The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP017802	Raoultella ornithinolytica strain MG isolate MG01 chromosome, complete genome	5499520	766416	775029	5499520		Enterobacteria_phage(83.33%)	9	NA	NA
APB04095.1|766416_767676_+	DUF4102 domain-containing protein	NA	B7SYF8	Stenotrophomonas_phage	41.3	1.1e-73
APB04096.1|767795_768524_-	type II toxin-antitoxin system death-on-curing family toxin	NA	NA	NA	NA	NA
APB04097.1|769188_769755_-	Polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	62.7	1.8e-57
APB04098.1|769772_770018_-	hypothetical protein	NA	Q7M294	Enterobacteria_phage	59.3	5.0e-20
APB04099.1|770014_770752_-	glycoprotein 3	NA	Q7M2A2	Enterobacteria_phage	59.4	2.9e-71
APB04101.1|771574_772132_+	host cell division inhibitor Icd-like protein	NA	Q7M2A7	Enterobacteria_phage	65.0	3.6e-34
APB04102.1|772128_772356_+	hypothetical protein	NA	NA	NA	NA	NA
APB04103.1|772352_772673_+	hypothetical protein	NA	NA	NA	NA	NA
APB04104.1|772686_775029_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	83.6	0.0e+00
>prophage 2
CP017802	Raoultella ornithinolytica strain MG isolate MG01 chromosome, complete genome	5499520	2278414	2375450	5499520	transposase,terminase,tRNA,head,capsid,holin,tail,integrase,portal	Klebsiella_phage(46.67%)	100	2269577:2269595	2349439:2349457
2269577:2269595	attL	GGGCTGGCGATGGTCAGGC	NA	NA	NA	NA
APB05381.1|2278414_2278918_+|transposase	transposase	transposase	NA	NA	NA	NA
APB05382.1|2279297_2280419_-	cupin domain-containing protein	NA	NA	NA	NA	NA
APB05383.1|2280543_2282010_-	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
APB05384.1|2282006_2282681_-	two-component system response regulator PhoP	NA	NA	NA	NA	NA
APB05385.1|2283373_2284744_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	45.1	1.2e-107
APB05386.1|2284747_2285389_-	lysogenization regulator HflD	NA	NA	NA	NA	NA
APB05387.2|2285448_2286600_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
APB05388.1|2286611_2287070_-	NUDIX hydrolase	NA	NA	NA	NA	NA
APB05389.1|2287090_2287741_-	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
APB05390.1|2287974_2289225_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	92.6	1.1e-19
APB05391.1|2289342_2290470_-|integrase	integrase	integrase	O21925	Phage_21	58.4	4.4e-119
APB05392.1|2290450_2290696_-	excisionase	NA	NA	NA	NA	NA
APB05393.1|2290748_2292887_-	exonuclease	NA	S4TNL0	Salmonella_phage	43.0	5.0e-100
APB05394.1|2293028_2293373_-	transcriptional regulator	NA	NA	NA	NA	NA
APB05395.1|2293415_2293610_-	DUF1482 family protein	NA	NA	NA	NA	NA
AZB50773.1|2293619_2293913_-	hypothetical protein	NA	NA	NA	NA	NA
AZB50774.1|2294002_2294317_+	hypothetical protein	NA	NA	NA	NA	NA
APB05397.1|2294663_2295053_-	helix-turn-helix domain-containing protein	NA	A0A0M4R5D1	Salmonella_phage	60.2	6.7e-35
AZB50775.1|2295154_2295370_+	Rha family transcriptional regulator	NA	A0A0M4QX15	Salmonella_phage	57.5	2.0e-17
APB05398.1|2295372_2295927_+	hypothetical protein	NA	NA	NA	NA	NA
APB05399.1|2295978_2296962_+	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	54.0	9.9e-43
APB05400.1|2296954_2297419_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	68.9	6.5e-61
APB05401.1|2297432_2297873_+	hypothetical protein	NA	NA	NA	NA	NA
APB05402.1|2298536_2300036_+	SAVED domain-containing protein	NA	NA	NA	NA	NA
APB05403.1|2300041_2301187_+	hypothetical protein	NA	NA	NA	NA	NA
APB05404.2|2301183_2302986_+	thiamine biosynthesis protein ThiF	NA	NA	NA	NA	NA
AZB50776.1|2302855_2303470_+	hypothetical protein	NA	NA	NA	NA	NA
APB05405.1|2304094_2304328_+	DinI family protein	NA	K7PM44	Enterobacteria_phage	71.1	3.7e-25
AZB50777.1|2304339_2304630_+	hypothetical protein	NA	H6WRY6	Salmonella_phage	56.9	8.0e-17
APB05406.1|2304670_2305063_+	DNA-binding protein	NA	K7PHB4	Enterobacterial_phage	36.6	8.0e-12
APB05407.1|2305059_2305263_+	hypothetical protein	NA	NA	NA	NA	NA
APB05408.1|2305262_2306294_+	DUF968 domain-containing protein	NA	S5MW46	Escherichia_phage	49.9	7.3e-97
APB05409.1|2306306_2306651_+	antitermination protein	NA	A0A0P0ZCW0	Stx2-converting_phage	85.8	1.8e-55
APB05410.1|2306645_2307872_-	hypothetical protein	NA	NA	NA	NA	NA
APB08428.2|2307861_2309007_-	nucleoid-associated protein	NA	NA	NA	NA	NA
APB05411.1|2309371_2309548_+	type II toxin-antitoxin system HicA family toxin	NA	A0A0R6PD93	Moraxella_phage	56.4	1.4e-08
APB05412.1|2309595_2310003_+	type II toxin-antitoxin system HicB family antitoxin	NA	F1C593	Cronobacter_phage	78.8	2.8e-52
APB05413.1|2310158_2310395_+|holin	holin	holin	A5LH82	Enterobacteria_phage	82.6	4.0e-27
APB05414.1|2310372_2310903_+	lysozyme	NA	G9L6J6	Escherichia_phage	83.8	2.8e-84
APB08429.1|2310935_2311412_+	DUF2514 domain-containing protein	NA	NA	NA	NA	NA
AZB50778.1|2311638_2312001_+	HNH endonuclease	NA	Q6UAS2	Klebsiella_phage	82.5	9.8e-57
APB05415.1|2311952_2312270_+	hypothetical protein	NA	NA	NA	NA	NA
APB05416.2|2312266_2312698_+	hypothetical protein	NA	Q6UAS0	Klebsiella_phage	60.8	3.7e-42
APB05417.1|2312947_2313382_+|terminase	phage terminase small subunit P27 family	terminase	A0A1J0GV10	Halomonas_phage	61.9	9.4e-30
APB05418.1|2313381_2315103_+|terminase	terminase large subunit	terminase	Q7Y413	Yersinia_phage	57.2	7.2e-190
AZB50779.1|2315096_2315276_+	hypothetical protein	NA	Q6UAX9	Klebsiella_phage	57.9	6.8e-11
APB05419.1|2315275_2316535_+|portal	phage portal protein	portal	Q6UAX8	Klebsiella_phage	89.8	1.8e-222
APB05420.1|2316571_2317492_+	S49 family peptidase	NA	Q6UAX7	Klebsiella_phage	88.2	9.6e-149
APB05421.1|2317569_2318856_+|capsid	phage major capsid protein	capsid	Q6UAX6	Klebsiella_phage	89.0	1.3e-215
APB05422.1|2318914_2319175_+	hypothetical protein	NA	Q6UAX5	Klebsiella_phage	60.5	1.6e-21
APB05423.1|2319155_2319473_+|head,tail	phage gp6-like head-tail connector protein	head,tail	Q6UAX4	Klebsiella_phage	89.8	1.5e-45
APB05424.1|2319469_2319808_+|head,tail	head-tail adaptor protein	head,tail	Q6UAX3	Klebsiella_phage	91.1	5.6e-54
APB05425.1|2319788_2320178_+	hypothetical protein	NA	Q6UAX2	Klebsiella_phage	84.5	4.0e-56
APB05426.1|2320174_2320576_+	hypothetical protein	NA	Q6UAX1	Klebsiella_phage	93.2	1.1e-61
APB05427.1|2320607_2321069_+|tail	phage tail protein	tail	Q6UAX0	Klebsiella_phage	83.7	7.8e-67
APB05428.1|2321126_2321492_+|tail	phage tail protein	tail	Q6UAW8	Klebsiella_phage	89.3	1.6e-51
AZB50852.1|2321512_2321725_+	hypothetical protein	NA	Q6UAW9	Klebsiella_phage	88.9	3.7e-32
APB08430.1|2321724_2325060_+|tail	phage tail tape measure protein	tail	Q6UAW7	Klebsiella_phage	87.3	0.0e+00
APB05429.1|2325059_2325398_+|tail	phage tail protein	tail	Q6UAW6	Klebsiella_phage	89.3	8.3e-58
APB05430.1|2325394_2326150_+|tail	phage minor tail protein L	tail	Q6UAW5	Klebsiella_phage	81.3	1.2e-125
APB05431.1|2326151_2326862_+	peptidase P60	NA	Q6UAW4	Klebsiella_phage	89.4	4.2e-136
AZB50780.1|2326893_2327244_+	hypothetical protein	NA	NA	NA	NA	NA
APB05432.1|2327259_2327871_+|tail	tail assembly protein	tail	Q6UAW2	Klebsiella_phage	72.5	5.3e-71
APB05433.1|2327933_2340638_+	DUF1983 domain-containing protein	NA	Q6UAW1	Klebsiella_phage	46.8	0.0e+00
APB05434.1|2340706_2342131_+|tail	tail fiber domain-containing protein	tail	A0A0P0IDN1	Klebsiella_phage	49.5	3.3e-95
APB05435.1|2342553_2343612_+	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	30.6	1.4e-13
APB05436.1|2343967_2344660_+	EAL domain-containing protein	NA	NA	NA	NA	NA
AZB50781.1|2344665_2344989_+	hypothetical protein	NA	NA	NA	NA	NA
AZB50782.1|2345309_2345462_+	isocitrate dehydrogenase	NA	Q77Z09	Phage_21	90.0	1.9e-17
APB05438.2|2345838_2346639_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
APB05439.1|2346884_2348111_-	MFS transporter	NA	NA	NA	NA	NA
APB05440.1|2349404_2350043_+	LysE family translocator	NA	NA	NA	NA	NA
2349439:2349457	attR	GCCTGACCATCGCCAGCCC	NA	NA	NA	NA
APB05441.1|2350033_2350231_-	hypothetical protein	NA	NA	NA	NA	NA
APB05442.1|2350554_2352099_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	38.1	3.7e-20
APB05443.1|2352504_2353044_+	DUF2058 domain-containing protein	NA	NA	NA	NA	NA
APB05444.1|2353149_2353626_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
APB05445.1|2353798_2354830_-	methionine synthase	NA	NA	NA	NA	NA
APB05446.1|2354857_2355841_-	DUF1852 domain-containing protein	NA	NA	NA	NA	NA
APB05447.1|2356236_2356713_-	cold shock domain-containing protein	NA	NA	NA	NA	NA
APB05448.1|2356899_2357145_-	DUF2543 family protein	NA	NA	NA	NA	NA
APB05449.1|2357384_2358002_+	histidine phosphatase family protein	NA	NA	NA	NA	NA
APB05450.1|2358028_2359813_-	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	35.5	2.0e-17
APB05451.1|2359895_2361083_-	HD domain-containing protein	NA	NA	NA	NA	NA
APB05452.1|2361585_2363916_-	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
APB05453.1|2364013_2364961_-	fec operon regulator FecR	NA	NA	NA	NA	NA
APB05454.1|2364957_2365476_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
APB05455.1|2366266_2367181_+	kdo(2)-lipid IV(A) palmitoleoyltransferase	NA	A0A1W6JP29	Morganella_phage	50.8	1.7e-73
APB05456.1|2367272_2367911_+	leucine efflux protein LeuE	NA	NA	NA	NA	NA
APB05457.1|2368037_2368301_+	DUF2534 family protein	NA	NA	NA	NA	NA
AZB50783.1|2368343_2368466_-	hypothetical protein	NA	NA	NA	NA	NA
AZB50784.1|2368681_2368783_-	hypothetical protein	NA	NA	NA	NA	NA
APB05458.1|2368898_2369912_-	diguanylate cyclase	NA	NA	NA	NA	NA
APB05459.1|2370211_2370463_+	DUF333 domain-containing protein	NA	NA	NA	NA	NA
APB05460.1|2370452_2370818_-	DUF488 domain-containing protein	NA	NA	NA	NA	NA
APB05461.1|2370804_2371314_-	DUF523 domain-containing protein	NA	NA	NA	NA	NA
APB05462.1|2371505_2372198_+	hypothetical protein	NA	NA	NA	NA	NA
APB05463.1|2372309_2373494_-	MFS transporter	NA	NA	NA	NA	NA
APB05464.1|2373594_2374386_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
APB05465.1|2374369_2374816_-	DUF441 domain-containing protein	NA	NA	NA	NA	NA
APB05466.1|2374949_2375450_-|tRNA	YbaK/prolyl-tRNA synthetase associated domain-containing protein	tRNA	NA	NA	NA	NA
>prophage 3
CP017802	Raoultella ornithinolytica strain MG isolate MG01 chromosome, complete genome	5499520	3036516	3105496	5499520	head,lysis	Enterobacteria_phage(21.21%)	87	NA	NA
APB06035.1|3036516_3039624_+	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	59.5	0.0e+00
APB06036.1|3039809_3041075_+	MFS transporter	NA	NA	NA	NA	NA
APB06037.1|3041117_3042218_-	chromosome segregation protein SMC	NA	A0A077SLJ9	Escherichia_phage	81.9	8.7e-173
APB08467.1|3042319_3042580_-	hypothetical protein	NA	A0A077SK33	Escherichia_phage	83.1	7.4e-30
APB06038.1|3042875_3043751_+	class A broad-spectrum beta-lactamase ORN-1	NA	Q1MVP3	Enterobacteria_phage	71.1	4.1e-109
APB06039.1|3043860_3044091_-	hypothetical protein	NA	NA	NA	NA	NA
APB06040.1|3044476_3044719_+	DinI family protein	NA	Q6UAW0	Klebsiella_phage	79.7	6.2e-31
APB06041.1|3044876_3046922_-	peptidyl-dipeptidase Dcp	NA	A0A1V0SIU1	Klosneuvirus	21.0	1.1e-16
APB06042.1|3047670_3048420_+	bifunctional NADP-dependent 3-hydroxy acid dehydrogenase/3-hydroxypropionate dehydrogenase YdfG	NA	NA	NA	NA	NA
APB06043.1|3048512_3049199_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
APB06044.1|3049256_3049688_-	universal stress protein UspG	NA	A0A1W6JNV4	Morganella_phage	39.3	3.9e-20
APB06045.1|3050004_3051468_-	fructuronate reductase	NA	H8ZJP8	Ostreococcus_tauri_virus	30.5	1.7e-43
APB06046.1|3051685_3052978_-	MFS transporter	NA	NA	NA	NA	NA
APB06047.2|3053328_3053691_-	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	61.5	5.1e-29
APB06048.1|3053647_3053887_-	DNA polymerase V	NA	I6PD82	Cronobacter_phage	53.2	4.9e-20
AZB50796.1|3054288_3054711_-	hypothetical protein	NA	K7P834	Enterobacteria_phage	44.5	7.3e-27
APB06049.1|3054788_3055337_-	recombinase family protein	NA	A0A286S1P7	Klebsiella_phage	91.2	1.2e-85
APB06050.1|3055412_3057116_+	hypothetical protein	NA	A0A1P7WFW6	Pectobacterium_phage	35.5	1.1e-81
APB06051.1|3057125_3057380_+	hypothetical protein	NA	NA	NA	NA	NA
APB06054.1|3060103_3062587_-	MoaD/ThiS family protein	NA	F1C5A7	Cronobacter_phage	45.3	5.2e-197
APB06055.1|3062573_3062969_-	hypothetical protein	NA	F1C5F2	Cronobacter_phage	57.1	2.7e-39
APB06056.1|3062965_3063436_-	hypothetical protein	NA	F1C5F1	Cronobacter_phage	38.6	4.7e-27
APB06057.2|3063435_3063855_-	hypothetical protein	NA	F1C5F0	Cronobacter_phage	56.8	1.7e-36
APB06058.1|3064028_3064316_-	hypothetical protein	NA	NA	NA	NA	NA
APB06059.1|3064355_3067766_-	hypothetical protein	NA	Q5G8W8	Enterobacteria_phage	75.5	0.0e+00
APB06060.1|3067837_3068344_-	hypothetical protein	NA	NA	NA	NA	NA
APB08468.1|3068449_3068830_-	hypothetical protein	NA	NA	NA	NA	NA
APB06061.1|3068910_3069606_-	hypothetical protein	NA	G0ZNE7	Cronobacter_phage	54.2	3.2e-64
APB06062.1|3069672_3070437_-	hypothetical protein	NA	G0ZNE6	Cronobacter_phage	42.6	2.8e-37
APB06063.1|3070495_3070717_-	hypothetical protein	NA	NA	NA	NA	NA
APB06064.1|3070719_3071103_-	hypothetical protein	NA	NA	NA	NA	NA
APB06065.1|3071099_3071468_-	HK97 gp10 family phage protein	NA	F1C5E3	Cronobacter_phage	79.5	2.1e-46
APB06066.1|3071470_3071833_-	hypothetical protein	NA	G0ZNE2	Cronobacter_phage	51.7	3.6e-27
APB06067.1|3071843_3072161_-	hypothetical protein	NA	G8GWD9	Rhodobacter_phage	62.0	7.3e-32
APB06068.1|3072153_3072327_-	50S ribosomal protein L13	NA	Q5G8X7	Enterobacteria_phage	52.6	3.5e-12
APB06069.1|3072326_3072728_-	hypothetical protein	NA	G0ZNE1	Cronobacter_phage	74.4	2.1e-52
APB06070.1|3072788_3072971_-	glycoprotein	NA	Q5G8X9	Enterobacteria_phage	56.5	1.4e-11
APB06071.1|3072980_3074057_-	hypothetical protein	NA	A0A1V0E5P6	Salmonella_phage	94.7	5.0e-197
APB06072.1|3074074_3074524_-	hypothetical protein	NA	A0A1V0E5Q8	Salmonella_phage	89.0	5.8e-67
APB06073.1|3074536_3075802_-	hypothetical protein	NA	Q5G8Y2	Enterobacteria_phage	86.7	5.4e-211
APB06074.1|3075805_3076732_-|head	phage head morphogenesis protein	head	Q5G8Y3	Enterobacteria_phage	87.6	2.9e-153
APB06075.1|3076691_3078041_-	DUF1073 domain-containing protein	NA	A0A1V0E5Q5	Salmonella_phage	82.4	4.3e-222
APB06076.1|3078056_3079535_-	DNA-packaging protein	NA	G0ZND4	Cronobacter_phage	85.4	1.8e-253
APB06077.1|3079521_3080001_-	DUF2280 domain-containing protein	NA	H9C190	Pectobacterium_phage	70.7	8.5e-56
APB06078.1|3080031_3080670_-	hypothetical protein	NA	I6S676	Salmonella_phage	75.0	2.1e-94
AZB50797.1|3081281_3081533_-	Rz1 lytic protein	NA	U5P461	Shigella_phage	72.0	2.9e-23
APB06080.2|3081417_3081741_-	DUF2570 domain-containing protein	NA	U5P0U9	Shigella_phage	57.3	2.0e-21
APB06081.1|3081797_3082337_-	lysozyme	NA	K7PM52	Enterobacteria_phage	86.4	7.2e-88
APB06082.1|3082339_3082588_-|lysis	lysis protein	lysis	NA	NA	NA	NA
APB06083.1|3083326_3084136_-	antitermination protein	NA	M9NZB0	Enterobacteria_phage	77.0	7.2e-124
AZB50798.1|3084132_3084273_-	YlcG family protein	NA	NA	NA	NA	NA
APB06084.1|3084269_3084908_-	hypothetical protein	NA	H6WRY9	Salmonella_phage	72.6	3.6e-78
AZB50799.1|3084900_3085074_-	hypothetical protein	NA	G8C7V4	Escherichia_phage	70.2	2.4e-13
APB06085.1|3085073_3085529_-	hypothetical protein	NA	K7P7B8	Enterobacteria_phage	69.5	1.2e-56
APB06086.1|3085729_3085987_-	DNA polymerase III subunit theta	NA	G8C7V1	Escherichia_phage	75.3	2.2e-26
APB06087.1|3086180_3086528_+	hypothetical protein	NA	NA	NA	NA	NA
APB06088.1|3086540_3086918_+	hypothetical protein	NA	NA	NA	NA	NA
APB06089.1|3086914_3087307_+	hypothetical protein	NA	NA	NA	NA	NA
APB06090.1|3087340_3087643_-	hypothetical protein	NA	A0A220NQY7	Salmonella_phage	44.6	1.6e-07
APB08469.1|3087635_3088403_-	DUF550 domain-containing protein	NA	A0A0M4RTV1	Salmonella_phage	47.6	1.2e-48
APB06091.1|3088976_3089729_-	hypothetical protein	NA	M1FN76	Enterobacteria_phage	84.8	2.2e-127
APB06092.1|3089725_3090277_-	hypothetical protein	NA	A0A2H4N7C3	Pectobacterium_phage	55.2	2.2e-39
APB06093.1|3090269_3090533_-	DUF4752 family protein	NA	T1S9K2	Salmonella_phage	67.1	1.5e-25
APB06095.1|3091017_3091320_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
APB06096.1|3091319_3092750_-	helicase DnaB	NA	Q9MCT4	Escherichia_phage	66.9	7.6e-185
AZB50800.1|3092746_3093004_-	hypothetical protein	NA	A0A1R3Y5R9	Salmonella_virus	55.4	9.5e-22
AZB50801.1|3093003_3093561_-	replication protein	NA	A0A0N7KZ97	Stx2-converting_phage	54.5	2.3e-44
APB06097.1|3093786_3094107_-	hypothetical protein	NA	A0A0M4RU01	Salmonella_phage	68.9	3.8e-36
APB06098.1|3094147_3094375_-	Cro/Cl family transcriptional regulator	NA	A0A2I6PIE5	Escherichia_phage	59.2	2.4e-16
APB06099.1|3094410_3095166_+	helix-turn-helix domain-containing protein	NA	E7C9R0	Salmonella_phage	63.7	8.9e-76
AZB50802.1|3095188_3095308_+	hypothetical protein	NA	NA	NA	NA	NA
APB06100.1|3095520_3096282_+	KilA-N domain-containing protein	NA	A0A1L2BWW1	Bacteriophage	46.3	1.1e-09
APB06101.1|3096680_3096896_+	hypothetical protein	NA	B5WZV1	Pseudomonas_phage	47.1	1.4e-10
APB06102.1|3096995_3097190_+	hypothetical protein	NA	NA	NA	NA	NA
APB06103.1|3097279_3098281_+	hypothetical protein	NA	M9P0E1	Enterobacteria_phage	89.7	3.6e-64
APB06104.1|3098288_3098573_+	host nuclease inhibitor GamL	NA	G8C7T1	Escherichia_phage	79.8	4.3e-39
APB06105.1|3098588_3099434_+	phage recombination protein Bet	NA	A0A1I9KF88	Aeromonas_phage	60.7	1.5e-68
APB06106.1|3099430_3100111_+	exonuclease	NA	A0A0M3ULE0	Salmonella_phage	92.5	2.3e-123
AZB50803.1|3100107_3100266_+	DUF1317 family protein	NA	A0A0N7CHV0	Escherichia_phage	60.8	2.3e-10
APB06107.1|3100262_3100790_+	phage N-6-adenine-methyltransferase	NA	Q9ZWX6	Enterobacteria_phage	61.6	4.9e-57
APB06108.1|3100786_3101005_+	hypothetical protein	NA	NA	NA	NA	NA
APB06109.1|3101006_3101225_+	TraR/DksA family transcriptional regulator	NA	A0A0K2FI84	Escherichia_phage	50.0	3.9e-08
APB08470.1|3101224_3101464_+	DUF4222 domain-containing protein	NA	H6WZF9	Escherichia_phage	46.2	2.9e-09
APB08471.1|3101490_3101760_+	DNA-binding protein	NA	A0A286S2A4	Klebsiella_phage	55.6	2.5e-17
APB06110.1|3101796_3103077_+	DUF3596 domain-containing protein	NA	Q8W658	Enterobacteria_phage	61.0	1.1e-153
APB06111.1|3103257_3104271_-	Zn-dependent oxidoreductase	NA	NA	NA	NA	NA
APB06112.1|3104281_3105496_-	D-galactonate dehydratase family protein	NA	Q6A202	Oenococcus_phage	28.7	8.2e-47
>prophage 4
CP017802	Raoultella ornithinolytica strain MG isolate MG01 chromosome, complete genome	5499520	3289408	3300557	5499520		uncultured_Caudovirales_phage(50.0%)	10	NA	NA
APB06271.2|3289408_3291556_+	formate dehydrogenase subunit alpha	NA	A0A077SK27	Escherichia_phage	23.6	1.8e-28
APB06272.1|3291707_3292166_-	(2Fe-2S)-binding protein	NA	A0A0P0IVM8	Acinetobacter_phage	36.9	7.4e-17
APB06273.1|3292211_3295427_-	aldehyde oxidase	NA	A0A0P0IVM8	Acinetobacter_phage	25.6	1.1e-10
APB06274.1|3295775_3296546_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	29.1	1.4e-15
APB08480.1|3296636_3297020_+	glyoxalase/bleomycin resistance/extradiol dioxygenase family protein	NA	NA	NA	NA	NA
APB06275.1|3297055_3297697_+	CatA-like O-acetyltransferase	NA	NA	NA	NA	NA
APB06276.1|3297676_3298102_-	arsenate reductase (glutaredoxin)	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	62.6	3.1e-41
APB06277.1|3298111_3299404_-	arsenic transporter	NA	A0A2H4J144	uncultured_Caudovirales_phage	69.6	1.8e-161
APB06278.1|3299449_3299770_-	ArsR family transcriptional regulator	NA	A0A2H4J145	uncultured_Caudovirales_phage	46.4	1.1e-19
APB06279.1|3299858_3300557_+	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	65.1	1.1e-83
>prophage 5
CP017802	Raoultella ornithinolytica strain MG isolate MG01 chromosome, complete genome	5499520	3691286	3761062	5499520	protease,terminase,tRNA,head,capsid,holin,tail,integrase,portal	Klebsiella_phage(30.61%)	80	3721806:3721865	3761083:3761208
APB06623.1|3691286_3693074_-|tRNA	aspartate--tRNA ligase	tRNA	A0A2K9L3L6	Tupanvirus	25.0	1.6e-11
APB06624.1|3693342_3693909_+	hydrolase	NA	NA	NA	NA	NA
APB06625.1|3693905_3694724_+	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	79.5	1.5e-57
APB06626.1|3694777_3695173_+	hypothetical protein	NA	NA	NA	NA	NA
APB06627.1|3695212_3695956_+	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	30.4	7.8e-24
APB06628.1|3695952_3696966_+|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
APB06629.1|3697054_3697798_-	copper homeostasis protein CutC	NA	NA	NA	NA	NA
APB06630.1|3697873_3698443_-	VOC family protein	NA	NA	NA	NA	NA
APB06631.1|3698673_3700407_+|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.2	4.1e-84
APB06632.1|3700508_3701648_-	glycoside hydrolase family 105 protein	NA	NA	NA	NA	NA
APB06633.1|3701652_3703236_-	MFS transporter	NA	NA	NA	NA	NA
APB06634.1|3703596_3704025_+	universal stress protein UspC	NA	NA	NA	NA	NA
APB06635.1|3704060_3705485_-	alpha,alpha-trehalose-phosphate synthase	NA	NA	NA	NA	NA
APB06636.1|3705459_3706263_-	trehalose-phosphatase	NA	NA	NA	NA	NA
APB06637.1|3706424_3707405_-	L-arabinose ABC transporter permease AraH	NA	NA	NA	NA	NA
APB06638.1|3707419_3708934_-	L-arabinose ABC transporter ATP-binding protein AraG	NA	A0A2R8FG22	Brazilian_cedratvirus	30.1	4.1e-11
APB08495.1|3708996_3709977_-	arabinose ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
APB06639.1|3710871_3711375_+	non-heme ferritin-like protein	NA	NA	NA	NA	NA
APB06640.1|3711817_3713380_+	MFS transporter	NA	NA	NA	NA	NA
APB06641.1|3713428_3713680_-	DUF2766 domain-containing protein	NA	NA	NA	NA	NA
AZB50857.1|3713759_3713843_-	stress response protein AzuC	NA	NA	NA	NA	NA
APB06642.1|3714053_3715475_+	MFS transporter	NA	NA	NA	NA	NA
APB06643.1|3715527_3716166_-	hypothetical protein	NA	NA	NA	NA	NA
APB06644.1|3716600_3717098_+	non-heme ferritin	NA	NA	NA	NA	NA
APB06645.1|3717134_3717374_-	DUF2492 family protein	NA	NA	NA	NA	NA
APB06646.1|3717568_3718780_+	tyrosine transporter TyrP	NA	NA	NA	NA	NA
APB08496.1|3719161_3719830_-	YecA family protein	NA	H9NBT7	Sphingomonas_phage	62.1	4.3e-05
APB06647.1|3719915_3720491_-	DUF805 domain-containing protein	NA	NA	NA	NA	NA
APB06648.1|3720634_3721630_-	hypothetical protein	NA	NA	NA	NA	NA
3721806:3721865	attL	AGAAATGAAAAAACCACCCGTAGGTGGTTTCACGACACTGCTTATCATTGATTTTATTCT	NA	NA	NA	NA
APB06649.1|3722056_3722377_-	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	55.7	9.4e-27
APB06650.1|3722735_3723116_+	hypothetical protein	NA	NA	NA	NA	NA
APB06651.1|3723179_3723380_-	hypothetical protein	NA	NA	NA	NA	NA
APB06653.1|3725844_3728898_-	kinase	NA	A0A286S259	Klebsiella_phage	77.0	0.0e+00
APB06654.1|3728894_3729278_-	nitrite transporter	NA	A0A286S2A6	Klebsiella_phage	90.4	4.2e-66
APB06655.1|3729287_3729770_-	DUF1833 domain-containing protein	NA	A0A286S2B1	Klebsiella_phage	79.1	4.1e-66
APB06656.1|3729766_3730237_-	hypothetical protein	NA	A0A286S298	Klebsiella_phage	65.8	8.3e-64
APB06657.1|3730236_3732660_-|tail	phage tail tape measure protein	tail	A0A286S1S3	Klebsiella_phage	45.0	3.3e-156
APB06658.1|3732702_3733170_-	hypothetical protein	NA	NA	NA	NA	NA
APB06659.1|3733234_3733498_-|tail	phage tail protein	tail	A0A286S1P2	Klebsiella_phage	73.6	7.2e-33
APB06660.1|3733500_3733884_-|tail	phage tail protein	tail	A0A286S1N4	Klebsiella_phage	81.2	1.7e-51
APB06661.1|3733927_3734419_-|tail	phage tail protein	tail	A0A286S1Q8	Klebsiella_phage	90.8	2.0e-81
APB06662.1|3734476_3734842_-	DUF3168 domain-containing protein	NA	A0A286S1R1	Klebsiella_phage	87.6	1.1e-58
APB06663.1|3734838_3735378_-	HK97 gp10 family phage protein	NA	A0A286S249	Klebsiella_phage	91.1	2.7e-87
APB06664.1|3735370_3735703_-|head,tail	head-tail adaptor protein	head,tail	A0A286S2A2	Klebsiella_phage	91.8	6.1e-53
APB06665.1|3735703_3735907_-	hypothetical protein	NA	K7PJU7	Enterobacteria_phage	77.8	3.3e-17
APB06666.1|3735976_3736297_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1W6JNZ5	Morganella_phage	47.5	9.4e-19
APB06667.2|3736293_3736497_-	hypothetical protein	NA	S5FNU1	Shigella_phage	43.9	3.6e-08
APB06668.1|3736535_3737744_-|capsid	phage major capsid protein	capsid	M1FPN2	Enterobacteria_phage	82.5	4.3e-189
APB06669.1|3737758_3738412_-|head,protease	HK97 family phage prohead protease	head,protease	Q8W628	Enterobacteria_phage	87.4	1.2e-105
APB06670.1|3738398_3739628_-|portal	phage portal protein	portal	U5P411	Shigella_phage	82.0	3.1e-203
APB08497.1|3739627_3739813_-	hypothetical protein	NA	Q8HAD5	Salmonella_phage	60.0	8.9e-14
APB06671.1|3739823_3741581_-|terminase	terminase large subunit	terminase	A0A1B5FP96	Escherichia_phage	90.4	0.0e+00
APB06672.1|3741580_3742078_-|terminase	phage terminase small subunit P27 family	terminase	K7PHI2	Enterobacteria_phage	72.1	1.1e-61
AZB50820.1|3742236_3742587_-	HNH endonuclease	NA	K7PHK9	Enterobacteria_phage	75.9	3.3e-49
AZB50821.1|3742770_3743514_-|protease	serine protease	protease	A0A2H4J9L7	uncultured_Caudovirales_phage	48.7	1.2e-56
AZB50822.1|3743653_3743863_-	hypothetical protein	NA	A0A286SGR9	Klebsiella_phage	77.2	1.4e-18
APB06673.1|3743819_3744089_-	hypothetical protein	NA	G8C7W1	Escherichia_phage	44.8	2.3e-10
APB06674.1|3744085_3744433_-	hypothetical protein	NA	A0A286N2Q7	Klebsiella_phage	74.8	3.2e-36
APB06675.1|3744429_3744969_-	hypothetical protein	NA	A0A286N2Q6	Klebsiella_phage	95.0	1.0e-97
APB06676.2|3744965_3745265_-|holin	holin	holin	A0A286N2Q5	Klebsiella_phage	81.8	1.1e-37
APB06677.1|3745534_3746587_+	hypothetical protein	NA	NA	NA	NA	NA
APB06678.1|3746586_3746979_+	hypothetical protein	NA	NA	NA	NA	NA
APB06679.1|3746978_3747641_+	hypothetical protein	NA	NA	NA	NA	NA
APB06680.1|3747655_3748003_-	antitermination protein	NA	A0A0P0ZCW0	Stx2-converting_phage	86.7	6.1e-56
APB08499.1|3748021_3749002_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	67.5	2.1e-133
APB06681.1|3749009_3749810_-	KilA-N domain-containing protein	NA	A5LH75	Enterobacteria_phage	69.1	1.3e-101
APB06682.1|3749896_3750295_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A1C9IIA0	Salmonella_phage	75.0	5.4e-48
APB06683.1|3750304_3751114_-	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A1C9II58	Salmonella_phage	71.9	3.2e-116
APB06684.1|3751110_3752025_-	transcriptional regulator	NA	H2DE83	Erwinia_phage	58.0	1.1e-30
AZB50823.1|3751981_3752194_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	70.9	2.9e-16
APB06686.1|3752431_3752887_-	hypothetical protein	NA	K7PJS5	Enterobacterial_phage	86.5	3.3e-65
APB06687.1|3752887_3753118_-	hypothetical protein	NA	NA	NA	NA	NA
AZB50824.1|3753146_3753416_-	helix-turn-helix domain-containing protein	NA	D0UIL8	Aggregatibacter_phage	49.3	2.9e-13
APB06688.1|3753518_3754001_+	hypothetical protein	NA	A0A2D1GNH0	Pseudomonas_phage	52.1	3.7e-11
APB06689.1|3754170_3755325_+	type I restriction endonuclease subunit R	NA	A0A1S5SAB0	Streptococcus_phage	28.4	2.3e-35
APB06690.1|3755746_3756145_+	hypothetical protein	NA	K7PJS4	Enterobacterial_phage	37.2	2.1e-12
APB06691.1|3756144_3756960_+	chromosome partitioning protein ParB	NA	K7PKM7	Enterobacterial_phage	73.7	5.8e-105
APB08500.1|3757093_3758173_+	DGQHR domain-containing protein	NA	T1SBJ4	Salmonella_phage	72.4	4.4e-145
AZB50825.1|3759797_3760028_+	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
APB06692.1|3760027_3761062_+|integrase	integrase	integrase	H9C152	Pectobacterium_phage	63.1	2.4e-124
3761083:3761208	attR	AGAAATGAAAAAACCACCCGTAGGTGGTTTCACGACACTGCTTATCATTGATTTTATTCTATAATCCCAATGGTACCCGGAACGAGACTTGAACTCGTACAGCCTATGGCCGAGGGATTTTAAATC	NA	NA	NA	NA
>prophage 6
CP017802	Raoultella ornithinolytica strain MG isolate MG01 chromosome, complete genome	5499520	3901407	3909249	5499520		Enterobacteria_phage(42.86%)	7	NA	NA
APB06799.1|3901407_3902412_+	NAD-dependent epimerase	NA	E3T4Y8	Cafeteria_roenbergensis_virus	29.1	2.6e-30
APB06800.1|3902797_3903964_-	UDP-glucose 6-dehydrogenase	NA	O41091	Paramecium_bursaria_Chlorella_virus	54.5	2.8e-113
APB06801.1|3904138_3904693_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	56.9	1.5e-51
APB06802.1|3904704_3905595_-	dTDP-4-dehydrorhamnose reductase	NA	I7HXC9	Enterobacteria_phage	34.9	5.1e-30
APB06803.1|3905627_3906497_-	glucose-1-phosphate thymidylyltransferase	NA	I7I009	Enterobacteria_phage	68.1	4.0e-112
APB06804.1|3906535_3907600_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	54.4	1.3e-104
APB06805.1|3907842_3909249_-	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	29.5	1.5e-39
