypothetical protein	NA	B2ZYU8	Staphylococcus_phage	100.0	8.7e-32
AMG40594.1|49142_49304_+	DUF1270 domain-containing protein	NA	D2JGJ6	Staphylococcus_phage	100.0	4.3e-20
AMG40595.1|49395_49656_+	DUF1108 domain-containing protein	NA	Q4ZDA1	Staphylococcus_virus	100.0	1.2e-43
AMG40596.1|49665_49887_+	DUF2483 domain-containing protein	NA	A0A1X9H047	Staphylococcus_phage	100.0	1.2e-33
AMG40597.1|49879_50668_+	chromosomal replication initiator DnaA	NA	Q4ZBM5	Staphylococcus_phage	100.0	2.6e-142
AMG40598.1|50696_51248_+	single-stranded DNA-binding protein	NA	Q4ZBM4	Staphylococcus_phage	100.0	3.4e-101
AMG40599.1|51260_51932_+	hypothetical protein	NA	A7TWM9	Staphylococcus_phage	100.0	2.0e-127
AMG40600.1|52037_52895_-	DUF4393 domain-containing protein	NA	Q4ZBL8	Staphylococcus_phage	100.0	9.5e-159
AMG40601.1|52959_53730_+	replication protein	NA	W5R8N2	Staphylococcus_phage	100.0	1.4e-116
AMG40602.1|53739_54519_+	DNA replication protein DnaC	NA	W5RAN3	Staphylococcus_phage	100.0	1.2e-144
AMG40604.1|54686_54908_+	hypothetical protein	NA	A7TWN4	Staphylococcus_phage	100.0	1.3e-35
AMG40605.1|55326_55512_+	DUF3113 domain-containing protein	NA	A0A068A236	Staphylococcus_phage	95.1	7.8e-26
AMG40606.1|55512_55872_+	hypothetical protein	NA	Q4ZBU0	Staphylococcus_virus	96.6	4.2e-60
AMG40607.1|55871_56129_+	DUF3310 domain-containing protein	NA	B5WZM8	Staphylococcus_phage	98.8	1.3e-42
AMG40608.1|56131_56332_+	hypothetical protein	NA	C5I650	Staphylococcus_phage	98.5	7.4e-30
AMG40609.2|56340_56589_+	hypothetical protein	NA	A0A2I6PF06	Staphylococcus_phage	97.6	5.2e-41
AMG40610.1|56603_57005_+	hypothetical protein	NA	A0A0H4IPW3	Staphylococcus_phage	81.3	7.1e-56
AMG40611.1|57001_57196_+	hypothetical protein	NA	A0A0U2A067	Staphylococcus_phage	98.4	6.3e-26
AMG40612.1|57192_57630_+	hypothetical protein	NA	NA	NA	NA	NA
AMG40613.1|57626_57911_+	hypothetical protein	NA	A1KX14	Staphylococcus_virus	96.8	4.4e-44
AMG40614.1|57903_58152_+	DUF1024 domain-containing protein	NA	A0A2K9VBU0	Staphylococcus_phage	97.6	5.4e-38
AMG40615.1|58144_58681_+	dUTPase	NA	R4IG63	Staphylococcus_phage	99.4	4.6e-95
AMG40616.1|58717_58924_+	DUF1381 domain-containing protein	NA	Q4ZCV6	Staphylococcus_virus	98.5	7.1e-20
AMG40617.1|58920_59094_+	transcriptional regulator	NA	Q4ZAX6	Staphylococcus_virus	98.2	1.1e-21
AMG40618.1|59094_59241_+	hypothetical protein	NA	A0A059T5A8	Staphylococcus_phage	100.0	2.2e-15
AMG40619.1|59255_59675_+	transcriptional regulator	NA	I1W651	Staphylococcus_phage	100.0	8.1e-71
AMG40620.1|59860_60301_+|terminase	terminase small subunit	terminase	I1W650	Staphylococcus_phage	99.3	2.4e-73
AMG40621.1|60287_61565_+|terminase	PBSX family phage terminase large subunit	terminase	Q8SDU9	Staphylococcus_phage	100.0	3.0e-249
AMG40622.1|61575_63111_+|portal	phage portal protein	portal	Q8SDU8	Staphylococcus_phage	99.2	1.4e-290
AMG40623.1|63117_64113_+|head	phage head morphogenesis protein	head	S4V9L8	Staphylococcus_phage	99.1	3.8e-183
AMG40624.1|64185_64356_+	hypothetical protein	NA	Q4ZDF2	Staphylococcus_virus	98.2	9.7e-23
AMG40625.1|64464_65085_+	DUF4355 domain-containing protein	NA	B2ZYY4	Staphylococcus_phage	95.6	1.9e-71
64676:64692	attR	ATGCAAAAGAAAAAGCA	NA	NA	NA	NA
AMG40626.1|65098_66073_+|capsid	phage major capsid protein	capsid	E0Y3L0	Staphylococcus_virus	99.4	6.3e-183
AMG40627.1|66094_66382_+	hypothetical protein	NA	B7T0D3	Staphylococcus_virus	91.6	1.9e-42
AMG40628.1|66390_66723_+|head,tail	phage head-tail adapter protein	head,tail	B7T0D4	Staphylococcus_virus	95.5	6.7e-52
AMG40629.1|66719_67022_+	hypothetical protein	NA	A4ZFB6	Staphylococcus_virus	97.0	3.3e-50
AMG40630.1|67021_67369_+	hypothetical protein	NA	A0A0F6N3F5	Staphylococcus_phage	100.0	4.1e-60
AMG40631.1|67380_67764_+	hypothetical protein	NA	Q8SDU1	Staphylococcus_phage	100.0	2.6e-68
AMG40632.1|67782_68364_+|tail	phage major tail protein, TP901-1 family	tail	Q4ZDE5	Staphylococcus_virus	100.0	8.3e-106
AMG40633.1|68425_68791_+|tail	phage tail protein	tail	A0A0F6N4J9	Staphylococcus_phage	100.0	3.6e-59
AMG40634.1|68820_69165_+	hypothetical protein	NA	A0A0F6N3F7	Staphylococcus_phage	100.0	2.5e-57
AMG40635.1|69181_72646_+	hypothetical protein	NA	S4V989	Staphylococcus_phage	99.1	5.6e-266
AMG40636.1|72658_73606_+|tail	phage tail family protein	tail	Q8SDT6	Staphylococcus_phage	99.7	4.7e-183
AMG40637.1|73614_75516_+	peptidase	NA	Q8SDT5	Staphylococcus_phage	100.0	0.0e+00
AMG40638.1|75530_77441_+	hypothetical protein	NA	B2ZYZ7	Staphylococcus_phage	99.1	0.0e+00
AMG40639.1|77440_79264_+|plate	phage baseplate upper protein	plate	Q9FZY8	Staphylococcus_virus	96.4	2.2e-282
AMG40640.1|79263_79641_+	DUF2977 domain-containing protein	NA	W5R9M2	Staphylococcus_phage	99.2	3.4e-60
AMG40641.2|79650_79824_+	XkdX family protein	NA	A0A059T7K6	Staphylococcus_phage	100.0	1.3e-27
AMG40642.1|79864_80164_+	DUF2951 domain-containing protein	NA	A0EWU6	Staphylococcus_virus	98.0	3.8e-46
AMG40643.1|80300_82199_+	CHAP domain-containing protein	NA	Q8SDT1	Staphylococcus_phage	99.4	0.0e+00
AMG40644.1|82211_83384_+	DUF2479 domain-containing protein	NA	Q8SDT0	Staphylococcus_phage	99.7	1.1e-197
AMG40645.1|83389_83785_+	hypothetical protein	NA	Q4ZBW9	Staphylococcus_virus	100.0	1.6e-68
AMG40646.1|83840_84116_+|holin	phage holin	holin	A0A0F6N3M0	Staphylococcus_phage	100.0	8.6e-45
AMG40647.1|84102_85515_+	CHAP domain-containing protein	NA	A0A0F6N3N1	Staphylococcus_phage	99.6	6.4e-285
AMG40648.2|85659_85812_+	hypothetical protein	NA	A0A0F6N3H2	Staphylococcus_phage	100.0	3.1e-20
AMG40649.1|85882_85993_+	hypothetical protein	NA	W5R8J7	Staphylococcus_phage	100.0	1.7e-12
AMG40650.2|85979_86180_+	hypothetical protein	NA	W5R9N2	Staphylococcus_phage	100.0	3.7e-29
AMG40651.1|86850_87408_+	hypothetical protein	NA	W5R8Q1	Staphylococcus_phage	100.0	5.7e-104
>prophage 3
CP014064	Staphylococcus aureus strain FDAARGOS_159 chromosome, complete genome	2801196	170283	223407	2801196	holin,bacteriocin,tRNA,protease	Streptococcus_phage(28.57%)	55	NA	NA
AMG40731.1|170283_171273_-|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
AMG40732.1|171566_171962_+	transcriptional regulator Spx	NA	NA	NA	NA	NA
AMG40733.1|172332_173052_+	adaptor protein MecA	NA	NA	NA	NA	NA
AMG40734.1|173172_174159_+	competence protein CoiA	NA	NA	NA	NA	NA
AMG40735.1|174206_176015_+	oligoendopeptidase F	NA	A0A1X9I5X5	Streptococcus_phage	24.5	5.5e-47
AMG40736.1|176474_177281_-	DsbA family protein	NA	NA	NA	NA	NA
AMG40737.1|177303_177669_-	globin	NA	NA	NA	NA	NA
AMG40738.1|177772_178366_-	CYTH domain-containing protein	NA	NA	NA	NA	NA
AMG40739.1|178551_178899_+	hypothetical protein	NA	NA	NA	NA	NA
AMG40740.1|178915_179551_+	GTP pyrophosphokinase	NA	NA	NA	NA	NA
AMG40741.1|179567_180377_+	NAD(+) kinase	NA	NA	NA	NA	NA
AMG40742.1|180373_181228_+	RluA family pseudouridine synthase	NA	NA	NA	NA	NA
AMG40743.1|181248_182634_+	magnesium transporter	NA	NA	NA	NA	NA
AMG40744.1|182643_184488_+	sodium:proton antiporter	NA	NA	NA	NA	NA
AMG40745.1|184765_185536_+	enoyl-[acyl-carrier-protein] reductase FabI	NA	NA	NA	NA	NA
AMG40746.1|185732_186818_-	AI-2E family transporter	NA	NA	NA	NA	NA
AMG40747.1|187159_188728_+	alanine:cation symporter family protein	NA	NA	NA	NA	NA
AMG40748.1|188872_189631_+	esterase family protein	NA	NA	NA	NA	NA
AMG40749.1|189824_190334_+	hypothetical protein	NA	NA	NA	NA	NA
AMG40750.2|190446_191655_-	MFS transporter	NA	NA	NA	NA	NA
AMG40751.1|191614_192790_-	diacylglycerol beta-glucosyltransferase	NA	NA	NA	NA	NA
AMG40752.1|193222_194707_+	UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--L- lysine ligase	NA	NA	NA	NA	NA
AMG40753.2|194687_194948_+	hypothetical protein	NA	NA	NA	NA	NA
AMG40754.1|194947_196510_+	peptide chain release factor 3	NA	A0A1S5SF82	Streptococcus_phage	28.2	1.7e-36
AMG40755.1|196811_197615_+	hypothetical protein	NA	S5MAL1	Bacillus_phage	40.5	1.6e-30
AMG40756.2|197833_200158_+	PDZ domain-containing protein	NA	W5SAB9	Pithovirus	27.4	2.8e-11
AMG40757.1|200174_201533_+	Ktr system potassium uptake protein D	NA	NA	NA	NA	NA
AMG40758.1|201671_203183_+	bifunctional metallophosphatase/5'-nucleotidase	NA	NA	NA	NA	NA
AMG40759.1|203669_204239_-	competence protein ComK	NA	NA	NA	NA	NA
AMG40760.1|204448_204667_+	IDEAL domain-containing protein	NA	NA	NA	NA	NA
AMG40761.1|204747_205734_-	lipoate--protein ligase	NA	NA	NA	NA	NA
AMG40762.1|205932_206109_+	DUF2187 domain-containing protein	NA	NA	NA	NA	NA
AMG40763.1|206123_206726_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
AMG40764.2|207025_207103_+|holin	putative holin-like toxin	holin	NA	NA	NA	NA
AMG40765.1|207641_207743_+	hypothetical protein	NA	NA	NA	NA	NA
AVC42097.1|207752_208025_+|bacteriocin	lactococcin 972 family bacteriocin	bacteriocin	NA	NA	NA	NA
AMG40766.1|208068_210033_+	DUF1430 domain-containing protein	NA	NA	NA	NA	NA
AMG40767.1|210035_210356_+	hypothetical protein	NA	NA	NA	NA	NA
AMG40768.1|210352_210994_+|bacteriocin	bacteriocin ABC transporter ATP-binding protein	bacteriocin	G9BWD6	Planktothrix_phage	33.0	1.7e-19
AVC42028.1|211081_211372_-	hypothetical protein	NA	NA	NA	NA	NA
AVC42029.1|211512_211650_+	poly(glycerol-phosphate) alpha-glucosyltransferase	NA	NA	NA	NA	NA
AMG40769.1|211738_212095_-	DoxX family protein	NA	NA	NA	NA	NA
AMG40770.1|212582_213542_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AMG40771.2|213587_213719_-	hypothetical protein	NA	NA	NA	NA	NA
AMG40772.2|213782_214073_-	NINE protein	NA	A0A060AN66	Enterococcus_phage	38.0	7.5e-07
AMG40773.1|214162_214714_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AMG40774.1|214765_215704_-	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
AVC42030.1|215854_215959_+	hypothetical protein	NA	NA	NA	NA	NA
AMG40775.2|216035_217247_+	isochorismate synthase	NA	NA	NA	NA	NA
AMG40776.1|217233_218907_+	2-succinyl-5-enolpyruvyl-6-hydroxy-3- cyclohexene-1-carboxylate synthase	NA	NA	NA	NA	NA
AMG40777.1|218893_219697_+	2-succinyl-6-hydroxy-2, 4-cyclohexadiene-1-carboxylate synthase	NA	NA	NA	NA	NA
AMG40778.1|219689_220511_+	1,4-dihydroxy-2-naphthoyl-CoA synthase	NA	NA	NA	NA	NA
AMG40779.1|220748_221078_-	staphostatin B	NA	NA	NA	NA	NA
AMG40780.1|221115_222297_-|protease	cysteine protease staphopain B	protease	NA	NA	NA	NA
AMG40781.1|222378_223407_-|protease	serine protease	protease	A0A2H4PQP7	Staphylococcus_phage	32.3	6.3e-16
>prophage 4
CP014064	Staphylococcus aureus strain FDAARGOS_159 chromosome, complete genome	2801196	241828	250301	2801196		Synechococcus_phage(33.33%)	9	NA	NA
AMG40797.1|241828_242311_+	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	44.0	4.0e-21
AMG40798.1|242297_243422_+	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
AMG40799.1|243425_244130_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	M4R1E8	Synechococcus_phage	42.1	7.3e-48
AMG40800.1|244129_244393_+	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
AMG40801.1|244394_245066_+	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
AMG40802.1|245058_247248_+	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	39.8	3.5e-141
AMG40803.1|247226_248711_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	31.7	1.9e-45
AMG40804.1|248703_249732_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	41.7	3.4e-62
AMG40805.1|249734_250301_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	40.1	6.1e-29
>prophage 5
CP014064	Staphylococcus aureus strain FDAARGOS_159 chromosome, complete genome	2801196	870256	879299	2801196	tRNA	uncultured_Mediterranean_phage(50.0%)	7	NA	NA
AMG41379.1|870256_870775_-	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	46.5	5.6e-29
AMG41380.1|870796_873070_-	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	29.3	8.1e-64
AMG41381.1|873272_875552_-	protein translocase subunit SecDF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	35.8	1.8e-31
AMG41382.1|875826_876087_-	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	35.3	8.2e-05
AMG41383.1|876105_877245_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	44.7	5.4e-85
AMG41384.1|877267_878293_-|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
AVC42040.1|878294_879299_-	Holliday junction branch migration DNA helicase RuvB	NA	B3GAM6	uncultured_virus	29.1	1.7e-05
>prophage 6
CP014064	Staphylococcus aureus strain FDAARGOS_159 chromosome, complete genome	2801196	993327	1066360	2801196	transposase,tRNA,protease	Staphylococcus_phage(95.74%)	68	NA	NA
AMG41491.1|993327_993972_-|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
AMG41492.1|993986_994778_-	phosphotransferase	NA	NA	NA	NA	NA
AMG41493.1|995227_996076_-	D-amino-acid transaminase	NA	NA	NA	NA	NA
AMG41494.1|996079_997489_-	dipeptidase PepV	NA	NA	NA	NA	NA
AMG41495.1|998046_998469_-	YtxH domain-containing protein	NA	NA	NA	NA	NA
AMG41496.1|998485_999181_-	rRNA pseudouridine synthase	NA	NA	NA	NA	NA
AMG41497.1|999177_1000839_-	polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
AMG41498.1|1001245_1002514_+	NAD(P)/FAD-dependent oxidoreductase	NA	A0A2H4PQX1	Staphylococcus_phage	99.1	9.1e-57
AMG41499.1|1002630_1009191_-	DUF1542 domain-containing protein	NA	A0A2H4PQU6	Staphylococcus_phage	98.3	6.1e-306
AMG41500.1|1009516_1009828_-	rhodanese-like domain-containing protein	NA	A0A2H4PQR9	Staphylococcus_phage	99.0	4.8e-52
AMG41501.2|1009849_1012267_-|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	99.5	0.0e+00
AMG41502.1|1012554_1013736_-	MFS transporter	NA	A0A2H4PQR6	Staphylococcus_phage	99.7	7.3e-218
AMG41503.1|1013845_1014799_+	TIGR01212 family radical SAM protein	NA	A0A2H4PQV5	Staphylococcus_phage	100.0	2.2e-79
AMG41504.1|1014795_1015359_+	methyltransferase domain-containing protein	NA	A0A2H4PQV0	Staphylococcus_phage	99.5	8.3e-103
AMG41505.1|1015481_1015883_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
AMG41506.1|1016454_1017282_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
AMG41507.2|1017284_1017404_-	hypothetical protein	NA	NA	NA	NA	NA
AMG41508.1|1017515_1018517_+	proline dehydrogenase	NA	A0A2H4PQT6	Staphylococcus_phage	99.4	2.6e-184
AMG41509.1|1018638_1019103_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	100.0	4.5e-70
AMG41510.1|1019115_1020297_-	riboflavin biosynthesis protein RibBA	NA	A0A2H4PQS2	Staphylococcus_phage	99.5	5.6e-226
AMG41511.1|1020307_1020940_-	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	98.6	5.5e-111
AMG41512.2|1020946_1021978_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	98.8	4.0e-196
AMG41513.1|1022470_1023973_-	pyridine nucleotide-disulfide oxidoreductase	NA	A0A2H4PQX2	Staphylococcus_phage	98.6	1.9e-29
AMG41514.1|1024495_1024810_+	ArsR family transcriptional regulator	NA	A0A2H4PQT4	Staphylococcus_phage	98.1	9.8e-53
AMG41515.1|1024809_1026102_+	arsenical efflux pump membrane protein ArsB	NA	A0A2H4PQU3	Staphylococcus_phage	99.5	5.0e-228
AMG41516.1|1026188_1027043_-	autolysin	NA	Q4ZCC7	Staphylococcus_virus	38.6	9.8e-39
AMG41517.1|1027318_1027543_-	hypothetical protein	NA	NA	NA	NA	NA
AMG41518.1|1027741_1028212_+	RNA polymerase sigma factor SigS	NA	A0A2H4PQT5	Staphylococcus_phage	98.1	8.8e-82
AMG41519.1|1028324_1028768_+	competence protein ComK	NA	NA	NA	NA	NA
AMG41520.1|1028754_1029198_-	hypothetical protein	NA	A0A2H4PQT8	Staphylococcus_phage	98.6	2.4e-57
AMG41521.1|1029493_1030129_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
AMG41522.1|1030568_1031282_-	transaldolase	NA	M1PR54	Cyanophage	35.3	5.5e-19
AMG41523.1|1031541_1031844_+	hypothetical protein	NA	NA	NA	NA	NA
AMG41524.1|1032156_1033476_+|transposase	ISL3-like element IS1181 family transposase	transposase	NA	NA	NA	NA
AMG41525.1|1033619_1033985_+	fluoride efflux transporter CrcB	NA	A0A2H4PQR0	Staphylococcus_phage	100.0	3.6e-59
AMG41526.1|1033981_1034335_+	camphor resistance protein CrcB	NA	A0A2H4PQQ7	Staphylococcus_phage	94.0	3.8e-21
AMG41529.1|1036331_1037165_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	99.3	7.8e-158
AMG41530.1|1037376_1038285_-	NERD domain-containing protein	NA	A0A2H4PQQ8	Staphylococcus_phage	100.0	3.4e-138
AMG41531.1|1038406_1039603_-	S-adenosylmethionine synthase	NA	A0A2H4PQS6	Staphylococcus_phage	99.5	4.3e-218
AMG41532.1|1039974_1041567_+	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	100.0	0.0e+00
AMG41533.2|1041944_1042691_-	S9 family peptidase	NA	A0A2H4PQM6	Staphylococcus_phage	98.8	1.4e-142
AMG41534.2|1042695_1043169_-	nucleoside triphosphatase YtkD	NA	A0A2H4PQM4	Staphylococcus_phage	98.7	7.2e-84
AMG41535.1|1043234_1043492_+	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	100.0	7.2e-46
AMG41536.1|1043488_1044490_-	o-succinylbenzoate synthase	NA	A0A2H4PQM0	Staphylococcus_phage	97.3	5.3e-185
AMG41537.1|1044494_1045973_-	2-succinylbenzoate-CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	97.6	2.8e-283
AMG41538.2|1046131_1046587_-	DUF4909 domain-containing protein	NA	A0A2H4PQN7	Staphylococcus_phage	99.3	3.6e-80
AMG41539.2|1046889_1047540_+	calcium-binding protein	NA	A0A2H4PQM8	Staphylococcus_phage	94.0	2.9e-51
AMG41540.1|1047620_1048616_+	DUF4352 domain-containing protein	NA	A0A2H4PQN2	Staphylococcus_phage	97.9	2.6e-67
AMG41541.1|1048690_1049317_+	hypothetical protein	NA	A0A2H4PQM7	Staphylococcus_phage	79.8	3.1e-74
AMG41542.1|1049357_1049699_+	DUF3969 domain-containing protein	NA	A0A2H4PQN6	Staphylococcus_phage	94.7	1.1e-54
AMG41543.1|1049799_1050372_+	hypothetical protein	NA	A0A2H4PQN4	Staphylococcus_phage	93.1	2.3e-23
AMG41547.1|1051944_1052046_+	hypothetical protein	NA	NA	NA	NA	NA
AMG41549.1|1053121_1054351_-	restriction endonuclease subunit S	NA	A0A2H4PQP5	Staphylococcus_phage	64.7	4.0e-134
AMG41550.2|1054343_1056083_-	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	100.0	2.4e-289
AMG41551.1|1056063_1056198_-	hypothetical protein	NA	NA	NA	NA	NA
AMG41552.1|1056260_1056980_-|protease	serine protease SplF	protease	A0A2H4PQP1	Staphylococcus_phage	99.6	1.9e-131
AVC42042.1|1057081_1057189_+	hypothetical protein	NA	NA	NA	NA	NA
AMG41553.1|1057137_1057857_-|protease	serine protease SplD	protease	A0A2H4PQP9	Staphylococcus_phage	99.6	4.6e-130
AMG41554.1|1057977_1058697_-|protease	serine protease SplC	protease	A0A2H4PQP7	Staphylococcus_phage	98.7	1.3e-129
AMG41555.1|1058754_1059477_-|protease	serine protease SplB	protease	A0A2H4PQN0	Staphylococcus_phage	98.3	3.5e-130
AMG41556.1|1059601_1060309_-|protease	serine protease SplA	protease	A0A2H4PQN3	Staphylococcus_phage	97.0	7.9e-127
AMG41557.1|1060744_1060963_-	hypothetical protein	NA	NA	NA	NA	NA
AMG41558.1|1061272_1061854_+	DUF4888 domain-containing protein	NA	A0A2H4PQH6	Staphylococcus_phage	64.2	1.6e-53
AMG41559.1|1062326_1062545_-	hypothetical protein	NA	A0A2H4PQH0	Staphylococcus_phage	80.6	2.0e-25
AMG41560.1|1062800_1063274_+	hypothetical protein	NA	NA	NA	NA	NA
AMG41561.1|1063278_1064070_+	DUF1828 domain-containing protein	NA	NA	NA	NA	NA
AMG41562.1|1064439_1065423_-	bi-component leukocidin LukED subunit D	NA	A0A2H4PQH7	Staphylococcus_phage	99.4	1.8e-185
AMG41563.1|1065424_1066360_-	beta-channel forming cytolysin	NA	A0A2H4PQI5	Staphylococcus_phage	100.0	1.4e-174
>prophage 7
CP014064	Staphylococcus aureus strain FDAARGOS_159 chromosome, complete genome	2801196	1072561	1076808	2801196		Staphylococcus_phage(66.67%)	6	NA	NA
AMG41569.1|1072561_1073317_-	exotoxin	NA	A0A075M4C7	Staphylococcus_phage	41.4	6.0e-40
AMG41570.1|1073355_1073751_-	enterotoxin	NA	A0A097PAT7	Streptococcus_pyogenes_phage	50.4	1.5e-26
AMG41571.1|1073725_1074127_-	enterotoxin	NA	A0A097PAT7	Streptococcus_pyogenes_phage	37.9	1.5e-10
AMG41572.1|1074280_1075009_-	exotoxin	NA	A0A1X9H080	Staphylococcus_phage	39.2	1.1e-27
AMG41573.1|1075043_1075763_-	exotoxin	NA	A0A1X9H080	Staphylococcus_phage	35.8	2.3e-25
AMG41574.1|1076043_1076808_-	exotoxin	NA	A0A1X9H080	Staphylococcus_phage	37.1	2.3e-31
>prophage 8
CP014064	Staphylococcus aureus strain FDAARGOS_159 chromosome, complete genome	2801196	1171098	1253193	2801196	head,protease,terminase,holin,capsid,integrase,tail,portal	Staphylococcus_phage(88.16%)	108	1220157:1220174	1244333:1244350
AMG41658.1|1171098_1172265_+|protease	cysteine protease staphopain A	protease	NA	NA	NA	NA
AMG41659.1|1172295_1172622_+	staphostatin A	NA	NA	NA	NA	NA
AMG41660.1|1172913_1173087_-	NETI motif-containing protein	NA	NA	NA	NA	NA
AMG41661.1|1173067_1173670_-	DUF2179 domain-containing protein	NA	NA	NA	NA	NA
AMG41662.1|1173940_1174762_-	NAD(+) synthetase	NA	G3MA24	Bacillus_virus	52.7	2.3e-69
AMG41663.1|1174754_1176224_-	nicotinate phosphoribosyltransferase	NA	G3MA18	Bacillus_virus	45.1	5.9e-108
AMG41664.1|1176407_1177484_+	nitric oxide synthase oxygenase	NA	NA	NA	NA	NA
AMG41665.1|1177503_1178298_+	ACT domain-containing protein	NA	NA	NA	NA	NA
AMG41666.1|1178369_1178477_+	hypothetical protein	NA	NA	NA	NA	NA
AMG41667.1|1178487_1180050_-	sodium-dependent dicarboxylate transporter SdcS	NA	NA	NA	NA	NA
AMG41668.1|1180254_1181352_-	pectate lyase	NA	U5PWM6	Bacillus_phage	34.6	3.3e-47
AMG41669.1|1181720_1182281_+	cysteine hydrolase	NA	G3MA16	Bacillus_virus	41.2	2.0e-32
AMG41670.1|1182333_1183263_+	manganese-dependent inorganic pyrophosphatase	NA	NA	NA	NA	NA
AMG43219.2|1183455_1183629_-	hypothetical protein	NA	NA	NA	NA	NA
AMG41671.1|1183680_1185060_+	aldehyde dehydrogenase	NA	NA	NA	NA	NA
AMG41672.1|1185179_1186208_-	hypothetical protein	NA	NA	NA	NA	NA
AMG41673.1|1186477_1186879_+	YolD-like family protein	NA	U3PG23	Staphylococcus_phage	42.9	6.0e-23
AMG41674.1|1187451_1187625_-	hypothetical protein	NA	NA	NA	NA	NA
AMG41675.1|1188075_1189116_+	linear amide C-N hydrolase	NA	NA	NA	NA	NA
AMG41676.1|1189172_1190015_-	hypothetical protein	NA	NA	NA	NA	NA
AMG41677.1|1190011_1190569_-	DUF1700 domain-containing protein	NA	NA	NA	NA	NA
AMG41678.1|1190628_1191153_-	hypothetical protein	NA	NA	NA	NA	NA
AMG41679.1|1191273_1191837_+	thioredoxin family protein	NA	NA	NA	NA	NA
AMG41680.1|1191902_1192643_-	phenol-soluble modulin export ABC transporter permease subunit PmtD	NA	NA	NA	NA	NA
AMG41681.1|1192642_1193515_-	phenol-soluble modulin export ABC transporter ATP-binding protein PmtC	NA	A0A2H4PQG7	Staphylococcus_phage	36.0	1.0e-27
AMG41682.1|1193511_1194192_-	phenol-soluble modulin export ABC transporter permease subunit PmtB	NA	NA	NA	NA	NA
AMG41683.1|1194192_1195089_-	phenol-soluble modulin export ABC transporter ATP-binding protein PmtA	NA	A0A2H4PQG7	Staphylococcus_phage	30.2	5.0e-17
AMG41684.1|1195085_1195466_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AMG41685.1|1195723_1195900_-	hypothetical protein	NA	NA	NA	NA	NA
AMG41686.1|1196142_1196241_-	hypothetical protein	NA	NA	NA	NA	NA
AMG41687.1|1196440_1197727_+	aspartate aminotransferase	NA	NA	NA	NA	NA
AMG41688.1|1198005_1198296_-	MAP domain-containing protein	NA	NA	NA	NA	NA
AMG41689.1|1198306_1199740_-	MAP domain-containing protein	NA	NA	NA	NA	NA
AMG41690.1|1200125_1200326_+	hypothetical protein	NA	A0A1P8L6A7	Staphylococcus_phage	100.0	3.4e-27
AMG41691.1|1200697_1200877_+	hypothetical protein	NA	A0A1W6JQ29	Staphylococcus_phage	98.3	1.4e-24
AVC42044.1|1200900_1201209_+	hypothetical protein	NA	M9NTD8	Staphylococcus_phage	100.0	3.2e-40
AMG41693.2|1201187_1201448_+	hypothetical protein	NA	M9NS66	Staphylococcus_phage	100.0	2.3e-23
AMG41694.1|1201500_1201851_-	inhibitor	NA	A0A1P8L6B0	Staphylococcus_phage	100.0	7.5e-54
AMG41695.1|1202360_1202657_-	peptidoglycan hydrolase	NA	A0A1P8L6B4	Staphylococcus_phage	95.9	1.6e-49
AVC42045.1|1202563_1202818_-	amidase	NA	Q4ZCK0	Staphylococcus_virus	93.0	8.0e-13
AVC42046.1|1202744_1202900_+	amidase	NA	NA	NA	NA	NA
AMG41696.1|1203346_1203838_-	staphylokinase	NA	A0A1W6JQ12	Staphylococcus_phage	99.4	4.7e-86
AMG41697.1|1204028_1204784_-	CHAP domain-containing protein	NA	D2JLG5	Staphylococcus_phage	100.0	3.4e-152
AMG41698.1|1204795_1205050_-|holin	phage holin	holin	D2JLG4	Staphylococcus_phage	100.0	4.1e-41
AMG41699.1|1205101_1205209_+	hypothetical protein	NA	NA	NA	NA	NA
AVC42100.1|1205261_1205438_-|holin	putative holin-like toxin	holin	D2JLG3	Staphylococcus_phage	98.3	2.2e-22
AMG43220.2|1205640_1206423_-	exotoxin	NA	A0A075M4C7	Staphylococcus_phage	99.6	1.6e-149
AMG41700.1|1206834_1207209_-	hypothetical protein	NA	G4KNR3	Staphylococcus_phage	100.0	3.3e-39
AMG41701.1|1207264_1207552_-	hypothetical protein	NA	A0A075LZJ6	Staphylococcus_phage	100.0	5.8e-44
AMG41702.1|1207598_1207751_-	hypothetical protein	NA	D2JLG0	Staphylococcus_phage	98.0	1.2e-19
AMG41703.1|1207740_1211526_-	hypothetical protein	NA	A0A1X9H0H3	Staphylococcus_phage	98.3	0.0e+00
AMG41704.1|1211541_1213026_-|tail	phage tail protein	tail	A0A2I6PDJ0	Staphylococcus_phage	100.0	1.2e-297
AMG41705.1|1217795_1218146_-	hypothetical protein	NA	G4KNQ8	Staphylococcus_phage	100.0	7.8e-59
AVC42047.1|1218195_1218420_-	hypothetical protein	NA	A0A075LYE8	Staphylococcus_phage	100.0	3.0e-32
AMG41706.1|1218461_1219106_-|tail	phage tail protein	tail	A0EWZ9	Staphylococcus_phage	99.1	1.2e-118
AMG41707.1|1219106_1219514_-	hypothetical protein	NA	G4KNQ6	Staphylococcus_phage	100.0	7.1e-72
AMG41708.1|1219510_1219915_-	hypothetical protein	NA	G4KNQ5	Staphylococcus_phage	100.0	4.3e-69
AMG41709.1|1219911_1220274_-|head,tail	phage head-tail adapter protein	head,tail	G4KNQ4	Staphylococcus_phage	100.0	4.4e-65
1220157:1220174	attL	ATAATTTTTCTTCTTTTT	NA	NA	NA	NA
AMG41710.1|1220257_1220542_-|head,tail	phage head-tail adapter protein	head,tail	A0A2I6PDJ5	Staphylococcus_phage	98.9	4.0e-45
AMG41711.1|1220531_1220816_-	hypothetical protein	NA	A0A2I6PDJ3	Staphylococcus_phage	100.0	1.8e-45
AMG41712.1|1220835_1221981_-|capsid	phage major capsid protein	capsid	G4KNQ3	Staphylococcus_phage	100.0	9.6e-215
AMG41713.1|1222004_1222742_-|protease	Clp protease ClpP	protease	G4KNQ2	Staphylococcus_phage	99.6	4.0e-129
AMG41714.1|1222725_1223913_-|portal	phage portal protein	portal	A0A2I6PDI1	Staphylococcus_phage	100.0	1.0e-219
AMG41715.1|1223928_1225590_-|terminase	terminase large subunit	terminase	A0A2I6PDJ8	Staphylococcus_phage	100.0	0.0e+00
AMG43221.1|1225586_1225931_-	hypothetical protein	NA	G4KNP9	Staphylococcus_phage	100.0	9.4e-57
AMG41716.1|1226060_1226360_-	HNH endonuclease	NA	A0EWY8	Staphylococcus_phage	100.0	4.6e-52
AMG41717.1|1226591_1227008_-	transcriptional regulator	NA	G4KNP7	Staphylococcus_phage	100.0	1.3e-76
AMG41718.1|1227035_1227236_-	hypothetical protein	NA	A0A2I6PDV9	Staphylococcus_phage	100.0	1.4e-28
AMG41719.1|1227235_1227385_-	transcriptional regulator	NA	A0A1W6JPZ2	Staphylococcus_phage	98.0	8.2e-18
AMG41720.1|1227381_1227768_-	hypothetical protein	NA	W5R986	Staphylococcus_phage	100.0	3.0e-64
AMG41721.1|1227764_1227971_-	DUF1381 domain-containing protein	NA	A0A0H3U2R7	Staphylococcus_phage	100.0	1.3e-29
AMG41722.1|1227967_1228213_-	hypothetical protein	NA	A0A2I6PDW7	Staphylococcus_phage	100.0	5.0e-36
AMG41723.1|1228249_1228786_-	dUTPase	NA	A0A1W6JQ21	Staphylococcus_phage	100.0	9.4e-96
AMG41724.1|1228935_1229190_-	DUF1024 domain-containing protein	NA	A0A0H3U469	Staphylococcus_phage	100.0	5.0e-39
AMG41725.1|1229204_1229447_-	hypothetical protein	NA	Q4ZDP7	Staphylococcus_virus	95.0	2.1e-39
AMG41726.1|1229450_1229819_-	hypothetical protein	NA	A0A0H3U2T3	Staphylococcus_phage	100.0	2.0e-49
AVC42101.1|1229831_1230140_-	RusA family crossover junction endodeoxyribonuclease	NA	A0EWX6	Staphylococcus_phage	100.0	1.6e-52
AMG41727.1|1230242_1230461_-	hypothetical protein	NA	A0A2I6PDG4	Staphylococcus_phage	100.0	1.0e-37
AMG41728.1|1230516_1231362_-	DnaD domain protein	NA	A0A2I6PDG7	Staphylococcus_phage	99.3	7.0e-130
AMG41729.1|1231391_1231862_-	Single-stranded DNA-binding protein 1	NA	A0EWX3	Staphylococcus_phage	99.4	7.4e-81
AMG41730.2|1231862_1232480_-	MBL fold metallo-hydrolase	NA	A0A0H3U2T4	Staphylococcus_phage	100.0	4.1e-87
AMG41731.1|1232560_1233481_-	recombinase	NA	A0A2I6PDH5	Staphylococcus_phage	100.0	2.3e-166
AMG41732.1|1233482_1235426_-	ATPase	NA	S4V9K6	Staphylococcus_phage	100.0	0.0e+00
AVC42048.1|1235434_1235698_-	hypothetical protein	NA	A0A2I6PDG2	Staphylococcus_phage	100.0	7.7e-43
AMG41733.1|1235706_1235967_-	DUF1108 domain-containing protein	NA	A0A1P8L6F5	Staphylococcus_phage	100.0	5.2e-44
AMG41734.1|1235971_1236274_-	hypothetical protein	NA	A0A1P8L6F8	Staphylococcus_phage	100.0	7.0e-48
AMG41735.1|1236366_1236528_-	DUF1270 domain-containing protein	NA	D2JGJ6	Staphylococcus_phage	98.1	7.2e-20
AMG41736.1|1236524_1236845_-	DUF771 domain-containing protein	NA	Q4ZDR7	Staphylococcus_virus	100.0	1.5e-56
AMG41737.1|1236874_1237093_-	hypothetical protein	NA	Q4ZBN1	Staphylococcus_phage	97.2	2.1e-30
AMG41738.1|1237123_1237318_-	hypothetical protein	NA	A0A1X9H0A2	Staphylococcus_phage	100.0	1.5e-19
AMG41739.1|1237334_1238087_-	oxidoreductase	NA	A0A1X9H0A0	Staphylococcus_phage	99.2	1.5e-139
AMG41740.1|1238137_1238467_+	hypothetical protein	NA	M9NS98	Staphylococcus_phage	100.0	2.7e-53
AMG41741.1|1238455_1238671_-	DUF2829 domain-containing protein	NA	A0A0H3U4C7	Staphylococcus_phage	100.0	4.8e-35
AMG41742.1|1238686_1238950_-	XRE family transcriptional regulator	NA	A0A2I6PF09	Staphylococcus_phage	100.0	7.2e-41
AMG41743.1|1238946_1239120_-	transcriptional regulator	NA	NA	NA	NA	NA
AMG41744.1|1239082_1239796_+	XRE family transcriptional regulator	NA	M9NUL0	Staphylococcus_phage	100.0	1.2e-130
AMG41745.1|1239811_1240744_+	ATP-dependent helicase	NA	A0A2I6PEZ7	Staphylococcus_phage	100.0	5.7e-173
AMG41746.1|1240749_1241091_+	hypothetical protein	NA	A0A2I6PF04	Staphylococcus_phage	100.0	4.6e-56
AMG41747.1|1241294_1241477_+	hypothetical protein	NA	M9NSW6	Staphylococcus_phage	100.0	4.1e-27
AMG41748.1|1241576_1242041_+	hypothetical protein	NA	A0EWV3	Staphylococcus_phage	100.0	1.1e-28
AMG41749.1|1242099_1243137_+|integrase	site-specific integrase	integrase	A0EWV2	Staphylococcus_phage	100.0	9.1e-180
AMG41751.1|1244255_1245272_-	bi-component leukocidin LukGH subunit G	NA	A0A1X9IGW5	Staphylococcus_phage	30.2	6.7e-26
1244333:1244350	attR	ATAATTTTTCTTCTTTTT	NA	NA	NA	NA
AMG41752.1|1245293_1246349_-	bi-component leukocidin LukGH subunit H	NA	A0A1X9IGW5	Staphylococcus_phage	34.3	2.8e-35
AMG41753.1|1246784_1248008_+	succinyl-diaminopimelate desuccinylase	NA	NA	NA	NA	NA
AMG41754.1|1248451_1249759_+	TrkH family potassium uptake protein	NA	NA	NA	NA	NA
AMG41755.1|1250298_1251915_-	molecular chaperone GroEL	NA	A0A240F779	uncultured_virus	54.7	3.4e-157
AMG41756.1|1251990_1252275_-	co-chaperone GroES	NA	A0A221S386	uncultured_virus	46.2	4.7e-14
AMG41757.1|1252449_1253193_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
>prophage 9
CP014064	Staphylococcus aureus strain FDAARGOS_159 chromosome, complete genome	2801196	2404447	2410188	2801196	transposase	Staphylococcus_phage(50.0%)	8	NA	NA
AMG42838.1|2404447_2405368_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	42.2	1.0e-41
AMG42839.1|2405360_2406098_+	ABC transporter permease	NA	NA	NA	NA	NA
AMG42840.1|2406111_2406315_+	UDP kinase	NA	NA	NA	NA	NA
AMG42841.1|2406344_2407019_+|transposase	IS6 family transposase	transposase	A0A0N9RU54	Staphylococcus_phage	97.3	1.7e-126
AVC42083.1|2407180_2407747_+	adenylyltransferase	NA	E4ZFP8	Streptococcus_phage	99.5	3.9e-108
AMG42842.1|2407791_2408322_+	streptothricin N-acetyltransferase Sat4	NA	A0A1B0RXL7	Streptococcus_phage	97.8	1.3e-89
AMG42843.1|2408414_2409209_+	aminoglycoside O-phosphotransferase APH(3')-IIIa	NA	E4ZFP6	Streptococcus_phage	100.0	2.3e-154
AMG42844.1|2409513_2410188_-|transposase	IS6-like element IS257 family transposase	transposase	A0A0N9RU54	Staphylococcus_phage	99.6	6.8e-128
>prophage 10
CP014064	Staphylococcus aureus strain FDAARGOS_159 chromosome, complete genome	2801196	2704703	2712524	2801196		Hokovirus(16.67%)	10	NA	NA
AMG43106.1|2704703_2705759_-	two-component sensor histidine kinase	NA	A0A1V0SGX0	Hokovirus	29.8	3.6e-14
AMG43107.1|2705758_2706445_-	DNA-binding response regulator	NA	NA	NA	NA	NA
AMG43108.1|2706419_2706893_-	DoxX family protein	NA	NA	NA	NA	NA
AMG43109.1|2707235_2707676_-	hypothetical protein	NA	NA	NA	NA	NA
AMG43110.1|2707955_2708540_-	hypothetical protein	NA	NA	NA	NA	NA
AMG43111.1|2708638_2709352_-	7-carboxy-7-deazaguanine synthase QueE	NA	A0A1U9WRB6	Streptococcus_virus	43.5	6.5e-52
AMG43112.1|2709355_2709775_-	6-carboxytetrahydropterin synthase QueD	NA	S4U060	uncultured_phage	28.7	6.3e-07
AMG43113.1|2709776_2710445_-	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	57.5	9.6e-66
AMG43114.1|2710795_2711389_+	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	42.9	4.4e-38
AMG43115.1|2711372_2712524_+	anthranilate synthase component I family protein	NA	S4VNU7	Pandoravirus	35.7	6.0e-23
>prophage 11
CP014064	Staphylococcus aureus strain FDAARGOS_159 chromosome, complete genome	2801196	2728556	2739192	2801196		uncultured_Caudovirales_phage(62.5%)	12	NA	NA
AMG43130.1|2728556_2730062_-	peptide MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	32.2	2.0e-58
AVC42093.1|2730127_2730373_-	hypothetical protein	NA	NA	NA	NA	NA
AMG43131.1|2730402_2730903_-	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	E7DN65	Pneumococcus_phage	71.5	5.9e-52
AMG43132.1|2730922_2731789_-	EamA/RhaT family transporter	NA	NA	NA	NA	NA
AVC42094.1|2732173_2732440_+	ribonucleoside-diphosphate reductase	NA	NA	NA	NA	NA
AMG43133.1|2732589_2732988_+	protein NrdI	NA	A0A2H4J545	uncultured_Caudovirales_phage	72.0	1.2e-52
AMG43134.1|2732950_2735056_+	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	A0A2H4J2N6	uncultured_Caudovirales_phage	91.7	0.0e+00
AMG43135.1|2735173_2736145_+	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	A0A2H4J4P3	uncultured_Caudovirales_phage	91.3	4.2e-171
AMG43136.1|2736325_2736481_+	hypothetical protein	NA	NA	NA	NA	NA
AMG43245.1|2736519_2737491_+	iron ABC transporter permease	NA	A0A2H4IY97	uncultured_Caudovirales_phage	78.9	4.3e-139
AMG43137.1|2737477_2738434_+	iron ABC transporter permease	NA	A0A2H4J116	uncultured_Caudovirales_phage	57.8	1.2e-05
AMG43138.1|2738430_2739192_+	iron ABC transporter ATP-binding protein	NA	Q9EMR9	Amsacta_moorei_entomopoxvirus	31.6	6.5e-18
>prophage 12
CP014064	Staphylococcus aureus strain FDAARGOS_159 chromosome, complete genome	2801196	2790149	2800969	2801196	integrase	Staphylococcus_phage(80.0%)	14	2781218:2781233	2800295:2800310
2781218:2781233	attL	GGTATTAAGAATAAAT	NA	NA	NA	NA
AMG43185.1|2790149_2792507_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	38.5	2.8e-91
AMG43186.1|2792528_2792993_+	SsrA-binding protein	NA	W5RAM5	Staphylococcus_phage	98.1	3.6e-80
AMG43187.1|2793555_2794662_-|integrase	site-specific integrase	integrase	H0UST3	Bacillus_phage	44.2	3.1e-77
AMG43188.2|2794667_2795315_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AMG43189.1|2795472_2795679_+	hypothetical protein	NA	NA	NA	NA	NA
AMG43190.1|2795714_2795942_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AVC42095.1|2795938_2796112_+	pathogenicity island protein	NA	NA	NA	NA	NA
AMG43191.1|2796078_2796282_+	pathogenicity island protein	NA	A0A1W6JQF4	Staphylococcus_phage	98.5	2.0e-30
AMG43192.1|2796283_2796667_+	pathogenicity island protein	NA	A0A1W6JQI7	Staphylococcus_phage	96.9	2.6e-63
AMG43193.1|2796667_2796985_+	DUF1474 domain-containing protein	NA	A0A1W6JQH0	Staphylococcus_phage	52.3	1.2e-18
AMG43194.1|2797048_2797918_+	mobile element-associated protein	NA	Q4ZE74	Staphylococcus_phage	92.0	8.2e-158
AMG43195.1|2797931_2799641_+	DUF927 domain-containing protein	NA	Q4ZE73	Staphylococcus_phage	92.4	3.2e-299
AMG43196.1|2799950_2800331_+	hypothetical protein	NA	Q4ZE71	Staphylococcus_phage	97.6	1.7e-67
2800295:2800310	attR	GGTATTAAGAATAAAT	NA	NA	NA	NA
AMG43197.1|2800327_2800969_+	pathogenicity island protein	NA	Q4ZE67	Staphylococcus_phage	93.0	7.2e-111
>prophage 1
CP014063	Staphylococcus aureus strain FDAARGOS_159 plasmid unnamed, complete sequence	37980	0	15431	37980		Salmonella_phage(25.0%)	13	NA	NA
AMG40527.1|1250_2021_+	DUF536 domain-containing protein	NA	NA	NA	NA	NA
AMG40488.1|2219_2738_-	type 1 glutamine amidotransferase	NA	NA	NA	NA	NA
AMG40489.1|2826_3462_-	3-hexulose-6-phosphate synthase	NA	NA	NA	NA	NA
AMG40490.1|3564_3915_+	transcriptional regulator	NA	NA	NA	NA	NA
AMG40491.1|4510_5482_-	NADPH:quinone reductase	NA	NA	NA	NA	NA
AMG40492.1|5605_6025_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
AMG40493.1|6525_7371_-	penicillin-hydrolyzing class A beta-lactamase BlaZ	NA	A0A1B0VBP7	Salmonella_phage	34.1	9.8e-31
AMG40494.1|7477_9235_+	beta-lactam sensor/signal transducer BlaR1	NA	NA	NA	NA	NA
AMG40495.1|9224_9605_+	penicillinase repressor BlaI	NA	NA	NA	NA	NA
AMG40496.1|9868_10447_+	HTH domain-containing protein	NA	A0A0A7NPV4	Enterobacteria_phage	51.7	2.4e-41
AMG40497.1|10573_11185_+	transposon DNA-invertase	NA	I1ZBD6	Salisaeta_icosahedral_phage	29.5	6.4e-16
AMG40498.1|11455_13678_-	helicase	NA	NA	NA	NA	NA
AMG40499.2|13670_15431_-	site-specific DNA-methyltransferase	NA	A0A2K5B255	Erysipelothrix_phage	29.2	2.4e-31
>prophage 2
CP014063	Staphylococcus aureus strain FDAARGOS_159 plasmid unnamed, complete sequence	37980	19910	22724	37980	bacteriocin,integrase,transposase	Streptococcus_phage(50.0%)	6	11349:11370	30188:30209
11349:11370	attL	GGTTCTGTTGCAAAGTTAGAAA	NA	NA	NA	NA
AMG40504.1|19910_20258_+	transcriptional regulator	NA	E4ZFI8	Streptococcus_phage	36.8	4.9e-13
AMG40505.1|20448_20568_+	replication protein	NA	NA	NA	NA	NA
AMG40506.1|20607_21237_+|transposase	IS6 family transposase	transposase	A0A0N9RU54	Staphylococcus_phage	88.5	1.5e-105
AVC42024.1|21343_21754_+|integrase	site-specific integrase	integrase	A3F636	Streptococcus_phage	51.4	2.9e-28
AMG40528.1|21943_22246_+|bacteriocin	bacteriocin transporter	bacteriocin	NA	NA	NA	NA
AMG40507.1|22523_22724_+	transcriptional regulator	NA	A0A142LP09	Marinitoga_camini_virus	43.5	6.7e-07
30188:30209	attR	TTTCTAACTTTGCAACAGAACC	NA	NA	NA	NA
>prophage 3
CP014063	Staphylococcus aureus strain FDAARGOS_159 plasmid unnamed, complete sequence	37980	26278	34940	37980	transposase	Staphylococcus_phage(80.0%)	8	NA	NA
AMG40513.1|26278_28438_+	peptidase domain-containing ABC transporter	NA	W8CYL7	Bacillus_phage	25.7	9.8e-43
AMG40514.1|28439_29435_+	HlyD family secretion protein	NA	NA	NA	NA	NA
AMG40515.1|29476_30151_-|transposase	IS6 family transposase ISSau6	transposase	A0A0N9RU54	Staphylococcus_phage	88.4	1.3e-113
AMG40516.2|30410_30794_-	hypothetical protein	NA	NA	NA	NA	NA
AMG40517.1|30909_31653_+	epidermal cell differentiation inhibitor	NA	NA	NA	NA	NA
AMG40518.1|31994_32669_-|transposase	IS6 family transposase	transposase	A0A0N9RU54	Staphylococcus_phage	87.5	1.5e-114
AMG40519.1|32776_33529_-	exotoxin	NA	A0A075M4C7	Staphylococcus_phage	58.3	1.3e-74
AMG40520.1|34265_34940_+|transposase	IS6 family transposase	transposase	A0A0N9RU54	Staphylococcus_phage	87.5	1.5e-114
