The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP026585	Klebsiella pneumoniae strain WCHKP649 chromosome, complete genome	5461116	448578	517956	5461116	integrase,tail,head,portal,protease,tRNA,terminase,capsid	uncultured_Caudovirales_phage(61.11%)	75	466186:466203	482181:482198
AVE09206.1|448578_449526_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	37.2	2.2e-07
AVE09207.1|449540_450050_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	40.3	2.6e-18
AVE09208.1|450178_451303_+	DNA-protecting protein DprA	NA	NA	NA	NA	NA
AVE09209.1|451274_451748_+	DUF494 domain-containing protein	NA	NA	NA	NA	NA
AVE09210.1|451773_452316_+	hypothetical protein	NA	NA	NA	NA	NA
AVE09211.1|452320_452893_+	L-threonylcarbamoyladenylate synthase type 1 TsaC	NA	NA	NA	NA	NA
AVE09212.1|452896_453715_+	shikimate dehydrogenase	NA	NA	NA	NA	NA
AVE09213.1|453711_453969_+	DUF1488 domain-containing protein	NA	NA	NA	NA	NA
AVE13844.1|453944_454499_-	gamma carbonic anhydrase family protein	NA	NA	NA	NA	NA
AVE09214.1|460294_460516_-	hypothetical protein	NA	NA	NA	NA	NA
AVE09215.1|460809_463920_-	multidrug efflux RND transporter permease subunit	NA	NA	NA	NA	NA
AVE09216.1|463932_465072_-	MexX family efflux pump subunit	NA	NA	NA	NA	NA
AVE09217.1|465450_466101_+	acrEF/envCD operon transcriptional regulator	NA	NA	NA	NA	NA
466186:466203	attL	GTATCAGTTCATGCCGTA	NA	NA	NA	NA
AVE09218.1|466376_467603_+|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	62.2	1.8e-150
AVE09219.1|467695_468637_+	hypothetical protein	NA	NA	NA	NA	NA
AVE09220.1|468818_469103_+	transcriptional regulator	NA	NA	NA	NA	NA
AVE09221.1|469113_469893_+	hypothetical protein	NA	Q8HA02	Enterobacteria_phage	51.5	6.2e-40
AVE09222.1|470016_470211_-	toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
AVE13845.1|470434_470614_+	host cell division inhibitor Icd-like protein	NA	A0A2H4JGW3	uncultured_Caudovirales_phage	94.9	2.6e-26
AVE09223.1|470606_470795_+	hypothetical protein	NA	NA	NA	NA	NA
AVE09224.1|470787_471102_+	hypothetical protein	NA	NA	NA	NA	NA
AVE09225.1|471098_471467_+	hypothetical protein	NA	A0A2H4JCX7	uncultured_Caudovirales_phage	81.1	3.7e-51
AVE09226.1|471463_471829_+	hypothetical protein	NA	NA	NA	NA	NA
AVE09227.1|471828_473964_+	DNA primase	NA	A0A1W6JPG0	Morganella_phage	62.4	3.4e-205
AVE09228.1|474306_474642_+	hypothetical protein	NA	NA	NA	NA	NA
AVE09229.1|474690_475203_-	hypothetical protein	NA	NA	NA	NA	NA
AVE09230.1|475466_476633_+|capsid	phage major capsid protein	capsid	A0A2H4JED2	uncultured_Caudovirales_phage	95.9	9.8e-207
AVE09231.1|476684_477245_+|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	95.7	1.2e-98
AVE09232.1|477246_478488_+|portal	phage portal protein	portal	A0A2H4JFJ9	uncultured_Caudovirales_phage	96.5	1.0e-230
AVE09233.1|478484_478820_+|head,tail	head-tail adaptor	head,tail	A0A2H4JHK5	uncultured_Caudovirales_phage	57.8	3.7e-26
AVE09234.1|478816_479116_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2H4JD08	uncultured_Caudovirales_phage	80.8	3.4e-39
AVE09235.1|479115_479559_+	HNH endonuclease	NA	A0A2H4JAS8	uncultured_Caudovirales_phage	91.8	2.8e-77
AVE09236.1|479685_479877_+|terminase	terminase	terminase	NA	NA	NA	NA
AVE09237.1|479834_480191_+|terminase	phage terminase small subunit P27 family	terminase	A0A2H4JHS3	uncultured_Caudovirales_phage	99.2	5.5e-60
AVE09238.1|480174_481836_+|terminase	terminase large subunit	terminase	A0A2H4JB64	uncultured_Caudovirales_phage	98.0	0.0e+00
AVE09239.1|481838_482030_+	hypothetical protein	NA	NA	NA	NA	NA
AVE09240.1|482183_482480_-	Fis family transcriptional regulator	NA	NA	NA	NA	NA
482181:482198	attR	GTATCAGTTCATGCCGTA	NA	NA	NA	NA
AVE09241.1|482504_483470_-|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
AVE09242.1|483627_483822_-	hypothetical protein	NA	NA	NA	NA	NA
AVE09243.1|483827_484709_-	50S ribosomal protein L11 methyltransferase	NA	NA	NA	NA	NA
AVE09244.1|484720_486172_-	sodium/panthothenate symporter	NA	NA	NA	NA	NA
AVE09245.1|486161_486404_-	hypothetical protein	NA	NA	NA	NA	NA
AVE09246.1|486514_487864_-	acetyl-CoA carboxylase biotin carboxylase subunit	NA	NA	NA	NA	NA
AVE09247.1|487874_488342_-	acetyl-CoA carboxylase biotin carboxyl carrier protein	NA	NA	NA	NA	NA
AVE09248.1|488364_488817_-	type II 3-dehydroquinate dehydratase	NA	NA	NA	NA	NA
AVE09249.1|489040_489649_-	protein-methionine-sulfoxide reductase heme-binding subunit MsrQ	NA	NA	NA	NA	NA
AVE09250.1|489648_490650_-	protein-methionine-sulfoxide reductase catalytic subunit MsrP	NA	NA	NA	NA	NA
AVE09251.1|490878_491070_+	hypothetical protein	NA	NA	NA	NA	NA
AVE09252.1|491149_493090_+	RNase E specificity factor CsrD	NA	NA	NA	NA	NA
AVE09253.1|493211_493418_-	hypothetical protein	NA	NA	NA	NA	NA
AVE09254.1|493395_494439_+	rod shape-determining protein	NA	F2Y0P3	Organic_Lake_phycodnavirus	22.3	6.7e-05
AVE09255.1|494509_495502_+	rod shape-determining protein MreC	NA	NA	NA	NA	NA
AVE09256.1|495501_495990_+	rod shape-determining protein MreD	NA	NA	NA	NA	NA
AVE09257.1|495997_496579_+	septum formation inhibitor Maf	NA	NA	NA	NA	NA
AVE09258.1|496581_498051_+	ribonuclease G	NA	NA	NA	NA	NA
AVE09259.1|498088_501886_+	AsmA2 domain-containing protein	NA	NA	NA	NA	NA
AVE09260.1|501974_503420_+|protease	metalloprotease TldD	protease	NA	NA	NA	NA
AVE09261.1|503455_504385_-	HTH-type transcriptional activator AaeR	NA	NA	NA	NA	NA
AVE09262.1|504516_504720_+	protein AaeX	NA	NA	NA	NA	NA
AVE09263.1|504727_505660_+	p-hydroxybenzoic acid efflux pump subunit AaeA	NA	NA	NA	NA	NA
AVE09264.1|505665_507633_+	p-hydroxybenzoic acid efflux pump subunit AaeB	NA	NA	NA	NA	NA
AVE09265.1|507712_507988_+	hypothetical protein	NA	NA	NA	NA	NA
AVE09266.1|508038_508305_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
AVE09267.1|508403_508667_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
AVE09268.1|509042_509513_-	arginine repressor	NA	NA	NA	NA	NA
AVE09269.1|509927_510866_+	malate dehydrogenase	NA	NA	NA	NA	NA
AVE09270.1|511002_512061_-|protease	serine endoprotease DegS	protease	NA	NA	NA	NA
AVE09271.1|512148_513516_-|protease	serine endoprotease DegQ	protease	A0A1B1IT49	uncultured_Mediterranean_phage	25.3	6.0e-22
AVE09272.1|513689_514088_-	hypothetical protein	NA	NA	NA	NA	NA
AVE09273.1|514278_515406_+	cell division protein ZapE	NA	NA	NA	NA	NA
AVE09274.1|515671_516100_+	50S ribosomal protein L13	NA	NA	NA	NA	NA
AVE09275.1|516115_516508_+	30S ribosomal protein S9	NA	NA	NA	NA	NA
AVE09276.1|516617_516821_-	hypothetical protein	NA	NA	NA	NA	NA
AVE09277.1|516819_517458_+	stringent starvation protein A	NA	NA	NA	NA	NA
AVE09278.1|517461_517956_+|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	54.8	1.5e-26
>prophage 2
CP026585	Klebsiella pneumoniae strain WCHKP649 chromosome, complete genome	5461116	1241256	1290400	5461116	transposase,integrase,tail,plate,head,portal,tRNA,coat,capsid	Salmonella_phage(80.0%)	63	1240671:1240717	1279026:1279072
1240671:1240717	attL	TTTGGTGGAGCTGGCGGGAGTTGAACCCGCGTCCGAAATTCCTACAT	NA	NA	NA	NA
AVE09977.1|1241256_1242237_-|transposase	IS5-like element ISKpn26 family transposase	transposase	Q38213	Escherichia_phage	99.1	8.9e-185
AVE09978.1|1242282_1243281_-|integrase	site-specific integrase	integrase	A0A1S6L016	Salmonella_phage	94.5	2.2e-183
AVE09979.1|1243283_1243913_-	phage repressor protein	NA	A0A1S6KZZ7	Salmonella_phage	54.5	1.4e-61
AVE09980.1|1244035_1244278_+	Rha family transcriptional regulator	NA	A0A1S6KZZ6	Salmonella_phage	98.8	4.0e-38
AVE09981.1|1244310_1244820_+	hypothetical protein	NA	A0A1S6L008	Salmonella_phage	85.8	1.1e-77
AVE09982.1|1244827_1245028_+	DUF2724 domain-containing protein	NA	A0A1S6L005	Salmonella_phage	68.8	4.5e-19
AVE09983.1|1244991_1245330_+	hypothetical protein	NA	A0A218M4I7	Erwinia_phage	58.0	6.2e-29
AVE09984.1|1245397_1245631_+	DUF2732 domain-containing protein	NA	A0A1S6L021	Salmonella_phage	90.9	6.0e-31
AVE09985.1|1245630_1245858_+	hypothetical protein	NA	A0A1S6L007	Salmonella_phage	92.0	5.1e-35
AVE09986.1|1245854_1246706_+	DNA adenine methylase	NA	A0A1S6L011	Salmonella_phage	75.4	2.2e-115
AVE09987.1|1246702_1249087_+	replication endonuclease	NA	A0A1S6L028	Salmonella_phage	87.9	0.0e+00
AVE09988.1|1249316_1249568_+	hypothetical protein	NA	NA	NA	NA	NA
AVE09989.1|1249567_1251052_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
AVE09990.1|1251159_1251348_+	hypothetical protein	NA	A0A1S6L006	Salmonella_phage	90.3	2.2e-23
AVE09991.1|1251359_1251593_+	DinI family protein	NA	A0A0M4S6H1	Salmonella_phage	96.1	2.0e-34
AVE09992.1|1251688_1252372_-	hypothetical protein	NA	NA	NA	NA	NA
AVE09993.1|1252358_1253438_-	hypothetical protein	NA	NA	NA	NA	NA
AVE09994.1|1253437_1254439_-	hypothetical protein	NA	NA	NA	NA	NA
AVE13869.1|1254960_1255230_+	hypothetical protein	NA	D2IZW1	Enterococcus_phage	41.3	1.4e-15
AVE09995.1|1255286_1256330_-|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	85.6	3.1e-172
AVE09996.1|1256329_1258093_-	oxidoreductase	NA	A0A1S6KZW3	Salmonella_phage	91.8	0.0e+00
AVE09997.1|1258233_1259067_+|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	77.6	4.4e-100
AVE09998.1|1259083_1260136_+|capsid	phage major capsid protein, P2 family	capsid	A0A1S6KZZ3	Salmonella_phage	91.0	6.8e-175
AVE09999.1|1260139_1260793_+	hypothetical protein	NA	A0A1S6KZX1	Salmonella_phage	80.0	1.9e-90
AVE10000.1|1260888_1261353_+|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	85.7	1.5e-73
AVE10001.1|1261352_1261556_+|tail	phage tail protein	tail	E5G6M9	Salmonella_phage	89.6	9.8e-30
AVE13870.1|1261559_1261775_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	88.7	6.1e-30
AVE10002.1|1261755_1262265_+	lysozyme	NA	E5G6N1	Salmonella_phage	85.2	1.6e-81
AVE10003.1|1262269_1262653_+	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	45.4	1.9e-18
AVE10004.1|1262649_1263078_+	hypothetical protein	NA	A0A1S6KZX8	Salmonella_phage	82.5	7.1e-54
AVE10005.1|1263007_1263211_+	hypothetical protein	NA	A0A1S6KZX6	Salmonella_phage	77.6	3.0e-23
AVE10006.1|1263173_1263596_+|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	83.2	8.2e-63
AVE10007.1|1263588_1264035_+	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	72.3	2.5e-54
AVE10008.1|1264057_1264924_-	hypothetical protein	NA	NA	NA	NA	NA
AVE10009.1|1265018_1265591_+|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	70.8	1.4e-76
AVE10010.1|1265587_1265950_+|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	85.6	8.4e-48
AVE10011.1|1265936_1266845_+|plate	baseplate assembly protein	plate	E5G6N8	Salmonella_phage	68.9	1.9e-109
AVE13871.1|1266837_1267509_+|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	58.9	3.2e-61
AVE10012.1|1267510_1269460_+|coat	spore coat protein CotH	coat	Q6QI97	Burkholderia_phage	38.9	1.0e-06
AVE10013.1|1269469_1270588_+	hypothetical protein	NA	A0A248XD67	Klebsiella_phage	38.0	4.4e-55
AVE10014.1|1270639_1271713_+|tail	phage tail protein	tail	A0A1S6KZZ8	Salmonella_phage	53.6	6.6e-40
AVE10015.1|1271861_1273034_+|tail	phage tail protein	tail	A0A1S6KZY7	Salmonella_phage	91.5	3.4e-207
AVE10016.1|1273043_1273559_+|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	84.2	1.4e-80
AVE10017.1|1273611_1273911_+|tail	phage tail assembly protein	tail	E5G6P9	Salmonella_phage	78.0	8.2e-33
AVE10018.1|1273925_1274045_+|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.2e-13
AVE10019.1|1274037_1276668_+|tail	phage tail tape measure protein	tail	E5FFG5	Burkholderia_phage	41.9	8.9e-115
AVE10020.1|1276664_1277150_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	80.1	5.2e-61
AVE10021.1|1277146_1278241_+	late control protein D	NA	E5G6Q3	Salmonella_phage	83.6	2.4e-170
AVE10022.1|1278307_1278526_+	levansucrase regulator	NA	Q53ZE7	Salmonella_virus	72.2	1.9e-26
AVE10023.1|1278553_1278931_-	hypothetical protein	NA	NA	NA	NA	NA
AVE10024.1|1279534_1280017_-	SsrA-binding protein	NA	W5RAM5	Staphylococcus_phage	47.4	2.3e-29
1279026:1279072	attR	TTTGGTGGAGCTGGCGGGAGTTGAACCCGCGTCCGAAATTCCTACAT	NA	NA	NA	NA
AVE10025.1|1280127_1280604_+	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
AVE10026.1|1280593_1280884_+	RnfH family protein	NA	NA	NA	NA	NA
AVE10027.1|1280950_1281292_-	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
AVE10028.1|1281439_1283101_-	DNA repair protein RecN	NA	NA	NA	NA	NA
AVE10029.1|1283187_1284066_-	NAD(+) kinase	NA	NA	NA	NA	NA
AVE10030.1|1284190_1284781_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
AVE10031.1|1284900_1286187_-	DUF21 domain-containing protein	NA	NA	NA	NA	NA
AVE10032.1|1286206_1286998_-	inner membrane protein YpjD	NA	NA	NA	NA	NA
AVE10033.1|1287161_1288526_+	signal recognition particle protein	NA	NA	NA	NA	NA
AVE10034.1|1288785_1289034_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
AVE10035.1|1289052_1289601_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
AVE10036.1|1289632_1290400_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
>prophage 3
CP026585	Klebsiella pneumoniae strain WCHKP649 chromosome, complete genome	5461116	1395116	1447859	5461116	transposase,tail,terminase,holin	Salmonella_phage(40.38%)	63	NA	NA
AVE10125.1|1395116_1396583_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	38.7	1.2e-87
AVE10126.1|1396650_1398228_+	GMP synthase (glutamine-hydrolyzing)	NA	NA	NA	NA	NA
AVE10127.1|1398419_1399670_+	DUF4102 domain-containing protein	NA	A0A1X9TCT6	Enterobacter_phage	84.4	5.8e-205
AVE10128.1|1399612_1399855_-	hypothetical protein	NA	NA	NA	NA	NA
AVE10129.1|1399851_1400445_-	adenine methylase	NA	T1SA14	Salmonella_phage	91.9	6.3e-109
AVE10130.1|1400441_1401104_-	hypothetical protein	NA	A0A059VF56	Pseudomonas_phage	46.6	1.2e-47
AVE10131.1|1401100_1401259_-	DUF1317 domain-containing protein	NA	T1SAR0	Salmonella_phage	78.8	1.1e-17
AVE10132.1|1401251_1401545_-	PerC family transcriptional regulator	NA	T1S9J5	Salmonella_phage	71.1	4.0e-32
AVE10133.1|1401654_1401903_-	AlpA family phage regulatory protein	NA	A0A0F6TJ45	Escherichia_coli_O157_typing_phage	76.8	4.9e-31
AVE10134.1|1401951_1402833_-	recombinase RecT	NA	T1SBJ5	Salmonella_phage	84.3	8.9e-136
AVE10135.1|1402829_1403651_-	exodeoxyribonuclease VIII	NA	A0A193GYK2	Enterobacter_phage	80.2	1.8e-130
AVE10136.1|1403647_1403947_-	hypothetical protein	NA	A0A0F6R7M4	Escherichia_coli_O157_typing_phage	54.5	2.1e-20
AVE10137.1|1404313_1404895_-	XRE family transcriptional regulator	NA	Q858D7	Salmonella_phage	64.3	7.1e-65
AVE10138.1|1405049_1405283_+	hypothetical protein	NA	T1SAR5	Salmonella_phage	66.2	9.2e-24
AVE10139.1|1405429_1405639_+	hypothetical protein	NA	A0A193GYW4	Enterobacter_phage	78.3	1.8e-26
AVE10140.1|1405638_1406406_+	primosomal protein	NA	A0A193GZ86	Enterobacter_phage	91.4	8.9e-140
AVE10141.1|1406402_1407188_+	replication protein	NA	A0A193GYX1	Enterobacter_phage	87.7	3.7e-133
AVE10142.1|1407307_1407655_+	DUF1064 domain-containing protein	NA	A0A0F6R8N5	Escherichia_coli_O157_typing_phage	82.6	6.5e-50
AVE10143.1|1407847_1408258_+	hypothetical protein	NA	A0A2P1MXC5	Escherichia_phage	45.1	4.3e-16
AVE10144.1|1408241_1408433_+	hypothetical protein	NA	NA	NA	NA	NA
AVE10145.1|1408429_1409074_+	hypothetical protein	NA	Q1MVG0	Enterobacteria_phage	79.3	8.0e-110
AVE13874.1|1409367_1409835_+	hypothetical protein	NA	A0A2R2Z312	Escherichia_phage	51.7	1.3e-37
AVE10146.1|1409834_1410128_+	hypothetical protein	NA	Q6UAT9	Klebsiella_phage	86.6	2.7e-44
AVE10147.1|1410124_1410745_+	hypothetical protein	NA	Q1MVF7	Enterobacteria_phage	40.7	1.0e-29
AVE13876.1|1410744_1410948_+	hypothetical protein	NA	NA	NA	NA	NA
AVE10148.1|1410940_1411279_+	hypothetical protein	NA	A0A193GYX4	Enterobacter_phage	80.0	1.8e-44
AVE10149.1|1411375_1412860_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
AVE10150.1|1412859_1413111_-	hypothetical protein	NA	NA	NA	NA	NA
AVE13875.1|1413263_1413521_+	lF-82	NA	NA	NA	NA	NA
AVE10151.1|1413598_1414183_+|terminase	terminase small subunit	terminase	T1SBI8	Salmonella_phage	88.6	2.2e-90
AVE10152.1|1414179_1415655_+|terminase	terminase	terminase	Q858H3	Salmonella_phage	93.1	6.4e-280
AVE10153.1|1415698_1416070_-	hypothetical protein	NA	A0A0F6TJP2	Escherichia_coli_O157_typing_phage	91.9	3.7e-59
AVE10154.1|1416119_1416362_+	hypothetical protein	NA	NA	NA	NA	NA
AVE10155.1|1416823_1417030_+	hypothetical protein	NA	T1SA67	Salmonella_phage	88.2	4.8e-08
AVE10156.1|1417044_1418727_+|tail	phage tail protein	tail	A0A0F6TJD8	Escherichia_coli_O157_typing_phage	84.4	1.5e-264
AVE10157.1|1418723_1419020_+	hypothetical protein	NA	T1SBI9	Salmonella_phage	70.4	1.2e-33
AVE10158.1|1419022_1419703_+	peptidase	NA	G9L6C4	Escherichia_phage	84.0	6.1e-76
AVE10159.1|1419717_1420704_+	hypothetical protein	NA	A0A193GZ49	Enterobacter_phage	94.2	2.5e-179
AVE10160.1|1420757_1421195_+	hypothetical protein	NA	A0A193GYT9	Enterobacter_phage	91.7	1.3e-66
AVE10161.1|1421205_1421547_+	hypothetical protein	NA	G9L6C7	Escherichia_phage	70.8	2.4e-36
AVE10162.1|1421597_1421921_+	hypothetical protein	NA	G9L6C8	Escherichia_phage	85.0	5.3e-46
AVE10163.1|1421920_1422526_+	hypothetical protein	NA	A0A0F6TJN5	Escherichia_coli_O157_typing_phage	77.0	4.0e-87
AVE10164.1|1422525_1425003_+	hypothetical protein	NA	Q858G3	Salmonella_phage	84.4	0.0e+00
AVE10165.1|1425002_1425467_+	hypothetical protein	NA	Q858G2	Salmonella_phage	81.2	1.5e-70
AVE10166.1|1425466_1426006_+	hypothetical protein	NA	A0A0F6TJ56	Escherichia_coli_O157_typing_phage	80.0	8.0e-71
AVE10167.1|1426016_1428551_+	hypothetical protein	NA	Q858G0	Salmonella_phage	84.1	0.0e+00
AVE10168.1|1428550_1430461_+	hypothetical protein	NA	Q858F9	Salmonella_phage	82.7	5.4e-287
AVE10169.1|1430460_1433217_+	hypothetical protein	NA	Q858F8	Salmonella_phage	95.4	0.0e+00
AVE10170.1|1433213_1433408_+	hypothetical protein	NA	Q858F7	Salmonella_phage	67.2	6.5e-15
AVE10171.1|1433442_1433595_-	transmembrane anchored protein	NA	G9L6D9	Escherichia_phage	83.7	2.5e-14
AVE10172.1|1433693_1433990_-	hypothetical protein	NA	T1SA06	Salmonella_phage	63.9	6.9e-24
AVE10173.1|1436817_1437081_+	hypothetical protein	NA	NA	NA	NA	NA
AVE10174.1|1437121_1438255_-	hypothetical protein	NA	NA	NA	NA	NA
AVE13877.1|1438243_1438330_+	ABC transporter	NA	NA	NA	NA	NA
AVE10175.1|1438368_1439349_-|transposase	IS5 family transposase ISKpn26	transposase	A0A077SK28	Escherichia_phage	99.4	1.0e-185
AVE10176.1|1440217_1441480_-|transposase	IS1380 family transposase ISEc9	transposase	A0A1B0VDR3	Salmonella_phage	100.0	1.3e-39
AVE10177.1|1442370_1442511_-	ABC transporter	NA	NA	NA	NA	NA
AVE10178.1|1442588_1443905_+	right-handed parallel beta-helix repeat-containing protein	NA	A0A0K2FI18	Enterobacter_phage	32.3	2.3e-34
AVE10179.1|1443991_1444396_+	hypothetical protein	NA	T1SA79	Salmonella_phage	81.1	8.7e-54
AVE10180.1|1444382_1444688_+|holin	phage holin family protein	holin	A0A193GYK3	Enterobacter_phage	81.4	2.7e-39
AVE10181.1|1444677_1445307_+	endolysin	NA	Q858F0	Salmonella_phage	76.9	1.8e-90
AVE10182.1|1445303_1445804_+	DUF2514 domain-containing protein	NA	Q858E9	Salmonella_phage	76.9	1.3e-59
AVE10183.1|1445990_1447859_-	phosphatase	NA	A0A2P0VMN7	Tetraselmis_virus	22.6	2.6e-07
>prophage 4
CP026585	Klebsiella pneumoniae strain WCHKP649 chromosome, complete genome	5461116	1780210	1787115	5461116		Planktothrix_phage(33.33%)	6	NA	NA
AVE13892.1|1780210_1781074_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	27.5	7.4e-10
AVE10470.1|1781084_1781858_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.7	3.9e-26
AVE13893.1|1782098_1782992_-	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.8	6.1e-15
AVE10471.1|1783237_1784599_-	U32 family peptidase	NA	Q6DW11	Phage_TP	94.8	1.8e-207
AVE10472.1|1784917_1785640_-	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.2	8.3e-31
AVE10473.1|1785636_1787115_-	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	28.3	1.9e-29
>prophage 5
CP026585	Klebsiella pneumoniae strain WCHKP649 chromosome, complete genome	5461116	1830460	1842135	5461116	transposase	Escherichia_phage(33.33%)	10	NA	NA
AVE10502.1|1830460_1831867_+	phosphogluconate dehydrogenase (NADP(+)-dependent, decarboxylating)	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.7	4.7e-38
AVE10503.1|1832093_1833509_+	mannose-1-phosphate guanylyltransferase	NA	A0A1V0SH58	Hokovirus	31.0	1.4e-53
AVE10504.1|1833530_1834901_+	phosphomannomutase	NA	A0A127AWJ1	Bacillus_phage	25.9	6.4e-32
AVE13896.1|1835055_1836120_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	54.7	9.8e-105
AVE10505.1|1836133_1837003_+	glucose-1-phosphate thymidylyltransferase	NA	I7I009	Enterobacteria_phage	66.7	1.7e-110
AVE10506.1|1837034_1837925_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	34.2	2.8e-28
AVE10507.1|1837939_1838494_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	58.2	2.9e-52
AVE10508.1|1838673_1839840_+	UDP-glucose 6-dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	54.7	9.1e-112
AVE10509.1|1840202_1841114_+	acyltransferase	NA	NA	NA	NA	NA
AVE10510.1|1841154_1842135_+|transposase	IS5-like element ISKpn26 family transposase	transposase	Q38213	Escherichia_phage	99.1	8.9e-185
>prophage 6
CP026585	Klebsiella pneumoniae strain WCHKP649 chromosome, complete genome	5461116	2835473	2846360	5461116		Escherichia_phage(87.5%)	9	NA	NA
AVE11437.1|2835473_2838581_+	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	59.6	0.0e+00
AVE11438.1|2838635_2839901_+	MFS transporter	NA	NA	NA	NA	NA
AVE11439.1|2839931_2841020_-	chromosome segregation protein SMC	NA	A0A077SLJ9	Escherichia_phage	100.0	8.0e-211
AVE11440.1|2841106_2841367_-	hypothetical protein	NA	A0A077SK33	Escherichia_phage	97.7	3.5e-40
AVE11441.1|2841664_2842525_+	class A broad-spectrum beta-lactamase SHV-11	NA	A0A077SL40	Escherichia_phage	99.3	2.2e-155
AVE11442.1|2842545_2843307_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
AVE11443.1|2843567_2844470_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	99.3	7.7e-159
AVE11444.1|2844481_2845747_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	99.5	6.6e-233
AVE11445.1|2845739_2846360_+	aldolase	NA	A0A077SK32	Escherichia_phage	100.0	8.0e-115
>prophage 7
CP026585	Klebsiella pneumoniae strain WCHKP649 chromosome, complete genome	5461116	3029762	3102459	5461116	transposase,plate,tail,head,protease,terminase,lysis	uncultured_Caudovirales_phage(33.33%)	84	NA	NA
AVE11616.1|3029762_3030848_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
AVE11617.1|3030811_3032566_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
AVE11618.1|3034237_3037663_-	type VI secretion protein VasK	NA	NA	NA	NA	NA
AVE11619.1|3037646_3038786_-	hypothetical protein	NA	NA	NA	NA	NA
AVE11620.1|3038782_3039040_-	PAAR domain-containing protein	NA	NA	NA	NA	NA
AVE11621.1|3039084_3041502_-	DUF2235 domain-containing protein	NA	NA	NA	NA	NA
AVE11622.1|3041489_3042020_-	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
AVE11623.1|3042087_3042618_-	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
AVE11624.1|3042686_3043217_-	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
AVE11625.1|3043284_3043815_-	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
AVE11626.1|3043883_3044414_-	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
AVE11627.1|3044477_3045257_-	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
AVE11628.1|3045257_3047636_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	33.8	9.2e-18
AVE11629.1|3047628_3050283_-	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	33.4	2.5e-96
AVE11630.1|3050547_3051039_-	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
AVE11631.1|3051043_3052750_-	OmpA family protein	NA	NA	NA	NA	NA
AVE11632.1|3052746_3053436_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
AVE13947.1|3053432_3054773_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
AVE11633.1|3054785_3056330_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
AVE11634.1|3056372_3056864_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
AVE11635.1|3057333_3058314_+|transposase	IS5-like element ISKpn26 family transposase	transposase	Q38213	Escherichia_phage	99.1	8.9e-185
AVE11636.1|3058352_3058496_-	ABC transporter	NA	NA	NA	NA	NA
AVE11637.1|3058909_3059158_+	damage-inducible protein DinI	NA	S5MQI1	Escherichia_phage	70.4	1.4e-25
AVE11638.1|3059380_3059665_-	hypothetical protein	NA	NA	NA	NA	NA
AVE11639.1|3059769_3059979_-	hypothetical protein	NA	NA	NA	NA	NA
AVE11640.1|3059975_3060707_-	hypothetical protein	NA	NA	NA	NA	NA
AVE13948.1|3060717_3061446_-	hypothetical protein	NA	NA	NA	NA	NA
AVE11641.1|3063796_3063994_-	hypothetical protein	NA	NA	NA	NA	NA
AVE11642.1|3063993_3064860_-	hypothetical protein	NA	A0A2H4IYR0	uncultured_Caudovirales_phage	64.5	1.9e-34
AVE11643.1|3064859_3065633_-	DUF2612 domain-containing protein	NA	A0A2H4J1A9	uncultured_Caudovirales_phage	54.4	2.8e-77
AVE11644.1|3065629_3066826_-	hypothetical protein	NA	A0A0M4RD32	Salmonella_phage	72.9	3.9e-158
AVE11645.1|3066825_3067179_-	hypothetical protein	NA	A0A2H4J629	uncultured_Caudovirales_phage	80.3	2.3e-50
AVE11646.1|3067180_3067834_-	hypothetical protein	NA	A0A2H4J8H6	uncultured_Caudovirales_phage	63.5	1.0e-59
AVE11647.1|3067887_3068454_-	hypothetical protein	NA	NA	NA	NA	NA
AVE11648.1|3068490_3068676_+	hypothetical protein	NA	NA	NA	NA	NA
AVE11649.1|3068728_3069070_-	hypothetical protein	NA	A0A2H4J1A5	uncultured_Caudovirales_phage	46.6	1.8e-23
AVE11650.1|3069069_3070092_-	hypothetical protein	NA	A0A2H4J1B2	uncultured_Caudovirales_phage	54.2	9.2e-100
AVE11651.1|3070094_3070397_-	hypothetical protein	NA	A0A2H4J495	uncultured_Caudovirales_phage	55.2	2.0e-26
AVE11652.1|3070397_3070997_-	hypothetical protein	NA	A0A2H4J1B3	uncultured_Caudovirales_phage	57.6	9.9e-54
AVE11653.1|3070996_3073000_-	lytic transglycosylase domain-containing protein	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	63.6	1.2e-247
AVE11654.1|3072989_3073142_-	NTP pyrophosphohydrolase	NA	A0A2H4J1A2	uncultured_Caudovirales_phage	88.0	7.6e-19
AVE11655.1|3073177_3073603_-	hypothetical protein	NA	A0A2H4J2V6	uncultured_Caudovirales_phage	63.4	2.6e-40
AVE11656.1|3073606_3074047_-	DUF3277 domain-containing protein	NA	A0A0M5M1K6	Salmonella_phage	80.1	3.3e-62
AVE11657.1|3074057_3075203_-	DUF3383 domain-containing protein	NA	A0A2H4J8G4	uncultured_Caudovirales_phage	76.9	6.3e-166
AVE11658.1|3075206_3075647_-	hypothetical protein	NA	A0A2H4J1A0	uncultured_Caudovirales_phage	51.7	1.6e-40
AVE11659.1|3075741_3076128_-|head,tail	head-tail adaptor	head,tail	A0A2H4J1A4	uncultured_Caudovirales_phage	78.2	1.1e-48
AVE11660.1|3076127_3076634_-	hypothetical protein	NA	NA	NA	NA	NA
AVE11661.1|3076630_3077050_-	DUF4054 domain-containing protein	NA	A0A0M5M3S2	Salmonella_phage	60.7	3.3e-40
AVE11662.1|3077018_3077300_-	hypothetical protein	NA	NA	NA	NA	NA
AVE11663.1|3077339_3078281_-	DUF2184 domain-containing protein	NA	A0A2H4J191	uncultured_Caudovirales_phage	77.1	1.7e-137
AVE11664.1|3078292_3078787_-	hypothetical protein	NA	A0A2H4JHM9	uncultured_Caudovirales_phage	62.7	4.2e-50
AVE11665.1|3078790_3079993_-	DUF2213 domain-containing protein	NA	A0A0M4R5A6	Salmonella_phage	54.1	2.6e-106
AVE11666.1|3080044_3080593_-	hypothetical protein	NA	A0A0M4REK0	Salmonella_phage	56.3	3.0e-49
AVE11667.1|3080648_3082100_-	hypothetical protein	NA	A0A0M4S6U1	Salmonella_phage	68.8	3.8e-192
AVE11668.1|3082337_3083738_-|terminase	PBSX family phage terminase large subunit	terminase	A0A077KAW0	Edwardsiella_phage	69.0	9.4e-188
AVE11669.1|3083688_3084441_-	hypothetical protein	NA	A0A077KBY7	Edwardsiella_phage	66.0	4.0e-12
AVE11670.1|3084542_3084863_-	negative regulator GrlR	NA	NA	NA	NA	NA
AVE11671.1|3085097_3085487_-	lipase chaperone	NA	A0A192Y6H8	Salmonella_phage	49.2	9.4e-21
AVE11672.1|3085483_3086014_-	lysozyme	NA	K7PLY1	Enterobacteria_phage	77.1	2.7e-79
AVE11673.1|3086016_3086265_-|lysis	lysis protein	lysis	NA	NA	NA	NA
AVE11674.1|3086670_3087453_-	antitermination protein	NA	F1C595	Cronobacter_phage	76.8	7.2e-113
AVE11675.1|3087449_3087926_-	hypothetical protein	NA	A0A286N2Q1	Klebsiella_phage	100.0	1.8e-90
AVE11676.1|3087922_3088885_-	DNA primase	NA	A0A286N2Q0	Klebsiella_phage	99.4	4.8e-183
AVE11677.1|3088886_3090545_-	helicase	NA	A0A286N2P9	Klebsiella_phage	96.0	0.0e+00
AVE11678.1|3090853_3091147_-	hypothetical protein	NA	A0A286S2B5	Klebsiella_phage	97.6	2.8e-38
AVE11679.1|3091121_3091343_-	XRE family transcriptional regulator	NA	A0A286S2C1	Klebsiella_phage	100.0	3.0e-32
AVE11680.1|3091440_3092109_+	LexA family transcriptional repressor	NA	A0A286S2B2	Klebsiella_phage	99.5	2.4e-125
AVE11681.1|3092279_3092594_+	hypothetical protein	NA	A0A286S1T9	Klebsiella_phage	100.0	1.0e-49
AVE11682.1|3092586_3092775_+	hypothetical protein	NA	A0A286S1P8	Klebsiella_phage	100.0	4.6e-26
AVE11683.1|3092944_3093310_+	hypothetical protein	NA	A0A286S1Q6	Klebsiella_phage	99.2	6.9e-58
AVE11684.1|3093302_3093557_+	hypothetical protein	NA	A0A286SGR4	Klebsiella_phage	97.6	3.1e-41
AVE11685.1|3093743_3094169_+	hypothetical protein	NA	A0A286S1S2	Klebsiella_phage	77.9	3.5e-53
AVE11686.1|3094165_3094360_+	hypothetical protein	NA	NA	NA	NA	NA
AVE11687.1|3094356_3095184_+|protease	serine protease	protease	Q8W654	Enterobacteria_phage	84.0	5.5e-111
AVE11688.1|3095288_3095807_+	hypothetical protein	NA	A0A286S1S7	Klebsiella_phage	98.8	1.7e-94
AVE11689.1|3095812_3096523_+	DNA-binding protein	NA	A0A286S260	Klebsiella_phage	88.3	2.1e-111
AVE11690.1|3096512_3096737_+	hypothetical protein	NA	A0A286S2B3	Klebsiella_phage	89.2	3.1e-29
AVE11691.1|3096733_3096946_+	hypothetical protein	NA	A0A286S2B6	Klebsiella_phage	98.6	3.4e-33
AVE11692.1|3096942_3097422_+	hypothetical protein	NA	NA	NA	NA	NA
AVE11693.1|3097600_3097843_+	AlpA family transcriptional regulator	NA	A0A0M4RTZ2	Salmonella_phage	73.8	2.2e-20
AVE11694.1|3097823_3099005_-	DUF4102 domain-containing protein	NA	A0A0M4QX09	Salmonella_phage	84.2	5.6e-202
AVE11695.1|3099201_3099750_+|protease	protease	protease	NA	NA	NA	NA
AVE11696.1|3099948_3101481_-	HD domain-containing protein	NA	A0A1B1ISR1	uncultured_Mediterranean_phage	30.0	1.1e-21
AVE11697.1|3101697_3102459_-	3-oxoacyl-ACP reductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.5	2.4e-20
>prophage 8
CP026585	Klebsiella pneumoniae strain WCHKP649 chromosome, complete genome	5461116	3265540	3353419	5461116	tail,integrase,holin,head,portal,tRNA,terminase,capsid	Klebsiella_phage(45.45%)	96	3292343:3292357	3351230:3351244
AVE11850.1|3265540_3266041_+|tRNA	YbaK/prolyl-tRNA synthetase associated domain-containing protein	tRNA	NA	NA	NA	NA
AVE11851.1|3266157_3266604_+	DUF441 domain-containing protein	NA	NA	NA	NA	NA
AVE13955.1|3266587_3267379_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AVE11852.1|3267480_3268665_+	cyanate MFS transporter	NA	NA	NA	NA	NA
AVE11853.1|3268696_3269389_-	hypothetical protein	NA	NA	NA	NA	NA
AVE11854.1|3269534_3270044_+	DUF523 domain-containing protein	NA	NA	NA	NA	NA
AVE11855.1|3270030_3270387_+	DUF488 domain-containing protein	NA	NA	NA	NA	NA
AVE11856.1|3270376_3270616_-	DUF333 domain-containing protein	NA	NA	NA	NA	NA
AVE11857.1|3270916_3271930_+	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	29.0	1.4e-12
AVE11858.1|3271987_3272089_+	hypothetical protein	NA	NA	NA	NA	NA
AVE13956.1|3272088_3272163_+	hypothetical protein	NA	NA	NA	NA	NA
AVE11859.1|3272280_3272406_+	hypothetical protein	NA	NA	NA	NA	NA
AVE11860.1|3272465_3272729_-	DUF2534 domain-containing protein	NA	NA	NA	NA	NA
AVE11861.1|3272859_3273498_-	leucine efflux protein	NA	NA	NA	NA	NA
AVE11862.1|3273587_3274502_-	kdo(2)-lipid IV(A) palmitoleoyltransferase	NA	A0A1W6JP29	Morganella_phage	50.4	1.1e-72
AVE11863.1|3274717_3274909_+	hypothetical protein	NA	NA	NA	NA	NA
AVE11864.1|3275163_3276207_-	type II asparaginase	NA	NA	NA	NA	NA
AVE11865.1|3276509_3277718_+	phosphodiesterase	NA	NA	NA	NA	NA
AVE11866.1|3277791_3279576_+	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	36.1	5.8e-17
AVE11867.1|3279582_3280473_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AVE11868.1|3280593_3282102_+	3,4-dihydroxybenzoate decarboxylase	NA	NA	NA	NA	NA
AVE11869.1|3282412_3283099_-	diguanylate phosphodiesterase	NA	NA	NA	NA	NA
AVE11870.1|3283496_3283676_-	hypothetical protein	NA	NA	NA	NA	NA
AVE11871.1|3283715_3284348_-	DNA-binding protein	NA	NA	NA	NA	NA
AVE11872.1|3284914_3285112_+	hypothetical protein	NA	NA	NA	NA	NA
AVE11873.1|3285227_3286238_-	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
AVE11874.1|3286234_3287641_-	cytochrome ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
AVE11875.1|3287696_3288584_-	Mn-containing catalase	NA	NA	NA	NA	NA
AVE11876.1|3288600_3289107_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
AVE11877.1|3289133_3289628_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
AVE11878.1|3289718_3289904_-	stress-induced acidophilic repeat motif-containing protein	NA	NA	NA	NA	NA
AVE11879.1|3290525_3291719_+	glutathione-dependent formaldehyde dehydrogenase	NA	NA	NA	NA	NA
AVE11880.1|3291831_3292059_+	DUF1272 domain-containing protein	NA	NA	NA	NA	NA
3292343:3292357	attL	TGGCTGGCGTTCTTT	NA	NA	NA	NA
AVE11881.1|3292495_3292819_+	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
AVE11882.1|3292811_3293204_+	amino acid-binding protein	NA	NA	NA	NA	NA
AVE11883.1|3293200_3293914_+	ArsR family transcriptional regulator	NA	NA	NA	NA	NA
AVE11884.1|3294186_3294339_-	isocitrate dehydrogenase	NA	Q77Z09	Phage_21	92.0	3.8e-18
AVE11885.1|3294493_3295990_-|tail	phage tail protein	tail	A0A0P0IDN1	Klebsiella_phage	63.7	1.4e-125
AVE11886.1|3296058_3308763_-	DUF1983 domain-containing protein	NA	Q6UAW1	Klebsiella_phage	47.1	0.0e+00
AVE11887.1|3308825_3309419_-|tail	tail assembly protein	tail	K7PHE5	Enterobacteria_phage	76.6	8.0e-80
AVE11888.1|3309445_3309868_-	hypothetical protein	NA	J9Q806	Salmonella_phage	50.0	5.9e-29
AVE11889.1|3309909_3310620_-	peptidase P60	NA	Q6UAW4	Klebsiella_phage	90.3	1.9e-136
AVE11890.1|3310621_3311377_-|tail	phage minor tail protein L	tail	Q6UAW5	Klebsiella_phage	80.5	4.6e-125
AVE11891.1|3311373_3311712_-|tail	phage tail protein	tail	Q6UAW6	Klebsiella_phage	88.4	1.4e-57
AVE11892.1|3311711_3315047_-|tail	phage tail tape measure protein	tail	Q6UAW7	Klebsiella_phage	88.3	0.0e+00
AVE11893.1|3315046_3315265_-	hypothetical protein	NA	Q6UAW9	Klebsiella_phage	90.5	5.4e-34
AVE11894.1|3315279_3315645_-|tail	phage tail protein	tail	Q6UAW8	Klebsiella_phage	89.3	1.6e-51
AVE11895.1|3315702_3316164_-|tail	phage tail protein	tail	Q6UAX0	Klebsiella_phage	83.7	7.8e-67
AVE11896.1|3316195_3316597_-	hypothetical protein	NA	Q6UAX1	Klebsiella_phage	94.0	2.3e-62
AVE11897.1|3316593_3316983_-	hypothetical protein	NA	Q6UAX2	Klebsiella_phage	86.0	9.6e-58
AVE11898.1|3316963_3317302_-|head,tail	head-tail adaptor protein	head,tail	Q6UAX3	Klebsiella_phage	90.2	2.8e-53
AVE11899.1|3317298_3317616_-|head,tail	phage gp6-like head-tail connector protein	head,tail	Q6UAX4	Klebsiella_phage	89.8	1.5e-45
AVE11900.1|3317596_3317857_-	hypothetical protein	NA	Q6UAX5	Klebsiella_phage	60.5	7.4e-22
AVE11901.1|3317915_3319202_-|capsid	phage major capsid protein	capsid	Q6UAX6	Klebsiella_phage	89.0	9.8e-216
AVE11902.1|3319279_3320200_-	S49 family peptidase	NA	Q6UAX7	Klebsiella_phage	88.2	9.6e-149
AVE11903.1|3320236_3321496_-|portal	phage portal protein	portal	Q6UAX8	Klebsiella_phage	89.8	1.8e-222
AVE11904.1|3321495_3321675_-	hypothetical protein	NA	Q6UAX9	Klebsiella_phage	57.6	3.1e-11
AVE11905.1|3321668_3323390_-|terminase	terminase large subunit	terminase	Q7Y413	Yersinia_phage	57.4	1.5e-190
AVE11906.1|3323389_3323824_-|terminase	phage terminase small subunit P27 family	terminase	A0A1J0GV10	Halomonas_phage	61.9	9.4e-30
AVE11907.1|3324072_3324504_-	hypothetical protein	NA	Q6UAS0	Klebsiella_phage	61.6	1.8e-41
AVE11908.1|3324500_3324824_-	hypothetical protein	NA	NA	NA	NA	NA
AVE11909.1|3324775_3325138_-	HNH endonuclease	NA	Q6UAS2	Klebsiella_phage	83.3	1.2e-57
AVE11910.1|3325464_3325689_+	hypothetical protein	NA	NA	NA	NA	NA
AVE11911.1|3325727_3326180_-	hypothetical protein	NA	NA	NA	NA	NA
AVE11912.1|3327114_3327465_-	hypothetical protein	NA	R9TPM9	Aeromonas_phage	38.1	7.9e-11
AVE11913.1|3327461_3327959_-	lysozyme	NA	A0A1V0E5Q7	Salmonella_phage	84.6	1.1e-77
AVE11914.1|3327958_3328174_-|holin	holin	holin	A5LH82	Enterobacteria_phage	88.7	2.7e-30
AVE11915.1|3330425_3331028_-	hypothetical protein	NA	H9C175	Pectobacterium_phage	68.6	1.1e-76
AVE11916.1|3331044_3332076_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	49.6	4.7e-96
AVE11917.1|3332075_3332279_-	hypothetical protein	NA	NA	NA	NA	NA
AVE11918.1|3332275_3332668_-	DNA-binding protein	NA	K7PHB4	Enterobacterial_phage	36.6	8.0e-12
AVE11919.1|3332708_3332999_-	hypothetical protein	NA	H6WRY6	Salmonella_phage	56.9	8.0e-17
AVE11920.1|3333010_3333244_-	DinI family protein	NA	K7PM44	Enterobacteria_phage	71.1	3.7e-25
AVE11921.1|3333322_3334807_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
AVE11922.1|3334806_3335058_-	hypothetical protein	NA	NA	NA	NA	NA
AVE11923.1|3335647_3337009_-	dGTPase	NA	NA	NA	NA	NA
AVE11924.1|3337182_3337896_-	hypothetical protein	NA	NA	NA	NA	NA
AVE13957.1|3338247_3339117_+	hypothetical protein	NA	NA	NA	NA	NA
AVE11925.1|3339205_3340597_+	hypothetical protein	NA	NA	NA	NA	NA
AVE11926.1|3340945_3341386_-	hypothetical protein	NA	NA	NA	NA	NA
AVE11927.1|3341399_3341864_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	72.2	4.1e-63
AVE13958.1|3341856_3342861_-	DNA-binding protein	NA	A0A0U2RT81	Escherichia_phage	40.0	1.0e-31
AVE11928.1|3342920_3343475_-	hypothetical protein	NA	NA	NA	NA	NA
AVE11929.1|3343477_3343702_-	Cro/Cl family transcriptional regulator	NA	H6WRX5	Salmonella_phage	62.5	1.3e-19
AVE11930.1|3343790_3344228_+	helix-turn-helix domain-containing protein	NA	H6WRX4	Salmonella_phage	62.2	1.3e-39
AVE11931.1|3344549_3344864_-	hypothetical protein	NA	NA	NA	NA	NA
AVE11932.1|3345026_3345245_+	hypothetical protein	NA	NA	NA	NA	NA
AVE11933.1|3345254_3345449_+	DUF1482 domain-containing protein	NA	NA	NA	NA	NA
AVE11934.1|3345491_3345836_+	transcriptional regulator	NA	NA	NA	NA	NA
AVE11935.1|3345977_3348116_+	exonuclease	NA	S4TNL0	Salmonella_phage	42.7	5.6e-99
AVE11936.1|3348168_3348414_+	excisionase	NA	NA	NA	NA	NA
AVE11937.1|3348394_3349522_+|integrase	integrase	integrase	O21925	Phage_21	58.4	4.4e-119
AVE11938.1|3349639_3350890_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	92.6	1.1e-19
AVE11939.1|3351130_3351781_+	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
3351230:3351244	attR	AAAGAACGCCAGCCA	NA	NA	NA	NA
AVE11940.1|3351797_3352256_+	NUDIX hydrolase	NA	NA	NA	NA	NA
AVE13959.1|3352312_3353419_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
>prophage 9
CP026585	Klebsiella pneumoniae strain WCHKP649 chromosome, complete genome	5461116	3462994	3495608	5461116	plate,tail,integrase,portal,terminase,capsid	Enterobacteria_phage(41.38%)	39	3461154:3461174	3495678:3495698
3461154:3461174	attL	AACCCGGAGTGCTCCGGGTTT	NA	NA	NA	NA
AVE12043.1|3462994_3464149_-	hypothetical protein	NA	B9A7A9	Serratia_phage	77.2	6.6e-171
AVE12044.1|3464300_3465482_+|tail	phage tail protein	tail	A0A0A7NV69	Enterobacteria_phage	69.4	8.0e-156
AVE12045.1|3465482_3465998_+|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	70.0	2.6e-63
AVE12046.1|3466049_3466349_+|tail	phage tail protein	tail	B9A7B2	Serratia_phage	72.7	2.9e-30
AVE12047.1|3466369_3466522_+|tail	GpE family phage tail protein	tail	O80316	Escherichia_phage	71.4	1.5e-11
AVE12048.1|3466511_3469247_+|tail	phage tail tape measure protein	tail	B9A7B3	Serratia_phage	80.6	2.0e-242
AVE12049.1|3469258_3469747_+|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	59.9	2.9e-51
AVE12050.1|3469844_3470921_-|tail	phage tail protein	tail	Q37842	Escherichia_phage	48.3	2.3e-32
AVE12051.1|3470932_3471676_-	hypothetical protein	NA	NA	NA	NA	NA
AVE12052.1|3471681_3473946_-	hypothetical protein	NA	B5TAB2	Burkholderia_phage	39.7	5.7e-102
AVE12053.1|3473947_3474550_-|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	44.8	1.8e-42
AVE12054.1|3474542_3475442_-|plate	baseplate assembly protein	plate	A0A0A7NPY5	Enterobacteria_phage	62.2	6.2e-92
AVE12055.1|3475428_3475797_-|plate	baseplate assembly protein	plate	A0A0A7NQ90	Enterobacteria_phage	57.4	2.3e-29
AVE12056.1|3475793_3476378_-|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	61.4	8.7e-63
AVE12057.1|3476377_3477019_-	phage virion morphogenesis protein	NA	A0A0M4RCU1	Salmonella_phage	49.8	1.4e-45
AVE12058.1|3477015_3477474_-|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	46.8	3.1e-31
AVE13965.1|3477470_3477734_-	peptidase	NA	NA	NA	NA	NA
AVE12059.1|3478010_3478562_-	lysozyme	NA	Q1I0Z1	Pasteurella_virus	42.5	6.8e-33
AVE12060.1|3478558_3478840_-	hypothetical protein	NA	NA	NA	NA	NA
AVE12061.1|3478830_3479031_-|tail	phage tail protein	tail	A0A0A7NV57	Enterobacteria_phage	64.6	3.0e-15
AVE12062.1|3479030_3479528_-|capsid	capsid assembly protein	capsid	B9A7B7	Serratia_phage	69.7	2.2e-59
AVE12063.1|3479630_3480491_-|terminase	terminase	terminase	B9A7B6	Serratia_phage	68.4	1.0e-83
AVE12064.1|3480537_3481587_-|capsid	phage major capsid protein, P2 family	capsid	A0A0M3ULA3	Salmonella_phage	53.9	2.3e-106
AVE12065.1|3481610_3482444_-|capsid	phage capsid protein	capsid	A0A0A7NRY7	Enterobacteria_phage	65.3	6.5e-96
AVE12066.1|3482604_3484326_+	oxidoreductase	NA	A0A0A7NV54	Enterobacteria_phage	66.5	4.3e-227
AVE12067.1|3484346_3485381_+|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	68.6	2.0e-139
AVE13966.1|3485788_3486103_-	hypothetical protein	NA	NA	NA	NA	NA
AVE12068.1|3486375_3486783_-	hypothetical protein	NA	NA	NA	NA	NA
AVE12069.1|3486954_3489549_-	replication endonuclease	NA	A0A0M4RTM8	Salmonella_phage	51.7	1.1e-192
AVE12070.1|3489541_3490558_-	DNA cytosine methyltransferase	NA	Q6J1P4	Burkholderia_virus	54.8	2.4e-92
AVE12071.1|3490859_3491828_-	adenine methylase	NA	A0A0M4QWR0	Salmonella_phage	49.1	3.1e-73
AVE12072.1|3491836_3492415_-	3'-5' exoribonuclease	NA	A0A192Y6E0	Salmonella_phage	39.5	2.7e-32
AVE12073.1|3492411_3492636_-	hypothetical protein	NA	NA	NA	NA	NA
AVE12074.1|3492703_3492976_-	hypothetical protein	NA	NA	NA	NA	NA
AVE12075.1|3492991_3493378_-	hypothetical protein	NA	NA	NA	NA	NA
AVE13967.1|3493394_3493592_-	DUF4761 domain-containing protein	NA	NA	NA	NA	NA
AVE12076.1|3493783_3494116_-	hypothetical protein	NA	NA	NA	NA	NA
AVE12077.1|3494210_3494513_+	XRE family transcriptional regulator	NA	Q1JS63	Enterobacteria_phage	61.0	2.6e-26
AVE12078.1|3494600_3495608_+|integrase	integrase	integrase	A0A0M4RTQ0	Salmonella_phage	52.1	7.6e-99
3495678:3495698	attR	AACCCGGAGTGCTCCGGGTTT	NA	NA	NA	NA
>prophage 10
CP026585	Klebsiella pneumoniae strain WCHKP649 chromosome, complete genome	5461116	3603922	3699983	5461116	transposase,plate,tail,integrase,head,portal,protease,tRNA,capsid	Salmonella_phage(55.0%)	101	3659448:3659466	3700058:3700076
AVE12171.1|3603922_3605215_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	44.7	7.3e-94
AVE12172.1|3605305_3606649_-	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	40.8	7.3e-81
AVE12173.1|3606657_3607269_-	outer membrane lipoprotein carrier protein LolA	NA	NA	NA	NA	NA
AVE12174.1|3607391_3611645_-	DNA translocase FtsK	NA	S5VNE3	Mycobacterium_phage	49.2	5.2e-88
AVE12175.1|3611780_3612275_-	leucine-responsive regulatory protein	NA	NA	NA	NA	NA
AVE12176.1|3612807_3613776_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.0	3.2e-62
AVE12177.1|3613890_3615657_+	thiol reductant ABC exporter subunit CydD	NA	W8CYL7	Bacillus_phage	25.9	2.3e-21
AVE12178.1|3615657_3617379_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	34.3	1.5e-14
AVE12179.1|3617423_3618125_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
AVE12180.1|3618478_3618697_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
AVE12181.1|3618817_3621097_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.0	1.6e-165
AVE12182.1|3621127_3621445_-|protease	ATP-dependent Clp protease adaptor ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	2.0e-13
AVE12183.1|3621770_3621992_+	cold shock domain protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	1.3e-16
AVE12184.1|3621946_3622129_-	hypothetical protein	NA	NA	NA	NA	NA
AVE12185.1|3622068_3624009_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.5	1.9e-37
AVE12186.1|3624005_3625121_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	52.7	1.3e-06
AVE12187.1|3625267_3626926_-	ATP-dependent endonuclease	NA	NA	NA	NA	NA
AVE12188.1|3627345_3628041_+	aquaporin Z	NA	NA	NA	NA	NA
AVE12189.1|3628156_3629056_+	lysine exporter LysO family protein	NA	NA	NA	NA	NA
AVE13972.1|3629199_3630852_+	hydroxylamine reductase	NA	NA	NA	NA	NA
AVE12190.1|3630862_3631831_+	NADH oxidoreductase	NA	NA	NA	NA	NA
AVE12191.1|3631781_3631985_+	hypothetical protein	NA	NA	NA	NA	NA
AVE12192.1|3632042_3632477_-	DoxX family protein	NA	NA	NA	NA	NA
AVE13973.1|3632628_3634347_+	ubiquinone-dependent pyruvate dehydrogenase	NA	NA	NA	NA	NA
AVE12193.1|3634385_3635387_+	low-specificity L-threonine aldolase	NA	NA	NA	NA	NA
AVE12194.1|3635397_3636840_+	DUF2867 domain-containing protein	NA	NA	NA	NA	NA
AVE12195.1|3636927_3637941_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
AVE12196.1|3637937_3638768_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1B0UZW5	Roseobacter_phage	31.6	4.1e-05
AVE12197.1|3638799_3639939_-	GGDEF domain-containing protein	NA	NA	NA	NA	NA
AVE12198.1|3639991_3640171_+	hypothetical protein	NA	NA	NA	NA	NA
AVE12199.1|3640816_3641332_+	lipoprotein	NA	NA	NA	NA	NA
AVE12200.1|3641558_3642287_+	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	37.1	1.2e-29
AVE13974.1|3642307_3643039_+	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AVE12201.1|3643045_3643762_+	arginine ABC transporter permease ArtQ	NA	NA	NA	NA	NA
AVE12202.1|3643761_3644430_+	arginine ABC transporter permease ArtM	NA	NA	NA	NA	NA
AVE12203.1|3644613_3645345_+	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AVE12204.1|3645387_3646860_-	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	31.8	7.9e-28
AVE12205.1|3646856_3647573_-	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	36.9	2.1e-34
AVE12206.1|3647651_3648779_-	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A2K5B251	Erysipelothrix_phage	25.6	1.3e-19
AVE12207.1|3648820_3649309_-	DUF2593 domain-containing protein	NA	NA	NA	NA	NA
AVE12208.1|3649366_3650212_-	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
AVE12209.1|3650208_3651162_-	putrescine ABC transporter permease	NA	NA	NA	NA	NA
AVE13975.1|3651172_3652306_-	polyamine ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	34.9	2.2e-30
AVE12210.1|3652469_3653582_-	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
AVE12211.1|3653930_3654410_-	YbjN domain-containing protein	NA	NA	NA	NA	NA
AVE12212.1|3654498_3655401_-	30S ribosomal protein S6--L-glutamate ligase	NA	A0A1D7SR78	Cyanophage	35.3	2.0e-34
AVE12213.1|3656222_3656510_-	hypothetical protein	NA	NA	NA	NA	NA
AVE12214.1|3656712_3656976_+	GrxA family glutaredoxin	NA	A0A2I7SAE2	Vibrio_phage	73.1	1.6e-27
AVE12215.1|3656982_3657366_-	hypothetical protein	NA	NA	NA	NA	NA
AVE13976.1|3657632_3659318_+	transporter	NA	NA	NA	NA	NA
3659448:3659466	attL	ATGGGTTTTTTGTTGCCTG	NA	NA	NA	NA
AVE12216.1|3659537_3659756_-	transcriptional regulator	NA	Q53ZE7	Salmonella_virus	69.0	7.5e-20
AVE12217.1|3659847_3660948_-	late control protein D	NA	A0A1S6KZZ5	Salmonella_phage	87.4	4.9e-176
AVE12218.1|3660944_3661430_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	75.6	7.2e-63
AVE12219.1|3661426_3664054_-|tail	phage tail tape measure protein	tail	E5FFG5	Burkholderia_phage	42.0	5.6e-117
AVE12220.1|3664046_3664166_-|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.2e-13
AVE12221.1|3664180_3664480_-|tail	phage tail assembly protein	tail	E5G6P9	Salmonella_phage	79.0	3.7e-33
AVE12222.1|3664532_3665048_-|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	85.4	1.3e-81
AVE12223.1|3665057_3666230_-|tail	phage tail protein	tail	A0A1S6KZY7	Salmonella_phage	93.3	1.9e-210
AVE12224.1|3666368_3667445_-|tail	phage tail protein	tail	Q37842	Escherichia_phage	44.8	1.2e-25
AVE12225.1|3667474_3667678_-	hypothetical protein	NA	NA	NA	NA	NA
AVE12226.1|3667674_3668406_-	hypothetical protein	NA	NA	NA	NA	NA
AVE12227.1|3668409_3671361_-	hypothetical protein	NA	A0A2H4N7A3	Pectobacterium_phage	50.9	1.2e-06
AVE13977.1|3671362_3671962_-|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	60.5	1.3e-58
AVE12228.1|3671954_3672863_-|plate	baseplate assembly protein	plate	E5G6N8	Salmonella_phage	66.9	7.6e-106
AVE12229.1|3672849_3673212_-|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	83.9	4.9e-48
AVE12230.1|3673208_3673781_-|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	72.3	4.7e-77
AVE13978.1|3673964_3674102_+	ABC transporter	NA	NA	NA	NA	NA
AVE12231.1|3674140_3675121_-|transposase	IS5 family transposase ISKpn26	transposase	A0A077SK28	Escherichia_phage	99.4	1.0e-185
AVE12232.1|3675258_3675768_+	hypothetical protein	NA	NA	NA	NA	NA
AVE12233.1|3675764_3676211_-	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	71.2	2.2e-50
AVE12234.1|3676203_3676635_-|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	82.5	9.9e-64
AVE12235.1|3676730_3677159_-	hypothetical protein	NA	A0A1S6KZX8	Salmonella_phage	77.9	9.6e-51
AVE12236.1|3677155_3677539_-	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	42.0	2.1e-17
AVE12237.1|3677543_3678053_-	lysozyme	NA	E5G6N1	Salmonella_phage	83.4	2.1e-81
AVE12238.1|3678033_3678249_-	hypothetical protein	NA	E5G6N0	Salmonella_phage	90.1	3.6e-30
AVE12239.1|3678252_3678456_-|tail	phage tail protein	tail	A0A1S6KZY4	Salmonella_phage	88.1	1.3e-29
AVE12240.1|3678455_3678920_-|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	89.0	8.4e-77
AVE12241.1|3679015_3679666_-	hypothetical protein	NA	E5G6M7	Salmonella_phage	96.3	8.7e-112
AVE12242.1|3679669_3680728_-|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	93.1	1.1e-180
AVE12243.1|3680744_3681578_-|capsid	capsid protein	capsid	A0A1S6KZW9	Salmonella_phage	88.8	6.3e-123
AVE12244.1|3681720_3683487_+	oxidoreductase	NA	A0A1S6KZW3	Salmonella_phage	99.0	0.0e+00
AVE12245.1|3683486_3684512_+|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	86.7	7.6e-171
AVE12246.1|3684573_3686316_-	hypothetical protein	NA	NA	NA	NA	NA
AVE12247.1|3686591_3687269_-	hypothetical protein	NA	NA	NA	NA	NA
AVE12248.1|3687383_3687689_-	DinI family protein	NA	E5G6M1	Salmonella_phage	100.0	4.7e-36
AVE13979.1|3687627_3687816_-	hypothetical protein	NA	E5G6M0	Salmonella_phage	98.4	5.5e-27
AVE12249.1|3687916_3689401_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
AVE12250.1|3689400_3689652_-	hypothetical protein	NA	NA	NA	NA	NA
AVE12251.1|3689879_3692294_-	replication endonuclease	NA	E5G6L9	Salmonella_phage	97.5	0.0e+00
AVE12252.1|3692290_3693148_-	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	95.4	2.0e-156
AVE12253.1|3693144_3693372_-	hypothetical protein	NA	E5G6L7	Salmonella_phage	98.7	6.0e-36
AVE12254.1|3693371_3693605_-	DUF2732 domain-containing protein	NA	E5G6L6	Salmonella_phage	96.1	4.1e-32
AVE12255.1|3693672_3694014_-	hypothetical protein	NA	E5G6L5	Salmonella_phage	99.1	4.6e-56
AVE12256.1|3693977_3694178_-	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	97.0	1.6e-32
AVE12257.1|3694185_3694695_-	hypothetical protein	NA	E5G6L3	Salmonella_phage	98.8	5.8e-87
AVE12258.1|3694727_3694949_-	regulator	NA	NA	NA	NA	NA
AVE12259.1|3695094_3695973_+	Repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	39.9	1.7e-30
AVE12260.1|3695984_3696929_+	hypothetical protein	NA	NA	NA	NA	NA
AVE12261.1|3697027_3698512_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
AVE12262.1|3698511_3698763_-	hypothetical protein	NA	NA	NA	NA	NA
AVE12263.1|3698930_3699983_+|integrase	integrase	integrase	A0A218M4I3	Erwinia_phage	57.0	1.0e-106
3700058:3700076	attR	ATGGGTTTTTTGTTGCCTG	NA	NA	NA	NA
>prophage 11
CP026585	Klebsiella pneumoniae strain WCHKP649 chromosome, complete genome	5461116	4351766	4363419	5461116	integrase	Enterobacteria_phage(70.0%)	13	4352216:4352230	4375272:4375286
AVE12846.1|4351766_4352870_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.5	4.8e-62
4352216:4352230	attL	CAATCTCTCCGCGCT	NA	NA	NA	NA
AVE12847.1|4352880_4354134_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	44.9	8.9e-89
AVE12848.1|4354486_4355677_+|integrase	integrase	integrase	Q7M297	Enterobacteria_phage	62.7	6.4e-145
AVE12849.1|4355664_4356615_+	cobyrinic acid a,c-diamide synthase	NA	A0A1X9IGI7	Lactococcus_phage	27.1	1.2e-13
AVE12850.1|4356614_4357040_+	hypothetical protein	NA	NA	NA	NA	NA
AVE12851.1|4357607_4358174_-	Polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	63.8	9.7e-59
AVE12852.1|4358191_4358437_-	hypothetical protein	NA	Q7M294	Enterobacteria_phage	56.8	5.5e-19
AVE12853.1|4358433_4359171_-	glycoprotein 3	NA	Q7M2A2	Enterobacteria_phage	59.4	1.9e-70
AVE12854.1|4359712_4359979_+	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	71.6	2.6e-30
AVE12855.1|4359975_4360533_+	Ash-like/host cell division inhibitor Icd-like protein	NA	Q7M2A7	Enterobacteria_phage	70.4	1.8e-33
AVE12856.1|4360529_4360757_+	hypothetical protein	NA	NA	NA	NA	NA
AVE12857.1|4360753_4361074_+	hypothetical protein	NA	NA	NA	NA	NA
AVE12858.1|4361085_4363419_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	82.2	0.0e+00
4375272:4375286	attR	CAATCTCTCCGCGCT	NA	NA	NA	NA
>prophage 12
CP026585	Klebsiella pneumoniae strain WCHKP649 chromosome, complete genome	5461116	4831656	4841181	5461116	transposase	Enterobacteria_phage(83.33%)	10	NA	NA
AVE13262.1|4831656_4833990_-	DNA primase	NA	Q7M2A8	Enterobacteria_phage	83.9	0.0e+00
AVE13263.1|4834004_4834325_-	hypothetical protein	NA	NA	NA	NA	NA
AVE13264.1|4834321_4834549_-	hypothetical protein	NA	NA	NA	NA	NA
AVE13265.1|4834545_4835094_-	Ash-like/host cell division inhibitor Icd-like protein	NA	Q7M2A7	Enterobacteria_phage	69.4	1.1e-30
AVE13266.1|4835917_4836655_+	glycoprotein 3	NA	Q7M2A2	Enterobacteria_phage	59.4	1.1e-70
AVE13267.1|4836651_4836897_+	hypothetical protein	NA	Q7M294	Enterobacteria_phage	56.8	5.5e-19
AVE13268.1|4836914_4837481_+	Polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	63.8	9.7e-59
AVE13269.1|4838221_4839301_+	hypothetical protein	NA	NA	NA	NA	NA
AVE13270.1|4839301_4839838_+	hypothetical protein	NA	NA	NA	NA	NA
AVE13271.1|4840200_4841181_+|transposase	IS5 family transposase ISKpn26	transposase	A0A077SK28	Escherichia_phage	99.4	1.0e-185
>prophage 1
CP026584	Klebsiella pneumoniae strain WCHKP649 plasmid pKPC2_095649, complete sequence	156099	1796	21170	156099	transposase,protease	Escherichia_phage(50.0%)	17	NA	NA
AVE08598.1|1796_2450_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
AVE08599.1|2669_3134_+	mRNA interferase PemK	NA	NA	NA	NA	NA
AVE08600.1|3130_3235_+	hypothetical protein	NA	NA	NA	NA	NA
AVE08601.1|4444_5149_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AVE08602.1|6417_7299_-	carbapenem-hydrolyzing class A beta-lactamase KPC-2	NA	A0A1B0VBP7	Salmonella_phage	52.2	2.2e-73
AVE08603.1|7574_8555_-|transposase	IS481 family transposase ISKpn27	transposase	A8RHK4	Spiroplasma_virus	27.4	2.9e-10
AVE08604.1|8677_9151_-	recombinase	NA	Q1MVP4	Enterobacteria_phage	99.3	3.3e-76
AVE08605.1|9190_9895_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AVE08606.1|10405_11281_+	class A extended-spectrum beta-lactamase CTX-M-65	NA	A0A1B0VBP7	Salmonella_phage	98.9	6.8e-152
AVE08607.1|11360_12284_+|transposase	IS5/IS1182 family transposase	transposase	Q9MCT5	Escherichia_phage	99.7	2.2e-177
AVE08608.1|14034_14739_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AVE08609.1|15849_16554_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AVE08610.1|17231_17420_-	hypothetical protein	NA	NA	NA	NA	NA
AVE08773.1|17511_18048_+	recombinase	NA	Q1MVP4	Enterobacteria_phage	100.0	2.8e-84
AVE08611.1|18230_19091_+	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
AVE08612.1|19260_20016_+	16S rRNA (guanine(1405)-N(7))-methyltransferase RmtB1	NA	NA	NA	NA	NA
AVE08613.1|20465_21170_-|transposase	IS6 family transposase IS15DI	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
>prophage 2
CP026584	Klebsiella pneumoniae strain WCHKP649 plasmid pKPC2_095649, complete sequence	156099	85132	98938	156099	transposase	Enterobacteria_phage(18.18%)	18	NA	NA
AVE08686.1|85132_85393_-	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	46.2	4.1e-12
AVE08687.1|85579_85771_-	hypothetical protein	NA	NA	NA	NA	NA
AVE08688.1|85813_86320_-	antirestriction protein	NA	A0A1I9S7Y0	Rhodococcus_phage	31.8	4.8e-09
AVE08689.1|86724_87504_-	hypothetical protein	NA	NA	NA	NA	NA
AVE08690.1|87557_87977_-	DUF1380 domain-containing protein	NA	NA	NA	NA	NA
AVE08691.1|87987_88209_-	hypothetical protein	NA	NA	NA	NA	NA
AVE08692.1|88208_88886_-	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	36.9	1.6e-28
AVE08693.1|89244_89916_+	DNA breaking-rejoining protein	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	61.7	5.1e-83
AVE08694.1|90095_90518_+	peptidase	NA	A0A1W6JNS2	Morganella_phage	51.5	3.1e-30
AVE08695.1|90517_91789_+	translesion error-prone DNA polymerase V subunit UmuC	NA	F1C5A5	Cronobacter_phage	63.0	6.1e-154
AVE08696.1|91924_92896_-	ParB/RepB/Spo0J family partition protein	NA	Q1MVJ4	Enterobacteria_phage	68.9	1.4e-113
AVE08697.1|92892_94098_-	ParA family protein	NA	Q1MVJ3	Enterobacteria_phage	89.2	1.1e-205
AVE08698.1|94460_95093_+	LacI family DNA-binding transcriptional regulator	NA	A0A1V0E035	Clostridioides_phage	31.9	2.5e-07
AVE08699.1|95146_95347_+	hypothetical protein	NA	NA	NA	NA	NA
AVE08700.1|95493_96444_+|transposase	ISNCY family transposase	transposase	Q2A0A7	Sodalis_phage	55.6	6.6e-76
AVE08701.1|96440_97052_-	DUF2913 domain-containing protein	NA	NA	NA	NA	NA
AVE08778.1|97048_97444_-	hypothetical protein	NA	NA	NA	NA	NA
AVE08702.1|97957_98938_+|transposase	IS5 family transposase ISKpn26	transposase	A0A077SK28	Escherichia_phage	99.4	1.0e-185
>prophage 3
CP026584	Klebsiella pneumoniae strain WCHKP649 plasmid pKPC2_095649, complete sequence	156099	124774	135933	156099		Escherichia_phage(50.0%)	11	NA	NA
AVE08741.1|124774_125476_-	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	36.2	1.6e-26
AVE08742.1|125912_126143_-	hypothetical protein	NA	NA	NA	NA	NA
AVE08743.1|126205_126877_-	Mediator of plasmid stability	NA	NA	NA	NA	NA
AVE08744.1|126879_127851_-	StbA family protein	NA	A0A222YXF2	Escherichia_phage	46.8	1.1e-73
AVE08745.1|128099_129584_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
AVE08746.1|129583_129835_-	hypothetical protein	NA	NA	NA	NA	NA
AVE08747.1|129993_130425_+	peptidase	NA	A0A1W6JNS2	Morganella_phage	53.3	2.1e-29
AVE08748.1|130424_131696_+	DNA polymerase V subunit UmuC	NA	F1C5A5	Cronobacter_phage	63.7	7.5e-152
AVE08749.1|131777_132755_-	ParB/RepB/Spo0J family partition protein	NA	Q38420	Escherichia_phage	53.8	1.4e-86
AVE08750.1|132751_133957_-	ParA family protein	NA	A0A077SL49	Escherichia_phage	69.3	5.3e-163
AVE08751.1|135066_135933_-	RepB family plasmid replication initiator protein	NA	A0A222YYK1	Escherichia_phage	31.1	1.5e-23
