The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP020409	Yersinia sp. FDAARGOS_228 chromosome, complete genome	4963041	1700700	1708834	4963041	integrase	uncultured_Mediterranean_phage(33.33%)	6	1695152:1695166	1714174:1714188
1695152:1695166	attL	CTGTTTTCATTTCTT	NA	NA	NA	NA
ARB83910.1|1700700_1701453_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	50.8	1.6e-64
ARB83911.1|1701475_1702102_+	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	51.2	4.8e-35
ARB83912.1|1702501_1703485_+	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	32.8	1.3e-07
ARB83913.1|1703539_1704538_+	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.3	3.6e-32
ARB83914.1|1704644_1707206_-	DNA mismatch repair protein MutS	NA	A0A1V0SJ67	Klosneuvirus	24.4	1.3e-25
ARB83915.1|1707364_1708834_+|integrase	integrase	integrase	A0A0R6PGY7	Moraxella_phage	27.4	1.3e-22
1714174:1714188	attR	AAGAAATGAAAACAG	NA	NA	NA	NA
>prophage 2
CP020409	Yersinia sp. FDAARGOS_228 chromosome, complete genome	4963041	2191646	2200566	4963041		Escherichia_phage(71.43%)	10	NA	NA
ARB84304.1|2191646_2192216_+	N-acetyltransferase	NA	D0R097	Streptococcus_phage	28.5	1.3e-10
ARB84305.1|2192352_2193588_+	alanine transaminase	NA	NA	NA	NA	NA
ARB84306.1|2193763_2194288_+	cytochrome b	NA	A0A0U2QLA7	Escherichia_phage	51.0	7.6e-26
AVI44523.1|2194346_2194421_-	membrane protein YpdK	NA	NA	NA	NA	NA
ARB84307.1|2194929_2195361_-	hypothetical protein	NA	Q7Y3V7	Yersinia_phage	49.3	6.7e-28
ARB84308.2|2195457_2196003_-	(Fe-S)-binding protein	NA	NA	NA	NA	NA
ARB84309.1|2196017_2196632_-	molecular chaperone	NA	A0A077SLS7	Escherichia_phage	48.7	1.9e-44
ARB84310.1|2196735_2197512_-	diguanylate cyclase	NA	A0A077SK59	Escherichia_phage	42.2	7.8e-43
ARB84311.1|2197513_2198131_-	dimethylsulfoxide reductase, chain B	NA	A0A077SL61	Escherichia_phage	70.2	3.4e-89
ARB84312.1|2198142_2200566_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	55.8	4.8e-264
>prophage 3
CP020409	Yersinia sp. FDAARGOS_228 chromosome, complete genome	4963041	2430133	2445782	4963041	plate,tail,protease	Enterobacterial_phage(16.67%)	21	NA	NA
ARB84491.2|2430133_2431078_-|protease	protease	protease	NA	NA	NA	NA
ARB84492.1|2431245_2431488_-	DinI family protein	NA	K7PKM2	Enterobacterial_phage	70.9	1.7e-25
ARB84493.1|2431737_2432460_-	helix-turn-helix domain-containing protein	NA	F1C599	Cronobacter_phage	51.1	6.3e-63
ARB84494.2|2432416_2432626_-	hypothetical protein	NA	NA	NA	NA	NA
ARB84495.1|2432724_2433204_+	antitermination protein Q	NA	K7PGW2	Enterobacterial_phage	61.6	1.6e-38
ARB84496.1|2433466_2433745_+	hypothetical protein	NA	H6WRZ3	Salmonella_phage	47.2	1.6e-14
ARB84497.1|2433746_2434262_+	lysozyme	NA	A0A2H4JCH1	uncultured_Caudovirales_phage	58.4	1.9e-53
ARB84498.1|2434258_2434588_+	DUF2570 domain-containing protein	NA	NA	NA	NA	NA
ARB84499.1|2434896_2435427_+	ATP-binding protein	NA	NA	NA	NA	NA
ARB84500.1|2435431_2435596_+	DUF2635 domain-containing protein	NA	NA	NA	NA	NA
ARB84501.1|2435622_2437131_+|tail	phage tail protein	tail	B5TK67	Pseudomonas_phage	45.8	3.9e-107
ARB84502.1|2437172_2437541_+|tail	phage tail protein	tail	NA	NA	NA	NA
ARB84503.1|2437542_2437842_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
ARB84504.1|2437962_2439309_+	chemotaxis protein	NA	NA	NA	NA	NA
ARB84505.1|2439412_2440819_+	hypothetical protein	NA	Q8SBG8	Shigella_phage	32.8	5.4e-18
ARB84506.1|2440815_2441886_+|tail	phage tail protein	tail	M4M9L5	Vibrio_phage	29.8	2.5e-39
ARB84507.1|2441901_2442495_+|plate	baseplate assembly protein	plate	NA	NA	NA	NA
ARB84508.1|2442494_2442932_+	hypothetical protein	NA	A0A0C4UR04	Shigella_phage	46.2	2.9e-18
ARB84509.1|2442935_2444072_+|plate	phage baseplate protein	plate	B5TK75	Pseudomonas_phage	30.5	7.7e-31
ARB84510.1|2444068_2444665_+	DUF2313 domain-containing protein	NA	A0A2P9JZK7	Alteromonadaceae_phage	37.8	6.2e-32
ARB84511.1|2444714_2445782_+	hypothetical protein	NA	A9YX14	Burkholderia_phage	48.4	1.6e-46
>prophage 4
CP020409	Yersinia sp. FDAARGOS_228 chromosome, complete genome	4963041	2875375	2889113	4963041	tRNA,integrase	Pectobacterium_phage(53.33%)	22	2871463:2871477	2882544:2882558
2871463:2871477	attL	TTTTGCTCTGGCCTT	NA	NA	NA	NA
ARB84836.1|2875375_2876458_-|integrase	integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	51.0	9.4e-103
ARB84837.1|2876432_2876699_-	excisionase	NA	A0A2H4J5E1	uncultured_Caudovirales_phage	42.9	1.1e-09
ARB84838.1|2876771_2877284_-	hypothetical protein	NA	H9C156	Pectobacterium_phage	45.9	7.4e-34
ARB84839.1|2877280_2879374_-	hypothetical protein	NA	H9C157	Pectobacterium_phage	34.4	3.4e-93
ARB84840.1|2879450_2879723_-	hypothetical protein	NA	NA	NA	NA	NA
ARB84841.1|2879863_2880094_-	hypothetical protein	NA	A0A2H4JG91	uncultured_Caudovirales_phage	43.7	1.6e-12
ARB84842.1|2880311_2880647_-	hypothetical protein	NA	NA	NA	NA	NA
ARB84843.1|2880873_2881110_-	hypothetical protein	NA	NA	NA	NA	NA
ARB84844.1|2881231_2881456_-	hypothetical protein	NA	NA	NA	NA	NA
ARB84845.1|2881630_2882023_-	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	55.4	1.0e-30
ARB84846.1|2882104_2882302_+	transcriptional regulator	NA	H9C161	Pectobacterium_phage	49.2	7.1e-09
ARB84847.1|2882342_2882783_+|tRNA	tRNA-(guanine-N1)-methyltransferase	tRNA	H9C162	Pectobacterium_phage	53.1	1.9e-33
2882544:2882558	attR	AAGGCCAGAGCAAAA	NA	NA	NA	NA
ARB84848.1|2882796_2883048_+	cell envelope biogenesis protein OmpA	NA	NA	NA	NA	NA
ARB84849.1|2883040_2883229_+	hypothetical protein	NA	NA	NA	NA	NA
ARB84850.1|2883241_2884276_+	hypothetical protein	NA	G9L6A8	Escherichia_phage	55.3	1.5e-41
ARB86716.1|2884304_2884712_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	47.2	1.2e-31
ARB84851.1|2884726_2885227_+	hypothetical protein	NA	H9C166	Pectobacterium_phage	44.5	3.9e-19
ARB84852.1|2885223_2887389_+	DNA cytosine methyltransferase	NA	H9C171	Pectobacterium_phage	50.4	1.9e-216
ARB84853.1|2887535_2887718_+	hypothetical protein	NA	NA	NA	NA	NA
ARB84854.1|2887792_2888386_+	DUF1367 domain-containing protein	NA	H9C173	Pectobacterium_phage	56.6	2.0e-59
ARB84855.1|2888394_2888679_+	DUF1364 domain-containing protein	NA	H9C174	Pectobacterium_phage	78.7	6.1e-38
ARB86717.1|2888687_2889113_+	antitermination protein Q	NA	K7PGW2	Enterobacterial_phage	62.5	2.4e-38
>prophage 5
CP020409	Yersinia sp. FDAARGOS_228 chromosome, complete genome	4963041	2892808	2917248	4963041	head,terminase,tail	Cronobacter_phage(55.0%)	27	NA	NA
ARB84860.1|2892808_2893126_+	hypothetical protein	NA	H6WRZ3	Salmonella_phage	62.1	9.3e-27
ARB84861.1|2893109_2893616_+	lysozyme	NA	I6PBN2	Cronobacter_phage	59.1	3.4e-47
ARB84862.1|2893600_2893936_+	DUF2570 domain-containing protein	NA	NA	NA	NA	NA
ARB84863.1|2894211_2894532_-	hypothetical protein	NA	NA	NA	NA	NA
ARB84864.1|2894824_2895151_+	hypothetical protein	NA	NA	NA	NA	NA
ARB84865.1|2895319_2895922_+	hypothetical protein	NA	A0A077KBY7	Edwardsiella_phage	73.0	4.0e-71
ARB84866.1|2895921_2897403_+|terminase	terminase	terminase	A0A1W6JNY3	Morganella_phage	83.0	1.1e-250
ARB86718.1|2897447_2898890_+	DUF1073 domain-containing protein	NA	F1C5D7	Cronobacter_phage	55.3	2.6e-132
ARB84867.1|2898891_2899791_+|head	phage head morphogenesis protein	head	F1C5D8	Cronobacter_phage	59.7	2.2e-97
ARB84868.2|2899827_2900571_+	hypothetical protein	NA	NA	NA	NA	NA
ARB84869.1|2900622_2901972_+	DUF2213 domain-containing protein	NA	F1C5D9	Cronobacter_phage	52.9	9.8e-126
ARB84870.1|2901972_2902401_+	hypothetical protein	NA	NA	NA	NA	NA
ARB84871.1|2902411_2903494_+	hypothetical protein	NA	A0A125RNM3	Pseudomonas_phage	43.8	4.4e-76
ARB84872.1|2903504_2903789_+	hypothetical protein	NA	NA	NA	NA	NA
ARB84873.1|2903791_2904172_+	hypothetical protein	NA	F1C5E2	Cronobacter_phage	49.6	7.2e-26
ARB84874.1|2904171_2904483_+	hypothetical protein	NA	NA	NA	NA	NA
ARB84875.1|2904479_2904830_+	hypothetical protein	NA	G0ZNE2	Cronobacter_phage	53.4	1.8e-26
ARB84876.1|2904831_2905200_+	hypothetical protein	NA	F1C5E3	Cronobacter_phage	68.0	7.7e-41
ARB84877.1|2905196_2905580_+	hypothetical protein	NA	G0ZNE4	Cronobacter_phage	68.5	5.7e-47
ARB84878.1|2905604_2906354_+	DNA breaking-rejoining protein	NA	G0ZNE6	Cronobacter_phage	48.8	4.0e-52
ARB84879.1|2906493_2907183_+	hypothetical protein	NA	A0A1W6JNX2	Morganella_phage	50.9	3.0e-54
ARB84880.1|2907175_2910928_+	hypothetical protein	NA	A0A1W6JNU2	Morganella_phage	39.9	2.2e-159
ARB84881.1|2910924_2911398_+	hypothetical protein	NA	F1C5F0	Cronobacter_phage	53.9	1.6e-46
ARB84882.1|2911397_2911868_+	DUF1833 domain-containing protein	NA	B1GS46	Salmonella_phage	46.8	3.0e-37
ARB84883.1|2911903_2912296_+	peptidoglycan endopeptidase	NA	F1C5F2	Cronobacter_phage	43.5	1.2e-28
ARB84884.1|2912282_2914778_+|tail	phage tail protein	tail	A0A1B1W274	Salmonella_phage	49.1	4.4e-220
ARB84885.1|2914836_2917248_+	hypothetical protein	NA	A0A291AXF7	Shigella_phage	43.6	2.2e-43
>prophage 6
CP020409	Yersinia sp. FDAARGOS_228 chromosome, complete genome	4963041	2999262	3010592	4963041	tRNA	Anomala_cuprea_entomopoxvirus(16.67%)	10	NA	NA
ARB84957.1|2999262_3000789_-	sugar ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	26.0	6.3e-12
ARB84958.1|3001123_3001936_+	IclR family transcriptional regulator	NA	NA	NA	NA	NA
AVI44457.1|3002079_3002793_+	DUF554 domain-containing protein	NA	NA	NA	NA	NA
ARB84959.1|3002904_3003117_-	KTSC domain-containing protein	NA	A0A0K1LMB5	Caulobacter_phage	43.5	3.4e-09
ARB84960.1|3003569_3005498_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	36.8	9.7e-127
ARB84961.1|3005501_3006053_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	33.7	3.4e-16
ARB84962.1|3006148_3006346_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
ARB84963.1|3006383_3006740_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
ARB84964.1|3007207_3008191_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2H4UW22	Bodo_saltans_virus	38.0	3.8e-34
ARB84965.1|3008204_3010592_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	A0A1L3IZU3	BeAn_58058_virus	25.8	4.3e-07
>prophage 7
CP020409	Yersinia sp. FDAARGOS_228 chromosome, complete genome	4963041	3555428	3592363	4963041	plate,tail,head,integrase,capsid,portal,holin	Escherichia_phage(38.24%)	47	3555584:3555634	3592531:3592581
ARB86767.1|3555428_3555578_+|integrase	integrase	integrase	F1C5B2	Cronobacter_phage	73.0	6.3e-10
3555584:3555634	attL	TTTGTTGGTGGGTCGTGCAGGGTTCGAACCTGCGACCAATTGATTAAGAGT	NA	NA	NA	NA
ARB85388.1|3555852_3556464_+	protein cII	NA	NA	NA	NA	NA
ARB85389.1|3556458_3557496_-	beta family protein	NA	NA	NA	NA	NA
ARB85390.1|3557495_3558038_-	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
ARB86768.1|3558038_3558539_-	transmembrane HD family hydrolase	NA	NA	NA	NA	NA
ARB85391.1|3558972_3559983_-|integrase	integrase	integrase	A0A218M4I3	Erwinia_phage	61.3	1.1e-116
ARB85392.1|3559992_3560580_-	transcriptional regulator	NA	A0A1S6KZZ7	Salmonella_phage	35.3	9.5e-25
ARB86769.1|3560779_3560959_+	hypothetical protein	NA	NA	NA	NA	NA
AVI44475.1|3560986_3561508_+	hypothetical protein	NA	A0A0M4QWN1	Salmonella_phage	38.3	2.3e-22
ARB85393.1|3561508_3561967_-	hypothetical protein	NA	NA	NA	NA	NA
ARB86770.1|3562383_3562851_+	replication protein B	NA	M1SV55	Escherichia_phage	53.9	2.1e-43
ARB86771.1|3562918_3563170_+	DUF2732 domain-containing protein	NA	NA	NA	NA	NA
ARB85394.1|3563181_3563400_+	hypothetical protein	NA	Q6K1F5	Salmonella_virus	53.5	1.1e-13
ARB85395.1|3563396_3565667_+	replication endonuclease	NA	U5N0W3	Enterobacteria_phage	60.2	1.1e-265
ARB85396.1|3565779_3565974_+	hypothetical protein	NA	NA	NA	NA	NA
ARB85397.1|3566429_3567299_+	DUF559 domain-containing protein	NA	NA	NA	NA	NA
ARB85398.1|3567616_3567871_+	type II toxin-antitoxin system HicA family toxin	NA	NA	NA	NA	NA
ARB85399.1|3567867_3568209_+	type II toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
ARB85400.1|3568947_3571974_+	NACHT domain-containing protein	NA	NA	NA	NA	NA
AVI44476.1|3572052_3573072_-|portal	phage portal protein	portal	F1BUR7	Erwinia_phage	75.1	9.3e-153
ARB85401.1|3573071_3574835_-	oxidoreductase	NA	F1BUR2	Erwinia_phage	80.4	3.2e-286
ARB85402.1|3574977_3575799_+|capsid	GPO family capsid scaffolding protein	capsid	Q6K1I7	Salmonella_virus	61.1	2.5e-92
ARB85403.1|3575820_3576888_+|capsid	phage major capsid protein, P2 family	capsid	Q778Y7	Enterobacteria_phage	72.8	9.8e-145
ARB85404.1|3576891_3577548_+	hypothetical protein	NA	F1BUQ7	Erwinia_phage	67.6	6.8e-72
ARB85405.1|3577637_3578144_+|head	head completion/stabilization protein	head	M1SNN6	Escherichia_phage	78.7	2.6e-71
ARB85406.1|3578143_3578347_+|tail	phage tail protein	tail	A0A0F7LCN2	Escherichia_phage	80.6	8.0e-24
ARB85407.1|3578337_3578559_+	primosomal protein	NA	A0A218M4L5	Erwinia_phage	71.2	6.0e-25
ARB85408.1|3578542_3579052_+	lysozyme	NA	A0A218M4K3	Erwinia_phage	80.2	9.6e-74
ARB85409.1|3579048_3579474_+	protein lysB	NA	O80310	Escherichia_phage	65.2	2.4e-38
ARB85410.1|3579361_3579607_+|holin	holin	holin	S4TNY4	Salmonella_phage	78.2	3.2e-27
ARB85411.1|3579569_3580037_+|tail	phage tail protein	tail	A0A0F7LA33	Escherichia_phage	78.7	7.2e-68
ARB85412.1|3580029_3580476_+	phage virion morphogenesis protein	NA	O80313	Escherichia_phage	69.2	2.5e-49
ARB85413.1|3580509_3581175_-	hypothetical protein	NA	NA	NA	NA	NA
ARB85414.1|3581292_3581928_+|plate	phage baseplate assembly protein V	plate	U5N3F0	Enterobacteria_phage	81.5	1.2e-94
ARB85415.1|3581924_3582272_+|plate	baseplate assembly protein	plate	A0A0F7LDQ1	Escherichia_phage	73.0	1.7e-42
ARB85416.1|3582276_3583185_+|plate	baseplate assembly protein	plate	A0A218M4K5	Erwinia_phage	81.8	1.0e-134
ARB85417.1|3583177_3583783_+|tail	phage tail protein I	tail	A0A218M4J3	Erwinia_phage	76.9	2.0e-86
ARB85418.1|3583787_3585062_+|tail	phage tail protein	tail	M1TAS6	Escherichia_phage	44.7	4.6e-101
ARB85419.1|3585064_3585643_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	44.5	4.4e-43
ARB85420.1|3585772_3586963_+|tail	phage tail protein	tail	A0A0F7LBW9	Escherichia_phage	89.4	1.2e-207
ARB85421.1|3586975_3587494_+|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	92.4	2.2e-89
ARB85422.1|3587554_3587836_+|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	84.1	2.6e-33
ARB85423.1|3587868_3587988_+|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	89.7	2.6e-14
ARB85424.1|3587980_3590425_+|tail	phage tail tape measure protein	tail	Q858U7	Yersinia_virus	69.0	4.2e-268
ARB85425.1|3590439_3590919_+|tail	phage tail protein	tail	A0A0F7LDE8	Escherichia_phage	82.9	1.9e-71
ARB85426.1|3590918_3592079_+	hypothetical protein	NA	Q7Y4C6	Escherichia_virus	78.8	2.9e-166
ARB85427.1|3592162_3592363_+	late control protein B	NA	E5G6Q4	Salmonella_phage	63.9	1.6e-16
3592531:3592581	attR	TTTGTTGGTGGGTCGTGCAGGGTTCGAACCTGCGACCAATTGATTAAGAGT	NA	NA	NA	NA
>prophage 8
CP020409	Yersinia sp. FDAARGOS_228 chromosome, complete genome	4963041	4205188	4317679	4963041	plate,tail,head,lysis,transposase,terminase,integrase,capsid,portal,holin	Salmonella_phage(20.0%)	136	4269896:4269941	4317711:4317756
ARB85913.1|4205188_4205425_+|transposase	IS6 family transposase	transposase	NA	NA	NA	NA
ARB85914.1|4205848_4206238_+	hypothetical protein	NA	NA	NA	NA	NA
ARB85915.1|4206654_4206960_+|holin	holin	holin	NA	NA	NA	NA
ARB85916.1|4206961_4207351_+	peptidase M15	NA	A0A2I6PFM8	Proteus_phage	54.9	2.3e-35
ARB85917.1|4207347_4207686_+	hypothetical protein	NA	NA	NA	NA	NA
ARB85918.1|4208248_4208659_+	hypothetical protein	NA	NA	NA	NA	NA
ARB85919.1|4208872_4210123_+	hypothetical protein	NA	NA	NA	NA	NA
ARB85920.1|4210197_4211478_+	thermolabile hemolysin	NA	NA	NA	NA	NA
ARB85921.1|4211784_4212711_-	transcriptional regulator MelR	NA	NA	NA	NA	NA
ARB85922.1|4212981_4214331_+	alpha-glucosidase/alpha-galactosidase	NA	NA	NA	NA	NA
ARB85923.1|4214420_4215842_+	melibiose:sodium transporter MelB	NA	NA	NA	NA	NA
ARB85924.1|4215844_4216099_+	hypothetical protein	NA	NA	NA	NA	NA
ARB86810.1|4216495_4218049_+	YjjI family glycine radical enzyme	NA	NA	NA	NA	NA
ARB85925.1|4218020_4218890_+	YjjW family glycine radical enzyme activase	NA	NA	NA	NA	NA
ARB85926.1|4219516_4221805_-	heavy metal translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	31.3	4.2e-60
ARB85927.1|4222146_4222671_+|integrase	integrase	integrase	A0A0M4R586	Salmonella_phage	65.7	1.0e-62
ARB85928.1|4223938_4224268_+	hypothetical protein	NA	NA	NA	NA	NA
ARB85929.1|4224634_4225555_+	hypothetical protein	NA	NA	NA	NA	NA
ARB85930.1|4225929_4226586_+	hypothetical protein	NA	NA	NA	NA	NA
ARB85931.1|4226586_4226835_-	hypothetical protein	NA	NA	NA	NA	NA
ARB85932.1|4228790_4229246_+	hypothetical protein	NA	G9L674	Escherichia_phage	66.0	1.1e-47
ARB85933.1|4229247_4230279_+	serine/threonine protein kinase	NA	D2X3B9	Enterobacteria_phage	48.9	2.4e-84
ARB86812.1|4230480_4230690_-	fumarate hydratase FumD	NA	NA	NA	NA	NA
ARB85934.1|4230790_4231426_-|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	42.5	6.0e-33
ARB86813.1|4231425_4232565_-	hypothetical protein	NA	K7P7Q7	Enterobacteria_phage	46.2	3.1e-32
ARB85935.1|4233010_4233607_-	DUF2313 domain-containing protein	NA	A0A2P9JZK7	Alteromonadaceae_phage	40.1	3.0e-34
ARB85936.1|4233603_4234740_-|plate	phage baseplate protein	plate	A0A1E1GE19	Vibrio_phage	28.0	1.7e-09
ARB85937.1|4234743_4235181_-	hypothetical protein	NA	A0A0C4UR04	Shigella_phage	45.4	2.0e-19
ARB85938.1|4235177_4235771_-|plate	baseplate assembly protein	plate	A0A077KAY0	Edwardsiella_phage	35.2	2.0e-06
ARB85939.1|4235767_4236841_-|tail	phage tail protein	tail	M1PVV2	Vibrio_phage	30.3	5.0e-40
ARB85940.1|4236837_4238244_-	hypothetical protein	NA	A0A192Y5U9	Salmonella_phage	28.3	3.0e-24
ARB85941.1|4238301_4240104_-	lytic transglycosylase domain-containing protein	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	49.2	1.1e-23
ARB85942.1|4240221_4240524_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
ARB85943.1|4240525_4240900_-|tail	phage tail protein	tail	NA	NA	NA	NA
ARB85944.1|4240912_4242403_-|tail	phage tail protein	tail	B5TK67	Pseudomonas_phage	43.3	6.0e-100
ARB85945.1|4242402_4242594_-	DUF2635 domain-containing protein	NA	NA	NA	NA	NA
ARB85946.1|4242598_4243144_-	ATP-binding protein	NA	NA	NA	NA	NA
ARB85947.1|4243140_4243485_-	hypothetical protein	NA	NA	NA	NA	NA
ARB85948.1|4243484_4243892_-	hypothetical protein	NA	NA	NA	NA	NA
ARB85949.1|4243893_4244940_-|capsid	major capsid protein	capsid	Q6UYI3	Burkholderia_phage	31.8	1.4e-39
ARB85950.1|4245049_4245451_-|head	head decoration protein	head	A0A067ZIL6	Vibrio_phage	37.2	8.2e-12
ARB85951.1|4245450_4246035_-	DNA primase	NA	NA	NA	NA	NA
ARB85952.1|4246034_4246892_-	S49 family peptidase	NA	K7P7A7	Enterobacteria_phage	39.5	3.0e-51
ARB85953.1|4246888_4248457_-|portal	phage portal protein	portal	A0A291AUL8	Sinorhizobium_phage	38.5	7.0e-99
ARB85954.1|4248525_4248789_-|head,tail	phage head-tail adapter protein	head,tail	NA	NA	NA	NA
ARB86814.2|4248797_4250777_-|terminase	terminase	terminase	G8EXZ6	Synechococcus_phage	46.0	3.1e-136
ARB85955.1|4250745_4251357_-	RNA polymerase subunit sigma-70	NA	NA	NA	NA	NA
ARB85956.1|4251468_4251993_-	Fis family transcriptional regulator	NA	A0A1W6DY33	Salmonella_phage	48.8	1.7e-33
ARB85957.1|4252069_4252714_-	hypothetical protein	NA	A0A1B0Z000	Pseudomonas_phage	30.9	2.6e-07
ARB85958.1|4253061_4253343_-	hypothetical protein	NA	G8C7W3	Escherichia_phage	76.3	3.7e-35
ARB86815.1|4253375_4253876_-	DUF2514 domain-containing protein	NA	Q7Y3V2	Yersinia_phage	86.1	5.2e-72
ARB85959.1|4253893_4254289_-	peptidase M15	NA	K0NZV5	Escherichia_virus	65.1	5.9e-39
ARB85960.1|4254278_4254617_-|holin	phage holin, lambda family	holin	A0A0N7CER3	Salmonella_phage	47.1	7.9e-16
AVI44496.1|4254890_4255388_+	hypothetical protein	NA	NA	NA	NA	NA
AVI44497.1|4255821_4256028_+	hypothetical protein	NA	NA	NA	NA	NA
ARB85961.1|4256143_4256560_-	hypothetical protein	NA	NA	NA	NA	NA
ARB85962.1|4258402_4258828_-	antitermination protein	NA	S5M7R9	Escherichia_phage	57.1	9.5e-35
AVI44498.1|4259089_4260139_-	hypothetical protein	NA	A0A1B5FPA6	Escherichia_phage	50.5	8.6e-69
ARB85963.1|4260190_4262866_-	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	48.9	1.4e-232
ARB85964.1|4262862_4263258_-	hypothetical protein	NA	NA	NA	NA	NA
ARB85965.1|4263371_4263575_-	hypothetical protein	NA	NA	NA	NA	NA
ARB85966.1|4263577_4263748_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
ARB85967.1|4263725_4263923_-	hypothetical protein	NA	NA	NA	NA	NA
ARB85968.1|4263915_4264710_-	phage antirepressor Ant	NA	F1C5A3	Cronobacter_phage	44.3	1.2e-41
ARB86816.1|4264702_4264999_-	transcriptional regulator	NA	NA	NA	NA	NA
ARB85969.1|4265153_4266230_-	hypothetical protein	NA	NA	NA	NA	NA
ARB85970.1|4266226_4266739_-	hypothetical protein	NA	NA	NA	NA	NA
ARB85971.1|4266847_4267054_-	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
ARB85972.1|4267163_4268168_-	hypothetical protein	NA	NA	NA	NA	NA
ARB85973.1|4268543_4269731_-	DUF4102 domain-containing protein	NA	Q7M297	Enterobacteria_phage	57.0	2.3e-131
4269896:4269941	attL	ATGGTACGCCCTACAGGATTCGAACCTGTGACCTACGGCTTAGAAG	NA	NA	NA	NA
ARB85974.1|4270228_4272064_+	acyltransferase	NA	A0A193GZ69	Enterobacter_phage	31.9	1.1e-63
ARB85975.1|4272120_4274163_-	hypothetical protein	NA	A0A291AXF7	Shigella_phage	58.0	8.4e-44
ARB86817.1|4274220_4276584_-|tail	phage tail protein	tail	F1C5A7	Cronobacter_phage	49.6	8.6e-218
ARB85976.1|4276702_4277095_-	peptidoglycan endopeptidase	NA	F1C5F2	Cronobacter_phage	46.8	2.6e-31
ARB85977.1|4277130_4277601_-	DUF1833 domain-containing protein	NA	B1GS46	Salmonella_phage	46.8	3.0e-37
ARB85978.1|4277600_4278074_-	hypothetical protein	NA	B1GS45	Salmonella_phage	54.2	3.2e-47
ARB85979.1|4278070_4281334_-	hypothetical protein	NA	A0A1W6JNU2	Morganella_phage	40.0	1.9e-154
ARB85980.2|4281364_4281742_-	hypothetical protein	NA	NA	NA	NA	NA
ARB85981.1|4281802_4282483_-	hypothetical protein	NA	A0A1W6JNX2	Morganella_phage	54.4	1.5e-66
ARB85982.1|4282535_4283279_-	DNA breaking-rejoining protein	NA	G0ZNE6	Cronobacter_phage	53.0	8.5e-55
ARB85983.1|4283335_4283710_-	hypothetical protein	NA	NA	NA	NA	NA
ARB85984.1|4283706_4284078_-	hypothetical protein	NA	G0ZNE3	Cronobacter_phage	63.3	8.3e-35
ARB85985.1|4284079_4284421_-	hypothetical protein	NA	A0A1B1W262	Salmonella_phage	48.5	1.3e-18
ARB85986.2|4284430_4284649_-	hypothetical protein	NA	NA	NA	NA	NA
ARB85987.1|4284654_4284825_-	DUF551 domain-containing protein	NA	Q5G8X7	Enterobacteria_phage	55.6	3.0e-16
ARB85988.1|4284824_4285223_-	hypothetical protein	NA	G0ZNE1	Cronobacter_phage	81.8	1.4e-59
ARB85989.1|4285286_4285472_-	glycoprotein	NA	Q5G8X9	Enterobacteria_phage	58.7	9.2e-11
ARB85990.1|4285482_4286580_-	hypothetical protein	NA	J7I0Q9	Pseudomonas_phage	71.9	1.2e-150
ARB85991.1|4286590_4287031_-	hypothetical protein	NA	A0A125RNM2	Pseudomonas_phage	62.8	1.6e-40
ARB85992.1|4287030_4288308_-	hypothetical protein	NA	G0ZND7	Cronobacter_phage	78.3	9.1e-190
ARB85993.1|4288311_4289235_-|head	phage head morphogenesis protein	head	Q5G8Y3	Enterobacteria_phage	63.9	3.6e-103
ARB85994.1|4289194_4290565_-	DUF1073 domain-containing protein	NA	H6WRT0	Salmonella_phage	73.1	8.0e-184
ARB85995.1|4290762_4292082_-|terminase	PBSX family phage terminase large subunit	terminase	Q5G8Y7	Enterobacteria_phage	89.7	3.0e-236
ARB85996.1|4292065_4292533_-	DUF2280 domain-containing protein	NA	I6S1P9	Salmonella_phage	72.5	1.8e-55
ARB86818.2|4292566_4293202_-	hypothetical protein	NA	I6S676	Salmonella_phage	70.9	1.8e-85
ARB85997.1|4293552_4294128_-	hypothetical protein	NA	A0A0H4IQ87	Shigella_phage	58.8	3.7e-58
ARB85998.1|4294472_4294658_-	hypothetical protein	NA	NA	NA	NA	NA
ARB85999.1|4294673_4295132_-|lysis	lysis protein	lysis	A5LH84	Enterobacteria_phage	43.3	9.0e-23
ARB86000.1|4295116_4295629_-	lysozyme	NA	I6PBN2	Cronobacter_phage	59.9	1.8e-48
ARB86819.1|4295628_4295910_-	hypothetical protein	NA	H6WRZ3	Salmonella_phage	54.3	1.1e-18
ARB86001.1|4296364_4297189_-	antitermination protein	NA	M9NZB0	Enterobacteria_phage	50.7	1.0e-72
ARB86002.1|4297185_4297545_-	RusA family crossover junction endodeoxyribonuclease	NA	G8C7V6	Escherichia_phage	69.5	5.2e-42
ARB86003.1|4297541_4297832_-	DUF1364 domain-containing protein	NA	A0A220NQY2	Salmonella_phage	76.8	5.7e-39
ARB86004.1|4297943_4298612_-	serine/threonine-protein phosphatase	NA	K7PJY0	Enterobacterial_phage	62.4	3.5e-76
ARB86005.1|4298604_4298991_-	DUF2591 domain-containing protein	NA	A0A2I7QJ87	Vibrio_phage	37.0	2.6e-07
ARB86006.1|4299085_4299469_-	HNH endonuclease	NA	A0A2R2Z2X9	Escherichia_phage	76.9	1.2e-52
ARB86007.1|4299465_4299903_-	recombination protein NinB	NA	E5AGF7	Erwinia_phage	83.4	3.3e-67
ARB86008.1|4299895_4300207_-	hypothetical protein	NA	A0A0A0YR00	Erwinia_phage	36.6	6.1e-07
ARB86820.1|4300203_4300560_-	DUF551 domain-containing protein	NA	S4TSR6	Salmonella_phage	36.8	7.0e-07
ARB86009.1|4300910_4301261_-	hypothetical protein	NA	Q7Y3W5	Yersinia_phage	75.2	1.7e-45
ARB86010.1|4301521_4301716_-	hypothetical protein	NA	NA	NA	NA	NA
ARB86011.1|4301715_4303119_-	helicase DnaB	NA	A0A0N7C224	Escherichia_phage	61.7	1.9e-164
ARB86012.1|4303108_4304011_-	DNA replication protein	NA	Q8VNP8	Enterobacteria_phage	47.2	1.6e-63
ARB86013.1|4304177_4304468_-	hypothetical protein	NA	I6RSP4	Salmonella_phage	61.9	4.8e-22
ARB86014.1|4304603_4304834_-	transcriptional regulator	NA	Q76H55	Enterobacteria_phage	47.1	1.0e-06
ARB86821.1|4304992_4305691_+	helix-turn-helix transcriptional regulator	NA	A0A2D1GM27	Escherichia_phage	63.5	5.3e-83
ARB86015.1|4306022_4306370_+	hypothetical protein	NA	NA	NA	NA	NA
ARB86016.1|4306997_4307360_+	hypothetical protein	NA	NA	NA	NA	NA
ARB86017.1|4307409_4307652_+	hypothetical protein	NA	NA	NA	NA	NA
ARB86018.1|4308199_4308511_+	hypothetical protein	NA	A0A2I7RGU7	Vibrio_phage	42.6	2.3e-14
ARB86019.1|4308634_4309732_+	hypothetical protein	NA	A0A2H4FRY7	Salmonella_phage	78.9	1.5e-10
ARB86020.1|4309806_4310196_+	hypothetical protein	NA	NA	NA	NA	NA
ARB86021.1|4310546_4310795_+	hypothetical protein	NA	NA	NA	NA	NA
ARB86022.1|4310766_4311447_+	ATP-binding protein	NA	A0A2D1GLT5	Escherichia_phage	69.5	1.8e-91
ARB86023.1|4311443_4312040_+	DUF669 domain-containing protein	NA	K7PHD7	Enterobacteria_phage	51.6	2.7e-43
ARB86024.1|4312066_4312333_+	hypothetical protein	NA	NA	NA	NA	NA
ARB86025.1|4312372_4312576_+	restriction alleviation protein, Lar family	NA	NA	NA	NA	NA
AVI44499.1|4312585_4312780_+	hypothetical protein	NA	NA	NA	NA	NA
AVI44500.1|4312779_4313286_+	hypothetical protein	NA	A0A0H4ISY5	Shigella_phage	45.9	9.7e-10
ARB86026.1|4313285_4314179_+	hypothetical protein	NA	A0A2K9VK66	Klebsiella_phage	60.4	4.1e-96
ARB86823.1|4314194_4314425_+	hypothetical protein	NA	NA	NA	NA	NA
ARB86027.1|4314421_4314721_+	hypothetical protein	NA	NA	NA	NA	NA
ARB86028.1|4314785_4314992_+	hypothetical protein	NA	NA	NA	NA	NA
ARB86029.1|4314999_4315218_+	hypothetical protein	NA	NA	NA	NA	NA
ARB86030.1|4315214_4315850_+	DNA methyltransferase	NA	I6PDF5	Cronobacter_phage	74.0	1.1e-87
ARB86031.1|4316524_4317679_+|integrase	site-specific integrase	integrase	G8C7S0	Escherichia_phage	71.1	6.2e-161
4317711:4317756	attR	ATGGTACGCCCTACAGGATTCGAACCTGTGACCTACGGCTTAGAAG	NA	NA	NA	NA
>prophage 9
CP020409	Yersinia sp. FDAARGOS_228 chromosome, complete genome	4963041	4344546	4353258	4963041		Tupanvirus(14.29%)	8	NA	NA
ARB86051.1|4344546_4345557_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L1R4	Tupanvirus	47.2	4.5e-83
ARB86052.1|4345616_4346987_-	phosphomannomutase	NA	A0A127AWJ1	Bacillus_phage	28.7	1.8e-34
ARB86053.1|4346999_4348397_-	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	31.0	5.2e-53
ARB86054.1|4348403_4349369_-	GDP-L-fucose synthase	NA	M4R1H4	Synechococcus_phage	48.9	8.7e-84
ARB86055.1|4349374_4350493_-	GDP-mannose 4,6-dehydratase	NA	M1HXY1	Acanthocystis_turfacea_Chlorella_virus	63.6	3.4e-132
ARB86056.1|4350489_4351566_-	galactosyltransferase	NA	NA	NA	NA	NA
ARB86057.1|4351552_4352401_-	alpha-1,2-fucosyltransferase	NA	A0A2H4UUT1	Bodo_saltans_virus	26.4	5.0e-11
ARB86827.1|4352397_4353258_-	glycosyl transferase	NA	A0A1V0SAH6	Catovirus	34.8	2.2e-09
>prophage 10
CP020409	Yersinia sp. FDAARGOS_228 chromosome, complete genome	4963041	4713834	4785343	4963041	plate,tRNA,protease	Paramecium_bursaria_Chlorella_virus(40.0%)	54	NA	NA
ARB86337.1|4713834_4714587_+|protease	metalloprotease	protease	NA	NA	NA	NA
ARB86338.1|4714653_4714977_-	non-heme iron oxygenase ferredoxin subunit	NA	NA	NA	NA	NA
ARB86339.1|4715130_4717110_-	biosynthetic arginine decarboxylase	NA	NA	NA	NA	NA
ARB86341.1|4718399_4719554_+	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	63.2	8.7e-131
ARB86342.1|4719611_4720025_-	hypothetical protein	NA	NA	NA	NA	NA
ARB86343.1|4720034_4720466_-	hypothetical protein	NA	NA	NA	NA	NA
ARB86840.1|4720462_4720768_-	transcriptional regulator	NA	NA	NA	NA	NA
ARB86344.1|4720918_4721431_+|protease	SprT family zinc-dependent metalloprotease	protease	NA	NA	NA	NA
ARB86345.1|4721528_4722236_+	deoxyribonuclease I	NA	NA	NA	NA	NA
ARB86346.1|4722282_4723014_+	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
ARB86347.1|4723039_4723993_+	glutathione synthase	NA	NA	NA	NA	NA
ARB86348.1|4724526_4725090_+	YqgE/AlgH family protein	NA	NA	NA	NA	NA
ARB86349.1|4725089_4725512_+	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
ARB86350.1|4725694_4726579_+	N-carbamoylputrescine amidase	NA	A7IVZ1	Paramecium_bursaria_Chlorella_virus	50.7	5.3e-80
ARB86351.1|4726582_4727707_+	agmatine deiminase	NA	A7RCL2	Paramecium_bursaria_Chlorella_virus	50.0	1.8e-96
ARB86841.1|4727746_4728811_-	type IV pili twitching motility protein PilT	NA	NA	NA	NA	NA
ARB86352.1|4728905_4729601_+	YggS family pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
ARB86353.1|4729688_4730510_+	pyrroline-5-carboxylate reductase	NA	NA	NA	NA	NA
ARB86354.1|4730638_4731193_+	YggT family protein	NA	NA	NA	NA	NA
ARB86355.1|4731189_4731480_+	YggU family protein	NA	NA	NA	NA	NA
ARB86356.1|4731534_4732128_+	XTP/dITP diphosphatase	NA	NA	NA	NA	NA
ARB86357.1|4732120_4733251_+	YggW family oxidoreductase	NA	NA	NA	NA	NA
ARB86358.1|4733339_4734080_-	DUF2884 domain-containing protein	NA	NA	NA	NA	NA
ARB86842.1|4734100_4735018_-	glutaminase	NA	NA	NA	NA	NA
ARB86359.1|4735154_4735481_-	DUF469 domain-containing protein	NA	NA	NA	NA	NA
ARB86360.1|4735480_4736200_-|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
ARB86843.1|4736477_4737539_+	adenine DNA glycosylase	NA	NA	NA	NA	NA
ARB86361.1|4737592_4737865_+	oxidative damage protection protein	NA	NA	NA	NA	NA
ARB86844.2|4737922_4738999_+	membrane-bound lytic murein transglycosylase MltC	NA	NA	NA	NA	NA
ARB86362.1|4739232_4739982_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
ARB86363.1|4740052_4742215_-	ornithine decarboxylase SpeF	NA	NA	NA	NA	NA
ARB86366.1|4745350_4746106_+	carbonic anhydrase	NA	NA	NA	NA	NA
ARB86845.1|4746570_4747656_+	lipase	NA	NA	NA	NA	NA
ARB86846.1|4749047_4752644_-	histidine kinase	NA	A0A1V0SGX0	Hokovirus	33.2	2.8e-34
ARB86367.1|4752648_4753263_-	DNA-binding response regulator	NA	NA	NA	NA	NA
ARB86368.1|4754258_4754870_+	LuxR family transcriptional regulator	NA	NA	NA	NA	NA
ARB86369.1|4755921_4756401_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
ARB86370.1|4756400_4757207_-	ImpE family T6SS protein Cts1E	NA	NA	NA	NA	NA
ARB86371.1|4757232_4758075_-	TagK domain-containing protein	NA	NA	NA	NA	NA
ARB86372.1|4758080_4758341_-	hypothetical protein	NA	NA	NA	NA	NA
ARB86373.1|4763755_4767589_-	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
ARB86374.1|4767597_4768995_-	type VI secretion system protein TssL	NA	NA	NA	NA	NA
ARB86375.1|4768991_4770341_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
ARB86376.1|4770344_4770899_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
ARB86377.1|4771073_4771559_-	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
ARB86378.1|4771882_4773385_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
ARB86379.1|4773408_4773933_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
ARB86380.1|4774040_4774643_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
AVI44512.1|4774627_4777294_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
ARB86381.1|4777390_4778191_-	pilus assembly protein	NA	NA	NA	NA	NA
ARB86382.1|4778302_4778860_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
ARB86383.1|4779031_4781704_-	type VI secretion system ATPase TssH	NA	H6X3M6	Enterobacteria_phage	31.3	1.9e-88
ARB86384.1|4782437_4784318_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
ARB86385.1|4784317_4785343_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
