The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP014065	Achromobacter xylosoxidans strain FDAARGOS_162 chromosome, complete genome	6547320	1946934	1964726	6547320	tail	Burkholderia_virus(25.0%)	17	NA	NA
AMG44651.1|1946934_1948404_+	DUF1254 domain-containing protein	NA	M1IA53	Paramecium_bursaria_Chlorella_virus	33.5	2.8e-57
AMG44652.1|1948498_1949197_-	phage repressor protein	NA	NA	NA	NA	NA
AMG47957.2|1949470_1950064_+	hypothetical protein	NA	NA	NA	NA	NA
AMG44653.1|1950315_1950783_+	hypothetical protein	NA	NA	NA	NA	NA
AMG44654.1|1950788_1951262_+|tail	phage tail protein	tail	A4JX08	Burkholderia_virus	44.4	2.4e-26
AMG44655.1|1951261_1951552_+	DUF4035 domain-containing protein	NA	S4TND7	Salmonella_phage	48.8	9.1e-13
AVC42596.1|1951609_1952911_+|tail	phage tail tape measure protein	tail	A0A1W6JP49	Morganella_phage	29.7	2.2e-13
AMG44656.2|1952907_1953252_+|tail	phage tail protein	tail	K7P7R1	Enterobacteria_phage	49.1	4.1e-28
AMG44657.1|1953256_1955899_+	hypothetical protein	NA	A0A0B5A596	Achromobacter_phage	26.7	6.4e-36
AMG44658.1|1955901_1956630_+|tail	phage minor tail protein L	tail	A0A2R3UA90	Siphoviridae_environmental_samples	51.0	3.0e-68
AMG44659.1|1956632_1957412_+	hydrolase Nlp/P60	NA	A4JX14	Burkholderia_virus	50.2	1.9e-65
AMG44660.1|1957408_1958014_+|tail	tail assembly protein	tail	C7BGD3	Burkholderia_phage	55.7	9.4e-52
AMG44661.1|1958010_1961634_+	host specificity protein J	NA	A0A2R3UA88	Siphoviridae_environmental_samples	45.3	1.3e-268
AMG44662.1|1961984_1962200_+	hypothetical protein	NA	NA	NA	NA	NA
AMG44663.1|1962196_1962793_+|tail	tail assembly protein	tail	Q6JIL3	Burkholderia_virus	53.3	8.6e-50
AMG44664.1|1962922_1963852_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AMG44665.1|1963907_1964726_-	SDR family NAD(P)-dependent oxidoreductase	NA	W8CYX9	Bacillus_phage	49.3	4.1e-10
>prophage 2
CP014065	Achromobacter xylosoxidans strain FDAARGOS_162 chromosome, complete genome	6547320	1998723	2009668	6547320		Pseudomonas_phage(22.22%)	16	NA	NA
AMG44685.1|1998723_1999425_-	hypothetical protein	NA	B4UTY5	Rhizobium_phage	38.8	1.1e-32
AMG44686.1|1999414_2000344_-	hypothetical protein	NA	NA	NA	NA	NA
AMG44687.1|2000340_2000862_-	hypothetical protein	NA	NA	NA	NA	NA
AMG44688.1|2000864_2001317_-	hypothetical protein	NA	NA	NA	NA	NA
AMG44689.1|2001524_2002121_-	hypothetical protein	NA	A0A0F6SIL9	Sinorhizobium_phage	58.6	1.1e-63
AMG44690.1|2002147_2002660_-	single-stranded DNA-binding protein	NA	I6NRL7	Burkholderia_virus	58.7	7.0e-40
AMG44691.1|2002659_2003331_-	hypothetical protein	NA	A0A0M3LP90	Mannheimia_phage	37.3	9.1e-32
AMG44692.1|2003323_2004157_-	hypothetical protein	NA	E5DV80	Deep-sea_thermophilic_phage	30.5	6.3e-14
AVC42602.1|2004167_2004659_-	Fis family transcriptional regulator	NA	A5H1K2	Xanthomonas_virus	45.2	1.5e-28
AMG44693.1|2004666_2005767_-	hypothetical protein	NA	Q9MC69	Pseudomonas_phage	48.2	9.1e-37
AMG44694.1|2005771_2005951_-	hypothetical protein	NA	NA	NA	NA	NA
AMG44695.1|2006018_2006381_-	hypothetical protein	NA	NA	NA	NA	NA
AMG44696.1|2006383_2006683_-	hypothetical protein	NA	NA	NA	NA	NA
AMG44697.1|2006724_2007753_-	hypothetical protein	NA	A0A221SAP8	Ralstonia_phage	54.8	1.5e-17
AMG44698.2|2007946_2008708_+	hypothetical protein	NA	NA	NA	NA	NA
AMG44699.2|2008720_2009668_-	phage repressor protein	NA	A0A1C6ZDG7	Pseudomonas_phage	27.3	2.4e-09
>prophage 3
CP014065	Achromobacter xylosoxidans strain FDAARGOS_162 chromosome, complete genome	6547320	2016586	2067230	6547320	tail,integrase,protease,transposase,head	Burkholderia_phage(32.26%)	49	2019159:2019174	2066019:2066034
AMG44709.1|2016586_2017102_+	Rha family transcriptional regulator	NA	A0A0P0ZFJ1	Escherichia_phage	40.7	5.4e-16
AMG44710.1|2017549_2018203_+	hypothetical protein	NA	G8C7P2	Escherichia_phage	40.9	1.4e-29
AMG44711.1|2018202_2019798_+	TerL protein	NA	A9YWZ6	Burkholderia_phage	76.6	3.7e-249
2019159:2019174	attL	CGGCCTGGACGTGGCC	NA	NA	NA	NA
AMG47962.2|2019806_2021258_+	hypothetical protein	NA	A0A0P0I486	Acinetobacter_phage	58.5	1.1e-146
AMG47961.2|2021148_2021988_+|head	phage head morphogenesis protein	head	A9YWZ8	Burkholderia_phage	54.6	4.4e-68
AMG44712.1|2022008_2023301_+	hypothetical protein	NA	A0A0P0IRE1	Acinetobacter_phage	45.9	1.5e-78
AMG44713.2|2023310_2023799_+	hypothetical protein	NA	A0A0P0I8F3	Acinetobacter_phage	51.9	2.4e-34
AMG44714.1|2023859_2024882_+	hypothetical protein	NA	A0A0N7IRF2	Acinetobacter_phage	68.5	2.5e-129
AMG44715.1|2024892_2025291_+	hypothetical protein	NA	NA	NA	NA	NA
AMG44716.1|2025300_2025684_+	DUF4054 domain-containing protein	NA	A9YX25	Burkholderia_phage	59.8	2.7e-36
AMG44717.1|2026169_2026550_+|head,tail	head-tail adaptor	head,tail	A0A2H4J1A4	uncultured_Caudovirales_phage	56.9	4.8e-30
AMG44718.1|2026542_2027130_+	hypothetical protein	NA	A9YX29	Burkholderia_phage	56.0	2.0e-51
AMG44719.1|2027194_2028676_+	hypothetical protein	NA	A0A0P0I492	Acinetobacter_phage	51.4	5.9e-132
AMG44720.1|2028691_2029135_+	DUF3277 domain-containing protein	NA	A0A0P0IKY2	Acinetobacter_phage	60.3	7.9e-40
AMG44721.1|2029134_2029533_+	hypothetical protein	NA	A0A0N7IRF3	Acinetobacter_phage	32.9	3.8e-09
AMG44722.1|2029728_2031546_+	hypothetical protein	NA	A0A0M4REK7	Salmonella_phage	33.1	1.1e-84
AMG44723.1|2031542_2032115_+	hypothetical protein	NA	A0A2H4J1B3	uncultured_Caudovirales_phage	40.5	1.6e-29
AMG44724.1|2032111_2032417_+	hypothetical protein	NA	A0A0M4R5B7	Salmonella_phage	43.6	3.4e-18
AVC42604.1|2032420_2033344_+	hypothetical protein	NA	A9YX04	Burkholderia_phage	50.9	7.5e-69
AVC42605.1|2033336_2034083_+	translation initiation factor IF-2	NA	A9YX06	Burkholderia_phage	59.3	4.2e-78
AMG44727.1|2034091_2034445_+	hypothetical protein	NA	A9YX11	Burkholderia_phage	61.5	4.8e-32
AMG44728.1|2034441_2035623_+	hypothetical protein	NA	A9YX12	Burkholderia_phage	65.1	2.0e-130
AMG44729.1|2035624_2036293_+	DUF2612 domain-containing protein	NA	A9YX13	Burkholderia_phage	65.4	2.4e-77
AMG44730.1|2036302_2036974_+	hypothetical protein	NA	NA	NA	NA	NA
AVC42606.1|2036949_2037402_+	hypothetical protein	NA	U5P083	Shigella_phage	36.7	1.9e-17
AMG44731.2|2037391_2038705_-	hypothetical protein	NA	A0A2H4IZR3	uncultured_Caudovirales_phage	26.5	2.3e-18
AMG44732.1|2038617_2038926_+	hypothetical protein	NA	NA	NA	NA	NA
AMG44733.1|2038927_2039206_+	hypothetical protein	NA	NA	NA	NA	NA
AMG44734.1|2039202_2039694_+	hypothetical protein	NA	I6NSS1	Burkholderia_phage	61.1	5.3e-45
AMG44735.2|2039708_2040086_+	hypothetical protein	NA	NA	NA	NA	NA
AMG44736.1|2040182_2040401_-	hypothetical protein	NA	NA	NA	NA	NA
AMG44737.1|2040403_2041387_-|integrase	site-specific integrase	integrase	A0A1B1P9F9	Acinetobacter_phage	41.3	5.4e-65
AMG44738.1|2042148_2043123_+	hypothetical protein	NA	NA	NA	NA	NA
AMG47963.1|2046681_2047623_-	WYL domain-containing protein	NA	NA	NA	NA	NA
AVC42607.1|2047717_2047906_+	hypothetical protein	NA	NA	NA	NA	NA
AVC42608.1|2048108_2049086_+	patatin	NA	A0A1B2LRS3	Wolbachia_phage	27.4	5.8e-19
AVC42609.1|2049078_2050218_+	hypothetical protein	NA	NA	NA	NA	NA
AVC42610.1|2050217_2050826_+	hypothetical protein	NA	NA	NA	NA	NA
AMG44742.2|2050867_2052008_+|transposase	IS3-like element ISStma9 family transposase	transposase	U5P429	Shigella_phage	60.6	7.4e-90
AVC42611.1|2052111_2053095_+	thiamine biosynthesis protein ThiF	NA	NA	NA	NA	NA
AVC42612.1|2053082_2053565_+	hypothetical protein	NA	NA	NA	NA	NA
AMG44745.1|2055182_2055464_+	hypothetical protein	NA	NA	NA	NA	NA
AMG44746.1|2056237_2057389_-	PDZ domain-containing protein	NA	A0A1B1IT49	uncultured_Mediterranean_phage	30.8	5.2e-27
AMG44747.2|2057407_2058400_-|protease	Zn-dependent protease	protease	NA	NA	NA	NA
AMG44748.1|2058359_2058848_-	hypothetical protein	NA	NA	NA	NA	NA
AVC42613.1|2058870_2060559_-	sodium:proton exchanger	NA	NA	NA	NA	NA
AMG44749.1|2060562_2061009_-	thioredoxin TrxC	NA	A0A1J0GW78	Streptomyces_phage	37.9	7.0e-12
AMG44750.1|2062912_2064343_-	cardiolipin synthase	NA	NA	NA	NA	NA
AVC42614.1|2064359_2067230_-|protease	ATP-dependent Clp protease ATP-binding subunit	protease	K4FB40	Cronobacter_phage	40.9	5.3e-129
2066019:2066034	attR	GGCCACGTCCAGGCCG	NA	NA	NA	NA
>prophage 4
CP014065	Achromobacter xylosoxidans strain FDAARGOS_162 chromosome, complete genome	6547320	2885128	2939281	6547320	integrase,plate,tail,portal,protease,tRNA,transposase,holin,head,terminase,capsid	uncultured_Caudovirales_phage(21.43%)	55	2889997:2890016	2920831:2920850
AMG45310.1|2885128_2885617_+|tRNA	Cys-tRNA(Pro) deacylase	tRNA	NA	NA	NA	NA
AMG45311.1|2885826_2886405_+|protease	protease	protease	NA	NA	NA	NA
AMG45312.1|2886566_2887595_-	alcohol dehydrogenase AdhP	NA	A0A2K9L339	Tupanvirus	27.3	1.0e-34
AMG45313.1|2887839_2888229_+	aryl-sulfate sulfotransferase	NA	NA	NA	NA	NA
AVC42714.1|2888353_2889151_-	D-alanyl-D-alanine endopeptidase	NA	NA	NA	NA	NA
2889997:2890016	attL	TTAACTACGGCGAGACGGGC	NA	NA	NA	NA
AMG45315.1|2890180_2891209_+|integrase	site-specific integrase	integrase	A0A2D1GMX8	Marinobacter_phage	39.1	4.3e-57
AMG45316.2|2891205_2891424_-	hypothetical protein	NA	NA	NA	NA	NA
AMG45317.2|2891482_2893249_-	DNA cytosine methyltransferase	NA	L7TH64	Pseudomonas_virus	54.0	1.4e-175
AVC43230.1|2893577_2896253_-	bifunctional DNA primase/helicase	NA	A0A077K8T2	Ralstonia_phage	53.4	3.8e-270
AMG45318.1|2896282_2896516_-	hypothetical protein	NA	NA	NA	NA	NA
AMG45319.1|2896602_2896965_-	hypothetical protein	NA	NA	NA	NA	NA
AVC42715.1|2896981_2897263_-	transcriptional regulator	NA	NA	NA	NA	NA
AMG45321.1|2898121_2898301_+	hypothetical protein	NA	NA	NA	NA	NA
AMG45322.1|2898431_2898722_+	hypothetical protein	NA	NA	NA	NA	NA
AMG45323.1|2898733_2899819_-	late control protein	NA	A0A2H4JAV0	uncultured_Caudovirales_phage	49.8	6.8e-85
AVC42716.1|2899818_2900274_-	oxidoreductase	NA	A0A2H4JG54	uncultured_Caudovirales_phage	52.8	2.1e-32
AMG45324.1|2900286_2903025_-|tail	phage tail tape measure protein	tail	A0A2H4JE61	uncultured_Caudovirales_phage	42.2	1.7e-169
AVC42717.1|2903028_2903145_-|tail	GpE family phage tail protein	tail	E5FFG6	Burkholderia_phage	75.8	3.0e-07
AMG48026.2|2903153_2903513_-|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	42.9	1.6e-14
AMG45325.1|2903534_2904050_-|tail	phage major tail tube protein	tail	V9IQX1	Stenotrophomonas_phage	54.1	3.8e-46
AMG45326.1|2904107_2905289_-|tail	phage tail protein	tail	A0A077K9Y4	Ralstonia_phage	65.2	1.4e-147
AMG45327.1|2905409_2905889_-	hypothetical protein	NA	NA	NA	NA	NA
AMG45328.1|2905908_2907255_-	hypothetical protein	NA	A0A1S6KZZ8	Salmonella_phage	62.0	5.7e-49
AMG45329.2|2907251_2907890_-|tail	phage tail protein I	tail	A0A077KER5	Ralstonia_phage	56.4	1.3e-51
AMG45330.1|2907873_2908791_-|plate	baseplate assembly protein	plate	A0A077K9X9	Ralstonia_phage	55.6	9.8e-77
AMG48027.1|2908792_2909134_-|plate	baseplate assembly protein	plate	E5E3V5	Burkholderia_phage	53.2	1.4e-17
AMG45331.1|2909145_2909781_-|plate	phage baseplate assembly protein V	plate	A0A077K9S0	Ralstonia_phage	51.2	6.0e-49
AMG45332.1|2909842_2910304_-	phage virion morphogenesis protein	NA	Q6K1H7	Salmonella_virus	50.0	4.2e-28
AMG45333.1|2910296_2910800_-|tail	phage tail protein	tail	E5E3R4	Burkholderia_phage	50.0	8.1e-25
AMG45334.1|2910898_2911321_-	hypothetical protein	NA	Q9ZXL5	Pseudomonas_virus	31.5	3.6e-10
AMG45335.1|2911317_2912127_-	peptidoglycan-binding protein	NA	A0A2H4JGJ9	uncultured_Caudovirales_phage	57.0	1.9e-76
AMG45336.1|2912119_2912419_-|holin	phage holin family protein	holin	NA	NA	NA	NA
AMG45337.1|2912415_2912778_-	hypothetical protein	NA	NA	NA	NA	NA
AMG45338.2|2912783_2912993_-|tail	phage tail protein	tail	A0A2H4J946	uncultured_Caudovirales_phage	58.0	3.7e-16
AMG45339.1|2912989_2913460_-|head	head completion/stabilization protein	head	A4PE32	Ralstonia_virus	53.5	1.6e-35
AMG45340.1|2913552_2914248_-	hypothetical protein	NA	A0A2H4J948	uncultured_Caudovirales_phage	40.9	7.5e-37
AMG45341.1|2914250_2915258_-|capsid	phage major capsid protein, P2 family	capsid	Q9ZXM3	Pseudomonas_virus	61.2	1.2e-115
AMG45342.2|2915302_2916166_-|capsid	phage capsid protein	capsid	E5FFI7	Burkholderia_phage	46.2	9.3e-53
AMG45343.1|2916306_2918061_+|terminase	terminase	terminase	A4JWQ1	Burkholderia_virus	67.5	1.5e-230
AMG45344.1|2918057_2919083_+|portal	phage portal protein	portal	A4JWV0	Burkholderia_virus	62.4	1.4e-127
AMG45345.1|2919165_2919420_-	hypothetical protein	NA	NA	NA	NA	NA
AMG45346.1|2921064_2921829_+	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
2920831:2920850	attR	TTAACTACGGCGAGACGGGC	NA	NA	NA	NA
AMG45347.1|2921825_2923448_+	fatty-acid--CoA ligase	NA	NA	NA	NA	NA
AMG45348.1|2923444_2924395_+	hydroxymethylglutaryl-CoA lyase	NA	NA	NA	NA	NA
AMG48028.1|2924483_2925017_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
AMG45349.1|2925107_2925842_+	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
AMG45350.1|2925838_2927035_+	CoA transferase	NA	NA	NA	NA	NA
AMG45351.1|2927106_2928078_+	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
AMG45352.1|2928231_2928486_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
AMG45353.1|2928485_2928911_+	PIN domain-containing protein	NA	NA	NA	NA	NA
AMG45354.1|2928992_2929946_-	2-nitropropane dioxygenase	NA	NA	NA	NA	NA
AMG45355.1|2930158_2931358_+	MFS transporter	NA	NA	NA	NA	NA
AMG48029.1|2931620_2934284_+	hypothetical protein	NA	NA	NA	NA	NA
AVC42718.1|2934287_2937845_+	nuclease	NA	NA	NA	NA	NA
AMG45356.1|2938150_2939281_+|transposase	IS481 family transposase	transposase	S5WIU1	Leptospira_phage	32.2	3.8e-14
>prophage 5
CP014065	Achromobacter xylosoxidans strain FDAARGOS_162 chromosome, complete genome	6547320	3146439	3175048	6547320	tail,head	Pseudomonas_phage(45.83%)	36	NA	NA
AMG45508.1|3146439_3147294_+	DNA methyltransferase	NA	Q5QF26	Pseudomonas_virus	52.3	3.1e-77
AMG45509.1|3147290_3148454_+	DUF1376 domain-containing protein	NA	H2BD69	Pseudomonas_phage	49.2	3.2e-40
AVC42746.1|3148450_3148675_+	hypothetical protein	NA	NA	NA	NA	NA
AMG45510.1|3148671_3149169_+	RusA family crossover junction endodeoxyribonuclease	NA	J7I4J7	Pseudomonas_phage	51.3	1.4e-29
AMG45511.1|3149158_3149788_+	hypothetical protein	NA	NA	NA	NA	NA
AMG45512.1|3150648_3151440_+	restriction endonuclease subunit M	NA	Q5ZQW7	Pseudomonas_phage	78.2	4.4e-126
AMG45513.1|3151449_3152058_+	hypothetical protein	NA	A0A125RNL5	Pseudomonas_phage	61.1	1.2e-67
AVC43234.1|3152054_3152495_-	hypothetical protein	NA	M1PSB6	Streptococcus_phage	47.8	9.6e-30
AMG45515.1|3152777_3153251_+	hypothetical protein	NA	A0A125RNL6	Pseudomonas_phage	59.6	5.1e-37
AMG45516.2|3153282_3154785_+	hypothetical protein	NA	A0A291LBL3	Klebsiella_phage	47.5	2.0e-111
AMG48036.1|3156103_3156847_+|head	phage head morphogenesis protein	head	I3PGT9	Xanthomonas_phage	39.4	7.5e-35
AMG45517.1|3156857_3157940_+	hypothetical protein	NA	E5AGA6	Erwinia_phage	40.1	8.0e-54
AMG45518.1|3157939_3158395_+	hypothetical protein	NA	NA	NA	NA	NA
AMG45519.1|3158458_3159418_+	DNA-binding protein	NA	A0A0N9SG07	Pseudomonas_phage	37.7	5.3e-57
AMG45520.1|3159417_3159780_+	hypothetical protein	NA	NA	NA	NA	NA
AMG45521.1|3159782_3160157_+	DUF4054 domain-containing protein	NA	NA	NA	NA	NA
AMG45522.1|3160146_3160599_+	hypothetical protein	NA	A0A2I7R2V2	Vibrio_phage	33.1	1.4e-07
AMG45523.1|3160602_3160971_+	hypothetical protein	NA	NA	NA	NA	NA
AMG48037.1|3161143_3161668_+	hypothetical protein	NA	NA	NA	NA	NA
AMG45524.1|3161813_3162311_+	DNA-binding protein	NA	A0A1W6JP13	Morganella_phage	41.1	5.7e-23
AMG45525.1|3162378_3163737_+	hypothetical protein	NA	A0A0N9SJA3	Pseudomonas_phage	40.0	5.7e-81
AMG45526.1|3163747_3164176_+	DUF3277 domain-containing protein	NA	NA	NA	NA	NA
AMG45527.1|3164175_3164661_+	hypothetical protein	NA	NA	NA	NA	NA
AVC42747.1|3164803_3167107_+|tail	tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	29.3	1.4e-23
AVC42748.1|3167118_3167724_+	hypothetical protein	NA	I3PGV3	Xanthomonas_phage	26.4	2.0e-06
AMG45528.1|3167720_3168053_+	hypothetical protein	NA	A0A0N9SG14	Pseudomonas_phage	38.7	2.7e-13
AMG45529.1|3168039_3168957_+	hypothetical protein	NA	E5AGC0	Erwinia_phage	32.9	9.6e-40
AMG45530.1|3168953_3169655_+	hypothetical protein	NA	A0A2H4J8H6	uncultured_Caudovirales_phage	28.8	3.1e-14
AMG45531.1|3169654_3170023_+	hypothetical protein	NA	A0A2K9V3L8	Faecalibacterium_phage	38.0	4.9e-11
AMG45532.1|3170048_3171500_+	hypothetical protein	NA	A0A0N9SH53	Pseudomonas_phage	37.7	1.0e-75
AMG45533.1|3171499_3172165_+	DUF2612 domain-containing protein	NA	A0A0N9SSD8	Pseudomonas_phage	36.2	7.2e-29
AMG45534.1|3172165_3173452_+	hypothetical protein	NA	NA	NA	NA	NA
AMG45535.1|3173464_3173887_+|tail	phage tail protein	tail	U5P083	Shigella_phage	43.6	1.4e-25
AMG45536.1|3173932_3174241_+	hypothetical protein	NA	NA	NA	NA	NA
AMG45537.1|3174242_3174521_+	hypothetical protein	NA	NA	NA	NA	NA
AMG45538.1|3174517_3175048_+	hypothetical protein	NA	C8ZKR3	Pseudomonas_phage	48.1	1.0e-30
>prophage 6
CP014065	Achromobacter xylosoxidans strain FDAARGOS_162 chromosome, complete genome	6547320	4720090	4727958	6547320	tRNA	Moraxella_phage(33.33%)	9	NA	NA
AMG46577.1|4720090_4720678_+	DUF1949 domain-containing protein	NA	A0A1X9I5T8	Streptococcus_phage	39.6	1.2e-19
AMG46578.1|4720710_4721085_-	thioredoxin	NA	V9SJ74	Achromobacter_phage	26.8	7.1e-10
AMG46579.1|4721276_4722299_-	LLM class flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
AMG46580.1|4722624_4722981_+	glyoxalase/bleomycin resistance/extradiol dioxygenase family protein	NA	NA	NA	NA	NA
AMG46581.1|4723065_4724358_-	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	36.3	7.1e-65
AMG46582.1|4724466_4725498_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	51.4	7.1e-92
AMG46583.1|4725570_4726212_-	glycerol-3-phosphate 1-O-acyltransferase PlsY	NA	NA	NA	NA	NA
AMG46584.1|4726390_4727149_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	52.0	1.2e-67
AMG46585.2|4727268_4727958_+	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	45.8	3.2e-32
>prophage 7
CP014065	Achromobacter xylosoxidans strain FDAARGOS_162 chromosome, complete genome	6547320	5936502	5981019	6547320	integrase,tail,tRNA,holin,head	Pseudomonas_phage(39.39%)	58	5955217:5955232	5985820:5985835
AMG47405.1|5936502_5936994_-	hypothetical protein	NA	I6NSS1	Burkholderia_phage	58.6	2.2e-43
AMG47406.1|5936993_5937293_-|holin	phage holin family protein	holin	E5E3W3	Burkholderia_phage	40.7	6.3e-09
AMG47407.1|5937294_5937639_-	hypothetical protein	NA	A4JWU2	Burkholderia_virus	57.9	1.5e-22
AVC43128.1|5937727_5938750_+|integrase	integrase	integrase	A0A2H4JE37	uncultured_Caudovirales_phage	32.3	8.2e-24
AMG47408.1|5938752_5939109_-|tail	phage tail protein	tail	NA	NA	NA	NA
AMG47409.1|5940357_5941692_-	hypothetical protein	NA	A0A0A8J8U5	Ralstonia_phage	35.3	3.8e-29
AMG47410.1|5941691_5942357_-	DUF2612 domain-containing protein	NA	A0A0N9SSD8	Pseudomonas_phage	36.8	1.7e-30
AMG47411.1|5942356_5943808_-	hypothetical protein	NA	A0A0N9SH53	Pseudomonas_phage	37.1	5.3e-77
AMG47412.1|5943832_5944201_-	hypothetical protein	NA	A0A0N7GFC5	Pseudomonas_phage	45.5	2.7e-17
AMG47413.1|5944200_5944899_-	hypothetical protein	NA	A0A2H4J8H6	uncultured_Caudovirales_phage	31.1	1.3e-12
AMG47414.1|5944895_5945813_-	hypothetical protein	NA	E5AGC0	Erwinia_phage	30.9	1.3e-36
AMG47415.1|5945799_5946132_-	hypothetical protein	NA	NA	NA	NA	NA
AVC43129.1|5946128_5946749_-	hypothetical protein	NA	I3PGV3	Xanthomonas_phage	29.4	3.2e-07
AVC43130.1|5946757_5949229_-|tail	tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	29.1	1.5e-23
AMG47416.1|5949374_5949854_-	hypothetical protein	NA	NA	NA	NA	NA
AMG47417.1|5949853_5950282_-	DUF3277 domain-containing protein	NA	A0A2H4P8K8	Pseudomonas_phage	31.0	2.1e-13
AMG47418.1|5950297_5951656_-	DUF3383 domain-containing protein	NA	A0A0N9SJA3	Pseudomonas_phage	39.7	5.7e-81
AMG47419.1|5951722_5952247_-	hypothetical protein	NA	NA	NA	NA	NA
AMG47420.1|5952372_5952786_-	hypothetical protein	NA	NA	NA	NA	NA
AMG47421.1|5952790_5953243_-	hypothetical protein	NA	E5AGB1	Erwinia_phage	35.4	1.6e-08
AMG47422.1|5953220_5953607_-	DUF4054 domain-containing protein	NA	NA	NA	NA	NA
AMG47423.1|5953609_5953993_-	hypothetical protein	NA	NA	NA	NA	NA
AMG47424.1|5953992_5954952_-	DUF2184 domain-containing protein	NA	A0A0N9SG07	Pseudomonas_phage	38.8	3.7e-58
AMG47425.1|5955013_5955469_-	hypothetical protein	NA	NA	NA	NA	NA
5955217:5955232	attL	GGCGCACGCGCAGCAC	NA	NA	NA	NA
AMG47426.1|5955468_5956551_-	DUF2213 domain-containing protein	NA	E5AGA6	Erwinia_phage	39.2	1.2e-54
AMG47427.1|5956560_5957400_-|head	phage head morphogenesis protein	head	I3PGT9	Xanthomonas_phage	36.5	4.5e-36
AMG47428.1|5957341_5958622_-	DUF1073 domain-containing protein	NA	A0A2H4PGN2	Escherichia_phage	30.4	5.4e-33
AVC43131.1|5958621_5960124_-	hypothetical protein	NA	A0A291LBL3	Klebsiella_phage	47.7	1.7e-110
AMG47429.1|5960155_5960629_-	DUF2280 domain-containing protein	NA	A0A125RNL6	Pseudomonas_phage	55.9	3.1e-34
AMG47430.1|5960650_5961295_-	hypothetical protein	NA	A0A1B0VRJ1	Pseudomonas_phage	61.2	2.7e-65
AMG47431.1|5961301_5961922_-|tRNA	methionyl-tRNA formyltransferase	tRNA	A4JWM2	Burkholderia_virus	65.8	1.2e-73
AVC43132.1|5961912_5963034_-	ABC transporter ATP-binding protein	NA	A4JWM1	Burkholderia_virus	76.6	5.6e-167
AVC43133.1|5963166_5963391_-	Com family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
AMG47432.1|5963803_5963989_+	hypothetical protein	NA	NA	NA	NA	NA
AMG47433.1|5964030_5964660_-	hypothetical protein	NA	NA	NA	NA	NA
AMG47434.1|5964649_5965144_-	RusA family crossover junction endodeoxyribonuclease	NA	A9YWY9	Burkholderia_phage	52.0	6.3e-30
AMG47435.1|5965140_5965371_-	hypothetical protein	NA	NA	NA	NA	NA
AMG47436.1|5965367_5966447_-	hypothetical protein	NA	NA	NA	NA	NA
AMG47437.2|5966443_5967295_-	DNA methyltransferase	NA	Q5QF26	Pseudomonas_virus	52.7	1.5e-76
AVC43134.1|5967294_5969328_-	DNA cytosine methyltransferase	NA	L7TH64	Pseudomonas_virus	51.1	2.8e-164
AMG47438.1|5969324_5969924_-	hypothetical protein	NA	A0A0S2SYA8	Pseudomonas_phage	49.5	1.8e-42
AMG47439.1|5969984_5970176_+	hypothetical protein	NA	NA	NA	NA	NA
AVC43273.1|5970228_5970435_-	hypothetical protein	NA	NA	NA	NA	NA
AMG47440.1|5970470_5970989_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AMG47441.1|5971204_5971498_+	hypothetical protein	NA	NA	NA	NA	NA
AMG47442.2|5971729_5972011_+	hypothetical protein	NA	NA	NA	NA	NA
AMG47444.1|5972702_5972909_+	hypothetical protein	NA	NA	NA	NA	NA
AMG47445.1|5972905_5973190_+	hypothetical protein	NA	NA	NA	NA	NA
AMG47446.1|5973186_5973387_+	hypothetical protein	NA	NA	NA	NA	NA
AMG47447.1|5973403_5974201_+	nuclease	NA	H2BD50	Pseudomonas_phage	49.1	6.3e-56
AVC43135.1|5974204_5975410_+	hypothetical protein	NA	J7HXB6	Pseudomonas_phage	54.2	3.7e-68
AMG47448.2|5975467_5976151_+	cell division protein FtsK	NA	NA	NA	NA	NA
AMG47449.1|5976154_5977936_+	recombinase RecF	NA	J7HXJ7	Pseudomonas_phage	39.5	1.3e-77
AMG47450.1|5977932_5978298_+	hypothetical protein	NA	NA	NA	NA	NA
AMG47451.1|5978294_5978690_+	hypothetical protein	NA	NA	NA	NA	NA
AMG47452.1|5978682_5979678_+	phage Gp37/Gp68 family protein	NA	Q8W6R4	Burkholderia_virus	59.2	2.6e-107
AVC43136.1|5979674_5979962_+	hypothetical protein	NA	NA	NA	NA	NA
AMG47453.2|5979963_5981019_+|integrase	integrase	integrase	A0A1B0VP19	Pseudomonas_phage	27.8	1.9e-20
5985820:5985835	attR	GTGCTGCGCGTGCGCC	NA	NA	NA	NA
>prophage 8
CP014065	Achromobacter xylosoxidans strain FDAARGOS_162 chromosome, complete genome	6547320	5987501	5999938	6547320	tail	Burkholderia_phage(40.0%)	17	NA	NA
AMG47460.1|5987501_5988032_-	hypothetical protein	NA	A0A2H4JFP9	uncultured_Caudovirales_phage	54.9	3.2e-40
AMG47461.1|5988021_5988483_-	hypothetical protein	NA	A0A0U5LBV3	unidentified_phage	36.5	1.3e-13
AVC43139.1|5988674_5989124_-|tail	tail fiber assembly protein	tail	A0A2H4J9Z7	uncultured_Caudovirales_phage	61.8	8.3e-13
AMG47462.1|5989135_5990167_-	hypothetical protein	NA	A0A1W6JT73	Escherichia_phage	38.5	5.9e-14
AMG47463.1|5990181_5990847_-	DUF2612 domain-containing protein	NA	A9YX13	Burkholderia_phage	59.7	1.1e-72
AMG47464.1|5990848_5992030_-	hypothetical protein	NA	A9YX12	Burkholderia_phage	63.4	3.1e-131
AMG47465.1|5992026_5992380_-	hypothetical protein	NA	A9YX11	Burkholderia_phage	65.0	1.3e-34
AMG47466.1|5992388_5993132_-	hypothetical protein	NA	A9YX06	Burkholderia_phage	63.5	6.7e-84
AMG48228.1|5993166_5994177_-	hypothetical protein	NA	A9YX04	Burkholderia_phage	51.3	4.8e-77
AMG47467.1|5994196_5994496_-	hypothetical protein	NA	A0A2H4J495	uncultured_Caudovirales_phage	44.0	4.1e-16
AMG47468.1|5994505_5995105_-	hypothetical protein	NA	A0A0M3ULD5	Salmonella_phage	34.3	2.5e-20
AVC43140.1|5995097_5996774_-|tail	phage tail protein	tail	NA	NA	NA	NA
AMG47469.1|5996766_5996955_-	hypothetical protein	NA	NA	NA	NA	NA
AMG47470.1|5996951_5997401_-	hypothetical protein	NA	A0A0N7IRF3	Acinetobacter_phage	36.5	2.9e-18
AMG47471.1|5997404_5997845_-	DUF3277 domain-containing protein	NA	A0A0P0IKY2	Acinetobacter_phage	54.1	3.1e-36
AMG47472.1|5997858_5999334_-	DUF3383 domain-containing protein	NA	A0A0P0I492	Acinetobacter_phage	48.5	3.6e-113
AMG47473.1|5999344_5999938_-	hypothetical protein	NA	A9YX29	Burkholderia_phage	47.2	2.6e-46
