The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP028542	Klebsiella pneumoniae strain WCHKP2 chromosome, complete genome	5476966	451769	533552	5476966	tRNA,capsid,head,portal,protease,tail,terminase,transposase,integrase	uncultured_Caudovirales_phage(55.0%)	82	469377:469394	485372:485389
AVZ93396.1|451769_452717_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	37.2	2.2e-07
AVZ93397.1|452731_453241_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	40.3	2.6e-18
AVZ93398.1|453369_454494_+	DNA-protecting protein DprA	NA	NA	NA	NA	NA
AVZ93399.1|454465_454939_+	DUF494 domain-containing protein	NA	NA	NA	NA	NA
AVZ93400.1|454964_455507_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ93401.1|455511_456084_+	L-threonylcarbamoyladenylate synthase type 1 TsaC	NA	NA	NA	NA	NA
AVZ93402.1|456087_456906_+	shikimate dehydrogenase	NA	NA	NA	NA	NA
AVZ93403.1|456902_457160_+	DUF1488 domain-containing protein	NA	NA	NA	NA	NA
AVZ98055.1|457135_457690_-	gamma carbonic anhydrase family protein	NA	NA	NA	NA	NA
AVZ93404.1|463485_463707_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ93405.1|464000_467111_-	multidrug efflux RND transporter permease subunit	NA	NA	NA	NA	NA
AVZ93406.1|467123_468263_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
AVZ93407.1|468641_469292_+	acrEF/envCD operon transcriptional regulator	NA	NA	NA	NA	NA
469377:469394	attL	GTATCAGTTCATGCCGTA	NA	NA	NA	NA
AVZ93408.1|469567_470794_+|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	62.2	1.8e-150
AVZ93409.1|470886_471828_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ93410.1|472009_472294_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
AVZ93411.1|472304_473084_+	hypothetical protein	NA	Q8HA02	Enterobacteria_phage	51.5	6.2e-40
AVZ93412.1|473207_473402_-	toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
AVZ98056.1|473535_473805_+	host cell division inhibitor Icd-like protein	NA	A0A2H4JGW3	uncultured_Caudovirales_phage	94.4	2.4e-44
AVZ93413.1|473797_473986_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ93414.1|473978_474293_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ93415.1|474289_474658_+	hypothetical protein	NA	A0A2H4JCX7	uncultured_Caudovirales_phage	81.1	3.7e-51
AVZ93416.1|474654_475020_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ93417.1|475019_477155_+	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	62.4	3.4e-205
AVZ93418.1|477497_477833_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ93419.1|477881_478394_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ93420.1|478657_479824_+|capsid	phage major capsid protein	capsid	A0A2H4JED2	uncultured_Caudovirales_phage	95.9	9.8e-207
AVZ93421.1|479875_480436_+|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	95.7	1.2e-98
AVZ93422.1|480437_481679_+|portal	phage portal protein	portal	A0A2H4JFJ9	uncultured_Caudovirales_phage	96.5	1.0e-230
AVZ93423.1|481675_482011_+|head,tail	head-tail adaptor	head,tail	A0A2H4JHK5	uncultured_Caudovirales_phage	57.8	3.7e-26
AVZ93424.1|482007_482307_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2H4JD08	uncultured_Caudovirales_phage	80.8	3.4e-39
AVZ93425.1|482306_482750_+	HNH endonuclease	NA	A0A2H4JAS8	uncultured_Caudovirales_phage	91.8	2.8e-77
AVZ93426.1|482876_483068_+|terminase	terminase	terminase	NA	NA	NA	NA
AVZ93427.1|483025_483382_+|terminase	phage terminase small subunit P27 family	terminase	A0A2H4JHS3	uncultured_Caudovirales_phage	99.2	5.5e-60
AVZ93428.1|483365_485027_+|terminase	terminase large subunit	terminase	A0A2H4JB64	uncultured_Caudovirales_phage	98.0	0.0e+00
AVZ93429.1|485029_485221_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ93430.1|485374_485671_-	Fis family transcriptional regulator	NA	NA	NA	NA	NA
485372:485389	attR	GTATCAGTTCATGCCGTA	NA	NA	NA	NA
AVZ93431.1|485695_486661_-|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
AVZ93432.1|486818_487013_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ93433.1|487018_487900_-	50S ribosomal protein L11 methyltransferase	NA	NA	NA	NA	NA
AVZ93434.1|487911_489363_-	sodium/panthothenate symporter	NA	NA	NA	NA	NA
AVZ93435.1|489352_489595_-	DUF997 family protein	NA	NA	NA	NA	NA
AVZ93436.1|489705_491055_-	acetyl-CoA carboxylase biotin carboxylase subunit	NA	NA	NA	NA	NA
AVZ93437.1|491065_491533_-	acetyl-CoA carboxylase biotin carboxyl carrier protein	NA	NA	NA	NA	NA
AVZ93438.1|491555_492008_-	type II 3-dehydroquinate dehydratase	NA	NA	NA	NA	NA
AVZ93439.1|492231_492840_-	protein-methionine-sulfoxide reductase heme-binding subunit MsrQ	NA	NA	NA	NA	NA
AVZ93440.1|492839_493841_-	protein-methionine-sulfoxide reductase catalytic subunit MsrP	NA	NA	NA	NA	NA
AVZ93441.1|494069_494261_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ93442.1|494340_496281_+	RNase E specificity factor CsrD	NA	NA	NA	NA	NA
AVZ93443.1|496402_496609_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ93444.1|496586_497630_+	rod shape-determining protein	NA	F2Y0P3	Organic_Lake_phycodnavirus	22.3	6.7e-05
AVZ93445.1|497700_498693_+	rod shape-determining protein MreC	NA	NA	NA	NA	NA
AVZ93446.1|498692_499181_+	rod shape-determining protein MreD	NA	NA	NA	NA	NA
AVZ93447.1|499188_499770_+	septum formation inhibitor Maf	NA	NA	NA	NA	NA
AVZ93448.1|499772_501242_+	ribonuclease G	NA	NA	NA	NA	NA
AVZ93449.1|501279_505077_+	AsmA2 domain-containing protein	NA	NA	NA	NA	NA
AVZ93450.1|505165_506611_+|protease	metalloprotease TldD	protease	NA	NA	NA	NA
AVZ93451.1|506646_507576_-	HTH-type transcriptional activator AaeR	NA	NA	NA	NA	NA
AVZ93452.1|507707_507911_+	protein AaeX	NA	NA	NA	NA	NA
AVZ93453.1|507918_508851_+	p-hydroxybenzoic acid efflux pump subunit AaeA	NA	NA	NA	NA	NA
AVZ93454.1|508856_510824_+	p-hydroxybenzoic acid efflux pump subunit AaeB	NA	NA	NA	NA	NA
AVZ93455.1|510903_511179_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ93456.1|511229_511496_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
AVZ93457.1|511594_511858_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
AVZ93458.1|512233_512704_-	arginine repressor	NA	NA	NA	NA	NA
AVZ93459.1|513118_514057_+	malate dehydrogenase	NA	NA	NA	NA	NA
AVZ93460.1|514193_515252_-|protease	serine endoprotease DegS	protease	NA	NA	NA	NA
AVZ93461.1|515339_516707_-|protease	serine endoprotease DegQ	protease	A0A1B1IT49	uncultured_Mediterranean_phage	25.3	6.0e-22
AVZ93462.1|516880_517279_-	DUF1043 family protein	NA	NA	NA	NA	NA
AVZ93463.1|517469_518597_+	cell division protein ZapE	NA	NA	NA	NA	NA
AVZ93464.1|518862_519291_+	50S ribosomal protein L13	NA	NA	NA	NA	NA
AVZ93465.1|519306_519699_+	30S ribosomal protein S9	NA	NA	NA	NA	NA
AVZ93466.1|519808_520012_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ93467.1|520010_520649_+	stringent starvation protein A	NA	NA	NA	NA	NA
AVZ93468.1|520652_521147_+|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	54.8	1.5e-26
AVZ93469.1|521271_521976_+	N-acetylmannosamine-6-phosphate 2-epimerase	NA	NA	NA	NA	NA
AVZ93470.1|522030_523449_-	glutamate synthase small subunit	NA	NA	NA	NA	NA
AVZ93471.1|523458_527919_-	glutamate synthase large subunit	NA	NA	NA	NA	NA
AVZ93472.1|528592_529525_+	TIGR01212 family radical SAM protein	NA	A0A2H4PQV5	Staphylococcus_phage	33.8	3.4e-16
AVZ93473.1|529576_530860_-	MFS transporter	NA	NA	NA	NA	NA
AVZ93474.1|530945_531962_-	Zn-dependent oxidoreductase	NA	NA	NA	NA	NA
AVZ93475.1|532359_533552_-|transposase	IS3-like element ISKpn18 family transposase	transposase	U5P429	Shigella_phage	43.5	3.5e-50
>prophage 2
CP028542	Klebsiella pneumoniae strain WCHKP2 chromosome, complete genome	5476966	691564	703217	5476966		Enterobacteria_phage(70.0%)	13	NA	NA
AVZ93608.1|691564_693898_-	DNA primase	NA	Q7M2A8	Enterobacteria_phage	82.2	0.0e+00
AVZ93609.1|693909_694230_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ93610.1|694226_694454_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ93611.1|694450_695008_-	host cell division inhibitor Icd-like protein	NA	Q7M2A7	Enterobacteria_phage	70.4	1.8e-33
AVZ93612.1|695004_695271_-	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	71.6	2.6e-30
AVZ93613.1|695812_696550_+	glycoprotein 3	NA	Q7M2A2	Enterobacteria_phage	59.4	1.9e-70
AVZ93614.1|696546_696792_+	hypothetical protein	NA	Q7M294	Enterobacteria_phage	56.8	5.5e-19
AVZ93615.1|696809_697376_+	Polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	63.8	9.7e-59
AVZ93616.1|697943_698369_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ93617.1|698368_699319_-	cobyrinic acid a,c-diamide synthase	NA	A0A1X9IGI7	Lactococcus_phage	27.1	1.2e-13
AVZ93618.1|699306_700497_-	DUF4102 domain-containing protein	NA	Q7M297	Enterobacteria_phage	62.7	6.4e-145
AVZ93619.1|700849_702103_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	44.9	8.9e-89
AVZ93620.1|702113_703217_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.5	4.8e-62
>prophage 3
CP028542	Klebsiella pneumoniae strain WCHKP2 chromosome, complete genome	5476966	1355000	1393536	5476966	capsid,head,portal,plate,lysis,tail,transposase,integrase	Salmonella_phage(82.5%)	49	1354908:1354926	1393608:1393626
1354908:1354926	attL	CAGGCAACAAAAAACCCAT	NA	NA	NA	NA
AVZ94202.1|1355000_1356053_-|integrase	site-specific integrase	integrase	A0A218M4I3	Erwinia_phage	57.0	1.0e-106
AVZ94203.1|1356220_1356472_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ94204.1|1356471_1357956_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
AVZ94205.1|1358054_1358999_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ94206.1|1359010_1359889_-	Repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	39.9	1.7e-30
AVZ94207.1|1360034_1360256_+	regulator	NA	NA	NA	NA	NA
AVZ94208.1|1360288_1360798_+	hypothetical protein	NA	E5G6L3	Salmonella_phage	98.8	5.8e-87
AVZ98100.1|1360805_1361006_+	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	97.0	1.6e-32
AVZ94209.1|1360969_1361311_+	hypothetical protein	NA	E5G6L5	Salmonella_phage	99.1	4.6e-56
AVZ94210.1|1361378_1361612_+	DUF2732 family protein	NA	E5G6L6	Salmonella_phage	96.1	4.1e-32
AVZ94211.1|1361611_1361839_+	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	98.7	6.0e-36
AVZ94212.1|1361835_1362693_+	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	95.4	2.0e-156
AVZ94213.1|1362689_1365104_+	replication endonuclease	NA	E5G6L9	Salmonella_phage	97.5	0.0e+00
AVZ94214.1|1365257_1365446_+	hypothetical protein	NA	E5G6M0	Salmonella_phage	98.4	5.5e-27
AVZ94215.1|1365384_1365690_+	DinI family protein	NA	E5G6M1	Salmonella_phage	100.0	4.7e-36
AVZ94216.1|1365804_1366482_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ98101.1|1366468_1366591_+	ABC transporter	NA	NA	NA	NA	NA
AVZ94217.1|1366629_1367610_-|transposase	IS5-like element ISKpn26 family transposase	transposase	Q38213	Escherichia_phage	99.1	8.9e-185
AVZ94218.1|1367957_1369700_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ94219.1|1369761_1370787_-|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	86.7	7.6e-171
AVZ94220.1|1370786_1372553_-	oxidoreductase	NA	A0A1S6KZW3	Salmonella_phage	99.0	0.0e+00
AVZ94221.1|1372695_1373529_+|capsid	capsid protein	capsid	A0A1S6KZW9	Salmonella_phage	88.8	6.3e-123
AVZ94222.1|1373545_1374604_+|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	93.1	1.1e-180
AVZ94223.1|1374607_1375258_+	hypothetical protein	NA	E5G6M7	Salmonella_phage	96.3	8.7e-112
AVZ94224.1|1375353_1375818_+|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	89.0	8.4e-77
AVZ94225.1|1375817_1376021_+|tail	phage tail protein	tail	A0A1S6KZY4	Salmonella_phage	88.1	1.3e-29
AVZ94226.1|1376024_1376240_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	90.1	3.6e-30
AVZ94227.1|1376220_1376730_+	lysozyme	NA	E5G6N1	Salmonella_phage	83.4	2.1e-81
AVZ94228.1|1376734_1377118_+	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	42.0	2.1e-17
AVZ94229.1|1377114_1377543_+|lysis	LysB family phage lysis regulatory protein	lysis	A0A1S6KZX8	Salmonella_phage	77.9	9.6e-51
AVZ94230.1|1377638_1378070_+|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	82.5	9.9e-64
AVZ94231.1|1378062_1378509_+	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	71.2	2.2e-50
AVZ94232.1|1378505_1379198_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ94233.1|1379292_1379865_+|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	72.3	4.7e-77
AVZ94234.1|1379861_1380224_+|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	83.9	4.9e-48
AVZ94235.1|1380210_1381119_+|plate	baseplate assembly protein	plate	E5G6N8	Salmonella_phage	66.9	7.6e-106
AVZ94236.1|1381111_1381711_+|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	60.5	1.3e-58
AVZ94237.1|1381712_1384664_+	hypothetical protein	NA	A0A2H4N7A3	Pectobacterium_phage	50.9	1.2e-06
AVZ94238.1|1384667_1385399_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ94239.1|1385395_1385599_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ94240.1|1385628_1386705_+|tail	phage tail protein	tail	Q37842	Escherichia_phage	44.8	1.2e-25
AVZ94241.1|1386843_1388016_+|tail	phage tail protein	tail	A0A1S6KZY7	Salmonella_phage	93.3	1.9e-210
AVZ94242.1|1388025_1388541_+|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	85.4	1.3e-81
AVZ94243.1|1388593_1388893_+|tail	phage tail assembly protein	tail	E5G6P9	Salmonella_phage	79.0	3.7e-33
AVZ94244.1|1388907_1389027_+|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.2e-13
AVZ94245.1|1389019_1391647_+|tail	phage tail tape measure protein	tail	E5FFG5	Burkholderia_phage	42.0	5.6e-117
AVZ94246.1|1391643_1392129_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	75.6	7.2e-63
AVZ94247.1|1392125_1393226_+	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	87.4	4.9e-176
AVZ94248.1|1393317_1393536_+	transcriptional regulator	NA	Q53ZE7	Salmonella_virus	69.0	7.5e-20
1393608:1393626	attR	CAGGCAACAAAAAACCCAT	NA	NA	NA	NA
>prophage 4
CP028542	Klebsiella pneumoniae strain WCHKP2 chromosome, complete genome	5476966	1427952	1437416	5476966	tRNA,protease	Dickeya_phage(16.67%)	9	NA	NA
AVZ94278.1|1427952_1429068_+	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	52.7	1.3e-06
AVZ94279.1|1429064_1431005_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.5	1.9e-37
AVZ94280.1|1430944_1431127_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ94281.1|1431081_1431303_-	cold shock domain protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	1.3e-16
AVZ94282.1|1431628_1431946_+|protease	ATP-dependent Clp protease adaptor ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	2.0e-13
AVZ94283.1|1431976_1434256_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.0	1.6e-165
AVZ94284.1|1434376_1434595_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
AVZ94285.1|1434948_1435650_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
AVZ94286.1|1435694_1437416_-	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	34.3	1.5e-14
>prophage 5
CP028542	Klebsiella pneumoniae strain WCHKP2 chromosome, complete genome	5476966	1518781	1590079	5476966	capsid,portal,plate,protease,tail,terminase,integrase	Enterobacteria_phage(38.71%)	79	1557376:1557396	1591900:1591920
AVZ94347.1|1518781_1520539_-|protease	Lon protease family protein	protease	NA	NA	NA	NA
AVZ94348.1|1520724_1521177_+	macrodomain Ter protein	NA	NA	NA	NA	NA
AVZ94349.1|1521308_1522379_-	porin OmpA	NA	NA	NA	NA	NA
AVZ94350.1|1522731_1523241_-	cell division inhibitor SulA	NA	NA	NA	NA	NA
AVZ94351.1|1523259_1523499_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ94352.1|1523589_1524186_+	competence protein	NA	NA	NA	NA	NA
AVZ94353.1|1524199_1526335_-	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
AVZ94354.1|1526352_1526799_-	YccF domain-containing protein	NA	NA	NA	NA	NA
AVZ94355.1|1526923_1528978_+	DNA helicase IV	NA	A7KV33	Bacillus_phage	26.0	1.8e-14
AVZ94356.1|1528989_1529448_-	methylglyoxal synthase	NA	NA	NA	NA	NA
AVZ94357.1|1529602_1530016_+	CoA-binding protein	NA	NA	NA	NA	NA
AVZ94358.1|1530045_1530363_-	heat-shock protein HspQ	NA	NA	NA	NA	NA
AVZ94359.1|1530422_1531625_-	ribosomal RNA large subunit methyltransferase I	NA	NA	NA	NA	NA
AVZ94360.1|1531815_1532370_+	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
AVZ94361.1|1532387_1533176_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AVZ94362.1|1533224_1533506_+	acylphosphatase	NA	NA	NA	NA	NA
AVZ94363.1|1533502_1533832_-	sulfurtransferase TusE	NA	NA	NA	NA	NA
AVZ94364.1|1533920_1534580_-|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	46.6	3.2e-37
AVZ94365.1|1534849_1536502_+	oligopeptide ABC transporter substrate-binding protein OppA	NA	NA	NA	NA	NA
AVZ94366.1|1536858_1537479_-	EAL domain-containing protein	NA	NA	NA	NA	NA
AVZ94367.1|1537457_1537745_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ94368.1|1537809_1537998_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ94369.1|1538167_1539133_-	oxidoreductase	NA	NA	NA	NA	NA
AVZ94370.1|1539190_1540639_-	NAD-dependent succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
AVZ94371.1|1540657_1541782_-	ring-hydroxylating oxygenase subunit alpha	NA	NA	NA	NA	NA
AVZ94372.1|1541818_1543426_-	BCCT family transporter	NA	NA	NA	NA	NA
AVZ94373.1|1543930_1545016_-	tartrate dehydrogenase	NA	NA	NA	NA	NA
AVZ94374.1|1545119_1546061_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AVZ94375.1|1546057_1547338_-	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
AVZ94376.1|1547340_1548828_-	aldehyde dehydrogenase PuuC	NA	NA	NA	NA	NA
AVZ94377.1|1549148_1549706_-	HTH-type transcriptional regulator PuuR	NA	NA	NA	NA	NA
AVZ94378.1|1549731_1550496_-	gamma-glutamyl-gamma-aminobutyrate hydrolase	NA	NA	NA	NA	NA
AVZ94379.1|1550709_1552131_+	glutamine synthetase	NA	NA	NA	NA	NA
AVZ94380.1|1552303_1552495_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ94381.1|1552484_1553876_+	APC family permease	NA	NA	NA	NA	NA
AVZ94382.1|1553994_1554117_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ94383.1|1554373_1554595_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ94384.1|1554615_1555404_-	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
AVZ94385.1|1555519_1555969_-	transcriptional regulator	NA	NA	NA	NA	NA
AVZ94386.1|1556121_1557369_+	bifunctional glucose-1-phosphatase/inositol phosphatase	NA	NA	NA	NA	NA
1557376:1557396	attL	AAACCCGGAGCACTCCGGGTT	NA	NA	NA	NA
AVZ94387.1|1557465_1558473_-|integrase	integrase	integrase	A0A0M4RTQ0	Salmonella_phage	52.1	7.6e-99
AVZ94388.1|1558560_1558863_-	XRE family transcriptional regulator	NA	Q1JS63	Enterobacteria_phage	61.0	2.6e-26
AVZ94389.1|1558957_1559290_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ98110.1|1559481_1559679_+	DUF4761 domain-containing protein	NA	NA	NA	NA	NA
AVZ94390.1|1559695_1560082_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ94391.1|1560097_1560370_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ94392.1|1560437_1560662_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ94393.1|1560658_1561237_+	3'-5' exoribonuclease	NA	A0A192Y6E0	Salmonella_phage	39.5	2.7e-32
AVZ94394.1|1561245_1562214_+	DNA adenine methylase	NA	A0A0M4QWR0	Salmonella_phage	49.1	3.1e-73
AVZ94395.1|1562515_1563532_+	DNA cytosine methyltransferase	NA	Q6J1P4	Burkholderia_virus	54.8	2.4e-92
AVZ94396.1|1563524_1566119_+	replication endonuclease	NA	A0A0M4RTM8	Salmonella_phage	51.7	1.1e-192
AVZ94397.1|1566290_1566698_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ98111.1|1566970_1567285_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ94398.1|1567692_1568727_-|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	68.6	2.0e-139
AVZ94399.1|1568747_1570469_-	oxidoreductase	NA	A0A0A7NV54	Enterobacteria_phage	66.5	4.3e-227
AVZ94400.1|1570629_1571463_+|capsid	phage capsid protein	capsid	A0A0A7NRY7	Enterobacteria_phage	65.3	6.5e-96
AVZ94401.1|1571486_1572536_+|capsid	phage major capsid protein, P2 family	capsid	A0A0M3ULA3	Salmonella_phage	53.9	2.3e-106
AVZ94402.1|1572582_1573443_+|terminase	terminase	terminase	B9A7B6	Serratia_phage	68.4	1.0e-83
AVZ94403.1|1573545_1574043_+|capsid	capsid assembly protein	capsid	B9A7B7	Serratia_phage	69.7	2.2e-59
AVZ94404.1|1574042_1574243_+|tail	phage tail protein	tail	A0A0A7NV57	Enterobacteria_phage	64.6	3.0e-15
AVZ94405.1|1574233_1574515_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ94406.1|1574511_1575063_+	lysozyme	NA	Q1I0Z1	Pasteurella_virus	42.5	6.8e-33
AVZ98112.1|1575339_1575603_+	peptidase	NA	NA	NA	NA	NA
AVZ94407.1|1575599_1576058_+|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	46.8	3.1e-31
AVZ94408.1|1576054_1576696_+	phage virion morphogenesis protein	NA	A0A0M4RCU1	Salmonella_phage	49.8	1.4e-45
AVZ94409.1|1576695_1577280_+|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	61.4	8.7e-63
AVZ94410.1|1577276_1577645_+|plate	baseplate assembly protein	plate	A0A0A7NQ90	Enterobacteria_phage	57.4	2.3e-29
AVZ94411.1|1577631_1578531_+|plate	baseplate assembly protein	plate	A0A0A7NPY5	Enterobacteria_phage	62.2	6.2e-92
AVZ94412.1|1578523_1579126_+|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	44.8	1.8e-42
AVZ94413.1|1579127_1581392_+	hypothetical protein	NA	B5TAB2	Burkholderia_phage	39.7	5.7e-102
AVZ94414.1|1581397_1582141_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ94415.1|1582152_1583229_+|tail	phage tail protein	tail	Q37842	Escherichia_phage	48.3	2.3e-32
AVZ94416.1|1583326_1583815_-|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	59.9	2.9e-51
AVZ94417.1|1583826_1586562_-|tail	phage tail tape measure protein	tail	B9A7B3	Serratia_phage	80.6	2.0e-242
AVZ94418.1|1586551_1586704_-|tail	GpE family phage tail protein	tail	O80316	Escherichia_phage	71.4	1.5e-11
AVZ94419.1|1586724_1587024_-|tail	phage tail assembly protein	tail	B9A7B2	Serratia_phage	72.7	2.9e-30
AVZ94420.1|1587075_1587591_-|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	70.0	2.6e-63
AVZ94421.1|1587591_1588773_-|tail	phage tail protein	tail	A0A0A7NV69	Enterobacteria_phage	69.4	8.0e-156
AVZ94422.1|1588924_1590079_+	phage late control D family protein	NA	B9A7A9	Serratia_phage	77.2	6.6e-171
1591900:1591920	attR	AAACCCGGAGCACTCCGGGTT	NA	NA	NA	NA
>prophage 6
CP028542	Klebsiella pneumoniae strain WCHKP2 chromosome, complete genome	5476966	1699654	1787533	5476966	tRNA,capsid,head,portal,holin,tail,terminase,integrase	Klebsiella_phage(45.45%)	96	1695952:1695966	1754072:1754086
1695952:1695966	attL	GGTGACGCAGCAGGG	NA	NA	NA	NA
AVZ98121.1|1699654_1700761_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
AVZ94523.1|1700817_1701276_-	NUDIX hydrolase	NA	NA	NA	NA	NA
AVZ94524.1|1701292_1701943_-	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
AVZ94525.1|1702183_1703434_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	92.6	1.1e-19
AVZ94526.1|1703551_1704679_-|integrase	integrase	integrase	O21925	Phage_21	58.4	4.4e-119
AVZ94527.1|1704659_1704905_-	excisionase	NA	NA	NA	NA	NA
AVZ94528.1|1704957_1707096_-	exonuclease	NA	S4TNL0	Salmonella_phage	42.7	5.6e-99
AVZ94529.1|1707237_1707582_-	transcriptional regulator	NA	NA	NA	NA	NA
AVZ94530.1|1707624_1707819_-	DUF1482 family protein	NA	NA	NA	NA	NA
AVZ94531.1|1707828_1708047_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ94532.1|1708209_1708524_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ94533.1|1708845_1709283_-	helix-turn-helix domain-containing protein	NA	H6WRX4	Salmonella_phage	62.2	1.3e-39
AVZ94534.1|1709371_1709596_+	Cro/Cl family transcriptional regulator	NA	H6WRX5	Salmonella_phage	62.5	1.3e-19
AVZ94535.1|1709598_1710153_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ98122.1|1710212_1711217_+	DNA-binding protein	NA	A0A0U2RT81	Escherichia_phage	40.0	1.0e-31
AVZ94536.1|1711209_1711674_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	72.2	4.1e-63
AVZ94537.1|1711687_1712128_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ94538.1|1712476_1713868_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ98123.1|1713956_1714826_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ94539.1|1715177_1715891_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ94540.1|1716064_1717426_+	dNTP triphosphohydrolase	NA	NA	NA	NA	NA
AVZ94541.1|1718015_1718267_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ94542.1|1718266_1719751_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
AVZ94543.1|1719829_1720063_+	DinI family protein	NA	K7PM44	Enterobacteria_phage	71.1	3.7e-25
AVZ94544.1|1720074_1720365_+	hypothetical protein	NA	H6WRY6	Salmonella_phage	56.9	8.0e-17
AVZ94545.1|1720405_1720798_+	DNA-binding protein	NA	K7PHB4	Enterobacterial_phage	36.6	8.0e-12
AVZ94546.1|1720794_1720998_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ94547.1|1720997_1722029_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	49.6	4.7e-96
AVZ94548.1|1722045_1722648_+	hypothetical protein	NA	H9C175	Pectobacterium_phage	68.6	1.1e-76
AVZ94549.1|1724899_1725115_+|holin	holin	holin	A5LH82	Enterobacteria_phage	88.7	2.7e-30
AVZ94550.1|1725114_1725612_+	lysozyme	NA	A0A1V0E5Q7	Salmonella_phage	84.6	1.1e-77
AVZ94551.1|1725608_1725959_+	hypothetical protein	NA	R9TPM9	Aeromonas_phage	38.1	7.9e-11
AVZ94552.1|1726908_1727346_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ94553.1|1727384_1727609_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ94554.1|1727935_1728298_+	HNH endonuclease	NA	Q6UAS2	Klebsiella_phage	83.3	1.2e-57
AVZ94555.1|1728249_1728573_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ94556.1|1728569_1729001_+	hypothetical protein	NA	Q6UAS0	Klebsiella_phage	61.6	1.8e-41
AVZ94557.1|1729249_1729684_+|terminase	phage terminase small subunit P27 family	terminase	A0A1J0GV10	Halomonas_phage	61.9	9.4e-30
AVZ94558.1|1729683_1731405_+|terminase	terminase large subunit	terminase	Q7Y413	Yersinia_phage	57.4	1.5e-190
AVZ94559.1|1731398_1731578_+	hypothetical protein	NA	Q6UAX9	Klebsiella_phage	57.6	3.1e-11
AVZ94560.1|1731577_1732837_+|portal	phage portal protein	portal	Q6UAX8	Klebsiella_phage	89.8	1.8e-222
AVZ94561.1|1732873_1733794_+	S49 family peptidase	NA	Q6UAX7	Klebsiella_phage	88.2	9.6e-149
AVZ94562.1|1733871_1735158_+|capsid	phage major capsid protein	capsid	Q6UAX6	Klebsiella_phage	89.0	9.8e-216
AVZ94563.1|1735216_1735477_+	hypothetical protein	NA	Q6UAX5	Klebsiella_phage	60.5	7.4e-22
AVZ94564.1|1735457_1735775_+|head,tail	phage gp6-like head-tail connector protein	head,tail	Q6UAX4	Klebsiella_phage	89.8	1.5e-45
AVZ94565.1|1735771_1736110_+|head,tail	head-tail adaptor protein	head,tail	Q6UAX3	Klebsiella_phage	90.2	2.8e-53
AVZ94566.1|1736090_1736480_+	hypothetical protein	NA	Q6UAX2	Klebsiella_phage	86.0	9.6e-58
AVZ94567.1|1736476_1736878_+	hypothetical protein	NA	Q6UAX1	Klebsiella_phage	94.0	2.3e-62
AVZ94568.1|1736909_1737371_+|tail	phage tail protein	tail	Q6UAX0	Klebsiella_phage	83.7	7.8e-67
AVZ94569.1|1737428_1737794_+|tail	phage tail protein	tail	Q6UAW8	Klebsiella_phage	89.3	1.6e-51
AVZ94570.1|1737808_1738027_+	hypothetical protein	NA	Q6UAW9	Klebsiella_phage	90.5	5.4e-34
AVZ94571.1|1738026_1741362_+|tail	phage tail tape measure protein	tail	Q6UAW7	Klebsiella_phage	88.3	0.0e+00
AVZ94572.1|1741361_1741700_+|tail	phage tail protein	tail	Q6UAW6	Klebsiella_phage	88.4	1.4e-57
AVZ94573.1|1741696_1742452_+|tail	phage minor tail protein L	tail	Q6UAW5	Klebsiella_phage	80.5	4.6e-125
AVZ94574.1|1742453_1743164_+	peptidase P60	NA	Q6UAW4	Klebsiella_phage	90.3	1.9e-136
AVZ94575.1|1743205_1743628_+	hypothetical protein	NA	J9Q806	Salmonella_phage	50.0	5.9e-29
AVZ94576.1|1743654_1744248_+|tail	tail assembly protein	tail	K7PHE5	Enterobacteria_phage	76.6	8.0e-80
AVZ94577.1|1744310_1757015_+	DUF1983 domain-containing protein	NA	Q6UAW1	Klebsiella_phage	47.1	0.0e+00
1754072:1754086	attR	GGTGACGCAGCAGGG	NA	NA	NA	NA
AVZ94578.1|1757083_1758580_+|tail	tail fiber domain-containing protein	tail	A0A0P0IDN1	Klebsiella_phage	63.7	1.4e-125
AVZ94579.1|1758734_1758887_+	isocitrate dehydrogenase	NA	Q77Z09	Phage_21	92.0	3.8e-18
AVZ94580.1|1759159_1759873_-	ArsR family transcriptional regulator	NA	NA	NA	NA	NA
AVZ94581.1|1759869_1760262_-	amino acid-binding protein	NA	NA	NA	NA	NA
AVZ94582.1|1760254_1760578_-	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
AVZ94583.1|1761014_1761242_-	DUF1272 domain-containing protein	NA	NA	NA	NA	NA
AVZ94584.1|1761354_1762548_-	glutathione-dependent formaldehyde dehydrogenase	NA	NA	NA	NA	NA
AVZ94585.1|1763169_1763355_+	stress-induced acidophilic repeat motif-containing protein	NA	NA	NA	NA	NA
AVZ94586.1|1763445_1763940_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
AVZ94587.1|1763966_1764473_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
AVZ94588.1|1764489_1765377_+	manganese catalase family protein	NA	NA	NA	NA	NA
AVZ94589.1|1765432_1766839_+	cytochrome ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
AVZ94590.1|1766835_1767846_+	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
AVZ94591.1|1767961_1768159_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ94592.1|1768725_1769358_+	DNA-binding protein	NA	NA	NA	NA	NA
AVZ94593.1|1769397_1769577_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ94594.1|1769974_1770661_+	EAL domain-containing protein	NA	NA	NA	NA	NA
AVZ94595.1|1770971_1772480_-	UbiD family decarboxylase	NA	NA	NA	NA	NA
AVZ94596.1|1772600_1773491_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AVZ94597.1|1773497_1775282_-	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	36.1	5.8e-17
AVZ94598.1|1775355_1776564_-	HD domain-containing protein	NA	NA	NA	NA	NA
AVZ94599.1|1776866_1777910_+	type II asparaginase	NA	NA	NA	NA	NA
AVZ94600.1|1778164_1778356_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ94601.1|1778571_1779486_+	kdo(2)-lipid IV(A) palmitoleoyltransferase	NA	A0A1W6JP29	Morganella_phage	50.4	1.1e-72
AVZ94602.1|1779575_1780214_+	leucine efflux protein	NA	NA	NA	NA	NA
AVZ94603.1|1780344_1780608_+	DUF2534 family protein	NA	NA	NA	NA	NA
AVZ94604.1|1780667_1780793_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ98124.1|1780910_1780985_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ94605.1|1780984_1781086_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ94606.1|1781143_1782157_-	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	29.0	1.4e-12
AVZ94607.1|1782457_1782697_+	DUF333 domain-containing protein	NA	NA	NA	NA	NA
AVZ94608.1|1782686_1783043_-	DUF488 domain-containing protein	NA	NA	NA	NA	NA
AVZ94609.1|1783029_1783539_-	DUF523 domain-containing protein	NA	NA	NA	NA	NA
AVZ94610.1|1783684_1784377_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ94611.1|1784408_1785593_-	cyanate MFS transporter	NA	NA	NA	NA	NA
AVZ98125.1|1785694_1786486_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AVZ94612.1|1786469_1786916_-	DUF441 domain-containing protein	NA	NA	NA	NA	NA
AVZ94613.1|1787032_1787533_-|tRNA	YbaK/prolyl-tRNA synthetase associated domain-containing protein	tRNA	NA	NA	NA	NA
>prophage 7
CP028542	Klebsiella pneumoniae strain WCHKP2 chromosome, complete genome	5476966	1915205	1928117	5476966	integrase	Enterobacteria_phage(50.0%)	19	1907183:1907198	1930799:1930814
1907183:1907198	attL	CATTTTTTTGCTCGTT	NA	NA	NA	NA
AVZ94734.1|1915205_1916015_-	peptide ABC transporter ATP-binding protein SapF	NA	A0A2H4PQG7	Staphylococcus_phage	28.9	2.1e-14
AVZ94735.1|1916016_1917009_-	peptide ABC transporter ATP-binding protein SapD	NA	G9BWD6	Planktothrix_phage	27.2	3.0e-07
AVZ94736.1|1917008_1917899_-	peptide ABC transporter permease SapC	NA	NA	NA	NA	NA
AVZ98130.1|1918075_1919263_+|integrase	site-specific integrase	integrase	K7PGY1	Enterobacteria_phage	52.4	1.1e-120
AVZ94737.1|1919159_1919474_-	hypothetical protein	NA	K7PM28	Enterobacteria_phage	50.8	1.6e-10
AVZ94738.1|1919470_1920133_-	DNA methyltransferase	NA	G8C7S6	Escherichia_phage	84.6	2.7e-105
AVZ94739.1|1920129_1920558_-	regulator	NA	M9NYX4	Enterobacteria_phage	80.3	7.5e-64
AVZ94740.1|1920554_1921235_-	exonuclease	NA	A0A0M3ULE0	Salmonella_phage	91.2	8.2e-121
AVZ94741.1|1921520_1922366_-	phage recombination protein Bet	NA	A0A1I9KF88	Aeromonas_phage	59.2	1.8e-69
AVZ94742.1|1922381_1922666_-	host nuclease inhibitor GamL	NA	G8C7T1	Escherichia_phage	79.8	1.1e-39
AVZ94743.1|1922754_1922949_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ94744.1|1923377_1923581_+	hypothetical protein	NA	A0A192Y6Q5	Salmonella_phage	71.6	3.9e-18
AVZ94745.1|1923662_1924739_-	ParA family protein	NA	H2BD62	Pseudomonas_phage	37.9	9.1e-58
AVZ94746.1|1924884_1925004_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ98131.1|1925026_1925725_-	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	84.1	3.7e-108
AVZ94747.1|1925836_1926064_+	transcriptional regulator	NA	Q76H55	Enterobacteria_phage	77.1	1.4e-24
AVZ94748.1|1926104_1926326_+	transcriptional regulator	NA	G8EYH8	Enterobacteria_phage	41.7	6.9e-05
AVZ94749.1|1926411_1927272_+	replication protein	NA	K7PGT1	Enterobacteria_phage	53.3	1.0e-59
AVZ94750.1|1927268_1928117_+	AAA family ATPase	NA	K7PLU3	Enterobacteria_phage	60.1	5.1e-88
1930799:1930814	attR	AACGAGCAAAAAAATG	NA	NA	NA	NA
>prophage 8
CP028542	Klebsiella pneumoniae strain WCHKP2 chromosome, complete genome	5476966	1931250	1946846	5476966	holin,transposase	Enterobacteria_phage(26.67%)	19	NA	NA
AVZ94753.1|1931250_1931718_+	recombination protein NinB	NA	Q8VNP6	Enterobacteria_phage	45.8	3.4e-33
AVZ94754.1|1931698_1931866_+	NinE family protein	NA	K7P7K0	Enterobacteria_phage	62.5	4.6e-09
AVZ94755.1|1931862_1932531_+	serine/threonine protein phosphatase	NA	K7P6H8	Enterobacteria_phage	78.7	1.4e-104
AVZ94756.1|1932523_1933162_+	hypothetical protein	NA	H6WRY9	Salmonella_phage	69.8	3.2e-74
AVZ94757.1|1933158_1933299_+	YlcG family protein	NA	NA	NA	NA	NA
AVZ98132.1|1933298_1933988_+	antiterminator	NA	I6PDF8	Cronobacter_phage	53.1	2.1e-55
AVZ94758.1|1934625_1934937_+|holin	holin	holin	A0A286N2Q5	Klebsiella_phage	100.0	3.8e-49
AVZ94759.1|1934933_1935473_+	hypothetical protein	NA	A0A286N2Q6	Klebsiella_phage	98.9	3.3e-101
AVZ94760.1|1935613_1936318_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AVZ98133.1|1937299_1938091_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA2	NA	NA	NA	NA	NA
AVZ94761.1|1938254_1938602_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
AVZ94762.1|1939217_1939922_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AVZ94763.1|1940514_1940937_+	hypothetical protein	NA	K7P834	Enterobacteria_phage	45.3	3.6e-26
AVZ94764.1|1941583_1941835_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ94765.1|1941834_1943319_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
AVZ94766.1|1943398_1943818_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	57.5	1.4e-35
AVZ94767.1|1943819_1945085_+	translesion error-prone DNA polymerase V subunit UmuC	NA	I6RSM4	Salmonella_phage	82.7	9.6e-208
AVZ98134.1|1945160_1945988_-	FRG domain-containing protein	NA	A0A1S6KZX9	Salmonella_phage	30.2	8.4e-19
AVZ94768.1|1946174_1946846_-	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	59.6	4.5e-79
>prophage 9
CP028542	Klebsiella pneumoniae strain WCHKP2 chromosome, complete genome	5476966	1979779	2051432	5476966	head,plate,lysis,tail,terminase,transposase	uncultured_Caudovirales_phage(33.33%)	84	NA	NA
AVZ94799.1|1979779_1980541_+	SDR family NAD(P)-dependent oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.5	2.4e-20
AVZ94800.1|1980757_1982290_+	HD domain-containing protein	NA	A0A1B1ISR1	uncultured_Mediterranean_phage	30.0	1.1e-21
AVZ94801.1|1982488_1983037_-	DJ-1/PfpI family protein	NA	NA	NA	NA	NA
AVZ94802.1|1983233_1984415_+	DUF4102 domain-containing protein	NA	A0A0M4QX09	Salmonella_phage	84.2	5.6e-202
AVZ94803.1|1984395_1984638_-	AlpA family transcriptional regulator	NA	A0A0M4RTZ2	Salmonella_phage	73.8	2.2e-20
AVZ94804.1|1984816_1985296_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ94805.1|1985292_1985505_-	hypothetical protein	NA	A0A286S2B6	Klebsiella_phage	98.6	3.4e-33
AVZ94806.1|1985501_1985726_-	hypothetical protein	NA	A0A286S2B3	Klebsiella_phage	89.2	3.1e-29
AVZ94807.1|1985715_1986426_-	DNA-binding protein	NA	A0A286S260	Klebsiella_phage	88.3	2.1e-111
AVZ94808.1|1986431_1986950_-	hypothetical protein	NA	A0A286S1S7	Klebsiella_phage	98.8	1.7e-94
AVZ94809.1|1987054_1987882_-	SPFH/Band 7/PHB domain protein	NA	Q8W654	Enterobacteria_phage	84.0	5.5e-111
AVZ94810.1|1987878_1988073_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ94811.1|1988069_1988495_-	hypothetical protein	NA	A0A286S1S2	Klebsiella_phage	77.9	3.5e-53
AVZ94812.1|1988681_1988936_-	hypothetical protein	NA	A0A286SGR4	Klebsiella_phage	97.6	3.1e-41
AVZ94813.1|1988928_1989294_-	hypothetical protein	NA	A0A286S1Q6	Klebsiella_phage	99.2	6.9e-58
AVZ94814.1|1989463_1989652_-	hypothetical protein	NA	A0A286S1P8	Klebsiella_phage	100.0	4.6e-26
AVZ94815.1|1989644_1989959_-	hypothetical protein	NA	A0A286S1T9	Klebsiella_phage	100.0	1.0e-49
AVZ94816.1|1990129_1990798_-	LexA family transcriptional regulator	NA	A0A286S2B2	Klebsiella_phage	99.5	2.4e-125
AVZ94817.1|1990895_1991117_+	XRE family transcriptional regulator	NA	A0A286S2C1	Klebsiella_phage	100.0	3.0e-32
AVZ94818.1|1991091_1991385_+	hypothetical protein	NA	A0A286S2B5	Klebsiella_phage	97.6	2.8e-38
AVZ94819.1|1991693_1993352_+	ATP-dependent helicase	NA	A0A286N2P9	Klebsiella_phage	96.0	0.0e+00
AVZ94820.1|1993353_1994316_+	DNA primase	NA	A0A286N2Q0	Klebsiella_phage	99.4	4.8e-183
AVZ94821.1|1994312_1994789_+	hypothetical protein	NA	A0A286N2Q1	Klebsiella_phage	100.0	1.8e-90
AVZ94822.1|1994785_1995568_+	antitermination protein	NA	F1C595	Cronobacter_phage	76.8	7.2e-113
AVZ94823.1|1995973_1996222_+|lysis	lysis protein	lysis	NA	NA	NA	NA
AVZ94824.1|1996224_1996755_+	lysozyme	NA	K7PLY1	Enterobacteria_phage	77.1	2.7e-79
AVZ94825.1|1996751_1997141_+	lipase chaperone	NA	A0A192Y6H8	Salmonella_phage	49.2	9.4e-21
AVZ94826.1|1997375_1997696_+	negative regulator GrlR	NA	NA	NA	NA	NA
AVZ94827.1|1997797_1998550_+	hypothetical protein	NA	A0A077KBY7	Edwardsiella_phage	66.0	4.0e-12
AVZ94828.1|1998500_1999901_+|terminase	PBSX family phage terminase large subunit	terminase	A0A077KAW0	Edwardsiella_phage	69.0	9.4e-188
AVZ94829.1|2000138_2001590_+	DUF1073 domain-containing protein	NA	A0A0M4S6U1	Salmonella_phage	68.8	3.8e-192
AVZ98137.1|2001645_2002194_+	hypothetical protein	NA	A0A0M4REK0	Salmonella_phage	56.3	3.0e-49
AVZ94830.1|2002245_2003448_+	DUF2213 domain-containing protein	NA	A0A0M4R5A6	Salmonella_phage	54.1	2.6e-106
AVZ94831.1|2003451_2003946_+	hypothetical protein	NA	A0A2H4JHM9	uncultured_Caudovirales_phage	62.7	4.2e-50
AVZ94832.1|2003957_2004899_+	DUF2184 domain-containing protein	NA	A0A2H4J191	uncultured_Caudovirales_phage	77.1	1.7e-137
AVZ94833.1|2004938_2005220_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ94834.1|2005188_2005608_+	DUF4054 domain-containing protein	NA	A0A0M5M3S2	Salmonella_phage	60.7	3.3e-40
AVZ94835.1|2005604_2006111_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ94836.1|2006110_2006497_+|head,tail	head-tail adaptor	head,tail	A0A2H4J1A4	uncultured_Caudovirales_phage	78.2	1.1e-48
AVZ94837.1|2006591_2007032_+	hypothetical protein	NA	A0A2H4J1A0	uncultured_Caudovirales_phage	51.7	1.6e-40
AVZ94838.1|2007035_2008181_+	DUF3383 domain-containing protein	NA	A0A2H4J8G4	uncultured_Caudovirales_phage	76.9	6.3e-166
AVZ94839.1|2008191_2008632_+	DUF3277 family protein	NA	A0A0M5M1K6	Salmonella_phage	80.1	3.3e-62
AVZ94840.1|2008635_2009061_+	hypothetical protein	NA	A0A2H4J2V6	uncultured_Caudovirales_phage	63.4	2.6e-40
AVZ94841.1|2009096_2009249_+	NTP pyrophosphohydrolase	NA	A0A2H4J1A2	uncultured_Caudovirales_phage	88.0	7.6e-19
AVZ94842.1|2009238_2011242_+	lytic transglycosylase domain-containing protein	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	63.6	1.2e-247
AVZ94843.1|2011241_2011841_+	hypothetical protein	NA	A0A2H4J1B3	uncultured_Caudovirales_phage	57.6	9.9e-54
AVZ94844.1|2011841_2012144_+	hypothetical protein	NA	A0A2H4J495	uncultured_Caudovirales_phage	55.2	2.0e-26
AVZ94845.1|2012146_2013169_+	hypothetical protein	NA	A0A2H4J1B2	uncultured_Caudovirales_phage	54.2	9.2e-100
AVZ94846.1|2013168_2013510_+	hypothetical protein	NA	A0A2H4J1A5	uncultured_Caudovirales_phage	46.6	1.8e-23
AVZ94847.1|2013562_2013748_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ94848.1|2013784_2014351_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ94849.1|2014404_2015058_+	hypothetical protein	NA	A0A2H4J8H6	uncultured_Caudovirales_phage	63.5	1.0e-59
AVZ94850.1|2015059_2015413_+	hypothetical protein	NA	A0A2H4J629	uncultured_Caudovirales_phage	80.3	2.3e-50
AVZ94851.1|2015412_2016609_+	hypothetical protein	NA	A0A0M4RD32	Salmonella_phage	72.9	3.9e-158
AVZ94852.1|2016605_2017379_+	DUF2612 domain-containing protein	NA	A0A2H4J1A9	uncultured_Caudovirales_phage	54.4	2.8e-77
AVZ94853.1|2017378_2018245_+	hypothetical protein	NA	A0A2H4IYR0	uncultured_Caudovirales_phage	64.5	1.9e-34
AVZ94854.1|2018244_2018442_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ98138.1|2020792_2021521_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ94855.1|2021531_2022263_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ94856.1|2022259_2022469_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ94857.1|2022573_2022858_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ94858.1|2023080_2023329_-	DinI family protein	NA	S5MQI1	Escherichia_phage	70.4	1.4e-25
AVZ94859.1|2023742_2023886_+	ABC transporter	NA	NA	NA	NA	NA
AVZ94860.1|2023924_2024905_-|transposase	IS5-like element ISKpn26 family transposase	transposase	Q38213	Escherichia_phage	99.1	8.9e-185
AVZ94861.1|2025913_2027458_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
AVZ98139.1|2027470_2028811_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
AVZ94862.1|2028807_2029497_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
AVZ94863.1|2029493_2031200_+	OmpA family protein	NA	NA	NA	NA	NA
AVZ94864.1|2031204_2031696_+	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
AVZ94865.1|2031960_2034615_+	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	33.4	2.5e-96
AVZ94866.1|2034607_2036986_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	33.8	9.2e-18
AVZ94867.1|2036986_2037766_+	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
AVZ94868.1|2037829_2038360_+	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
AVZ94869.1|2038428_2038959_+	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
AVZ94870.1|2039026_2039557_+	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
AVZ94871.1|2039625_2040156_+	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
AVZ94872.1|2040223_2040754_+	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
AVZ94873.1|2040741_2043159_+	DUF2235 domain-containing protein	NA	NA	NA	NA	NA
AVZ94874.1|2043203_2043461_+	PAAR domain-containing protein	NA	NA	NA	NA	NA
AVZ94875.1|2043457_2044597_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ94876.1|2044580_2048006_+	type VI secretion protein VasK	NA	NA	NA	NA	NA
AVZ94877.1|2048005_2048413_+	type VI secretion protein	NA	NA	NA	NA	NA
AVZ94878.1|2048464_2049598_+	type VI secretion system protein TssA	NA	NA	NA	NA	NA
AVZ94879.1|2049677_2051432_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
>prophage 10
CP028542	Klebsiella pneumoniae strain WCHKP2 chromosome, complete genome	5476966	2235883	2246770	5476966		Escherichia_phage(87.5%)	9	NA	NA
AVZ95052.1|2235883_2236504_-	aldolase	NA	A0A077SK32	Escherichia_phage	100.0	8.0e-115
AVZ95053.1|2236496_2237762_-	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	99.5	6.6e-233
AVZ95054.1|2237773_2238676_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	99.3	7.7e-159
AVZ95055.1|2238936_2239698_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
AVZ95056.1|2239718_2240579_-	class A broad-spectrum beta-lactamase SHV-11	NA	A0A077SL40	Escherichia_phage	99.3	2.2e-155
AVZ95057.1|2240876_2241137_+	hypothetical protein	NA	A0A077SK33	Escherichia_phage	97.7	3.5e-40
AVZ95058.1|2241223_2242312_+	chromosome segregation protein SMC	NA	A0A077SLJ9	Escherichia_phage	100.0	8.0e-211
AVZ95059.1|2242342_2243608_-	MFS transporter	NA	NA	NA	NA	NA
AVZ95060.1|2243662_2246770_-	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	59.6	0.0e+00
>prophage 11
CP028542	Klebsiella pneumoniae strain WCHKP2 chromosome, complete genome	5476966	3231768	3243443	5476966	transposase	Escherichia_phage(33.33%)	10	NA	NA
AVZ95976.1|3231768_3232749_-|transposase	IS5-like element ISKpn26 family transposase	transposase	Q38213	Escherichia_phage	99.1	8.9e-185
AVZ95977.1|3232789_3233701_-	acyltransferase	NA	NA	NA	NA	NA
AVZ95978.1|3234063_3235230_-	UDP-glucose 6-dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	54.7	9.1e-112
AVZ95979.1|3235409_3235964_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	58.2	2.9e-52
AVZ95980.1|3235978_3236869_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	34.2	2.8e-28
AVZ95981.1|3236900_3237770_-	glucose-1-phosphate thymidylyltransferase	NA	I7I009	Enterobacteria_phage	66.7	1.7e-110
AVZ98194.1|3237783_3238848_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	54.7	9.8e-105
AVZ95982.1|3239002_3240373_-	phosphomannomutase	NA	A0A127AWJ1	Bacillus_phage	25.9	6.4e-32
AVZ95983.1|3240394_3241810_-	mannose-1-phosphate guanylyltransferase	NA	A0A1V0SH58	Hokovirus	31.0	1.4e-53
AVZ95984.1|3242036_3243443_-	phosphogluconate dehydrogenase (NADP(+)-dependent, decarboxylating)	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.7	4.7e-38
>prophage 12
CP028542	Klebsiella pneumoniae strain WCHKP2 chromosome, complete genome	5476966	3286788	3293693	5476966		Bacillus_phage(33.33%)	6	NA	NA
AVZ96013.1|3286788_3288267_+	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	28.3	1.9e-29
AVZ96014.1|3288263_3288986_+	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.2	8.3e-31
AVZ96015.1|3289304_3290666_+	U32 family peptidase	NA	Q6DW11	Phage_TP	94.8	1.8e-207
AVZ98197.1|3290911_3291805_+	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.8	6.1e-15
AVZ96016.1|3292045_3292819_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.7	3.9e-26
AVZ98198.1|3292829_3293693_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	27.5	7.4e-10
>prophage 13
CP028542	Klebsiella pneumoniae strain WCHKP2 chromosome, complete genome	5476966	3597090	3678781	5476966	tRNA,holin,tail,protease,terminase,transposase	Salmonella_phage(36.21%)	88	NA	NA
AVZ96277.1|3597090_3599094_-|tRNA	tRNA(Met) cytidine acetyltransferase	tRNA	NA	NA	NA	NA
AVZ96278.1|3599103_3599979_-	neutral zinc metallopeptidase	NA	NA	NA	NA	NA
AVZ96279.1|3600098_3600812_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A127KMU1	Cyanophage	35.7	1.1e-38
AVZ96280.1|3601027_3602062_-	outer membrane protein assembly factor BamC	NA	NA	NA	NA	NA
AVZ96281.1|3602078_3602957_-	4-hydroxy-tetrahydrodipicolinate synthase	NA	NA	NA	NA	NA
AVZ96282.1|3603044_3603677_+	glycine cleavage system transcriptional repressor	NA	NA	NA	NA	NA
AVZ96283.1|3603680_3604151_+	thioredoxin-dependent thiol peroxidase	NA	NA	NA	NA	NA
AVZ96284.1|3604212_3605274_-	AI-2E family transporter	NA	NA	NA	NA	NA
AVZ96285.1|3605496_3606960_+|protease	beta-barrel assembly-enhancing protease	protease	NA	NA	NA	NA
AVZ96286.1|3606969_3607329_+	arsenate reductase (glutaredoxin)	NA	NA	NA	NA	NA
AVZ96287.1|3607456_3608368_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	58.8	3.5e-74
AVZ96288.1|3608364_3609066_-	DnaA inactivator Hda	NA	NA	NA	NA	NA
AVZ96289.1|3609164_3610451_-	uracil permease	NA	Q9KX94	Enterobacteria_phage	38.1	1.9e-65
AVZ96290.1|3610546_3611173_-	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
AVZ96291.1|3611390_3612824_-	6-phospho-beta-glucosidase	NA	NA	NA	NA	NA
AVZ96292.1|3612833_3613727_-	beta-glucoside kinase	NA	NA	NA	NA	NA
AVZ96293.1|3613990_3615028_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	44.5	8.2e-72
AVZ96294.1|3615024_3615666_+	phosphoribosylglycinamide formyltransferase	NA	E3SNR5	Prochlorococcus_phage	41.1	1.2e-28
AVZ96295.1|3615846_3617907_+	polyphosphate kinase 1	NA	NA	NA	NA	NA
AVZ96296.1|3617910_3619443_+	exopolyphosphatase	NA	NA	NA	NA	NA
AVZ96297.1|3619496_3621725_-	sensor domain-containing phosphodiesterase	NA	NA	NA	NA	NA
AVZ96298.1|3622077_3622269_+	DUF2633 family protein	NA	G9L6F2	Escherichia_phage	79.3	3.3e-19
AVZ96299.1|3622365_3623253_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AVZ96300.1|3623350_3624583_+	MFS transporter	NA	NA	NA	NA	NA
AVZ96301.1|3624876_3626055_+	anaerobic sulfatase maturase	NA	NA	NA	NA	NA
AVZ96302.1|3626038_3627907_+	phosphatase	NA	A0A2P0VMN7	Tetraselmis_virus	22.6	2.6e-07
AVZ96303.1|3628093_3628594_-	DUF2514 domain-containing protein	NA	Q858E9	Salmonella_phage	76.9	1.3e-59
AVZ96304.1|3628590_3629220_-	glycoside hydrolase family 19 protein	NA	Q858F0	Salmonella_phage	76.9	1.8e-90
AVZ96305.1|3629209_3629515_-|holin	phage holin family protein	holin	A0A193GYK3	Enterobacter_phage	81.4	2.7e-39
AVZ96306.1|3629501_3629906_-	hypothetical protein	NA	T1SA79	Salmonella_phage	81.1	8.7e-54
AVZ96307.1|3629992_3631309_-	right-handed parallel beta-helix repeat-containing protein	NA	A0A0K2FI18	Enterobacter_phage	32.3	2.3e-34
AVZ96308.1|3631386_3631527_+	ABC transporter	NA	NA	NA	NA	NA
AVZ96309.1|3632417_3633680_+|transposase	IS1380 family transposase ISEc9	transposase	A0A1B0VDR3	Salmonella_phage	100.0	1.3e-39
AVZ96310.1|3634548_3635529_+|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.4	1.0e-185
AVZ98213.1|3635567_3635654_-	ABC transporter	NA	NA	NA	NA	NA
AVZ96311.1|3635642_3636776_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ96312.1|3636816_3637080_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ96313.1|3639907_3640204_+	hypothetical protein	NA	T1SA06	Salmonella_phage	63.9	6.9e-24
AVZ96314.1|3640302_3640455_+	transmembrane anchored protein	NA	G9L6D9	Escherichia_phage	83.7	2.5e-14
AVZ96315.1|3640489_3640684_-	hypothetical protein	NA	Q858F7	Salmonella_phage	67.2	6.5e-15
AVZ96316.1|3640680_3643437_-	hypothetical protein	NA	Q858F8	Salmonella_phage	95.4	0.0e+00
AVZ96317.1|3643436_3645347_-	hypothetical protein	NA	Q858F9	Salmonella_phage	82.7	5.4e-287
AVZ96318.1|3645346_3647881_-	hypothetical protein	NA	Q858G0	Salmonella_phage	84.1	0.0e+00
AVZ96319.1|3647891_3648431_-	hypothetical protein	NA	A0A0F6TJ56	Escherichia_coli_O157_typing_phage	80.0	8.0e-71
AVZ96320.1|3648430_3648895_-	hypothetical protein	NA	Q858G2	Salmonella_phage	81.2	1.5e-70
AVZ96321.1|3648894_3651372_-	hypothetical protein	NA	Q858G3	Salmonella_phage	84.4	0.0e+00
AVZ96322.1|3651371_3651977_-	hypothetical protein	NA	A0A0F6TJN5	Escherichia_coli_O157_typing_phage	77.0	4.0e-87
AVZ96323.1|3651976_3652300_-	hypothetical protein	NA	G9L6C8	Escherichia_phage	85.0	5.3e-46
AVZ96324.1|3652350_3652692_-	hypothetical protein	NA	G9L6C7	Escherichia_phage	70.8	2.4e-36
AVZ96325.1|3652702_3653140_-	hypothetical protein	NA	A0A193GYT9	Enterobacter_phage	91.7	1.3e-66
AVZ96326.1|3653193_3654180_-	hypothetical protein	NA	A0A193GZ49	Enterobacter_phage	94.2	2.5e-179
AVZ96327.1|3654194_3654875_-	peptidase	NA	G9L6C4	Escherichia_phage	84.0	6.1e-76
AVZ96328.1|3654877_3655174_-	hypothetical protein	NA	T1SBI9	Salmonella_phage	70.4	1.2e-33
AVZ96329.1|3655170_3656853_-|tail	phage tail protein	tail	A0A0F6TJD8	Escherichia_coli_O157_typing_phage	84.4	1.5e-264
AVZ96330.1|3656867_3657074_-	hypothetical protein	NA	T1SA67	Salmonella_phage	88.2	4.8e-08
AVZ96331.1|3657535_3657778_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ96332.1|3657827_3658199_+	hypothetical protein	NA	A0A0F6TJP2	Escherichia_coli_O157_typing_phage	91.9	3.7e-59
AVZ96333.1|3658242_3659718_-|terminase	terminase	terminase	Q858H3	Salmonella_phage	93.1	6.4e-280
AVZ96334.1|3659714_3660299_-|terminase	terminase small subunit	terminase	T1SBI8	Salmonella_phage	88.6	2.2e-90
AVZ98214.1|3660376_3660634_-	lF-82	NA	NA	NA	NA	NA
AVZ96335.1|3660786_3661038_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ96336.1|3661037_3662522_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
AVZ96337.1|3662618_3662957_-	hypothetical protein	NA	A0A193GYX4	Enterobacter_phage	80.0	1.8e-44
AVZ98215.1|3662949_3663153_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ96338.1|3663152_3663773_-	hypothetical protein	NA	Q1MVF7	Enterobacteria_phage	40.7	1.0e-29
AVZ96339.1|3663769_3664063_-	hypothetical protein	NA	Q6UAT9	Klebsiella_phage	86.6	2.7e-44
AVZ98216.1|3664062_3664530_-	hypothetical protein	NA	A0A2R2Z312	Escherichia_phage	51.7	1.3e-37
AVZ96340.1|3664823_3665468_-	hypothetical protein	NA	Q1MVG0	Enterobacteria_phage	79.3	8.0e-110
AVZ96341.1|3665464_3665656_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ96342.1|3665639_3666050_-	hypothetical protein	NA	A0A2P1MXC5	Escherichia_phage	45.1	4.3e-16
AVZ96343.1|3666242_3666590_-	DUF1064 domain-containing protein	NA	A0A0F6R8N5	Escherichia_coli_O157_typing_phage	82.6	6.5e-50
AVZ96344.1|3666709_3667495_-	replication protein	NA	A0A193GYX1	Enterobacter_phage	87.7	3.7e-133
AVZ96345.1|3667491_3668259_-	primosomal protein	NA	A0A193GZ86	Enterobacter_phage	91.4	8.9e-140
AVZ96346.1|3668258_3668468_-	hypothetical protein	NA	A0A193GYW4	Enterobacter_phage	78.3	1.8e-26
AVZ96347.1|3668614_3668848_-	hypothetical protein	NA	T1SAR5	Salmonella_phage	66.2	9.2e-24
AVZ96348.1|3669002_3669584_+	XRE family transcriptional regulator	NA	Q858D7	Salmonella_phage	64.3	7.1e-65
AVZ96349.1|3669950_3670250_+	hypothetical protein	NA	A0A0F6R7M4	Escherichia_coli_O157_typing_phage	54.5	2.1e-20
AVZ96350.1|3670246_3671068_+	exodeoxyribonuclease VIII	NA	A0A193GYK2	Enterobacter_phage	80.2	1.8e-130
AVZ96351.1|3671064_3671946_+	recombinase RecT	NA	T1SBJ5	Salmonella_phage	84.3	8.9e-136
AVZ96352.1|3671994_3672243_+	AlpA family phage regulatory protein	NA	A0A0F6TJ45	Escherichia_coli_O157_typing_phage	76.8	4.9e-31
AVZ96353.1|3672352_3672646_+	PerC family transcriptional regulator	NA	T1S9J5	Salmonella_phage	71.1	4.0e-32
AVZ96354.1|3672638_3672797_+	DUF1317 family protein	NA	T1SAR0	Salmonella_phage	78.8	1.1e-17
AVZ96355.1|3672793_3673456_+	hypothetical protein	NA	A0A059VF56	Pseudomonas_phage	46.6	1.2e-47
AVZ96356.1|3673452_3674046_+	adenine methylase	NA	T1SA14	Salmonella_phage	91.9	6.3e-109
AVZ96357.1|3674042_3674285_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ96358.1|3674227_3675478_-	DUF4102 domain-containing protein	NA	A0A1X9TCT6	Enterobacter_phage	84.4	5.8e-205
AVZ96359.1|3675669_3677247_-	GMP synthase (glutamine-hydrolyzing)	NA	NA	NA	NA	NA
AVZ96360.1|3677314_3678781_-	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	38.7	1.2e-87
>prophage 14
CP028542	Klebsiella pneumoniae strain WCHKP2 chromosome, complete genome	5476966	3750131	3832641	5476966	tRNA,capsid,head,portal,plate,lysis,tail,coat,transposase,integrase	Salmonella_phage(69.23%)	90	3794826:3794872	3833181:3833227
AVZ96423.1|3750131_3750869_-|tRNA	tRNA (adenosine(37)-N6)-methyltransferase TrmM	tRNA	NA	NA	NA	NA
AVZ96424.1|3751000_3752332_+	ATP-dependent RNA helicase SrmB	NA	E3T5E1	Cafeteria_roenbergensis_virus	31.9	6.2e-48
AVZ96425.1|3752377_3752761_-	autonomous glycyl radical cofactor GrcA	NA	A0A193GZ98	Escherichia_phage	79.3	4.0e-32
AVZ96426.1|3753074_3753764_+	uracil-DNA glycosylase	NA	A0A077BCN4	Equid_alphaherpesvirus	53.0	1.3e-57
AVZ96427.1|3753821_3754907_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
AVZ96428.1|3755110_3755536_+	thioredoxin TrxC	NA	A0A1J0GW78	Streptomyces_phage	40.2	6.0e-13
AVZ96429.1|3755605_3756304_+	DTW domain-containing protein	NA	NA	NA	NA	NA
AVZ96430.1|3756338_3758990_+	protein lysine acetyltransferase	NA	NA	NA	NA	NA
AVZ96431.1|3759110_3760466_+	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
AVZ96432.1|3760507_3760831_+	YfiM family lipoprotein	NA	NA	NA	NA	NA
AVZ96433.1|3760834_3762133_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	31.5	3.1e-44
AVZ96434.1|3768098_3770672_-	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.4	6.9e-128
AVZ96435.1|3770801_3771533_-	peptidoglycan editing factor PgeF	NA	NA	NA	NA	NA
AVZ96436.1|3771529_3772510_-	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
AVZ96437.1|3772641_3773379_+	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
AVZ96438.1|3773649_3773985_+	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
AVZ98218.1|3774091_3774139_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ96439.1|3774239_3775400_+	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
AVZ96440.1|3775396_3776269_-	SMP-30/gluconolactonase/LRE family protein	NA	NA	NA	NA	NA
AVZ96441.1|3776331_3777453_-	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
AVZ96442.1|3777462_3778533_-	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.5	1.8e-90
AVZ96443.1|3778875_3779385_+	YfiR family protein	NA	NA	NA	NA	NA
AVZ96444.1|3779377_3780601_+	diguanylate cyclase	NA	NA	NA	NA	NA
AVZ96445.1|3780614_3781097_+	OmpA family protein	NA	NA	NA	NA	NA
AVZ96446.1|3781105_3782476_-	PepSY domain-containing protein	NA	NA	NA	NA	NA
AVZ96447.1|3782532_3782991_-	DUF2946 domain-containing protein	NA	NA	NA	NA	NA
AVZ96448.1|3783110_3783458_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
AVZ96449.1|3783497_3784265_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
AVZ96450.1|3784296_3784845_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
AVZ96451.1|3784863_3785112_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
AVZ96452.1|3785371_3786736_-	signal recognition particle protein	NA	NA	NA	NA	NA
AVZ96453.1|3786899_3787691_+	inner membrane protein YpjD	NA	NA	NA	NA	NA
AVZ96454.1|3787710_3788997_+	DUF21 domain-containing protein	NA	NA	NA	NA	NA
AVZ96455.1|3789116_3789707_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
AVZ96456.1|3789831_3790710_+	NAD(+) kinase	NA	NA	NA	NA	NA
AVZ96457.1|3790796_3792458_+	DNA repair protein RecN	NA	NA	NA	NA	NA
AVZ96458.1|3792605_3792947_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
AVZ96459.1|3793013_3793304_-	RnfH family protein	NA	NA	NA	NA	NA
AVZ96460.1|3793293_3793770_-	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
AVZ96461.1|3793880_3794363_+	SsrA-binding protein	NA	W5RAM5	Staphylococcus_phage	47.4	2.3e-29
3794826:3794872	attL	ATGTAGGAATTTCGGACGCGGGTTCAACTCCCGCCAGCTCCACCAAA	NA	NA	NA	NA
AVZ96462.1|3794966_3795344_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ96463.1|3795371_3795590_-	levansucrase regulator	NA	Q53ZE7	Salmonella_virus	72.2	1.9e-26
AVZ96464.1|3795656_3796751_-	phage late control D family protein	NA	E5G6Q3	Salmonella_phage	83.6	2.4e-170
AVZ96465.1|3796747_3797233_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	80.1	5.2e-61
AVZ96466.1|3797229_3799860_-|tail	phage tail tape measure protein	tail	E5FFG5	Burkholderia_phage	41.9	8.9e-115
AVZ96467.1|3799852_3799972_-|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.2e-13
AVZ96468.1|3799986_3800286_-|tail	phage tail assembly protein	tail	E5G6P9	Salmonella_phage	78.0	8.2e-33
AVZ96469.1|3800338_3800854_-|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	84.2	1.4e-80
AVZ96470.1|3800863_3802036_-|tail	phage tail protein	tail	A0A1S6KZY7	Salmonella_phage	91.5	3.4e-207
AVZ96471.1|3802184_3803258_-|tail	phage tail protein	tail	A0A1S6KZZ8	Salmonella_phage	53.6	6.6e-40
AVZ96472.1|3803309_3804428_-	hypothetical protein	NA	A0A248XD67	Klebsiella_phage	38.0	4.4e-55
AVZ96473.1|3804437_3806387_-|coat	spore coat protein CotH	coat	Q6QI97	Burkholderia_phage	38.9	1.0e-06
AVZ96474.1|3806388_3807060_-|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	58.9	3.2e-61
AVZ96475.1|3807052_3807961_-|plate	baseplate assembly protein	plate	E5G6N8	Salmonella_phage	68.9	1.9e-109
AVZ96476.1|3807947_3808310_-|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	85.6	8.4e-48
AVZ96477.1|3808306_3808879_-|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	70.8	1.4e-76
AVZ96478.1|3808973_3809840_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ96479.1|3809862_3810309_-	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	72.3	2.5e-54
AVZ96480.1|3810301_3810724_-|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	83.2	8.2e-63
AVZ96481.1|3810686_3810890_-	hypothetical protein	NA	A0A1S6KZX6	Salmonella_phage	77.6	3.0e-23
AVZ96482.1|3810819_3811248_-|lysis	LysB family phage lysis regulatory protein	lysis	A0A1S6KZX8	Salmonella_phage	82.5	7.1e-54
AVZ96483.1|3811244_3811628_-	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	45.4	1.9e-18
AVZ96484.1|3811632_3812142_-	lysozyme	NA	E5G6N1	Salmonella_phage	85.2	1.6e-81
AVZ98219.1|3812122_3812338_-	hypothetical protein	NA	E5G6N0	Salmonella_phage	88.7	6.1e-30
AVZ96485.1|3812341_3812545_-|tail	phage tail protein	tail	E5G6M9	Salmonella_phage	89.6	9.8e-30
AVZ96486.1|3812544_3813009_-|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	85.7	1.5e-73
AVZ96487.1|3813104_3813758_-	hypothetical protein	NA	A0A1S6KZX1	Salmonella_phage	80.0	1.9e-90
AVZ96488.1|3813761_3814814_-|capsid	phage major capsid protein, P2 family	capsid	A0A1S6KZZ3	Salmonella_phage	91.0	6.8e-175
AVZ96489.1|3814830_3815664_-|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	77.6	4.4e-100
AVZ96490.1|3815804_3817568_+	oxidoreductase	NA	A0A1S6KZW3	Salmonella_phage	91.8	0.0e+00
AVZ96491.1|3817567_3818611_+|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	85.6	3.1e-172
AVZ96492.1|3818667_3818937_-	hypothetical protein	NA	D2IZW1	Enterococcus_phage	41.3	1.4e-15
AVZ96493.1|3819458_3820460_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ96494.1|3820459_3821539_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ96495.1|3821525_3822209_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ96496.1|3822304_3822538_-	DinI family protein	NA	A0A0M4S6H1	Salmonella_phage	96.1	2.0e-34
AVZ96497.1|3822549_3822738_-	hypothetical protein	NA	A0A1S6L006	Salmonella_phage	90.3	2.2e-23
AVZ96498.1|3822845_3824330_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
AVZ96499.1|3824329_3824581_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ96500.1|3824810_3827195_-	replication endonuclease	NA	A0A1S6L028	Salmonella_phage	87.9	0.0e+00
AVZ96501.1|3827191_3828043_-	DNA adenine methylase	NA	A0A1S6L011	Salmonella_phage	75.4	2.2e-115
AVZ96502.1|3828039_3828267_-	TraR/DksA family transcriptional regulator	NA	A0A1S6L007	Salmonella_phage	92.0	5.1e-35
AVZ96503.1|3828266_3828500_-	DUF2732 family protein	NA	A0A1S6L021	Salmonella_phage	90.9	6.0e-31
AVZ96504.1|3828567_3828906_-	hypothetical protein	NA	A0A218M4I7	Erwinia_phage	58.0	6.2e-29
AVZ96505.1|3828869_3829070_-	DUF2724 domain-containing protein	NA	A0A1S6L005	Salmonella_phage	68.8	4.5e-19
AVZ96506.1|3829077_3829587_-	hypothetical protein	NA	A0A1S6L008	Salmonella_phage	85.8	1.1e-77
AVZ96507.1|3829619_3829862_-	Rha family transcriptional regulator	NA	A0A1S6KZZ6	Salmonella_phage	98.8	4.0e-38
AVZ96508.1|3829984_3830614_+	phage repressor protein	NA	A0A1S6KZZ7	Salmonella_phage	54.5	1.4e-61
AVZ96509.1|3830616_3831615_+|integrase	site-specific integrase	integrase	A0A1S6L016	Salmonella_phage	94.5	2.2e-183
AVZ96510.1|3831660_3832641_+|transposase	IS5-like element ISKpn26 family transposase	transposase	Q38213	Escherichia_phage	99.1	8.9e-185
3833181:3833227	attR	ATGTAGGAATTTCGGACGCGGGTTCAACTCCCGCCAGCTCCACCAAA	NA	NA	NA	NA
>prophage 15
CP028542	Klebsiella pneumoniae strain WCHKP2 chromosome, complete genome	5476966	4853351	4862226	5476966	transposase	Enterobacteria_phage(83.33%)	9	NA	NA
AVZ97475.1|4853351_4855685_-	DNA primase	NA	Q7M2A8	Enterobacteria_phage	83.9	0.0e+00
AVZ97476.1|4855699_4856020_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ97477.1|4856016_4856244_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ97478.1|4856240_4856789_-	Ash-like/host cell division inhibitor Icd-like protein	NA	Q7M2A7	Enterobacteria_phage	69.4	1.1e-30
AVZ97479.1|4857612_4858350_+	glycoprotein 3	NA	Q7M2A2	Enterobacteria_phage	59.4	1.1e-70
AVZ97480.1|4858346_4858592_+	hypothetical protein	NA	Q7M294	Enterobacteria_phage	56.8	5.5e-19
AVZ97481.1|4858609_4859176_+	Polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	63.8	9.7e-59
AVZ97482.1|4859916_4860996_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ97483.2|4861245_4862226_+|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.4	1.0e-185
>prophage 1
CP028541	Klebsiella pneumoniae strain WCHKP2 plasmid pKPC2_020002, complete sequence	177516	1796	18519	177516	protease,transposase	Escherichia_phage(60.0%)	16	NA	NA
AVZ92763.1|1796_2450_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
AVZ92764.1|2669_3134_+	mRNA interferase PemK	NA	NA	NA	NA	NA
AVZ92765.1|3130_3235_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ92766.1|4444_5149_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AVZ92767.1|5659_6535_+	class A extended-spectrum beta-lactamase CTX-M-65	NA	A0A1B0VBP7	Salmonella_phage	98.9	6.8e-152
AVZ92768.1|6614_7538_+|transposase	IS5 family transposase	transposase	Q9MCT5	Escherichia_phage	99.7	2.2e-177
AVZ92769.1|9288_9993_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AVZ92770.1|11103_11808_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AVZ92771.1|11873_12392_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ92772.1|12396_12813_-	fosfomycin resistance glutathione transferase FosA3	NA	Q2LI91	Bacillus_phage	35.6	2.0e-08
AVZ92773.1|13198_13903_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AVZ92774.1|14580_14769_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ92958.1|14860_15397_+	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	100.0	2.8e-84
AVZ92775.1|15579_16440_+	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
AVZ92776.1|16609_17365_+	16S rRNA (guanine(1405)-N(7))-methyltransferase RmtB1	NA	NA	NA	NA	NA
AVZ92777.1|17814_18519_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
>prophage 2
CP028541	Klebsiella pneumoniae strain WCHKP2 plasmid pKPC2_020002, complete sequence	177516	73209	117049	177516	integrase,transposase	Escherichia_phage(34.78%)	45	76398:76412	106435:106449
AVZ92839.1|73209_73914_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AVZ92840.1|75182_76064_-	carbapenem-hydrolyzing class A beta-lactamase KPC-2	NA	A0A1B0VBP7	Salmonella_phage	52.2	2.2e-73
AVZ92841.1|76339_77320_-|transposase	IS481-like element ISKpn27 family transposase	transposase	A8RHK4	Spiroplasma_virus	27.4	2.9e-10
76398:76412	attL	TCATGCCATTCCTTG	NA	NA	NA	NA
AVZ92842.1|77442_77916_-	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	99.3	3.3e-76
AVZ92843.1|77955_78660_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AVZ92844.1|79928_80810_-	carbapenem-hydrolyzing class A beta-lactamase KPC-2	NA	A0A1B0VBP7	Salmonella_phage	52.2	2.2e-73
AVZ92845.1|81085_82066_-|transposase	IS481-like element ISKpn27 family transposase	transposase	A8RHK4	Spiroplasma_virus	27.4	2.9e-10
AVZ92846.1|82188_82662_-	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	99.3	3.3e-76
AVZ92847.1|82701_83406_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AVZ92848.1|84674_85556_-	carbapenem-hydrolyzing class A beta-lactamase KPC-2	NA	A0A1B0VBP7	Salmonella_phage	52.2	2.2e-73
AVZ92849.1|85831_86812_-|transposase	IS481-like element ISKpn27 family transposase	transposase	A8RHK4	Spiroplasma_virus	27.4	2.9e-10
AVZ92850.1|86934_87408_-	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	99.3	3.3e-76
AVZ92851.1|87447_88152_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AVZ92852.1|89463_90171_-	EAL domain-containing protein	NA	NA	NA	NA	NA
AVZ92853.1|90167_90404_-	mercury resistance protein	NA	NA	NA	NA	NA
AVZ92854.1|90400_90763_-	transcriptional regulator	NA	NA	NA	NA	NA
AVZ92855.1|90780_92475_-	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.6	8.8e-39
AVZ92964.1|92526_92949_-	mercury transport protein MerC	NA	NA	NA	NA	NA
AVZ92856.1|92984_93260_-	mercury resistance system periplasmic binding protein MerP	NA	NA	NA	NA	NA
AVZ92857.1|93273_93624_-	mercuric ion transporter MerT	NA	NA	NA	NA	NA
AVZ92858.1|93695_94130_+	mercuric resistance operon regulatory protein	NA	NA	NA	NA	NA
AVZ92859.1|94208_95213_+|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
AVZ92860.1|96746_97769_-	DNA helicase UvrD	NA	NA	NA	NA	NA
AVZ92861.1|97753_99316_-	ATP-dependent endonuclease	NA	NA	NA	NA	NA
AVZ92862.1|99389_99806_-	PIN domain-containing protein	NA	NA	NA	NA	NA
AVZ92863.1|99802_100033_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
AVZ92864.1|100016_100451_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ92865.1|100611_101556_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ92965.1|101634_101985_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ92866.1|102042_102564_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ92867.1|102609_102813_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ92868.1|102842_103847_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ92869.1|104030_104810_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	92.0	5.4e-52
AVZ92870.1|104855_105113_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ92871.1|105890_106757_+	RepB family plasmid replication initiator protein	NA	A0A222YYK1	Escherichia_phage	31.1	1.5e-23
106435:106449	attR	TCATGCCATTCCTTG	NA	NA	NA	NA
AVZ92872.1|107866_109072_+	ParA family protein	NA	A0A077SL49	Escherichia_phage	69.3	5.3e-163
AVZ92873.1|109068_110046_+	ParB/RepB/Spo0J family partition protein	NA	Q38420	Escherichia_phage	53.8	1.4e-86
AVZ92874.1|110127_111399_-	translesion error-prone DNA polymerase V subunit UmuC	NA	F1C5A5	Cronobacter_phage	63.7	7.5e-152
AVZ92875.1|111398_111830_-	peptidase	NA	A0A1W6JNS2	Morganella_phage	53.3	2.1e-29
AWT57758.1|111988_112240_+	hypothetical protein	NA	NA	NA	NA	NA
AWT57759.1|112239_113724_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
AVZ92876.1|113972_114944_+	StbA family protein	NA	A0A222YXF2	Escherichia_phage	46.8	1.1e-73
AVZ92877.1|114946_115618_+	Mediator of plasmid stability	NA	NA	NA	NA	NA
AVZ92878.1|115680_115911_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ92879.1|116347_117049_+	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	36.2	1.6e-26
>prophage 3
CP028541	Klebsiella pneumoniae strain WCHKP2 plasmid pKPC2_020002, complete sequence	177516	140504	169032	177516	transposase	Escherichia_phage(27.78%)	35	NA	NA
AVZ92916.1|140504_141209_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AVZ92917.1|141334_141709_-	hypothetical protein	NA	A0A248SL90	Klebsiella_phage	62.7	2.2e-27
AVZ92918.1|142334_142694_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ92919.1|142755_143079_-	theronine dehydrogenase	NA	I3UM57	Rhodobacter_phage	38.1	6.0e-13
AVZ92920.1|143075_143804_-	plasmid SOS inhibition protein A	NA	NA	NA	NA	NA
AVZ92921.1|143800_144232_-	conjugation system SOS inhibitor PsiB	NA	NA	NA	NA	NA
AVZ92922.1|146354_146585_-	DUF905 domain-containing protein	NA	NA	NA	NA	NA
AVZ92923.1|147562_147823_-	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	46.2	4.1e-12
AVZ92924.1|148009_148201_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ92925.1|148243_148750_-	antirestriction protein ArdA	NA	A0A1I9S7Y0	Rhodococcus_phage	31.8	4.8e-09
AVZ92926.1|149154_149934_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ92927.1|149987_150407_-	DUF1380 domain-containing protein	NA	NA	NA	NA	NA
AVZ92928.1|150417_150639_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ92929.1|150638_151316_-	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	36.9	1.6e-28
AVZ92930.1|151674_152346_+	DNA breaking-rejoining protein	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	61.7	5.1e-83
AVZ92931.1|152525_152948_+	peptidase	NA	A0A1W6JNS2	Morganella_phage	51.5	3.1e-30
AVZ92932.1|152947_154219_+	translesion error-prone DNA polymerase V subunit UmuC	NA	F1C5A5	Cronobacter_phage	63.0	6.1e-154
AVZ92933.1|154354_155326_-	ParB/RepB/Spo0J family partition protein	NA	Q1MVJ4	Enterobacteria_phage	68.9	1.4e-113
AVZ92934.1|155322_156528_-	ParA family protein	NA	Q1MVJ3	Enterobacteria_phage	89.2	1.1e-205
AVZ92935.1|156890_157523_+	LacI family DNA-binding transcriptional regulator	NA	A0A1V0E035	Clostridioides_phage	31.9	2.5e-07
AVZ92936.1|157576_157777_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ92937.1|157923_158874_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	55.6	6.6e-76
AVZ92938.1|158870_159482_-	DUF2913 family protein	NA	NA	NA	NA	NA
AVZ92970.1|159478_159874_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ92939.1|160387_161368_+|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.4	1.0e-185
AVZ92971.1|162019_162577_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ92940.1|163045_163750_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AVZ92941.1|163882_164524_-	type A-2 chloramphenicol O-acetyltransferase CatII	NA	G3CFL0	Escherichia_phage	45.9	7.3e-55
AVZ92972.1|164673_165174_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ92942.1|165253_165958_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AVZ92943.1|165991_166483_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ92944.1|166589_167327_+	resolvase	NA	NA	NA	NA	NA
AVZ92945.1|167323_167548_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ92946.1|167669_167846_+	DUF4102 domain-containing protein	NA	T1S9J3	Salmonella_phage	68.6	1.0e-06
AVZ92947.1|168027_169032_-|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
