The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP014070	Citrobacter amalonaticus strain FDAARGOS_165 chromosome, complete genome	5030678	793335	865573	5030678	tail,terminase,capsid,transposase,holin,head,portal,integrase,protease	Cronobacter_phage(56.41%)	79	785598:785616	870081:870099
785598:785616	attL	AGCGGAACGGGTAAGGCAA	NA	NA	NA	NA
AVC45148.1|793335_794698_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	52.2	3.2e-76
AMG52319.1|794753_795068_-	L-rhamnose mutarotase	NA	NA	NA	NA	NA
AMG52320.1|795064_796213_-	lactaldehyde reductase	NA	NA	NA	NA	NA
AMG52321.1|796273_797278_-	ABC transporter permease	NA	NA	NA	NA	NA
AMG52322.1|797274_798279_-	ABC transporter permease	NA	NA	NA	NA	NA
AMG52323.1|798278_799784_-	sugar ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	26.2	5.6e-13
AMG52324.1|799903_800890_-	rhamnose ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AMG52325.1|800989_801817_-	rhamnulose-1-phosphate aldolase	NA	NA	NA	NA	NA
AMG52326.1|801927_803187_-	L-rhamnose isomerase	NA	NA	NA	NA	NA
AMG52327.1|803183_804653_-	rhamnulokinase	NA	NA	NA	NA	NA
AMG52328.1|804953_805790_+	HTH-type transcriptional activator RhaS	NA	NA	NA	NA	NA
AMG52329.1|805930_806779_+	HTH-type transcriptional activator RhaR	NA	NA	NA	NA	NA
AMG52330.1|806775_807810_-	L-rhamnose/proton symporter RhaT	NA	NA	NA	NA	NA
AMG52331.1|808096_808717_+	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	57.4	1.3e-61
AMG52332.1|808910_809894_+	2-keto-3-deoxygluconate transporter	NA	NA	NA	NA	NA
AMG52333.1|809979_810870_-	dihydrodipicolinate synthase family protein	NA	NA	NA	NA	NA
AMG52334.1|811022_811697_+	MOSC domain-containing protein	NA	NA	NA	NA	NA
AVC45149.1|811684_811903_+	hypothetical protein	NA	NA	NA	NA	NA
AMG52335.1|811812_813186_-	two-component system sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	24.0	3.8e-16
AMG52336.1|813182_813881_-	DNA-binding response regulator	NA	Q6XM27	Feldmannia_irregularis_virus	30.3	5.3e-06
AMG55948.1|814031_814532_+	stress adaptor protein CpxP	NA	NA	NA	NA	NA
AMG52337.1|814717_815701_-|integrase	integrase	integrase	A0A0M4RTQ0	Salmonella_phage	67.9	3.6e-125
AMG55949.1|815785_816106_-	XRE family transcriptional regulator	NA	Q1JS83	Enterobacteria_phage	40.7	1.3e-12
AMG52338.1|816202_816472_+	hypothetical protein	NA	Q1JS20	Enterobacteria_phage	56.7	1.5e-22
AMG52339.1|816474_816810_+	hypothetical protein	NA	NA	NA	NA	NA
AMG52340.1|816819_817389_+	3'-5' exoribonuclease	NA	K7PLW7	Enterobacteria_phage	48.9	6.5e-47
AVC45353.1|817391_817610_+	hypothetical protein	NA	A0A286S1P6	Klebsiella_phage	43.3	2.4e-05
AMG52341.1|817649_820307_+	bifunctional DNA primase/helicase	NA	A0A077K8T2	Ralstonia_phage	46.0	7.4e-242
AMG52342.1|820309_820627_+	hypothetical protein	NA	NA	NA	NA	NA
AMG52343.1|820643_820967_-	transcriptional regulator	NA	F1BUM8	Cronobacter_phage	74.8	3.5e-37
AMG52344.1|820966_821986_-|portal	phage portal protein	portal	F1BUM7	Cronobacter_phage	69.4	1.6e-136
AMG52345.1|821982_823770_-|terminase	terminase	terminase	F1BUM5	Cronobacter_phage	70.2	7.9e-248
AMG52346.1|823955_824795_+|capsid	phage capsid protein	capsid	F1BUM4	Cronobacter_phage	48.5	3.1e-45
AMG52347.1|824829_825858_+|capsid	phage major capsid protein, P2 family	capsid	F1BUM2	Cronobacter_phage	71.3	8.3e-133
AMG52348.1|825868_826582_+|terminase	terminase	terminase	F1BUM0	Cronobacter_phage	54.3	3.9e-65
AMG52349.1|826583_826775_+	hypothetical protein	NA	Q8W634	Enterobacteria_phage	55.2	9.5e-11
AMG52350.2|826868_827321_+|head	head completion protein	head	F1BUL8	Cronobacter_phage	61.3	6.8e-47
AMG52351.1|827317_827800_+|tail	phage tail protein	tail	F1BUL7	Cronobacter_phage	48.7	5.2e-37
AMG52352.1|827796_828501_+	hypothetical protein	NA	F1BUL6	Cronobacter_phage	60.3	4.0e-70
AMG52353.1|828497_829625_+	DUF2586 domain-containing protein	NA	F1BUL5	Cronobacter_phage	84.0	7.3e-175
AMG52354.1|829621_830077_+	DUF2597 domain-containing protein	NA	F1BUL4	Cronobacter_phage	72.2	1.3e-58
AMG52355.1|830089_830386_+|holin	holin	holin	C7BGD7	Burkholderia_phage	50.6	2.4e-16
AMG52356.1|830382_830724_+	hypothetical protein	NA	F1BUL3	Cronobacter_phage	89.1	1.3e-47
AMG52357.1|830723_831056_+	hypothetical protein	NA	F1BUL2	Cronobacter_phage	63.6	9.7e-35
AVC45150.1|830982_831216_+	hypothetical protein	NA	F1BUL1	Cronobacter_phage	81.8	1.1e-29
AMG52358.1|831202_831460_+	hypothetical protein	NA	A5X9I7	Aeromonas_virus	62.2	1.1e-20
AMG52359.1|831647_833615_+|tail	phage tail tape measure protein	tail	F1BUK9	Cronobacter_phage	70.2	9.5e-271
AMG52360.1|833611_833941_+	DUF2590 domain-containing protein	NA	F1BUK8	Cronobacter_phage	71.4	2.1e-37
AMG52361.1|833937_835122_+	hypothetical protein	NA	F1BUK6	Cronobacter_phage	78.9	2.6e-178
AMG52362.2|835108_835702_+	hypothetical protein	NA	F1BUK5	Cronobacter_phage	86.2	8.8e-95
AMG52363.1|835711_837289_+|tail	phage tail protein	tail	F1BUK3	Cronobacter_phage	80.1	3.9e-134
AMG52364.1|837288_837876_+|tail	tail fiber assembly protein	tail	E5G6P1	Salmonella_phage	56.5	4.2e-57
AMG52365.1|837865_838591_+	hypothetical protein	NA	F1BUK1	Cronobacter_phage	52.7	1.5e-59
AMG52366.1|838562_839108_+	hypothetical protein	NA	F1BUJ9	Cronobacter_phage	74.2	1.0e-65
AMG55950.2|839107_840811_+	hypothetical protein	NA	F1BUJ7	Cronobacter_phage	80.4	1.2e-224
AVC45151.1|840900_841101_-	hypothetical protein	NA	NA	NA	NA	NA
AMG52367.1|841829_842933_-	acyltransferase	NA	NA	NA	NA	NA
AMG52368.1|843351_844254_+	cation-efflux pump FieF	NA	NA	NA	NA	NA
AMG52369.1|844438_845401_+	6-phosphofructokinase	NA	NA	NA	NA	NA
AMG52370.1|845603_846593_+	sulfate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AMG52371.1|846695_847451_+	CDP-diacylglycerol diphosphatase	NA	NA	NA	NA	NA
AMG52372.1|847716_849051_+	MFS transporter	NA	NA	NA	NA	NA
AMG52373.1|850029_851070_+	ADP-ribosylglycohydrolase family protein	NA	NA	NA	NA	NA
AMG55951.1|851132_851855_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AMG52374.1|851940_853245_+	citrate transporter	NA	NA	NA	NA	NA
AMG52375.1|853357_854830_+	C4-dicarboxylate ABC transporter	NA	NA	NA	NA	NA
AMG52376.1|854872_855640_-	triose-phosphate isomerase	NA	NA	NA	NA	NA
AMG52377.1|855752_856349_-	DUF1454 domain-containing protein	NA	NA	NA	NA	NA
AMG52378.1|856449_856878_+	DUF805 domain-containing protein	NA	NA	NA	NA	NA
AMG52379.1|856884_857631_-	ferredoxin--NADP(+) reductase	NA	NA	NA	NA	NA
AMG52380.1|857727_858738_-	fructose-bisphosphatase class II	NA	NA	NA	NA	NA
AMG52381.1|858896_860405_-	glycerol kinase	NA	NA	NA	NA	NA
AMG52382.1|860427_861273_-	aquaporin	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	28.4	4.4e-15
AMG55952.2|861660_861906_+	septal ring assembly protein ZapB	NA	NA	NA	NA	NA
AVC45152.1|861924_862131_-	hypothetical protein	NA	NA	NA	NA	NA
AMG52383.1|862127_862613_-	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
AMG52384.1|862705_863635_-	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
AMG52385.1|863701_865033_-	HslU--HslV peptidase ATPase subunit	NA	A0A173GE36	Erwinia_phage	30.3	4.9e-45
AMG52386.1|865042_865573_-|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
870081:870099	attR	AGCGGAACGGGTAAGGCAA	NA	NA	NA	NA
>prophage 2
CP014070	Citrobacter amalonaticus strain FDAARGOS_165 chromosome, complete genome	5030678	1116497	1121510	5030678		Escherichia_phage(100.0%)	6	NA	NA
AMG52576.1|1116497_1116698_+	hypothetical protein	NA	A0A077SK27	Escherichia_phage	75.0	2.5e-17
AMG55961.2|1116713_1118930_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	84.6	0.0e+00
AMG52577.1|1118943_1119570_+	dimethylsulfoxide reductase, chain B	NA	A0A077SL61	Escherichia_phage	93.3	4.4e-121
AMG52578.1|1119562_1120336_+	dimethyl sulfoxide reductase	NA	A0A077SK59	Escherichia_phage	79.8	1.1e-102
AMG52579.1|1120380_1120977_+	molecular chaperone	NA	A0A077SLS7	Escherichia_phage	68.2	8.3e-77
AMG52580.1|1120973_1121510_+	ferredoxin-type protein NapF	NA	A0A077SLP0	Escherichia_phage	60.9	2.1e-55
>prophage 3
CP014070	Citrobacter amalonaticus strain FDAARGOS_165 chromosome, complete genome	5030678	1861359	1906410	5030678	tail,coat,holin,terminase	Salmonella_phage(40.0%)	62	NA	NA
AMG53206.1|1861359_1862589_+	DUF4102 domain-containing protein	NA	H6WRW7	Salmonella_phage	95.6	6.2e-236
AMG53207.1|1862566_1862851_-	excisionase Xis	NA	H6WRW8	Salmonella_phage	78.7	5.6e-39
AMG53208.1|1862897_1863137_-	DUF4060 domain-containing protein	NA	M9P0E0	Enterobacteria_phage	79.2	4.4e-29
AMG53209.1|1863178_1864261_-	enterohemolysin	NA	K7PKR8	Enterobacteria_phage	51.2	6.9e-98
AMG53210.1|1864271_1867280_-	exodeoxyribonuclease	NA	H6WRX1	Salmonella_phage	62.5	5.5e-312
AMG53211.1|1867408_1867696_-	DNA breaking-rejoining protein	NA	H6WRX2	Salmonella_phage	81.1	9.6e-39
AMG53212.1|1867781_1867940_-	hypothetical protein	NA	K7P7H7	Enterobacteria_phage	100.0	1.4e-23
AMG53213.1|1867939_1868134_-	DUF1482 domain-containing protein	NA	NA	NA	NA	NA
AMG53214.1|1868258_1868483_-	hypothetical protein	NA	NA	NA	NA	NA
AMG55980.1|1868767_1868977_+	fumarate hydratase FumD	NA	I6R0R9	Salmonella_phage	91.3	6.1e-27
AMG53215.1|1869013_1869436_-	hypothetical protein	NA	NA	NA	NA	NA
AMG53216.1|1869437_1870046_-	hypothetical protein	NA	NA	NA	NA	NA
AMG53217.1|1870032_1870272_-	hypothetical protein	NA	NA	NA	NA	NA
AMG53218.1|1870603_1870990_-	transcriptional regulator	NA	A0A0M4R5D1	Salmonella_phage	88.1	1.5e-55
AMG53219.1|1871093_1871327_+	Rha family transcriptional regulator	NA	A0A0M4QX15	Salmonella_phage	83.1	6.0e-31
AMG55981.1|1871377_1871872_+	regulator	NA	K7PJT7	Enterobacteria_phage	59.5	1.4e-40
AMG53220.1|1872209_1873136_+	hypothetical protein	NA	K7PGZ0	Enterobacteria_phage	68.5	4.5e-106
AMG53221.1|1873119_1873809_+	phage replication protein	NA	G8C7U6	Escherichia_phage	58.5	1.7e-73
AMG53222.1|1873820_1874591_+	hypothetical protein	NA	A0A0U2SAW4	Escherichia_phage	26.4	1.9e-09
AMG53223.1|1874587_1875133_+	hypothetical protein	NA	NA	NA	NA	NA
AMG53224.1|1875129_1875621_+	hypothetical protein	NA	NA	NA	NA	NA
AVC45361.1|1875947_1876451_+	DUF551 domain-containing protein	NA	K7P7E4	Enterobacteria_phage	56.1	5.2e-40
AMG53225.1|1876452_1876680_+	hypothetical protein	NA	NA	NA	NA	NA
AMG53226.1|1876679_1876937_+	hypothetical protein	NA	NA	NA	NA	NA
AVC45197.1|1876933_1878913_+	DNA cytosine methyltransferase	NA	H9C171	Pectobacterium_phage	53.4	2.7e-201
AMG53227.1|1879056_1879290_+	DNA damage-inducible protein I	NA	K7PM44	Enterobacteria_phage	84.4	3.5e-31
AVC45198.1|1879406_1879655_+	hypothetical protein	NA	K7PHG9	Enterobacteria_phage	93.9	1.3e-39
AMG53228.1|1879689_1880292_+	DUF1367 domain-containing protein	NA	S4TTI0	Salmonella_phage	93.0	1.2e-104
AMG53229.2|1880297_1880498_+	hypothetical protein	NA	H6WRY8	Salmonella_phage	62.1	2.0e-19
AMG53230.1|1880488_1880782_+	hypothetical protein	NA	K7P7Q1	Enterobacteria_phage	95.5	3.1e-45
AVC45199.1|1880778_1880919_+	YlcG family protein	NA	A0A0M5M7B2	Salmonella_phage	84.6	3.1e-11
AMG53231.1|1880915_1881599_+	antiterminator	NA	I6PDF8	Cronobacter_phage	56.6	4.1e-64
AMG53232.2|1882045_1882375_+|holin	phage holin, lambda family	holin	A0A0M3ULK9	Salmonella_phage	94.5	9.3e-54
AMG53233.1|1882361_1882787_+	structural protein	NA	A0A0E3GMJ2	Enterobacteria_phage	54.0	2.2e-39
AMG53234.1|1882851_1883733_+	site-specific DNA-methyltransferase	NA	H2EQJ0	Salmonella_phage	72.0	8.0e-52
AMG53235.1|1883785_1884067_+	hypothetical protein	NA	NA	NA	NA	NA
AMG55982.1|1884143_1884683_+	hypothetical protein	NA	K7PHH7	Enterobacteria_phage	71.0	4.1e-59
AMG53236.1|1885073_1885277_+	hypothetical protein	NA	NA	NA	NA	NA
AMG53237.1|1885373_1885598_-	hypothetical protein	NA	NA	NA	NA	NA
AMG53238.1|1885664_1886315_+	hypothetical protein	NA	I6S676	Salmonella_phage	83.8	3.2e-106
AMG53239.1|1886347_1886836_+	DUF2280 domain-containing protein	NA	H9C190	Pectobacterium_phage	70.2	2.8e-54
AMG53240.1|1886832_1888404_+|terminase	terminase	terminase	G8C7P3	Escherichia_phage	90.2	1.0e-299
AMG53241.1|1888407_1889811_+	DUF4055 domain-containing protein	NA	G8C7P4	Escherichia_phage	73.9	3.2e-196
AMG53242.1|1889797_1890910_+	hypothetical protein	NA	I6PD76	Cronobacter_phage	56.3	2.0e-116
AMG53243.1|1891014_1891779_+	hypothetical protein	NA	G8C7P6	Escherichia_phage	69.3	4.0e-92
AMG53244.1|1891865_1893002_+|coat	P22 coat - protein 5 family protein	coat	G8C7P7	Escherichia_phage	76.5	8.8e-160
AMG53245.1|1893049_1893286_+	hypothetical protein	NA	NA	NA	NA	NA
AMG53246.1|1893289_1893700_+	protein singed	NA	A0A0H5AUF0	Pseudomonas_phage	39.0	1.7e-09
AVC45362.1|1893710_1893944_+	hypothetical protein	NA	A0A1V0E8A3	Vibrio_phage	58.5	5.6e-13
AMG55983.1|1893930_1894314_+	glutamate 5-kinase	NA	A0A059VA70	Pseudomonas_phage	47.2	4.9e-22
AMG53247.1|1894313_1894520_+	hypothetical protein	NA	NA	NA	NA	NA
AMG53248.1|1894512_1895145_+	hypothetical protein	NA	A0A2H4J0Q3	uncultured_Caudovirales_phage	31.1	5.8e-12
AMG53249.1|1895141_1895534_+	electron transfer flavoprotein subunit beta	NA	NA	NA	NA	NA
AMG53250.1|1895560_1896721_+	Ig domain-containing protein	NA	A0A059VG08	Pseudomonas_phage	41.2	2.8e-60
AMG53251.1|1896783_1897251_+	hypothetical protein	NA	NA	NA	NA	NA
AMG53252.1|1897346_1897568_+	hypothetical protein	NA	NA	NA	NA	NA
AVC45200.1|1898332_1901143_+|tail	phage tail tape measure protein	tail	A0A2H4J9A1	uncultured_Caudovirales_phage	32.5	1.2e-106
AMG53253.1|1901146_1901740_+	hypothetical protein	NA	S4TSP7	Salmonella_phage	58.2	1.2e-59
AMG53254.1|1901739_1902324_+	hypothetical protein	NA	S4TND4	Salmonella_phage	88.7	4.1e-97
AMG53255.1|1902330_1902729_+	hypothetical protein	NA	S4TR39	Salmonella_phage	81.8	2.1e-60
AMG53256.1|1902728_1905440_+	DUF1983 domain-containing protein	NA	S4TTF5	Salmonella_phage	85.0	0.0e+00
AMG53257.1|1905447_1906410_+	hypothetical protein	NA	H6WRW5	Salmonella_phage	65.0	4.1e-118
>prophage 4
CP014070	Citrobacter amalonaticus strain FDAARGOS_165 chromosome, complete genome	5030678	2381526	2389949	5030678	tRNA	Enterobacteria_phage(66.67%)	9	NA	NA
AMG53655.1|2381526_2382474_+	ABC transporter ATP-binding protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	26.1	1.7e-07
AMG53656.1|2382457_2383189_+	ABC transporter permease	NA	NA	NA	NA	NA
AVC45216.1|2383169_2383277_-	hypothetical protein	NA	NA	NA	NA	NA
AMG53657.1|2383336_2384068_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	89.9	8.3e-103
AMG53658.1|2384291_2385980_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.5	2.4e-278
AMG53659.1|2385972_2386692_+	two-component system response regulator YehT	NA	NA	NA	NA	NA
AMG56003.1|2386738_2387209_+	DUF1456 domain-containing protein	NA	Q9EYF4	Enterobacteria_phage	76.8	3.1e-63
AMG53660.1|2387253_2387712_-	DUF1307 domain-containing protein	NA	Q9EYF5	Enterobacteria_phage	66.7	1.1e-49
AMG53661.1|2387915_2389949_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.4e-54
>prophage 5
CP014070	Citrobacter amalonaticus strain FDAARGOS_165 chromosome, complete genome	5030678	2477097	2519739	5030678	head,tail,integrase,holin	Salmonella_phage(52.17%)	65	2476699:2476714	2496704:2496719
2476699:2476714	attL	GCTTCCTGCGGGGTGA	NA	NA	NA	NA
AMG53730.1|2477097_2478279_+	DUF4102 domain-containing protein	NA	A0A0M4QX09	Salmonella_phage	88.8	3.3e-210
AMG53731.1|2478259_2478451_-	AlpA family phage regulatory protein	NA	A0A0M4RTZ2	Salmonella_phage	79.0	7.8e-21
AVC45219.1|2478601_2478817_-	hypothetical protein	NA	NA	NA	NA	NA
AMG53732.1|2478816_2479050_-	hypothetical protein	NA	NA	NA	NA	NA
AMG53733.1|2479062_2479290_-	hypothetical protein	NA	NA	NA	NA	NA
AMG53734.1|2479934_2480180_-	hypothetical protein	NA	A0A1B0V7L5	Salmonella_phage	53.8	2.0e-16
AMG53735.1|2480280_2480505_-	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	68.5	3.8e-19
AMG53736.1|2480501_2481068_-	hypothetical protein	NA	A0A088C4R7	Shewanella_sp._phage	40.6	1.1e-30
AMG56009.1|2481064_2481832_-	DNA-binding protein	NA	B1GS65	Salmonella_phage	47.7	7.3e-17
AMG53737.1|2481884_2482163_-	hypothetical protein	NA	NA	NA	NA	NA
AMG53738.1|2482173_2482752_-	hypothetical protein	NA	A0A286S1S7	Klebsiella_phage	85.5	1.7e-90
AMG53739.1|2482732_2483167_-	hypothetical protein	NA	A0A286S1S2	Klebsiella_phage	70.9	3.7e-50
AVC45220.1|2483353_2483554_-	hypothetical protein	NA	A0A286SGR4	Klebsiella_phage	74.2	3.3e-22
AMG53740.1|2483605_2483962_-	hypothetical protein	NA	A0A1B5FPB3	Escherichia_phage	48.7	5.9e-22
AMG53741.1|2483951_2484152_-	hypothetical protein	NA	NA	NA	NA	NA
AMG53743.1|2484744_2484936_-	hypothetical protein	NA	NA	NA	NA	NA
AMG53744.1|2484932_2485145_-	hypothetical protein	NA	A0A1W6JPD9	Morganella_phage	39.3	8.7e-05
AMG53745.1|2485320_2485998_-	phage repressor protein	NA	K7P850	Enterobacteria_phage	53.9	1.6e-52
AMG56010.1|2486120_2486318_+	hypothetical protein	NA	NA	NA	NA	NA
AVC45221.1|2486322_2486520_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
AMG53746.2|2486516_2486705_+	hypothetical protein	NA	NA	NA	NA	NA
AMG53747.1|2486701_2487736_+	helix-turn-helix domain-containing protein	NA	Q8W642	Enterobacteria_phage	59.4	1.6e-27
AMG53748.1|2487842_2489714_+	bifunctional DNA primase/helicase	NA	A0A0M4R313	Salmonella_phage	59.0	2.4e-223
AMG53749.1|2489716_2490040_+	hypothetical protein	NA	NA	NA	NA	NA
AMG53750.2|2490039_2490219_+	hypothetical protein	NA	NA	NA	NA	NA
AMG53751.1|2490215_2491019_+	antitermination protein	NA	F1C595	Cronobacter_phage	73.8	2.1e-107
AMG53752.1|2491215_2491785_+	hypothetical protein	NA	NA	NA	NA	NA
AMG53753.2|2492148_2492478_+|holin	phage holin, lambda family	holin	A0A0M3ULK9	Salmonella_phage	94.5	9.3e-54
AMG53754.1|2492464_2492890_+	structural protein	NA	A0A0E3GMJ2	Enterobacteria_phage	54.0	2.2e-39
AMG53755.1|2492954_2493836_+	site-specific DNA-methyltransferase	NA	H2EQJ0	Salmonella_phage	72.0	8.0e-52
AMG53756.1|2493888_2494170_+	hypothetical protein	NA	NA	NA	NA	NA
AMG56011.1|2494246_2494786_+	hypothetical protein	NA	K7PHH7	Enterobacteria_phage	72.2	1.1e-59
AMG53757.1|2494848_2495853_+|integrase	site-specific integrase	integrase	Q2A0C3	Sodalis_phage	26.3	2.1e-19
AMG53758.1|2496147_2496750_+	hypothetical protein	NA	NA	NA	NA	NA
2496704:2496719	attR	TCACCCCGCAGGAAGC	NA	NA	NA	NA
AMG53759.1|2496947_2498564_+	TerL protein	NA	A0A0M5M1R6	Salmonella_phage	81.3	7.3e-269
AMG53760.1|2498565_2500035_+	DUF1073 domain-containing protein	NA	A0A0M4S6U1	Salmonella_phage	56.3	1.2e-156
AMG53761.1|2500105_2500639_+	hypothetical protein	NA	A0A0M4REK0	Salmonella_phage	56.3	5.5e-48
AMG53762.1|2500635_2500818_+	hypothetical protein	NA	NA	NA	NA	NA
AVC45222.1|2500900_2502175_+	hypothetical protein	NA	A0A0M4R5A6	Salmonella_phage	42.0	1.9e-78
AVC45223.1|2502186_2502690_+	hypothetical protein	NA	A0A0M4QWZ6	Salmonella_phage	47.0	3.8e-30
AMG53763.1|2502701_2503649_+	DUF2184 domain-containing protein	NA	A0A2H4J191	uncultured_Caudovirales_phage	60.1	4.2e-107
AMG53764.1|2503693_2504104_+	hypothetical protein	NA	NA	NA	NA	NA
AMG53765.1|2504075_2504486_+	DUF4054 domain-containing protein	NA	A0A2H4J1A6	uncultured_Caudovirales_phage	51.9	4.4e-29
AMG53766.1|2504482_2504986_+	hypothetical protein	NA	NA	NA	NA	NA
AMG53767.1|2504985_2505390_+|head,tail	head-tail adaptor	head,tail	A0A2H4J1A4	uncultured_Caudovirales_phage	68.5	7.6e-42
AMG53768.1|2505382_2505931_+	hypothetical protein	NA	A0A0M4R331	Salmonella_phage	53.0	2.3e-49
AMG53769.1|2505933_2507085_+	DUF3383 domain-containing protein	NA	A0A0M4RD26	Salmonella_phage	89.8	3.1e-197
AMG53770.1|2507094_2507535_+	DUF3277 domain-containing protein	NA	A0A0M5M1K6	Salmonella_phage	83.6	4.0e-68
AMG53771.1|2507538_2507988_+	hypothetical protein	NA	A0A0M4S6U8	Salmonella_phage	65.1	2.5e-49
AVC45224.1|2507999_2508185_+	NTP pyrophosphohydrolase	NA	A0A2H4J1A2	uncultured_Caudovirales_phage	68.8	5.4e-11
AMG53772.1|2508165_2510148_+	lytic transglycosylase	NA	A0A0M4REK7	Salmonella_phage	61.1	3.0e-216
AMG53773.1|2510147_2510723_+	hypothetical protein	NA	A0A0M3ULD5	Salmonella_phage	93.7	9.7e-91
AMG53774.1|2510722_2511025_+	hypothetical protein	NA	A0A0M4R5B7	Salmonella_phage	91.0	4.1e-48
AMG53775.1|2511027_2512098_+	hypothetical protein	NA	A0A0M4QX01	Salmonella_phage	88.5	2.1e-171
AMG53776.1|2512100_2512562_+	hypothetical protein	NA	NA	NA	NA	NA
AMG53777.1|2512626_2513379_+	translation initiation factor IF-2	NA	A0A0M5M1K7	Salmonella_phage	69.0	3.3e-91
AMG53778.1|2513378_2513732_+	hypothetical protein	NA	A0A0M4R339	Salmonella_phage	92.3	6.2e-56
AMG53779.1|2513732_2514932_+	hypothetical protein	NA	A0A0M4RD32	Salmonella_phage	87.2	5.6e-189
AMG53780.1|2514928_2515609_+	DUF2612 domain-containing protein	NA	A0A0M5M1K4	Salmonella_phage	84.5	3.1e-112
AMG53781.1|2516267_2516609_+|tail	tail fiber assembly protein	tail	S5FXM8	Shigella_phage	50.0	5.0e-10
AVC45225.1|2516589_2516811_-|tail	phage tail protein	tail	A0A0F7LDZ0	Escherichia_phage	52.1	6.3e-14
AMG53782.1|2517214_2517769_+	DNA-invertase	NA	A0A0F7LA37	Escherichia_phage	86.7	4.8e-87
AMG53783.1|2517874_2518123_-	damage-inducible protein DinI	NA	S5MQI1	Escherichia_phage	74.1	1.9e-27
AVC45226.1|2518281_2518464_-	hypothetical protein	NA	NA	NA	NA	NA
AMG53784.1|2518566_2519739_+	serine-type D-Ala-D-Ala carboxypeptidase DacD	NA	B6DZZ7	Stx2-converting_phage	87.4	3.2e-197
>prophage 6
CP014070	Citrobacter amalonaticus strain FDAARGOS_165 chromosome, complete genome	5030678	3626758	3684427	5030678	tail,terminase,holin,transposase,portal,integrase,protease	Enterobacteria_phage(30.23%)	68	3647990:3648004	3668611:3668625
AMG54752.1|3626758_3627721_-	hypothetical protein	NA	H6WRW5	Salmonella_phage	64.4	4.5e-117
AMG54753.1|3627728_3630932_-	host specificity protein J	NA	O64335	Escherichia_phage	83.2	0.0e+00
AMG54754.1|3630983_3631583_-|tail	tail assembly protein	tail	K7PH91	Enterobacterial_phage	70.9	6.8e-71
AMG54755.1|3631641_3632064_-	hypothetical protein	NA	NA	NA	NA	NA
AMG54756.1|3632094_3632805_-	peptidase P60	NA	K7P6F5	Enterobacteria_phage	91.5	8.5e-137
AMG54757.1|3632806_3633562_-|tail	phage minor tail protein L	tail	K7PGX3	Enterobacteria_phage	86.5	5.1e-132
AMG54758.1|3633558_3633906_-|tail	phage tail protein	tail	K7PJT2	Enterobacteria_phage	75.7	3.7e-45
AMG54759.1|3633911_3637046_-|tail	phage tail tape measure protein	tail	E4WL33	Enterobacteria_phage	87.1	0.0e+00
AMG54760.2|3637029_3637344_-|tail	phage tail assembly protein T	tail	E4WL32	Enterobacteria_phage	89.4	5.9e-50
AMG54761.1|3637352_3637784_-|tail	phage minor tail protein G	tail	M9NZD7	Enterobacteria_phage	70.6	5.3e-49
AMG54762.1|3637794_3638538_-|tail	phage tail protein	tail	K7PKX6	Enterobacterial_phage	92.7	4.6e-125
AMG54763.1|3638548_3638950_-|tail	phage tail protein	tail	K7PHM6	Enterobacterial_phage	82.7	1.1e-61
AMG54764.1|3638946_3639525_-|tail	phage tail protein	tail	K7PMB7	Enterobacterial_phage	97.9	2.9e-95
AMG54765.2|3639534_3639810_-	DNA breaking-rejoining protein	NA	K7PH55	Enterobacterial_phage	90.0	9.5e-36
AMG56068.1|3639802_3640129_-	DUF2190 domain-containing protein	NA	K7PJY3	Enterobacterial_phage	87.0	3.0e-44
AMG56070.2|3640212_3642240_-|protease	Clp protease ClpP	protease	K7PKX4	Enterobacterial_phage	87.0	0.0e+00
AMG54766.1|3642184_3643684_-|portal	phage portal protein	portal	K7PHM5	Enterobacterial_phage	99.4	2.5e-287
AMG56069.1|3643680_3643896_-	hypothetical protein	NA	K7PMB5	Enterobacterial_phage	98.6	1.4e-31
AMG54767.1|3643892_3645995_-|terminase	phage terminase large subunit family protein	terminase	K7PH52	Enterobacterial_phage	90.7	0.0e+00
AMG54768.1|3645994_3646483_-	DUF1441 domain-containing protein	NA	K7PJY2	Enterobacterial_phage	85.8	6.6e-72
AMG54769.2|3646693_3646987_-	hypothetical protein	NA	Q8W634	Enterobacteria_phage	66.3	1.6e-25
AMG56071.1|3647089_3647629_-	hypothetical protein	NA	K7PHH7	Enterobacteria_phage	69.8	2.8e-55
AMG54770.1|3647705_3647987_-	hypothetical protein	NA	NA	NA	NA	NA
3647990:3648004	attL	TTTTTTCCTTCTTTG	NA	NA	NA	NA
AMG54771.1|3648039_3648921_-	site-specific DNA-methyltransferase	NA	H2EQJ0	Salmonella_phage	72.0	8.0e-52
AMG54772.1|3648985_3649411_-	structural protein	NA	X2KPC6	Enterobacteria_phage	54.0	1.4e-38
AMG54773.2|3649397_3649727_-|holin	phage holin, lambda family	holin	A0A0M3ULK9	Salmonella_phage	94.5	9.3e-54
AMG54774.1|3649876_3650929_-	site-specific DNA-methyltransferase	NA	K7PKK9	Enterobacteria_phage	83.0	3.6e-176
AMG54775.1|3651079_3651271_-	TrmB family transcriptional regulator	NA	NA	NA	NA	NA
AMG54776.1|3651641_3652241_-	hypothetical protein	NA	H9C175	Pectobacterium_phage	72.4	2.1e-80
AMG54777.1|3652254_3653289_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	52.0	2.4e-100
AMG54778.1|3653264_3653645_-	RusA family crossover junction endodeoxyribonuclease	NA	G8C7V6	Escherichia_phage	71.9	4.4e-47
AMG54779.1|3653647_3653848_-	hypothetical protein	NA	H6WRY8	Salmonella_phage	59.1	1.0e-15
AMG54780.1|3653973_3654219_-	hypothetical protein	NA	H6WRY6	Salmonella_phage	64.0	2.4e-22
AMG54781.1|3654262_3654496_-	DNA damage-inducible protein I	NA	K7PM44	Enterobacteria_phage	84.4	3.5e-31
AMG54782.1|3654639_3656682_-	DNA cytosine methyltransferase	NA	H9C171	Pectobacterium_phage	52.5	3.1e-200
AMG54783.1|3656678_3656936_-	hypothetical protein	NA	NA	NA	NA	NA
AMG56072.2|3656935_3657385_-	DUF550 domain-containing protein	NA	K7PGV7	Enterobacterial_phage	84.4	2.5e-54
AMG54784.1|3657964_3658144_-	hypothetical protein	NA	NA	NA	NA	NA
AMG54785.1|3658140_3658368_-	hypothetical protein	NA	K7PLX1	Enterobacteria_phage	64.5	6.4e-14
AMG54786.1|3658364_3659081_-	hypothetical protein	NA	NA	NA	NA	NA
AMG54787.2|3659096_3659678_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	73.2	2.9e-66
AMG54788.1|3660707_3661262_-	hypothetical protein	NA	M9NZI6	Enterobacteria_phage	33.7	1.5e-16
AMG54789.1|3661264_3661492_-	Cro/Cl family transcriptional regulator	NA	H6WRX5	Salmonella_phage	78.7	3.8e-30
AMG54790.1|3661622_3662030_+	transcriptional regulator	NA	H6WRX4	Salmonella_phage	52.3	3.0e-30
AMG54791.1|3662303_3662528_+	hypothetical protein	NA	NA	NA	NA	NA
AMG54792.1|3662657_3662849_+	DUF1482 domain-containing protein	NA	NA	NA	NA	NA
AMG54793.1|3663009_3663348_+	hypothetical protein	NA	NA	NA	NA	NA
AMG56074.1|3663359_3663686_+	transcriptional regulator	NA	NA	NA	NA	NA
AMG54794.1|3663827_3666119_+	exonuclease	NA	S4TNL0	Salmonella_phage	45.2	1.4e-111
AVC45287.1|3666188_3666467_+	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
AMG56075.1|3666405_3667434_+|integrase	integrase	integrase	A0A192Y7M7	Salmonella_phage	50.3	5.6e-81
AMG54795.1|3667898_3668558_+	transmembrane protein	NA	A0A2H4JFM9	uncultured_Caudovirales_phage	54.9	4.4e-47
AVC45288.1|3668789_3670152_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	51.9	1.2e-75
3668611:3668625	attR	CAAAGAAGGAAAAAA	NA	NA	NA	NA
AMG54798.1|3670258_3670588_+	sulfurtransferase TusE	NA	NA	NA	NA	NA
AMG54799.1|3670584_3670866_-	acylphosphatase	NA	NA	NA	NA	NA
AMG54800.1|3670960_3672151_+	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	NA	NA	NA	NA
AMG54801.1|3672208_3672526_+	heat shock protein HspQ	NA	NA	NA	NA	NA
AMG54802.1|3672594_3673008_-	CoA-binding protein	NA	NA	NA	NA	NA
AMG54803.1|3673180_3673843_+	DUF2057 domain-containing protein	NA	NA	NA	NA	NA
AMG54804.1|3673935_3674394_+	methylglyoxal synthase	NA	NA	NA	NA	NA
AMG54805.1|3674425_3676480_-	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.9	1.4e-19
AMG54806.1|3676603_3677062_+	YccF domain-containing protein	NA	NA	NA	NA	NA
AMG54807.1|3677068_3679231_+	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
AMG54808.1|3679184_3679814_-	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
AMG54809.1|3680031_3680541_+	cell division inhibitor SulA	NA	NA	NA	NA	NA
AMG54810.1|3680896_3681952_+	porin OmpA	NA	NA	NA	NA	NA
AMG54811.1|3682028_3682481_-	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
AMG54812.1|3682666_3684427_+|protease	Lon protease family protein	protease	NA	NA	NA	NA
>prophage 7
CP014070	Citrobacter amalonaticus strain FDAARGOS_165 chromosome, complete genome	5030678	4163770	4210870	5030678	head,tail,integrase,lysis	Enterobacteria_phage(29.63%)	65	4162552:4162598	4209682:4209728
4162552:4162598	attL	AATGGCGCCCCCTACAGGATTCGAACCTGTGACCGACGGCTTAGAAG	NA	NA	NA	NA
AMG55187.1|4163770_4164850_-	acyltransferase	NA	A0A2H4JA46	uncultured_Caudovirales_phage	28.0	3.3e-15
AMG55189.1|4167061_4169566_-|tail	phage tail protein	tail	F1C5A7	Cronobacter_phage	54.9	8.1e-267
AMG55190.1|4169525_4169945_-	hypothetical protein	NA	F1C5F2	Cronobacter_phage	63.5	7.4e-48
AMG55191.1|4169937_4170408_-	hypothetical protein	NA	R9TPR6	Aeromonas_phage	57.1	1.6e-46
AMG55192.1|4170407_4170902_-	hypothetical protein	NA	F1C5F0	Cronobacter_phage	66.5	1.1e-58
AMG56092.2|4170901_4173301_-|tail	phage tail tape measure protein	tail	A0A1B1W284	Salmonella_phage	51.4	2.1e-134
AMG55193.1|4173349_4174033_-	hypothetical protein	NA	G0ZNE7	Cronobacter_phage	51.3	1.9e-53
AMG55194.1|4174091_4174841_-	hypothetical protein	NA	F1C5E5	Cronobacter_phage	84.0	2.0e-72
AMG55195.1|4174903_4175287_-	hypothetical protein	NA	F1C5E4	Cronobacter_phage	62.2	4.4e-39
AMG55196.1|4175283_4175652_-	hypothetical protein	NA	F1C5E3	Cronobacter_phage	75.4	2.5e-47
AMG56093.1|4175654_4176005_-	hypothetical protein	NA	G0ZNE2	Cronobacter_phage	67.0	6.9e-39
AVC45309.1|4176004_4176178_-	50S ribosomal protein L13	NA	Q5G8X7	Enterobacteria_phage	49.1	1.3e-11
AVC45310.1|4176177_4176579_-	hypothetical protein	NA	G0ZNE1	Cronobacter_phage	80.8	1.2e-55
AMG55197.1|4176641_4176935_-	hypothetical protein	NA	A0A1V0E5P8	Salmonella_phage	88.7	1.5e-42
AMG55198.1|4176944_4178021_-	hypothetical protein	NA	Q5G8Y0	Enterobacteria_phage	91.6	1.5e-190
AMG55199.1|4178038_4178488_-	hypothetical protein	NA	H6WRT3	Salmonella_phage	85.2	7.1e-65
AMG56094.1|4178500_4179760_-	hypothetical protein	NA	Q5G8Y2	Enterobacteria_phage	88.5	4.4e-213
AMG55200.1|4179826_4180753_-|head	phage head morphogenesis protein	head	Q5G8Y3	Enterobacteria_phage	92.9	2.4e-163
AMG55201.1|4180712_4182062_-	DUF1073 domain-containing protein	NA	Q5G8Y4	Enterobacteria_phage	77.7	7.3e-206
AMG55202.1|4182077_4183556_-	DNA-packaging protein	NA	G0ZND4	Cronobacter_phage	87.2	1.3e-256
AMG55203.1|4183542_4184022_-	DUF2280 domain-containing protein	NA	I6S1P9	Salmonella_phage	87.2	3.3e-60
AMG55204.1|4184054_4184693_-	hypothetical protein	NA	I6S676	Salmonella_phage	91.5	3.1e-114
AMG55205.1|4184696_4184903_-	hypothetical protein	NA	NA	NA	NA	NA
AMG55206.1|4184899_4185109_-	hypothetical protein	NA	NA	NA	NA	NA
AMG55207.1|4185264_4185783_-	Rha family transcriptional regulator	NA	Q38450	Enterobacteria_phage	99.4	6.5e-94
AMG55208.1|4185961_4186426_-|lysis	lysis protein	lysis	M9NYX9	Enterobacteria_phage	61.0	1.8e-42
AMG56095.2|4186422_4186917_-	lysozyme	NA	A0A2H4FND7	Salmonella_phage	80.2	7.8e-73
AMG55209.1|4186888_4187092_-	hypothetical protein	NA	O80287	Bacteriophage	77.6	1.9e-25
AMG55210.1|4187659_4188343_-	DUF1133 domain-containing protein	NA	Q8HA89	Salmonella_phage	42.2	2.3e-38
AMG55211.1|4188339_4188927_-	protein NinG	NA	A0A1P8DTE0	Proteus_phage	50.3	1.6e-48
AMG56096.1|4188919_4189588_-	serine/threonine protein phosphatase	NA	K7P6H8	Enterobacteria_phage	92.3	5.6e-122
AVC45311.1|4189584_4189755_-	hypothetical protein	NA	G8C7V4	Escherichia_phage	64.3	2.4e-13
AMG55212.1|4189747_4190185_-	recombination protein NinB	NA	Q5G8S5	Enterobacteria_phage	60.0	1.2e-43
AMG55213.1|4190551_4190809_-	DNA polymerase III subunit theta	NA	G8C7V1	Escherichia_phage	73.8	1.1e-25
AVC45312.1|4190818_4191019_-	hypothetical protein	NA	NA	NA	NA	NA
AMG55214.1|4191436_4191721_-	hypothetical protein	NA	C6ZR26	Salmonella_phage	78.0	2.1e-09
AMG56097.1|4192522_4193035_-	hypothetical protein	NA	G9L6B3	Escherichia_phage	76.6	1.3e-73
AVC45313.1|4193043_4193562_-	hypothetical protein	NA	K7PLZ3	Enterobacterial_phage	84.6	3.9e-22
AMG55215.1|4193558_4193969_-	hypothetical protein	NA	NA	NA	NA	NA
AMG55216.1|4193970_4194660_-	phage replication protein	NA	G8C7U6	Escherichia_phage	90.4	2.3e-118
AMG56098.1|4194656_4195589_-	replication protein	NA	A5VW95	Enterobacteria_phage	81.9	3.3e-56
AMG55217.1|4195642_4196338_-	phage regulatory protein/antirepressor Ant	NA	A0A1P8DTE1	Proteus_phage	58.4	2.0e-61
AMG55218.1|4196431_4196977_-	hypothetical protein	NA	G8C7U3	Escherichia_phage	97.2	6.2e-95
AMG55219.1|4197006_4197234_-	transcriptional regulator	NA	Q76H55	Enterobacteria_phage	70.4	2.0e-23
AMG56099.1|4197345_4198050_+	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	77.8	3.0e-102
AMG55220.1|4198098_4198479_+	hypothetical protein	NA	NA	NA	NA	NA
AMG56100.1|4198519_4198729_-	hypothetical protein	NA	G8C7T7	Escherichia_phage	73.4	4.0e-18
AMG56101.1|4199190_4199505_+	hypothetical protein	NA	NA	NA	NA	NA
AMG55221.1|4199636_4199846_+	hypothetical protein	NA	NA	NA	NA	NA
AMG55222.1|4200002_4200176_+	host cell division inhibitory peptide Kil	NA	NA	NA	NA	NA
AMG55223.1|4200205_4200454_+	hypothetical protein	NA	NA	NA	NA	NA
AMG55224.1|4200679_4201651_+	hypothetical protein	NA	A0A077KCC0	Edwardsiella_phage	75.4	1.9e-38
AMG55225.1|4201658_4201943_+	host nuclease inhibitor GamL	NA	G8C7T1	Escherichia_phage	94.7	1.7e-48
AMG55226.1|4201952_4202870_+	recombinase RecT	NA	M9NZA6	Enterobacteria_phage	93.8	6.8e-163
AMG55227.1|4202866_4203547_+	exonuclease	NA	M9NZE1	Enterobacteria_phage	92.9	6.0e-124
AVC45314.1|4204004_4205990_+	phage N-6-adenine-methyltransferase	NA	A0A1B0V7P0	Salmonella_phage	48.8	5.9e-119
AMG55228.1|4205986_4206205_+	hypothetical protein	NA	NA	NA	NA	NA
AMG55229.1|4206201_4206402_+	hypothetical protein	NA	NA	NA	NA	NA
AMG55230.1|4206398_4206812_+	DUF2591 domain-containing protein	NA	A0A1J0GUX1	Halomonas_phage	37.2	2.0e-05
AMG55231.1|4206903_4207125_+	hypothetical protein	NA	M1FQT7	Enterobacteria_phage	62.5	7.9e-17
AVC45315.1|4207320_4207635_+	hypothetical protein	NA	M1FPC8	Enterobacteria_phage	75.3	1.3e-28
AMG55232.1|4207552_4207894_+	hypothetical protein	NA	I3PV00	Vibrio_phage	53.8	8.8e-23
AMG55233.1|4207934_4208174_+	hypothetical protein	NA	A0A1B0V7L5	Salmonella_phage	60.8	1.2e-18
AMG55234.1|4208504_4209668_+|integrase	site-specific integrase	integrase	A0A0M4R586	Salmonella_phage	86.5	3.4e-199
AMG55235.1|4210003_4210870_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	36.3	1.1e-29
4209682:4209728	attR	AATGGCGCCCCCTACAGGATTCGAACCTGTGACCGACGGCTTAGAAG	NA	NA	NA	NA
>prophage 8
CP014070	Citrobacter amalonaticus strain FDAARGOS_165 chromosome, complete genome	5030678	4742624	4790672	5030678	tRNA,protease,plate	Staphylococcus_phage(50.0%)	46	NA	NA
AMG55668.1|4742624_4743383_+|protease	metalloprotease	protease	NA	NA	NA	NA
AVC45334.1|4743433_4743559_-	DNA metabolism protein	NA	NA	NA	NA	NA
AMG55669.1|4743587_4744508_-	agmatinase	NA	NA	NA	NA	NA
AMG55670.2|4744651_4746628_-	biosynthetic arginine decarboxylase	NA	NA	NA	NA	NA
AVC45376.1|4746636_4746768_-	virulence promoting factor	NA	NA	NA	NA	NA
AMG55671.1|4747422_4748577_+	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	63.4	5.3e-128
AMG55672.1|4748944_4750339_+	sugar porter family MFS transporter	NA	NA	NA	NA	NA
AMG55673.1|4750417_4750918_+|protease	SprT family zinc-dependent metalloprotease	protease	NA	NA	NA	NA
AMG55674.1|4751009_4751717_+	deoxyribonuclease I	NA	NA	NA	NA	NA
AMG55675.1|4751796_4752528_+	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
AMG55676.1|4752540_4753488_+	glutathione synthase	NA	NA	NA	NA	NA
AMG55677.2|4753662_4754226_+	YqgE/AlgH family protein	NA	NA	NA	NA	NA
AMG55678.1|4754225_4754642_+	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
AMG55679.1|4754655_4755636_-	type IV pili twitching motility protein PilT	NA	NA	NA	NA	NA
AMG55680.1|4755653_4756358_+	YggS family pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
AMG55681.1|4756376_4756943_+	YggT family protein	NA	NA	NA	NA	NA
AMG55682.1|4756939_4757230_+	YggU family protein	NA	NA	NA	NA	NA
AMG55683.1|4757237_4757831_+	XTP/dITP diphosphatase	NA	NA	NA	NA	NA
AMG55684.1|4757823_4758960_+	YggW family oxidoreductase	NA	NA	NA	NA	NA
AMG55685.1|4758991_4759999_-	DUF1202 domain-containing protein	NA	NA	NA	NA	NA
AMG55686.1|4760132_4761179_-	L-asparaginase 2	NA	NA	NA	NA	NA
AMG55687.1|4761368_4762088_-	DUF2884 domain-containing protein	NA	NA	NA	NA	NA
AMG55688.1|4762140_4762467_-	DUF469 domain-containing protein	NA	NA	NA	NA	NA
AMG55689.1|4762466_4763186_-|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
AVC45335.1|4763248_4763395_+	adenine glycosylase	NA	NA	NA	NA	NA
AMG55690.1|4763348_4764401_+	adenine DNA glycosylase	NA	NA	NA	NA	NA
AMG55691.1|4764428_4764704_+	Fe(2+)-trafficking protein	NA	NA	NA	NA	NA
AMG55692.1|4764777_4765860_+	membrane-bound lytic murein transglycosylase MltC	NA	NA	NA	NA	NA
AMG55693.1|4766071_4767328_+	nucleoside permease	NA	NA	NA	NA	NA
AMG55694.1|4767423_4769559_-	ornithine decarboxylase	NA	NA	NA	NA	NA
AMG55695.1|4769986_4770694_+	DUF554 domain-containing protein	NA	NA	NA	NA	NA
AMG55696.1|4771578_4772058_-	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
AMG55697.1|4772081_4773416_-	hypothetical protein	NA	NA	NA	NA	NA
AMG55698.1|4773417_4773942_-	DUF1240 domain-containing protein	NA	NA	NA	NA	NA
AMG55699.1|4773951_4774857_-	hypothetical protein	NA	NA	NA	NA	NA
AMG55700.1|4774999_4778461_-	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
AMG55701.1|4778536_4779964_-	type VI secretion system protein TssA	NA	NA	NA	NA	NA
AMG55702.1|4779967_4780711_-	type VI secretion system-associated protein TagO	NA	NA	NA	NA	NA
AMG55703.1|4780707_4783398_-	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	32.1	1.2e-85
AMG56117.1|4783408_4784149_-	hypothetical protein	NA	NA	NA	NA	NA
AMG55704.1|4784231_4785575_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
AMG55705.2|4785577_4786084_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
AMG55706.1|4786107_4787406_-	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
AMG55707.1|4787410_4788454_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
AMG55708.1|4788420_4790244_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
AMG55709.1|4790249_4790672_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
>prophage 9
CP014070	Citrobacter amalonaticus strain FDAARGOS_165 chromosome, complete genome	5030678	5017892	5025571	5030678		Pseudoalteromonas_phage(16.67%)	10	NA	NA
AMG55907.1|5017892_5018870_+	calcium/sodium antiporter	NA	A0A2D1GNI8	Pseudoalteromonas_phage	22.0	5.6e-06
AMG55908.1|5018884_5019871_+	arabinose-5-phosphate isomerase KdsD	NA	A0A2P0VNK5	Tetraselmis_virus	31.8	5.1e-39
AMG55909.1|5019891_5020458_+	3-deoxy-manno-octulosonate-8-phosphatase KdsC	NA	A0A140XBD6	Dickeya_phage	77.2	2.2e-55
AMG55910.1|5020454_5021030_+	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
AMG55911.1|5020998_5021553_+	lipopolysaccharide ABC transporter substrate-binding protein LptA	NA	NA	NA	NA	NA
AMG55912.1|5021559_5022285_+	lipopolysaccharide ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.4	1.9e-22
AMG55913.1|5022332_5023766_+	RNA polymerase sigma-54 factor	NA	NA	NA	NA	NA
AMG55914.1|5023788_5024076_+	ribosome hibernation promoting factor	NA	A0A0M7QCF2	Escherichia_phage	43.2	7.1e-10
AMG55915.1|5024191_5024683_+	PTS IIA-like nitrogen regulatory protein PtsN	NA	NA	NA	NA	NA
AMG55916.1|5024716_5025571_+	RNase adaptor protein RapZ	NA	A0A0R8VB27	Thermobifida_phage	28.4	1.4e-05
>prophage 1
CP014069	Citrobacter amalonaticus strain FDAARGOS_165 plasmid unnamed	53359	4792	47982	53359	coat,transposase	Escherichia_phage(33.33%)	57	NA	NA
AMG51604.1|4792_5497_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AMG51606.1|6029_8126_+|transposase	transposase	transposase	NA	NA	NA	NA
AMG51608.1|8855_9095_-	DNA polymerase V	NA	I6PD82	Cronobacter_phage	55.1	1.3e-20
AMG51609.1|9196_10417_+|transposase	ISL3 family transposase ISKox3	transposase	NA	NA	NA	NA
AMG51657.1|10505_11168_-	resolvase	NA	M9Q1K0	Clostridium_phage	29.1	9.7e-10
AMG51610.1|11548_12211_+	peptidyl-arginine deiminase	NA	E5FFJ3	Burkholderia_phage	25.2	2.6e-07
AMG51611.1|12310_12595_+	CopG family transcriptional regulator	NA	NA	NA	NA	NA
AVC45084.1|12599_12779_+	hypothetical protein	NA	NA	NA	NA	NA
AMG51612.1|12801_13113_+	hypothetical protein	NA	NA	NA	NA	NA
AMG51613.1|13148_13433_+	hypothetical protein	NA	NA	NA	NA	NA
AMG51658.1|13453_13807_-	DNA distortion polypeptide 3	NA	NA	NA	NA	NA
AMG51614.1|13994_14438_-	hypothetical protein	NA	NA	NA	NA	NA
AMG51615.2|14446_15439_-	replication initiation protein	NA	NA	NA	NA	NA
AMG51616.1|16236_16431_+	hypothetical protein	NA	NA	NA	NA	NA
AMG51617.1|16754_16970_+	hypothetical protein	NA	NA	NA	NA	NA
AMG51618.1|17114_17630_+	molecular chaperone DnaJ	NA	A0A2K9L588	Tupanvirus	39.8	3.3e-05
AMG51619.1|17688_17925_+	hypothetical protein	NA	NA	NA	NA	NA
AMG51620.1|17984_18536_+	hypothetical protein	NA	NA	NA	NA	NA
AMG51659.1|18601_18814_+	hypothetical protein	NA	NA	NA	NA	NA
AMG51621.1|18803_19046_+	hypothetical protein	NA	NA	NA	NA	NA
AMG51622.1|19139_19478_+	hypothetical protein	NA	NA	NA	NA	NA
AMG51623.1|19713_19971_+	hypothetical protein	NA	NA	NA	NA	NA
AMG51660.1|20310_20856_+	DNA distortion polypeptide 1	NA	NA	NA	NA	NA
AMG51624.1|20858_22019_+|coat	spore coat protein CotH	coat	NA	NA	NA	NA
AMG51625.1|22372_22882_+	transcription termination factor NusG	NA	NA	NA	NA	NA
AVC45085.1|22832_23060_+	hypothetical protein	NA	NA	NA	NA	NA
AMG51626.1|23105_23750_+	transglycosylase	NA	NA	NA	NA	NA
AMG51627.1|23733_24024_+	hypothetical protein	NA	NA	NA	NA	NA
AVC45086.1|24048_26802_+	conjugal transfer protein	NA	NA	NA	NA	NA
AVC45087.1|26812_27583_+	pilus assembly protein	NA	NA	NA	NA	NA
AMG51628.1|27592_27850_+	hypothetical protein	NA	NA	NA	NA	NA
AMG51629.1|27861_28917_+	pilus assembly protein	NA	NA	NA	NA	NA
AVC45088.1|29147_29876_+	pilus assembly protein	NA	NA	NA	NA	NA
AMG51630.1|29881_30811_+	conjugal transfer protein	NA	NA	NA	NA	NA
AMG51631.1|30807_32019_+	type IV secretion system protein VirB10	NA	NA	NA	NA	NA
AMG51632.1|32020_32218_+	DNA-binding protein	NA	NA	NA	NA	NA
AMG51633.1|32214_33249_+	P-type DNA transfer ATPase VirB11	NA	NA	NA	NA	NA
AMG51634.2|33245_35087_+	conjugal transfer protein TraG	NA	NA	NA	NA	NA
AMG51635.1|35083_35476_+	conjugal transfer protein	NA	NA	NA	NA	NA
AVC45089.1|35563_35878_+	hypothetical protein	NA	NA	NA	NA	NA
AMG51636.1|35963_36290_+	hypothetical protein	NA	NA	NA	NA	NA
AMG51637.1|36286_36757_+	micrococcal nuclease	NA	A0A0R6PHV6	Moraxella_phage	37.5	9.9e-17
AMG51638.1|37527_37914_+	hypothetical protein	NA	NA	NA	NA	NA
AMG51639.1|37916_38513_+	hypothetical protein	NA	NA	NA	NA	NA
AVC45090.1|38515_40843_+	type IA DNA topoisomerase	NA	A0A1X9I6W8	Streptococcus_phage	28.2	2.3e-37
AMG51640.2|40854_41310_+	DNA-binding protein	NA	NA	NA	NA	NA
AMG51641.1|41348_41999_-	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
AVC45091.1|41988_42255_+	hypothetical protein	NA	NA	NA	NA	NA
AMG51642.1|42271_42451_+	hypothetical protein	NA	NA	NA	NA	NA
AMG51643.1|42447_43269_+	sprT domain-containing protein	NA	NA	NA	NA	NA
AMG51644.1|43379_43634_+	hypothetical protein	NA	NA	NA	NA	NA
AMG51645.1|43651_43927_+	hypothetical protein	NA	NA	NA	NA	NA
AMG51646.2|43989_44202_+	hypothetical protein	NA	NA	NA	NA	NA
AMG51647.1|44159_44345_+	hypothetical protein	NA	NA	NA	NA	NA
AMG51648.1|46384_47089_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AVC45095.1|46979_47231_-	hypothetical protein	NA	NA	NA	NA	NA
AMG51649.1|47217_47982_+|transposase	IS6 family transposase IS6100	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
