The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP014017	Serratia liquefaciens strain FDAARGOS_125 chromosome, complete genome	5284740	524566	530309	5284740	transposase	Erwinia_phage(33.33%)	10	NA	NA
AMG98114.1|524566_525424_-	phage repressor protein CI	NA	Q6K1G0	Salmonella_virus	50.0	3.5e-76
AMG98115.1|525528_525921_+	hypothetical protein	NA	NA	NA	NA	NA
AMG98116.1|525952_526462_+	hypothetical protein	NA	F1BUS6	Erwinia_phage	58.0	5.3e-48
AMG98117.1|526641_527097_-	hypothetical protein	NA	NA	NA	NA	NA
AMG98118.1|527095_527317_+	hypothetical protein	NA	NA	NA	NA	NA
AMG98119.1|527318_527672_+	hypothetical protein	NA	E5G6L5	Salmonella_phage	54.5	3.6e-27
AMG98120.1|527738_528011_+	DUF2732 domain-containing protein	NA	NA	NA	NA	NA
AMG98121.1|528010_528229_+	hypothetical protein	NA	A0A218M4I6	Erwinia_phage	59.7	2.3e-16
AMG98122.1|528231_529056_+	adenine methylase	NA	E5G6L8	Salmonella_phage	45.7	6.1e-62
AMG98123.2|529188_530309_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	42.0	1.1e-50
>prophage 2
CP014017	Serratia liquefaciens strain FDAARGOS_125 chromosome, complete genome	5284740	536585	544064	5284740	transposase	Shigella_phage(28.57%)	12	NA	NA
AUW39928.1|536585_536903_-	DUF1364 domain-containing protein	NA	A0A2K8HR56	Pseudomonas_phage	48.8	3.3e-16
AMG98130.1|536903_537551_-	DUF1367 domain-containing protein	NA	A0A0U2RT94	Escherichia_phage	32.5	1.4e-16
AMH02124.1|537547_538210_-	phage N-6-adenine-methyltransferase	NA	Q8SBE9	Shigella_phage	67.1	8.3e-86
AUW39929.1|538335_539549_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	58.1	5.2e-102
AMG98133.1|539569_539818_-	hypothetical protein	NA	NA	NA	NA	NA
AMG98134.1|539814_540957_-	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	66.4	5.8e-103
AUW39930.1|540960_541824_-	hypothetical protein	NA	NA	NA	NA	NA
AUW39931.1|542191_542374_+	hypothetical protein	NA	NA	NA	NA	NA
AMG98137.1|542502_542685_-	hypothetical protein	NA	NA	NA	NA	NA
AMG98138.1|542681_543044_-	hypothetical protein	NA	NA	NA	NA	NA
AUW39932.1|543064_543307_-	hypothetical protein	NA	Q8W647	Enterobacteria_phage	66.1	1.5e-16
AMG98139.1|543422_544064_+	helix-turn-helix domain-containing protein	NA	Q8W648	Enterobacteria_phage	47.9	1.1e-47
>prophage 3
CP014017	Serratia liquefaciens strain FDAARGOS_125 chromosome, complete genome	5284740	550693	559926	5284740	transposase,integrase	uncultured_Caudovirales_phage(37.5%)	12	554196:554210	562821:562835
AMG98150.1|550693_551848_+	hypothetical protein	NA	M4MHC3	Vibrio_phage	35.7	9.9e-34
AMG98151.1|551849_552272_+	hypothetical protein	NA	NA	NA	NA	NA
AMG98152.1|552278_552515_+	hypothetical protein	NA	H2DE70	Erwinia_phage	56.2	1.4e-16
AMG98153.1|552511_552814_+	hypothetical protein	NA	NA	NA	NA	NA
AMG98154.1|552813_553038_+	hypothetical protein	NA	NA	NA	NA	NA
AMG98155.1|553312_553963_+	hypothetical protein	NA	NA	NA	NA	NA
554196:554210	attL	CAGGTGTGTTTATTT	NA	NA	NA	NA
AMG98156.1|554813_555236_+	translesion error-prone DNA polymerase V subunit UmuD	NA	F1C5A6	Cronobacter_phage	55.6	6.3e-31
AMG98157.1|555235_556504_+	translesion error-prone DNA polymerase V subunit UmuC	NA	I6RSM4	Salmonella_phage	71.5	2.6e-176
AUW39934.1|556506_556995_-	hypothetical protein	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	53.2	1.3e-40
AMG98159.2|557092_558266_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	72.5	2.9e-134
AUW39935.1|558596_558872_+	excisionase	NA	A0A2H4J5E1	uncultured_Caudovirales_phage	39.6	6.0e-14
AMG98161.1|558840_559926_+|integrase	integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	54.7	2.9e-104
562821:562835	attR	AAATAAACACACCTG	NA	NA	NA	NA
>prophage 4
CP014017	Serratia liquefaciens strain FDAARGOS_125 chromosome, complete genome	5284740	3867647	3909427	5284740	holin,terminase,plate	Escherichia_phage(50.0%)	61	NA	NA
AMH00906.1|3867647_3868877_+	DUF4102 domain-containing protein	NA	H6WRW7	Salmonella_phage	67.0	5.0e-177
AUW40049.1|3868854_3869130_-	excisionase	NA	H6WRW8	Salmonella_phage	52.4	2.3e-18
AMH00907.1|3869319_3869721_-	hypothetical protein	NA	NA	NA	NA	NA
AUW40050.1|3869717_3869927_-	hypothetical protein	NA	NA	NA	NA	NA
AUW40051.1|3869985_3870480_-	phage antirepressor Ant	NA	A0A0P0ZDY7	Stx2-converting_phage	64.9	2.8e-38
AMH00908.1|3870779_3871283_-	hypothetical protein	NA	NA	NA	NA	NA
AMH00909.1|3871286_3871490_-	hypothetical protein	NA	NA	NA	NA	NA
AUW40115.1|3871489_3871735_-	hypothetical protein	NA	R9W086	Serratia_phage	61.8	2.6e-16
AMH00911.1|3872180_3872480_-	hypothetical protein	NA	A5VWB2	Enterobacteria_phage	75.3	4.3e-42
AMH00912.1|3872741_3873266_-	hypothetical protein	NA	A0A0H4IQ56	Shigella_phage	68.5	2.1e-63
AMH00913.1|3873252_3873681_-	hypothetical protein	NA	NA	NA	NA	NA
AMH00914.1|3873677_3874373_-	hypothetical protein	NA	A0A076G7C3	Sinorhizobium_phage	35.1	1.8e-27
AMH00915.1|3874369_3874663_-	hypothetical protein	NA	NA	NA	NA	NA
AMH02273.1|3874664_3875513_-	chromosome partitioning protein ParB	NA	R9W077	Serratia_phage	44.7	1.1e-55
AMH00916.1|3875528_3875771_-	hypothetical protein	NA	A0A248SKY6	Klebsiella_phage	52.9	4.8e-07
AMH00917.1|3876747_3877032_+	hypothetical protein	NA	NA	NA	NA	NA
AMH00918.1|3877235_3877817_-	hypothetical protein	NA	A0A291AXG3	Shigella_phage	57.5	2.4e-65
AMH00919.2|3878206_3878659_-	helix-turn-helix domain-containing protein	NA	A0A2R2X2B0	Escherichia_phage	62.6	1.3e-21
AMH02274.1|3878763_3878970_+	Cro/Cl family transcriptional regulator	NA	A4KWW0	Enterobacteria_phage	55.2	2.5e-09
AMH00920.1|3878988_3879279_+	hypothetical protein	NA	I6PCV6	Cronobacter_phage	39.8	2.3e-08
AUW40052.1|3879293_3879533_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
AUW40053.1|3879529_3879892_+	HNH endonuclease	NA	A0A2I7RX05	Vibrio_phage	42.2	1.3e-13
AMH00922.1|3879888_3880941_+	transcriptional regulator	NA	H2DE83	Erwinia_phage	54.6	1.8e-29
AMH00923.1|3880937_3881408_+	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	39.8	6.6e-13
AMH00924.1|3881404_3882037_+	hypothetical protein	NA	H6WRY9	Salmonella_phage	44.4	2.7e-41
AUW40054.1|3882033_3882441_+	hypothetical protein	NA	NA	NA	NA	NA
AMH00925.1|3882437_3883268_+	antitermination protein	NA	K7PKS8	Enterobacteria_phage	49.1	1.2e-68
AUW40055.1|3883494_3883731_+	hypothetical protein	NA	NA	NA	NA	NA
AMH00926.1|3883699_3884029_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
AUW40056.1|3884560_3884938_+	hypothetical protein	NA	A0A1S5NRL1	Burkholderia_phage	45.2	1.2e-12
AMH00927.1|3884927_3885206_+|holin	phage holin family protein	holin	A4PE35	Ralstonia_virus	43.2	1.5e-09
AMH00928.1|3885211_3885598_+	peptidase M15	NA	A0A0A7NQ86	Enterobacteria_phage	76.4	1.9e-50
AMH00929.1|3885594_3885981_+	DUF2570 domain-containing protein	NA	NA	NA	NA	NA
AUW40057.1|3885919_3886138_+	hypothetical protein	NA	NA	NA	NA	NA
AMH02275.1|3886290_3886476_+	hypothetical protein	NA	K7PHC3	Enterobacterial_phage	71.7	2.3e-17
AUW40058.1|3886501_3887050_+	hypothetical protein	NA	B5WZS6	Pseudomonas_phage	50.3	1.0e-44
AMH00930.1|3887042_3887951_+	hypothetical protein	NA	NA	NA	NA	NA
AMH00931.1|3887947_3888568_+	methyltransferase domain-containing protein	NA	A0A0U4IIB3	Pseudomonas_phage	47.7	2.5e-44
AMH00932.1|3888585_3889617_+|terminase	terminase	terminase	A0A0U2RXW9	Escherichia_phage	49.4	8.2e-64
AMH00933.2|3889626_3890952_+|terminase	terminase	terminase	A0A0U2JTW9	Escherichia_phage	75.8	4.8e-202
AMH00934.1|3890967_3892398_+	DUF1073 domain-containing protein	NA	A0A0U2S5X9	Escherichia_phage	76.1	1.6e-211
AMH02276.2|3892351_3893188_+	hypothetical protein	NA	A0A0U2I1R8	Escherichia_phage	80.2	3.1e-130
AMH00935.2|3893243_3894509_+	NUDIX hydrolase	NA	A0A0U2QW61	Escherichia_phage	73.5	1.3e-132
AMH00936.1|3894501_3895119_+	hypothetical protein	NA	A0A0U2S600	Escherichia_phage	70.7	2.2e-80
AMH00937.1|3895129_3896158_+	hypothetical protein	NA	A0A0U2QQI2	Escherichia_phage	79.8	1.4e-156
AMH00938.1|3896224_3896695_+	hypothetical protein	NA	A0A0U2SAX6	Escherichia_phage	71.2	5.6e-60
AMH00939.1|3896694_3897150_+	hypothetical protein	NA	A0A0U2S646	Escherichia_phage	63.8	4.0e-47
AMH00940.1|3897146_3897578_+	hypothetical protein	NA	A0A0U2RTA8	Escherichia_phage	61.6	2.7e-45
AMH00941.1|3897564_3898509_+	hypothetical protein	NA	A0A0U2SH76	Escherichia_phage	65.3	8.7e-113
AMH00942.1|3898508_3899834_+	hypothetical protein	NA	A0A0U2KD19	Escherichia_phage	73.0	6.8e-180
AMH00943.1|3899858_3900287_+	hypothetical protein	NA	A0A0U2S616	Escherichia_phage	70.4	1.6e-53
AMH00944.1|3900286_3900871_+	hypothetical protein	NA	A0A0U2S634	Escherichia_phage	66.8	9.0e-68
AMH00945.1|3900965_3902915_+	lytic transglycosylase	NA	A0A0U2QV45	Escherichia_phage	45.8	1.1e-146
AMH00946.1|3902918_3903572_+	hypothetical protein	NA	A0A0U2JGI7	Escherichia_phage	71.6	3.7e-86
AMH00947.1|3903571_3903841_+	hypothetical protein	NA	A0A0U2JGJ3	Escherichia_phage	64.4	2.1e-27
AMH00948.1|3903841_3904846_+	hypothetical protein	NA	A0A0U2QL72	Escherichia_phage	51.7	6.5e-90
AMH00949.1|3904846_3905548_+|plate	phage baseplate protein	plate	A0A0U2JTX5	Escherichia_phage	69.7	1.1e-85
AMH00950.1|3905547_3905895_+	hypothetical protein	NA	A0A0U2I1S2	Escherichia_phage	73.9	7.5e-46
AMH00951.1|3905916_3906618_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AMH00952.1|3906935_3907766_+	hypothetical protein	NA	A0A2H4FRZ6	Salmonella_phage	67.3	6.5e-80
AUW40059.1|3908164_3909427_+	hypothetical protein	NA	A0A0U2RJZ0	Escherichia_phage	60.4	2.3e-137
>prophage 5
CP014017	Serratia liquefaciens strain FDAARGOS_125 chromosome, complete genome	5284740	4153363	4163298	5284740		Planktothrix_phage(33.33%)	8	NA	NA
AMH01155.1|4153363_4154452_+	sulfate/thiosulfate ABC transporter ATP-binding protein CysA	NA	G9BWD6	Planktothrix_phage	40.7	9.3e-34
AMH02290.1|4154536_4155418_+	cysteine synthase CysM	NA	A0A1X9I5F1	Streptococcus_phage	40.3	1.1e-53
AMH01156.1|4155421_4157374_-	MacB family efflux pump subunit	NA	G9BWD6	Planktothrix_phage	41.6	3.5e-39
AMH01157.1|4157376_4158570_-	efflux RND transporter periplasmic adaptor subunit	NA	A0A140XAI1	Dickeya_phage	70.0	3.4e-29
AMH01158.1|4158744_4159425_+	DNA-binding response regulator	NA	NA	NA	NA	NA
AMH02291.1|4159430_4160747_+	HAMP domain-containing protein	NA	W8CYF6	Bacillus_phage	25.6	3.2e-20
AMH01159.1|4161011_4161521_-	PTS glucose transporter subunit IIA	NA	NA	NA	NA	NA
AMH01160.1|4161570_4163298_-	phosphoenolpyruvate-protein phosphotransferase PtsI	NA	A0A1V0SGR7	Hokovirus	32.9	1.1e-17
>prophage 6
CP014017	Serratia liquefaciens strain FDAARGOS_125 chromosome, complete genome	5284740	4981256	5020015	5284740	lysis,holin,protease,coat,portal,terminase,tail,integrase	Salmonella_phage(26.47%)	45	4983370:4983392	5022535:5022557
AMH01833.1|4981256_4983146_-	hypothetical protein	NA	A0A289Z7P2	Serratia_phage	33.0	2.4e-93
4983370:4983392	attL	CTAGAACACCTGTTTGAACGGTT	NA	NA	NA	NA
AMH01834.1|4983571_4984753_+|integrase	site-specific integrase	integrase	K7PGY1	Enterobacteria_phage	57.5	3.0e-139
AMH01835.1|4984754_4984958_-	excisionase	NA	NA	NA	NA	NA
AMH01836.1|4984957_4986349_-	ATP-dependent helicase	NA	Q3LZN8	Bacteriophage	75.4	2.9e-213
AMH01837.1|4986485_4986701_+	hypothetical protein	NA	NA	NA	NA	NA
AMH01838.1|4986827_4987097_-	VRR-NUC domain-containing protein	NA	Q3LZN4	Bacteriophage	64.0	6.0e-27
AMH01839.1|4987160_4987421_-	hypothetical protein	NA	J9Q7T5	Salmonella_phage	60.0	2.0e-19
AMH01840.1|4987478_4988135_-	hypothetical protein	NA	NA	NA	NA	NA
AMH01841.1|4988131_4988389_-	hypothetical protein	NA	NA	NA	NA	NA
AMH01842.1|4988390_4988816_-	hypothetical protein	NA	NA	NA	NA	NA
AMH01843.1|4988821_4990918_-	DNA polymerase I	NA	Q775A3	Bordetella_phage	65.9	1.2e-268
AMH01844.1|4990940_4991444_+	hypothetical protein	NA	NA	NA	NA	NA
AMH01845.1|4991507_4992377_-|protease	serine protease	protease	K4F991	Cronobacter_phage	80.8	3.1e-104
AMH01846.1|4992373_4992574_-	hypothetical protein	NA	NA	NA	NA	NA
AMH01847.1|4992616_4993165_-	DUF2815 domain-containing protein	NA	Q775A5	Bordetella_phage	67.6	2.5e-67
AMH01848.1|4993177_4994491_-	DUF2800 domain-containing protein	NA	B6SCX9	Bacteriophage	56.4	5.6e-134
AMH01849.1|4994494_4995418_-	hypothetical protein	NA	NA	NA	NA	NA
AMH01850.1|4995649_4996018_-	DUF2528 domain-containing protein	NA	M1FPD2	Enterobacteria_phage	67.2	2.4e-42
AMH01851.1|4996098_4996305_-	hypothetical protein	NA	NA	NA	NA	NA
AMH01852.1|4996315_4996498_-	hypothetical protein	NA	NA	NA	NA	NA
AMH01853.1|4996511_4996721_-	hypothetical protein	NA	NA	NA	NA	NA
AMH01854.1|4997607_4998273_-	phage repressor protein	NA	B6SCU0	Bacteriophage	44.0	2.3e-51
AMH01855.1|4998402_4998612_+	helix-turn-helix domain-containing protein	NA	K7RWG7	Bacteriophage	60.4	4.9e-08
AMH01856.1|4998615_5000784_+	replication protein	NA	B6SD37	Bacteriophage	68.4	4.7e-162
AMH01857.1|5001079_5001502_+	antitermination protein Q	NA	B6SCZ7	Bacteriophage	41.7	3.3e-19
AMH01858.2|5001979_5002324_+|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	52.3	1.8e-28
AMH01859.1|5002329_5002941_+	endolysin	NA	A0A192Y6G4	Salmonella_phage	56.9	1.4e-58
AMH01860.1|5002937_5003399_+|lysis	lysis protein	lysis	A0A2H4JHL8	uncultured_Caudovirales_phage	44.2	2.6e-17
AMH01861.1|5003395_5003761_+	hypothetical protein	NA	K7PH35	Enterobacteria_phage	66.4	2.2e-35
AMH01862.1|5003890_5004133_+	DUF2560 domain-containing protein	NA	A0A192Y6S9	Salmonella_phage	67.1	1.7e-17
AMH01863.1|5004141_5004675_+	hypothetical protein	NA	A0A192Y6U9	Salmonella_phage	27.0	5.6e-08
AMH01864.1|5004706_5005267_+|terminase	terminase small subunit	terminase	A0A1W6JNT5	Morganella_phage	65.4	5.8e-56
AMH01865.1|5005247_5006753_+|terminase	terminase	terminase	E7C9T5	Salmonella_phage	82.9	7.6e-260
AMH02334.1|5006756_5008934_+|portal	portal protein	portal	A0A2D1GLJ6	Escherichia_phage	78.8	1.5e-309
AMH01866.1|5008948_5009860_+	scaffolding protein	NA	A0A0M3ULI9	Salmonella_phage	71.0	3.4e-114
AUW40097.1|5009859_5011149_+|coat	coat protein	coat	A0A2D1GLV2	Escherichia_phage	74.5	5.6e-187
AMH01868.1|5011510_5012014_+	recombinase RmuC	NA	A0A2D1GLR5	Escherichia_phage	63.6	1.8e-48
AMH01869.2|5011991_5013413_+	hypothetical protein	NA	Q9AYZ4	Salmonella_phage	70.2	1.1e-199
AMH01870.1|5013409_5014240_+|tail	phage tail protein	tail	A0A192Y6T9	Salmonella_phage	61.2	4.0e-37
AMH01871.1|5014239_5014701_+	DUF2824 domain-containing protein	NA	Q2A0B3	Sodalis_phage	74.0	2.1e-64
AMH01872.1|5014694_5015345_+	DNA transfer protein	NA	G5DA80	Enterobacteria_phage	64.1	1.8e-40
AMH01873.1|5015354_5016698_+	DNA injection protein	NA	Q716G3	Shigella_phage	48.1	9.0e-63
AMH01874.1|5016697_5019385_+	lytic transglycosylase domain-containing protein	NA	A0A2D1GLK8	Escherichia_phage	33.0	2.4e-99
AMH01875.1|5019457_5019745_+	hypothetical protein	NA	Q76H12	Enterobacteria_phage	53.6	1.5e-20
AMH01876.1|5019766_5020015_-	Arc family DNA-binding protein	NA	E7C9U8	Salmonella_phage	51.9	2.0e-16
5022535:5022557	attR	CTAGAACACCTGTTTGAACGGTT	NA	NA	NA	NA
