The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP034966	Escherichia coli strain WCHEC020032 chromosome, complete genome	4686461	502880	547183	4686461	protease,tRNA,tail,integrase	Escherichia_phage(28.57%)	46	502697:502713	512176:512192
502697:502713	attL	TTAGTTCATGCCGTATT	NA	NA	NA	NA
QAS88559.1|502880_504116_+|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	54.2	5.5e-123
QAS88560.1|504410_504590_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
QAS88561.1|504598_504880_+	hypothetical protein	NA	NA	NA	NA	NA
QAS92229.1|504971_506552_+	virulence-associated E family protein	NA	A0A088FVF8	Escherichia_phage	65.6	4.6e-151
QAS88562.1|506561_506786_+	hypothetical protein	NA	NA	NA	NA	NA
QAS88563.1|506788_507052_-	hypothetical protein	NA	NA	NA	NA	NA
QAS88564.1|507519_508404_+	hypothetical protein	NA	NA	NA	NA	NA
QAS88565.1|508406_508721_+	hypothetical protein	NA	NA	NA	NA	NA
QAS88566.1|509042_509360_+	hypothetical protein	NA	NA	NA	NA	NA
QAS88567.1|509362_509572_+	hypothetical protein	NA	NA	NA	NA	NA
QAS88568.1|509581_509788_+	hypothetical protein	NA	NA	NA	NA	NA
QAS88569.1|509809_512098_+|tail	phage tail tape measure protein	tail	A0A1W6JT50	Escherichia_phage	43.0	2.9e-162
QAS88570.1|512175_512472_-	DNA-binding transcriptional regulator Fis	NA	NA	NA	NA	NA
512176:512192	attR	TTAGTTCATGCCGTATT	NA	NA	NA	NA
QAS88571.1|512497_513463_-|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
QAS88572.1|513791_514673_-	50S ribosomal protein L11 methyltransferase	NA	NA	NA	NA	NA
QAS88573.1|514684_516136_-	sodium/pantothenate symporter	NA	NA	NA	NA	NA
QAS88574.1|516125_516368_-	DUF997 family protein	NA	NA	NA	NA	NA
QAS88575.1|516476_517826_-	acetyl-CoA carboxylase biotin carboxylase subunit	NA	NA	NA	NA	NA
QAS88576.1|517836_518307_-	acetyl-CoA carboxylase biotin carboxyl carrier protein	NA	NA	NA	NA	NA
QAS88577.1|519284_520259_-	oxidoreductase	NA	NA	NA	NA	NA
QAS88578.1|520410_522351_+	RNase E specificity factor CsrD	NA	NA	NA	NA	NA
QAS88579.1|522359_522548_-	hypothetical protein	NA	NA	NA	NA	NA
QAS88580.1|522655_523699_+	rod shape-determining protein	NA	F2Y0P3	Organic_Lake_phycodnavirus	22.3	6.7e-05
QAS88581.1|523764_524868_+	rod shape-determining protein MreC	NA	NA	NA	NA	NA
QAS88582.1|524867_525356_+	rod shape-determining protein MreD	NA	NA	NA	NA	NA
QAS88583.1|525364_525958_+	septum formation inhibitor Maf	NA	NA	NA	NA	NA
QAS88584.1|525947_527417_+	ribonuclease G	NA	NA	NA	NA	NA
QAS88585.1|527484_531285_+	AsmA2 domain-containing protein	NA	NA	NA	NA	NA
QAS88586.1|531440_532886_+|protease	metalloprotease TldD	protease	NA	NA	NA	NA
QAS88587.1|533013_533943_-	HTH-type transcriptional activator AaeR	NA	NA	NA	NA	NA
QAS88588.1|534125_534329_+	DUF1656 domain-containing protein	NA	NA	NA	NA	NA
QAS88589.1|534336_535269_+	p-hydroxybenzoic acid efflux pump subunit AaeA	NA	NA	NA	NA	NA
QAS88590.1|535274_537242_+	p-hydroxybenzoic acid efflux pump subunit AaeB	NA	NA	NA	NA	NA
QAS88591.1|537333_537606_+	hypothetical protein	NA	NA	NA	NA	NA
QAS88592.1|537661_537925_-	peroxide/acid stress response protein YhcN	NA	NA	NA	NA	NA
QAS88593.1|538289_538760_-	transcriptional regulator ArgR	NA	NA	NA	NA	NA
QAS88594.1|539194_540133_+	malate dehydrogenase	NA	NA	NA	NA	NA
QAS88595.1|540194_541262_-|protease	serine endoprotease DegS	protease	A0A1S5Y2X3	uncultured_archaeal_virus	24.2	6.8e-05
QAS88596.1|541351_542719_-|protease	serine endoprotease DegQ	protease	A0A1B1IT49	uncultured_Mediterranean_phage	25.6	2.3e-21
QAS88597.1|542872_543271_-	DUF1043 family protein	NA	NA	NA	NA	NA
QAS88598.1|543464_544592_+	cell division protein ZapE	NA	NA	NA	NA	NA
QAS88599.1|544810_545239_+	50S ribosomal protein L13	NA	NA	NA	NA	NA
QAS88600.1|545254_545647_+	30S ribosomal protein S9	NA	NA	NA	NA	NA
QAS88601.1|545564_545786_-	hypothetical protein	NA	NA	NA	NA	NA
QAS88602.1|546041_546680_+	stringent starvation protein A	NA	NA	NA	NA	NA
QAS88603.1|546685_547183_+|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	42.9	3.3e-26
>prophage 2
CP034966	Escherichia coli strain WCHEC020032 chromosome, complete genome	4686461	1068654	1081837	4686461		Escherichia_phage(50.0%)	12	NA	NA
QAS89064.1|1068654_1069416_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	48.0	2.0e-59
QAS89065.1|1069409_1070036_+	protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	49.7	5.7e-36
QAS89066.1|1070175_1071315_+	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	35.6	1.7e-06
QAS89067.1|1071377_1072370_+	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	6.1e-32
QAS89068.1|1072463_1073828_-	GntP family transporter	NA	NA	NA	NA	NA
QAS89069.1|1073916_1074693_-	HPr family phosphocarrier protein	NA	NA	NA	NA	NA
QAS89070.1|1074697_1075336_-	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
QAS89071.1|1075332_1076595_-	3-oxo-tetronate kinase	NA	A0A077SLJ7	Escherichia_phage	61.4	1.3e-135
QAS89072.1|1076591_1077500_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
QAS89073.1|1077695_1078463_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.7	3.3e-70
QAS89074.1|1078513_1079170_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	46.3	8.0e-49
QAS89075.1|1079275_1081837_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	1.7e-30
>prophage 3
CP034966	Escherichia coli strain WCHEC020032 chromosome, complete genome	4686461	1934259	1960503	4686461	terminase,tail,holin,head	Klebsiella_phage(21.21%)	44	NA	NA
QAS89785.1|1934259_1935003_-	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	30.0	3.5e-24
QAS89786.1|1935043_1935439_-	hypothetical protein	NA	NA	NA	NA	NA
QAS89787.1|1935491_1936271_-	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	98.4	2.3e-71
QAS89788.1|1936267_1937527_-	DUF3596 domain-containing protein	NA	A0A286S1S8	Klebsiella_phage	90.6	2.7e-226
QAS89789.1|1937569_1937815_-	excisionase	NA	A0A286S2A4	Klebsiella_phage	93.4	3.8e-36
QAS89790.1|1937974_1938193_-	TraR/DksA family transcriptional regulator	NA	A0A0K2FI84	Escherichia_phage	56.6	7.8e-09
QAS89791.1|1938189_1938390_-	hypothetical protein	NA	NA	NA	NA	NA
QAS89792.1|1938544_1938748_+	DUF4752 family protein	NA	T1S9K2	Salmonella_phage	78.5	1.2e-22
QAS89793.1|1938854_1939238_+	hypothetical protein	NA	A0A1V0E5L5	Salmonella_phage	61.5	1.0e-11
QAS89794.1|1939630_1939828_+	hypothetical protein	NA	NA	NA	NA	NA
QAS89795.1|1939864_1940047_+	hypothetical protein	NA	NA	NA	NA	NA
QAS89796.1|1940043_1940307_+	DNA polymerase III subunit theta	NA	G8C7V1	Escherichia_phage	73.7	1.5e-25
QAS89797.1|1940413_1941010_+	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	53.8	9.5e-57
QAS89798.1|1941009_1941216_+	hypothetical protein	NA	S4TNP0	Salmonella_phage	64.7	8.4e-21
QAS89799.1|1941218_1941509_+	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	88.5	3.1e-45
QAS89800.1|1941505_1941868_+	RusA family crossover junction endodeoxyribonuclease	NA	K7PM48	Enterobacteria_phage	82.4	4.3e-52
QAS89801.1|1941864_1942005_+	YlcG family protein	NA	NA	NA	NA	NA
QAS89802.1|1942001_1942691_+	antiterminator	NA	I6PDF8	Cronobacter_phage	54.5	3.2e-56
QAS92279.1|1943146_1943446_+|holin	holin	holin	A0A286N2Q5	Klebsiella_phage	87.9	1.4e-40
QAS89803.1|1943442_1943982_+	hypothetical protein	NA	A0A286N2Q6	Klebsiella_phage	96.6	5.3e-99
QAS89804.1|1943978_1944326_+	hypothetical protein	NA	A0A286N2Q7	Klebsiella_phage	71.3	1.2e-35
QAS89805.1|1944322_1944598_+	hypothetical protein	NA	G8C7W1	Escherichia_phage	38.2	2.1e-06
QAS92280.1|1944548_1944746_+	hypothetical protein	NA	A0A286SGR9	Klebsiella_phage	88.1	6.6e-23
QAS89806.1|1944843_1945152_+	hypothetical protein	NA	Q5QF73	Pseudomonas_virus	55.1	4.2e-16
QAS89807.1|1945148_1945415_+	hypothetical protein	NA	NA	NA	NA	NA
QAS89808.1|1945584_1946013_+	hypothetical protein	NA	NA	NA	NA	NA
QAS89809.1|1946071_1946848_+	hypothetical protein	NA	A0A077KBY7	Edwardsiella_phage	66.0	8.4e-13
QAS89810.1|1946798_1948199_+|terminase	PBSX family phage terminase large subunit	terminase	A0A077KAW0	Edwardsiella_phage	69.0	2.1e-187
QAS89811.1|1948421_1949873_+	DUF1073 domain-containing protein	NA	A0A0M4S6U1	Salmonella_phage	68.6	2.5e-191
QAS89812.1|1949928_1950477_+	hypothetical protein	NA	A0A0M4REK0	Salmonella_phage	55.8	7.0e-46
QAS89813.1|1950508_1950931_+	hypothetical protein	NA	NA	NA	NA	NA
QAS89814.1|1950986_1952189_+	DUF2213 domain-containing protein	NA	A0A0M4R5A6	Salmonella_phage	49.3	2.4e-99
QAS89815.1|1952192_1952687_+	hypothetical protein	NA	A0A2H4JHM9	uncultured_Caudovirales_phage	62.7	4.2e-50
QAS89816.1|1952698_1953640_+	DUF2184 domain-containing protein	NA	A0A2H4J191	uncultured_Caudovirales_phage	77.7	3.5e-138
QAS89817.1|1953679_1953961_+	hypothetical protein	NA	NA	NA	NA	NA
QAS89818.1|1953929_1954349_+	DUF4054 domain-containing protein	NA	A0A0M5M3S2	Salmonella_phage	62.2	3.9e-41
QAS89819.1|1954345_1954852_+	hypothetical protein	NA	NA	NA	NA	NA
QAS89820.1|1954851_1955238_+|head,tail	head-tail adaptor	head,tail	A0A2H4J1A4	uncultured_Caudovirales_phage	79.0	2.8e-49
QAS92281.1|1955332_1955773_+	hypothetical protein	NA	A0A2H4J1A0	uncultured_Caudovirales_phage	51.7	1.6e-40
QAS92282.1|1955908_1956667_+	DUF2612 domain-containing protein	NA	A0A2H4J1A9	uncultured_Caudovirales_phage	52.2	2.4e-68
QAS89821.1|1956666_1957548_+	hypothetical protein	NA	A0A2H4IYR0	uncultured_Caudovirales_phage	61.1	4.3e-29
QAS89822.1|1957799_1959884_+	hypothetical protein	NA	A0A0C5Q3X6	Klebsiella_phage	47.3	7.1e-107
QAS89823.1|1959892_1960072_+	hypothetical protein	NA	NA	NA	NA	NA
QAS89824.1|1960185_1960503_+	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	50.0	5.3e-22
>prophage 4
CP034966	Escherichia coli strain WCHEC020032 chromosome, complete genome	4686461	2243763	2272366	4686461	tail,integrase	Escherichia_phage(25.0%)	32	2244828:2244842	2268606:2268620
QAS90090.1|2243763_2246190_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.0	7.7e-214
2244828:2244842	attL	CGCCGTCGCGGATTG	NA	NA	NA	NA
QAS92295.1|2246388_2246694_-	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
QAS90091.1|2246801_2247512_+	YnfC family lipoprotein	NA	NA	NA	NA	NA
QAS90092.1|2247514_2248075_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
QAS90093.1|2248109_2248451_-	DUF1283 family protein	NA	NA	NA	NA	NA
QAS90094.1|2248585_2248912_+	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
QAS90095.1|2249117_2250332_+	D-galactonate dehydratase family protein	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
QAS90096.1|2250343_2251363_+	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	26.2	4.3e-17
QAS90097.1|2251420_2251531_+	transporter	NA	NA	NA	NA	NA
QAS90098.1|2251550_2252831_-	DUF3596 domain-containing protein	NA	B6DZ48	Enterobacteria_phage	62.3	6.6e-156
QAS92296.1|2252865_2253102_-	DNA-binding protein	NA	S4TND0	Salmonella_phage	50.7	6.1e-15
QAS90099.1|2253189_2255661_-	exonuclease	NA	K7PLW7	Enterobacteria_phage	59.8	6.1e-57
QAS90100.1|2255754_2255946_-	DUF1482 family protein	NA	NA	NA	NA	NA
QAS90101.1|2255942_2256131_-	division inhibition protein DicB	NA	NA	NA	NA	NA
QAS90102.1|2256214_2256457_+	hypothetical protein	NA	NA	NA	NA	NA
QAS92297.1|2256437_2257403_+	hypothetical protein	NA	U5P0A0	Shigella_phage	63.9	9.7e-59
QAS90103.1|2257443_2257866_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	85.6	2.0e-61
QAS90104.1|2257995_2258940_-	GIY-YIG nuclease family protein	NA	NA	NA	NA	NA
QAS90105.1|2259487_2260837_-	hypothetical protein	NA	A0A1W6JNS5	Morganella_phage	98.0	5.7e-259
QAS90106.1|2261154_2261757_+|integrase	integrase	integrase	A0A1V0E036	Clostridioides_phage	31.2	3.7e-08
QAS90107.1|2262116_2263097_+	hypothetical protein	NA	NA	NA	NA	NA
QAS92298.1|2263301_2263610_+	hypothetical protein	NA	NA	NA	NA	NA
QAS90108.1|2263616_2263724_-	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	100.0	3.8e-09
QAS90109.1|2263768_2263981_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	95.4	2.0e-25
QAS90110.1|2264196_2264448_+	hypothetical protein	NA	NA	NA	NA	NA
QAS90111.1|2264514_2264793_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	7.4e-12
QAS90112.1|2264794_2265844_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.3	4.2e-108
QAS90113.1|2265856_2266231_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.7	8.4e-35
QAS90114.1|2266227_2267049_+	antitermination protein	NA	K7P7B9	Enterobacteria_phage	59.0	2.7e-78
QAS90115.1|2267794_2269957_+	DUF1983 domain-containing protein	NA	A0A291AWT4	Escherichia_phage	96.6	0.0e+00
2268606:2268620	attR	CGCCGTCGCGGATTG	NA	NA	NA	NA
QAS92299.1|2270788_2272186_+	chaperone of endosialidase	NA	K7PGT9	Enterobacteria_phage	85.2	1.4e-204
QAS92300.1|2272240_2272366_+|tail	phage tail protein	tail	K7PMH7	Enterobacteria_phage	82.5	1.5e-12
>prophage 5
CP034966	Escherichia coli strain WCHEC020032 chromosome, complete genome	4686461	2684012	2696750	4686461	transposase,integrase	Enterobacteria_phage(33.33%)	13	2681985:2682008	2695453:2695476
2681985:2682008	attL	AACGGGCGTGTTATACGCCCGTTG	NA	NA	NA	NA
QAS90479.1|2684012_2685968_-	AAA family ATPase	NA	K4I1H4	Acidithiobacillus_phage	28.6	7.5e-26
QAS90480.1|2688332_2688872_-	regulator	NA	M9NZI6	Enterobacteria_phage	65.6	7.5e-61
QAS90481.1|2689054_2689366_+	recombinase	NA	A0A0N7KZJ3	Stx2-converting_phage	100.0	2.4e-43
QAS90482.1|2689362_2690043_+	exonuclease	NA	A0A0P0ZCD4	Stx2-converting_phage	98.7	5.1e-131
QAS92319.1|2690039_2690198_+	DUF1317 family protein	NA	M1FJ61	Enterobacteria_phage	88.5	6.4e-21
QAS90483.1|2690194_2691259_+	DGQHR domain-containing protein	NA	T1SBJ4	Salmonella_phage	64.8	1.7e-133
QAS90484.1|2691412_2691631_+	TraR/DksA family transcriptional regulator	NA	M1FQT7	Enterobacteria_phage	94.4	3.2e-34
QAS90485.1|2691678_2691918_+	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	94.9	3.9e-38
QAS90486.1|2692057_2692294_+	excisionase	NA	NA	NA	NA	NA
QAS90487.1|2692417_2693440_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	99.1	1.0e-199
QAS90488.1|2693436_2694219_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	5.9e-139
QAS92320.1|2694261_2695386_+|integrase	integrase	integrase	O21929	Phage_21	99.7	8.0e-206
QAS90489.1|2695499_2696750_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	3.8e-23
2695453:2695476	attR	CAACGGGCGTATAACACGCCCGTT	NA	NA	NA	NA
>prophage 6
CP034966	Escherichia coli strain WCHEC020032 chromosome, complete genome	4686461	3011902	3020672	4686461	integrase	Salmonella_phage(90.0%)	12	3011572:3011585	3020714:3020727
3011572:3011585	attL	AAAACAATAAGTTA	NA	NA	NA	NA
QAS90765.1|3011902_3012091_-	hypothetical protein	NA	A0A1S6L006	Salmonella_phage	95.2	2.0e-24
QAS90766.1|3012249_3014643_-	replication endonuclease	NA	E5G6L9	Salmonella_phage	93.7	0.0e+00
QAS90767.1|3014639_3015497_-	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	95.8	9.5e-159
QAS90768.1|3015493_3015721_-	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	98.7	7.8e-36
QAS90769.1|3015720_3015954_-	DUF2732 family protein	NA	E5G6L6	Salmonella_phage	97.4	1.9e-32
QAS90770.1|3016021_3016363_-	hypothetical protein	NA	E5G6L5	Salmonella_phage	98.2	1.7e-55
QAS90771.1|3016480_3016777_-	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	88.5	1.9e-21
QAS90772.1|3016784_3017294_-	phage regulatory CII family protein	NA	E5G6L3	Salmonella_phage	98.2	1.3e-86
QAS90773.1|3017326_3017548_-	regulator	NA	NA	NA	NA	NA
QAS92332.1|3017693_3018572_+	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	39.4	1.7e-30
QAS90774.1|3018583_3019528_+	hypothetical protein	NA	NA	NA	NA	NA
QAS90775.1|3019619_3020672_+|integrase	site-specific integrase	integrase	A0A218M4I3	Erwinia_phage	57.0	1.4e-106
3020714:3020727	attR	TAACTTATTGTTTT	NA	NA	NA	NA
>prophage 7
CP034966	Escherichia coli strain WCHEC020032 chromosome, complete genome	4686461	3100257	3127461	4686461	capsid,lysis,tail,integrase	Enterobacteria_phage(47.06%)	48	3102173:3102187	3127535:3127549
QAS90845.1|3100257_3101547_+	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	27.1	3.4e-19
QAS90846.1|3101605_3102082_+	kinase inhibitor	NA	NA	NA	NA	NA
3102173:3102187	attL	TTAGTATAAAAAAGC	NA	NA	NA	NA
QAS90847.1|3102827_3104159_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	37.1	1.4e-20
QAS92336.1|3104232_3104409_-|tail	phage tail protein	tail	K7PMH7	Enterobacteria_phage	84.5	9.4e-21
QAS90848.1|3104558_3105227_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
QAS90849.1|3105171_3105309_-|capsid	nucleocapsid protein	capsid	NA	NA	NA	NA
QAS90850.1|3106117_3106678_-	DNA-packaging protein NohD	NA	A0A0K2FIG2	Enterobacteria_phage	98.8	4.9e-87
QAS90851.1|3107066_3107300_+	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	94.4	7.3e-21
QAS90852.1|3107356_3107767_+	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	76.3	1.3e-52
QAS90853.1|3108118_3108271_-	hypothetical protein	NA	K7PKL2	Enterobacteria_phage	96.0	3.1e-20
QAS90854.1|3108299_3108506_-	hypothetical protein	NA	H6WRZ6	Salmonella_phage	98.5	5.3e-31
QAS90855.1|3108722_3109220_-	lysozyme	NA	A0A1B5FP97	Escherichia_phage	97.0	1.6e-89
QAS90856.1|3109219_3109435_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	98.6	1.2e-33
QAS90857.1|3109622_3110210_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
QAS90858.1|3110218_3110353_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
QAS90859.1|3110704_3111664_-	DUF523 and DUF1722 domain-containing protein	NA	NA	NA	NA	NA
QAS90860.1|3111856_3112381_+	outer membrane lipoprotein Blc	NA	A0A1W6JNX6	Morganella_phage	54.1	1.1e-48
QAS90861.1|3112536_3112914_-	antitermination protein	NA	Q777W5	Enterobacteria_phage	84.2	7.3e-55
QAS90862.1|3112999_3113140_-	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	67.4	5.5e-08
QAS90863.1|3113136_3113499_-	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	97.4	1.5e-60
QAS90864.1|3113495_3113786_-	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	91.7	4.8e-46
QAS90865.1|3113778_3113949_-	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	69.8	2.4e-13
QAS90866.1|3113948_3114404_-	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	66.2	5.9e-59
QAS90867.1|3114400_3114502_-	hypothetical protein	NA	NA	NA	NA	NA
QAS90868.1|3114594_3115047_-	hypothetical protein	NA	NA	NA	NA	NA
QAS90869.1|3115043_3115604_-	UDP-N-acetylglucosamine acyltransferase	NA	NA	NA	NA	NA
QAS90870.1|3115860_3116052_+	hypothetical protein	NA	NA	NA	NA	NA
QAS90871.1|3116088_3116382_-	protein ren	NA	A0A0N6WES4	Escherichia_phage	95.7	1.1e-42
QAS90872.1|3116378_3117080_-	Replication protein P	NA	K7P6G2	Enterobacteria_phage	99.6	3.8e-129
QAS92337.1|3117076_3118006_-	Replication protein O	NA	A0A0M5M7Y1	Salmonella_phage	63.4	1.2e-109
QAS90873.1|3118092_3118632_-	regulator	NA	M9NZI6	Enterobacteria_phage	66.1	2.0e-61
QAS90874.1|3118701_3118932_-	helix-turn-helix domain-containing protein	NA	A0A2H4FNF3	Salmonella_phage	68.0	1.5e-21
QAS92338.1|3119036_3119726_+	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	75.0	2.8e-92
QAS90875.1|3119848_3120598_+	hypothetical protein	NA	NA	NA	NA	NA
QAS90876.1|3120594_3121422_+	DUF3037 domain-containing protein	NA	NA	NA	NA	NA
QAS90877.1|3121930_3122137_+	cell division inhibitor protein	NA	K7P6H3	Enterobacteria_phage	85.3	3.2e-28
QAS90878.1|3122212_3122509_+	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	100.0	1.6e-49
QAS90879.1|3122514_3123300_+	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
QAS90880.1|3123296_3123977_+	exonuclease	NA	A0A0P0ZCD4	Stx2-converting_phage	98.7	3.0e-131
QAS90881.1|3123973_3124156_+	DUF1317 family protein	NA	A0A0N7CHV0	Escherichia_phage	98.3	2.2e-28
QAS90882.1|3124128_3124320_+	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	98.4	2.8e-26
QAS90883.1|3124330_3124612_+	cell division protein ZapA	NA	A0A0P0ZE02	Stx2-converting_phage	100.0	2.5e-47
QAS90884.1|3124710_3124932_+	TraR/DksA family transcriptional regulator	NA	A0A0N7C211	Escherichia_phage	97.3	1.4e-34
QAS90885.1|3125142_3125745_-	hypothetical protein	NA	NA	NA	NA	NA
QAS90886.1|3125869_3126055_-	hypothetical protein	NA	NA	NA	NA	NA
QAS90887.1|3125987_3126155_+	hypothetical protein	NA	A5VWB7	Enterobacteria_phage	98.2	2.9e-27
QAS90888.1|3126194_3126413_+	excisionase	NA	Q77WA4	Escherichia_phage	100.0	3.7e-35
QAS90889.1|3126390_3127461_+|integrase	integrase	integrase	Q9MCR4	Enterobacteria_phage	99.7	1.9e-201
3127535:3127549	attR	TTAGTATAAAAAAGC	NA	NA	NA	NA
>prophage 8
CP034966	Escherichia coli strain WCHEC020032 chromosome, complete genome	4686461	3575358	3639669	4686461	lysis,capsid,tail,holin,protease,integrase	Shigella_phage(31.25%)	66	3612056:3612115	3635754:3635813
QAS91271.1|3575358_3577392_-|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	27.4	3.4e-21
QAS91272.1|3577520_3578108_+	transcriptional regulator BetI	NA	NA	NA	NA	NA
QAS91273.1|3578121_3579594_+	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
QAS91274.1|3579607_3581278_+|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	31.2	4.7e-61
QAS91275.1|3581490_3582159_+	hypothetical protein	NA	NA	NA	NA	NA
QAS91276.1|3582401_3583097_-	lactate utilization protein C	NA	NA	NA	NA	NA
QAS91277.1|3583089_3584517_-	iron-sulfur cluster-binding protein	NA	NA	NA	NA	NA
QAS91278.1|3584527_3585247_-	(Fe-S)-binding protein	NA	NA	NA	NA	NA
QAS91279.1|3585774_3586629_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
QAS91280.1|3586854_3588180_+	pyridine nucleotide-disulfide oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	47.6	2.5e-113
QAS91281.1|3588288_3588525_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
QAS91282.1|3588536_3589130_+	DUF417 domain-containing protein	NA	NA	NA	NA	NA
QAS91283.1|3589720_3590572_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
QAS91284.1|3590711_3594968_-	intimin-like adhesin FdeC	NA	NA	NA	NA	NA
QAS91285.1|3596082_3596184_+	hypothetical protein	NA	NA	NA	NA	NA
QAS92355.1|3596547_3596811_+	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
QAS91286.1|3596810_3596951_+	50S ribosomal protein L36	NA	NA	NA	NA	NA
QAS91287.1|3596985_3597213_-	hypothetical protein	NA	NA	NA	NA	NA
QAS91288.1|3598035_3598578_+	LuxR family transcriptional regulator	NA	NA	NA	NA	NA
QAS91289.1|3598652_3599240_+	common pilus major fimbrillin subunit EcpA	NA	NA	NA	NA	NA
QAS91290.1|3599297_3599966_+	fimbrial chaperone EcpB	NA	NA	NA	NA	NA
QAS91291.1|3599991_3602517_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
QAS91292.1|3602506_3604150_+	fimbrial adhesin EcpD	NA	NA	NA	NA	NA
QAS91293.1|3604118_3604829_+	hypothetical protein	NA	NA	NA	NA	NA
QAS91294.1|3605141_3605471_+	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
QAS91295.1|3605718_3606333_-	DUF1440 domain-containing protein	NA	NA	NA	NA	NA
QAS91296.1|3606750_3607440_+	aldehyde dehydrogenase iron-sulfur subunit	NA	NA	NA	NA	NA
QAS91297.1|3607436_3608393_+	xanthine dehydrogenase family protein subunit M	NA	NA	NA	NA	NA
QAS91298.1|3608389_3610588_+	xanthine dehydrogenase family protein molybdopterin-binding subunit	NA	A0A0P0I429	Acinetobacter_phage	25.8	1.1e-38
QAS91299.1|3610597_3611554_+	XdhC family protein	NA	NA	NA	NA	NA
QAS91300.1|3611532_3611943_+	hypothetical protein	NA	NA	NA	NA	NA
3612056:3612115	attL	CTTATTGATTTAAATGGTGCCGATAATAGGAGTCGAACCTACGACCTTCGCATTACGAAT	NA	NA	NA	NA
QAS91301.1|3612625_3613405_+	hypothetical protein	NA	NA	NA	NA	NA
QAS91302.1|3614016_3614550_-	hypothetical protein	NA	NA	NA	NA	NA
QAS91303.1|3614546_3615821_-	hypothetical protein	NA	NA	NA	NA	NA
QAS91304.1|3615920_3616025_-|capsid	capsid protein	capsid	NA	NA	NA	NA
QAS91305.1|3616211_3618779_-|tail	tail fiber domain-containing protein	tail	A0A2D1UII2	Escherichia_phage	81.8	0.0e+00
QAS91306.1|3618790_3619066_-	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	98.9	1.1e-44
QAS91307.1|3619058_3619382_-	DUF2190 family protein	NA	A5LH31	Enterobacteria_phage	100.0	8.5e-52
QAS91308.1|3619468_3621613_-|protease	Clp protease ClpP	protease	A0A291AWT6	Escherichia_phage	99.5	0.0e+00
QAS91309.1|3621612_3621828_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
QAS91310.1|3621895_3622948_-	site-specific DNA-methyltransferase	NA	A5LH81	Enterobacteria_phage	99.7	3.6e-208
QAS91311.1|3623097_3623292_-	TrmB family transcriptional regulator	NA	Q8SBE3	Shigella_phage	100.0	1.8e-28
QAS91312.1|3623540_3624701_+	DUF262 domain-containing protein	NA	A0A0R6PJX3	Moraxella_phage	37.0	6.4e-57
QAS91313.1|3624703_3625393_+	hypothetical protein	NA	NA	NA	NA	NA
QAS91314.1|3625361_3626402_-	DNA cytosine methyltransferase	NA	A0A0R6PG08	Moraxella_phage	50.9	8.7e-98
QAS91315.1|3626481_3626835_-	antitermination protein	NA	A0A0P0ZCW0	Stx2-converting_phage	85.5	5.8e-54
QAS91316.1|3626852_3627842_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	99.1	1.8e-193
QAS91317.1|3627849_3628197_-	hypothetical protein	NA	A0A291AWV6	Escherichia_phage	98.1	7.0e-52
QAS91318.1|3628199_3629141_-	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	92.7	1.1e-139
QAS91319.1|3629130_3629310_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	7.8e-15
QAS91320.1|3629485_3630043_-	protein YmfL	NA	S5FXP0	Shigella_phage	94.6	1.7e-95
QAS91321.1|3630035_3630296_-	XRE family transcriptional regulator	NA	K7PJQ8	Enterobacteria_phage	100.0	5.4e-41
QAS91322.1|3630267_3630420_-	amino acid permease	NA	NA	NA	NA	NA
QAS91323.1|3630393_3631086_+	XRE family transcriptional regulator	NA	S5FUZ3	Shigella_phage	96.5	6.4e-121
QAS91324.1|3631141_3631420_+	hypothetical protein	NA	A0A291AWY6	Escherichia_phage	94.9	2.5e-12
QAS91325.1|3631573_3631774_+	hypothetical protein	NA	NA	NA	NA	NA
QAS91326.1|3631788_3632151_+	hypothetical protein	NA	Q8SBF8	Shigella_phage	100.0	8.6e-61
QAS91327.1|3632216_3633041_+	DUF2303 family protein	NA	U5P439	Shigella_phage	99.6	1.7e-149
QAS91328.1|3633168_3633705_+	5'-deoxynucleotidase	NA	S5MW55	Escherichia_phage	98.9	1.4e-99
QAS91329.1|3633695_3634058_+	hypothetical protein	NA	U5P092	Shigella_phage	99.2	1.4e-66
QAS91330.1|3634057_3634363_+	hypothetical protein	NA	U5P0J0	Shigella_phage	99.0	1.5e-50
QAS91331.1|3634278_3634713_+	DNA-binding protein	NA	U5P4J3	Shigella_phage	100.0	6.4e-79
QAS91332.1|3634589_3635753_+|integrase	integrase	integrase	U5P434	Shigella_phage	100.0	2.4e-229
QAS91333.1|3635957_3637211_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.0	1.7e-95
3635754:3635813	attR	CTTATTGATTTAAATGGTGCCGATAATAGGAGTCGAACCTACGACCTTCGCATTACGAAT	NA	NA	NA	NA
QAS91334.1|3637222_3638326_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
QAS91335.1|3638613_3639669_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.9	7.7e-118
>prophage 9
CP034966	Escherichia coli strain WCHEC020032 chromosome, complete genome	4686461	3940173	3956532	4686461	tail,integrase	Enterobacteria_phage(42.86%)	14	3945069:3945083	3958513:3958527
QAS91581.1|3940173_3943875_-	peptidase S74	NA	A0A2D1UII2	Escherichia_phage	85.6	0.0e+00
QAS91582.1|3943939_3944539_-	Ail/Lom family protein	NA	H6WZM8	Escherichia_phage	96.5	1.6e-107
QAS91583.1|3944723_3947402_-	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	98.7	0.0e+00
3945069:3945083	attL	ATTGATACTGGCGGC	NA	NA	NA	NA
QAS91584.1|3947462_3948065_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	85.1	6.2e-88
QAS91585.1|3948001_3948745_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.4	4.7e-146
QAS92366.1|3949161_3949362_+	hypothetical protein	NA	A0A2I6TC81	Escherichia_phage	63.2	7.4e-06
QAS91586.1|3949376_3949739_+	hypothetical protein	NA	Q8SBF8	Shigella_phage	100.0	8.6e-61
QAS91587.1|3949804_3950629_+	DUF2303 family protein	NA	U5P439	Shigella_phage	100.0	6.0e-150
QAS91588.1|3950756_3951293_+	5'-deoxynucleotidase	NA	U5P0T3	Shigella_phage	98.9	4.8e-100
QAS91589.1|3951283_3951646_+	hypothetical protein	NA	K7PH61	Enterobacteria_phage	97.4	1.7e-64
QAS91590.1|3951645_3952266_+	DUF551 domain-containing protein	NA	A5LH60	Enterobacteria_phage	89.8	9.1e-111
QAS91591.1|3952265_3952460_+	DNA-binding protein	NA	A5LH59	Enterobacteria_phage	95.3	4.9e-31
QAS91592.1|3952593_3955200_-	hypothetical protein	NA	A0A1S6KZY3	Salmonella_phage	41.1	1.7e-20
QAS91593.1|3955308_3956532_-|integrase	site-specific integrase	integrase	A5LH57	Enterobacteria_phage	98.3	1.8e-235
3958513:3958527	attR	GCCGCCAGTATCAAT	NA	NA	NA	NA
>prophage 10
CP034966	Escherichia coli strain WCHEC020032 chromosome, complete genome	4686461	4038032	4044591	4686461	transposase	uncultured_Caudovirales_phage(16.67%)	7	NA	NA
QAS91667.1|4038032_4038989_+	Fe(3+) dicitrate ABC transporter permease subunit FecD	NA	A0A2H4IY97	uncultured_Caudovirales_phage	26.1	1.1e-17
QAS91668.1|4038989_4039757_+	Fe(3+) dicitrate transport ATP-binding protein FecE	NA	G3M9Y6	Bacillus_virus	24.8	6.4e-13
QAS91669.1|4040314_4040572_-	hypothetical protein	NA	NA	NA	NA	NA
QAS91670.1|4041623_4042775_+|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	36.0	2.6e-42
QAS91671.1|4042694_4043045_-|transposase	transposase	transposase	Q716C1	Shigella_phage	97.7	8.9e-39
QAS91672.1|4043145_4043718_+	hypothetical protein	NA	Q858R9	Enterobacteria_phage	69.0	2.2e-71
QAS91673.1|4043766_4044591_-	hypothetical protein	NA	L7TR00	Rhizobium_phage	35.5	3.0e-16
>prophage 1
CP034959	Escherichia coli strain WCHEC020032 plasmid p1_020032, complete sequence	90842	0	90524	90842	plate,holin,terminase,transposase,head,tail,lysis,portal	Escherichia_phage(62.22%)	95	NA	NA
QAS87788.1|0_861_+	replication protein RepA	NA	Q71TL8	Escherichia_phage	100.0	4.7e-158
QAS87789.1|1418_2615_+	ParA family protein	NA	A0A077SL49	Escherichia_phage	100.0	1.6e-225
QAS87790.1|2631_3633_+	ParB/RepB/Spo0J family partition protein	NA	Q38420	Escherichia_phage	99.4	1.1e-177
QAS87791.1|3858_5565_+	hypothetical protein	NA	Q1MVJ5	Enterobacteria_phage	94.2	6.3e-311
QAS87792.1|5625_7215_+	hypothetical protein	NA	Q71TB2	Escherichia_phage	98.5	2.4e-301
QAS87793.1|7224_8040_+	hypothetical protein	NA	A0A1B0V835	Salmonella_phage	99.3	2.6e-113
QAS87794.1|8075_8657_+	hypothetical protein	NA	Q1MVJ8	Enterobacteria_phage	97.4	7.3e-102
QAS87795.1|8668_9178_+|plate	baseplate protein	plate	Q1MVJ9	Enterobacteria_phage	100.0	1.3e-91
QAS87796.1|9261_9558_+	hypothetical protein	NA	Q1MVK0	Enterobacteria_phage	100.0	9.2e-53
QAS87797.1|9724_10189_-	oxidoreductase	NA	Q1MVK1	Enterobacteria_phage	98.7	4.3e-89
QAS87798.1|10188_10893_-	DUF3800 domain-containing protein	NA	Q71TB8	Escherichia_phage	99.6	1.3e-134
QAS87799.1|11061_11907_-	Replication protein repL	NA	Q1MVK3	Enterobacteria_phage	97.9	1.2e-150
QAS87800.1|11936_12737_-	DNA-binding protein	NA	Q1MVK4	Enterobacteria_phage	99.6	1.6e-147
QAS87801.1|12900_13935_-	phage antirepressor Ant	NA	A0A077SLI1	Escherichia_phage	99.1	4.5e-187
QAS87802.1|13931_14153_-	host cell division inhibitor Icd-like protein	NA	A0A077SLM6	Escherichia_phage	100.0	1.3e-38
QAS87803.1|14772_15285_+	hypothetical protein	NA	A0A077SK39	Escherichia_phage	100.0	4.5e-55
QAS87804.1|15288_15828_+	hypothetical protein	NA	A0A077SL46	Escherichia_phage	100.0	1.8e-46
QAS87805.1|15908_16475_+	hypothetical protein	NA	A0A077SK12	Escherichia_phage	99.5	6.6e-100
QAS87806.1|16485_17097_+|tail	phage tail protein	tail	Q71TN8	Escherichia_phage	99.5	2.9e-109
QAS87807.1|17111_17993_+	morphogenetic protein	NA	A0A1B0VBL3	Salmonella_phage	99.7	3.7e-174
QAS87808.1|18074_21815_+	lytic transglycosylase domain-containing protein	NA	Q1MVL3	Enterobacteria_phage	87.4	0.0e+00
QAS87809.1|21814_22171_+	hypothetical protein	NA	Q71TP1	Escherichia_phage	100.0	1.0e-61
QAS87810.1|22167_23601_+	bleomycin hydrolase	NA	Q71TP2	Escherichia_phage	99.4	3.4e-270
QAS87811.1|23600_24437_+|tail	phage tail protein	tail	A0A077SLH5	Escherichia_phage	99.6	1.5e-153
QAS87812.1|24515_24950_+|tail	phage tail protein	tail	A0A077SLL3	Escherichia_phage	98.6	2.8e-74
QAS87813.1|24961_29662_+	hypothetical protein	NA	Q71TP5	Escherichia_phage	57.9	4.1e-296
QAS87814.1|29661_30072_+|tail	phage tail protein	tail	Q9MCR5	Enterobacteria_phage	80.3	1.6e-23
QAS87815.1|30490_30772_+	hypothetical protein	NA	A0A1B0VBS6	Salmonella_phage	90.3	9.1e-42
QAS87816.1|30839_31169_+|holin	holin	holin	Q37876	Escherichia_phage	99.1	3.0e-52
QAS87817.1|31165_31609_+|lysis	lysis protein	lysis	A0A077SK09	Escherichia_phage	98.0	2.0e-80
QAS87818.1|31595_32198_+	odaE	NA	Q1MVM6	Enterobacteria_phage	99.5	1.6e-99
QAS87819.1|32199_34119_+	hypothetical protein	NA	A0A077SLK4	Escherichia_phage	95.6	0.0e+00
QAS87820.1|34115_34481_+	ddrA	NA	A0A077SK35	Escherichia_phage	98.3	6.7e-45
QAS87821.1|34493_37481_+	hypothetical protein	NA	A0A1B0VFX4	Salmonella_phage	98.4	0.0e+00
QAS87822.1|37470_37788_+	hypothetical protein	NA	Q1MVN0	Enterobacteria_phage	88.6	7.6e-45
QAS87823.1|37817_38612_-	hypothetical protein	NA	Q71TF1	Escherichia_phage	96.6	8.0e-144
QAS87824.1|38814_39303_-	single-stranded DNA-binding protein	NA	A0A1B0VAF5	Salmonella_phage	99.4	1.1e-87
QAS87825.1|39471_40029_+	lysozyme	NA	Q71TF3	Escherichia_phage	100.0	4.2e-107
QAS87826.1|40164_40341_+|holin	antiholin	holin	Q71TR5	Escherichia_phage	89.7	6.3e-25
QAS87827.1|40320_41340_-|head	head processing protein	head	Q71TR6	Escherichia_phage	95.9	1.9e-177
QAS87828.1|41332_43042_-|portal	phage portal protein	portal	Q71TR7	Escherichia_phage	99.6	0.0e+00
QAS87829.1|43118_49886_+	helicase	NA	Q1MVN7	Enterobacteria_phage	98.6	0.0e+00
QAS87830.1|49919_50360_+	peptide-binding protein	NA	A0A077SLF0	Escherichia_phage	100.0	1.7e-79
QAS87831.1|50356_50605_+	modulator protein	NA	Q71TG0	Escherichia_phage	100.0	1.8e-41
QAS87832.1|50663_51173_-	hypothetical protein	NA	NA	NA	NA	NA
QAS87833.1|51172_52213_-	hypothetical protein	NA	NA	NA	NA	NA
QAS87834.1|52303_52945_-	maturation control protein	NA	A0A077SK30	Escherichia_phage	96.2	4.2e-111
QAS87835.1|53134_53695_-	recombinase	NA	Q71TG3	Escherichia_phage	96.8	3.6e-98
QAS87836.1|53941_54253_-	lysogeny establishment protein	NA	Q5XLQ4	Enterobacteria_phage	93.2	6.3e-44
QAS87837.1|54303_55335_-	recombinase	NA	A0A077SLE7	Escherichia_phage	99.4	6.4e-194
QAS87838.1|55342_55564_-	creatininase	NA	Q5QBN7	Enterobacteria_phage	100.0	4.5e-36
QAS87839.1|55966_56080_+	peptidase	NA	Q5XLQ7	Enterobacteria_phage	100.0	3.2e-14
QAS87840.1|56226_57243_-|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.7	9.8e-187
QAS87841.1|57297_57393_+	peptidase	NA	Q38402	Escherichia_phage	100.0	2.8e-11
QAS87842.1|57358_57568_+	c1 repressor inactivator	NA	Q5XLQ8	Enterobacteria_phage	100.0	4.8e-32
QAS87843.1|57678_58530_+	hypothetical protein	NA	A0A077SLM8	Escherichia_phage	99.3	4.0e-157
QAS87844.1|58555_60040_-|terminase	terminase	terminase	Q71T61	Escherichia_phage	100.0	1.5e-292
QAS87845.1|60039_61233_-|terminase	terminase	terminase	Q5QBP3	Enterobacteria_phage	88.7	7.2e-181
QAS87846.1|61318_61771_-	Late promoter-activating protein	NA	Q71T63	Escherichia_phage	100.0	3.0e-79
QAS87847.1|61859_62903_-	DUF968 domain-containing protein	NA	Q1MVE3	Enterobacteria_phage	99.7	1.8e-207
QAS87848.1|62930_63110_-	PdcA protein	NA	Q71TH5	Escherichia_phage	100.0	7.1e-24
QAS87849.1|63114_63495_-	type II toxin-antitoxin system death-on-curing family toxin	NA	Q71T66	Escherichia_phage	100.0	1.9e-63
QAS87850.1|63494_63716_-	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	A0A222YXU1	Escherichia_phage	100.0	6.7e-32
QAS87851.1|63788_64178_-	DNA repair protein	NA	Q1MVE7	Enterobacteria_phage	100.0	8.3e-70
QAS87852.1|65514_67371_-	acyltransferase	NA	B5WZU0	Pseudomonas_phage	38.2	8.3e-75
QAS87853.1|68266_68461_-	hypothetical protein	NA	NA	NA	NA	NA
QAS87854.1|68693_69956_-	hypothetical protein	NA	A0A1B0V7L1	Salmonella_phage	99.3	1.7e-233
QAS87855.1|69957_70176_-	hypothetical protein	NA	Q71TI9	Escherichia_phage	100.0	3.4e-36
QAS87856.1|70257_70959_-	hypothetical protein	NA	Q71TJ0	Escherichia_phage	99.6	1.0e-142
QAS87857.1|70955_71633_-	serine/threonine protein phosphatase	NA	Q71TJ1	Escherichia_phage	97.3	3.3e-130
QAS87858.1|71629_72256_-	norphogenetic protein	NA	Q71T82	Escherichia_phage	99.0	4.0e-122
QAS87859.1|72153_72816_-	norphogenetic protein	NA	Q71T83	Escherichia_phage	100.0	4.5e-124
QAS87860.1|72757_72913_-	norphogenetic protein	NA	Q71TJ4	Escherichia_phage	100.0	7.0e-20
QAS87861.1|72979_73558_-	VRR-NUC domain-containing protein	NA	Q71T85	Escherichia_phage	99.5	4.4e-107
QAS87862.1|73560_73806_-	hypothetical protein	NA	A0A1B0VDU5	Salmonella_phage	100.0	1.5e-40
QAS87863.1|73952_74330_+	hypothetical protein	NA	Q38620	Escherichia_phage	100.0	2.2e-67
QAS87864.1|74339_75557_+|tail	phage tail protein	tail	A0A077SL53	Escherichia_phage	99.5	4.1e-224
QAS87865.1|75560_76289_+|tail	phage tail protein	tail	Q71TJ9	Escherichia_phage	100.0	4.2e-139
QAS87866.1|76275_77061_+|plate	baseplate	plate	A0A1B0V7N6	Salmonella_phage	99.2	1.4e-143
QAS87867.1|77062_78079_+|tail	phage tail tape measure protein	tail	A0A077SLQ1	Escherichia_phage	100.0	3.5e-192
QAS87868.1|78071_78704_+|plate	baseplate protein	plate	Q1MVH8	Enterobacteria_phage	99.4	7.7e-89
QAS87869.1|78750_79725_-	hypothetical protein	NA	A0A077SL52	Escherichia_phage	98.1	5.5e-187
QAS87870.1|79721_80024_-	hypothetical protein	NA	NA	NA	NA	NA
QAS87871.1|80023_81388_-	replicative DNA helicase	NA	O80281	Escherichia_phage	99.6	1.8e-252
QAS87872.1|81378_81594_+	hypothetical protein	NA	NA	NA	NA	NA
QAS87873.1|81860_82025_-	DUF3927 domain-containing protein	NA	Q1MVI2	Enterobacteria_phage	98.1	6.9e-18
QAS87874.1|82024_82459_-	tellurite resistance protein	NA	Q1MVI3	Enterobacteria_phage	100.0	8.1e-74
QAS87882.1|82655_82847_+	hypothetical protein	NA	Q71T98	Escherichia_phage	100.0	6.0e-29
QAS87875.1|84021_87063_-	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A077SL51	Escherichia_phage	86.5	0.0e+00
QAS87876.1|87059_87965_-	recombination-associated protein RdgC	NA	A0A077SK17	Escherichia_phage	99.7	1.6e-159
QAS87877.1|87957_88242_-	hypothetical protein	NA	Q71TA2	Escherichia_phage	97.9	2.5e-47
QAS87878.1|88515_88695_+	hypothetical protein	NA	A0A1B0V758	Salmonella_phage	98.3	6.8e-27
QAS87879.1|88703_89492_+	hypothetical protein	NA	A0A1B0V830	Salmonella_phage	96.6	1.4e-116
QAS87880.1|89531_89954_+	ppfA	NA	A0A1B0VCB0	Salmonella_phage	86.4	1.1e-46
QAS87881.1|90131_90524_+	hypothetical protein	NA	A0A077SLJ1	Escherichia_phage	97.7	7.6e-71
>prophage 1
CP034963	Escherichia coli strain WCHEC020032 plasmid pCMY42_020032, complete sequence	38448	5858	13593	38448		Burkholderia_phage(16.67%)	6	NA	NA
QAS87901.1|5858_6485_-	cobyrinic acid ac-diamide synthase	NA	E5FFJ3	Burkholderia_phage	31.1	2.0e-17
QAS87902.1|6664_7936_-	translesion error-prone DNA polymerase V subunit UmuC	NA	F1C5A5	Cronobacter_phage	60.9	2.0e-144
QAS87903.1|7935_8355_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	47.6	2.0e-24
QAS87904.1|8712_10614_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	29.1	3.1e-32
QAS87905.1|12034_12631_+	hypothetical protein	NA	A0A0N7KZV3	Escherichia_phage	56.6	9.0e-15
QAS87906.1|13092_13593_+	antirestriction protein ArdA	NA	G9FHQ1	Rhodococcus_virus	26.5	7.1e-05
>prophage 1
CP034964	Escherichia coli strain WCHEC020032 plasmid pCTXM3_020032, complete sequence	87704	1798	30239	87704	protease,transposase	Escherichia_phage(58.33%)	35	NA	NA
QAS87939.1|1798_2452_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
QAS87940.1|2544_2802_+	antitoxin PemI	NA	NA	NA	NA	NA
QAS87941.1|2803_3136_+	mRNA interferase PemK	NA	NA	NA	NA	NA
QAS87942.1|4446_5151_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
QAS87943.1|5285_5381_+	23S rRNA methyltransferase attenuation leader peptide	NA	NA	NA	NA	NA
QAS87944.1|5506_6244_+	23S rRNA (adenine(2058)-N(6))-methyltransferase Erm(B)	NA	E4ZFQ0	Streptococcus_phage	99.6	6.3e-135
QAS87945.1|6248_6359_+	hypothetical protein	NA	E4ZFP9	Streptococcus_phage	88.6	1.9e-08
QAS87946.1|6873_7323_+	hypothetical protein	NA	NA	NA	NA	NA
QAS87947.1|7851_9384_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
QAS87948.1|9706_9904_-	hypothetical protein	NA	A0A077SL39	Escherichia_phage	94.7	1.4e-12
QAS87949.1|9880_10585_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
QAS87950.1|11681_12542_+	aminoglycoside N-acetyltransferase AAC(3)-IId	NA	NA	NA	NA	NA
QAS87951.1|12554_13097_+	tunicamycin resistance protein	NA	NA	NA	NA	NA
QAS87952.1|13578_13770_-	hypothetical protein	NA	NA	NA	NA	NA
QAS87953.1|13775_14021_+	hypothetical protein	NA	NA	NA	NA	NA
QAS87954.1|14071_15199_+	DUF3883 domain-containing protein	NA	NA	NA	NA	NA
QAS87955.1|15235_15940_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
QAS87956.1|16061_16967_+	Mph(A) family macrolide 2'-phosphotransferase	NA	NA	NA	NA	NA
QAS87957.1|16963_18202_+	MFS transporter	NA	NA	NA	NA	NA
QAS87958.1|18201_18786_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
QAS87959.1|18731_19088_+	hypothetical protein	NA	NA	NA	NA	NA
QAS87960.1|19278_20043_-|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
QAS87961.1|20071_20254_+	resolvase	NA	NA	NA	NA	NA
QAS87962.1|20269_20575_-	PadR family transcriptional regulator	NA	NA	NA	NA	NA
QAS87963.1|20585_21791_-	chromate efflux transporter	NA	NA	NA	NA	NA
QAS87964.1|21946_22150_-	hypothetical protein	NA	NA	NA	NA	NA
QAS87965.1|22168_22348_+	hypothetical protein	NA	NA	NA	NA	NA
QAS87966.1|22277_23117_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
QAS87967.1|23110_23458_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
QAS87968.1|23663_24452_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA5	NA	NA	NA	NA	NA
QAS88042.1|24582_25056_-	trimethoprim-resistant dihydrofolate reductase DfrA17	NA	A0A1B2IAU3	Erwinia_phage	34.6	1.3e-16
QAS87969.1|25958_26663_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
QAS87970.1|27714_28191_+	cupin fold metalloprotein, WbuC family	NA	NA	NA	NA	NA
QAS87971.1|28237_29113_-	class A extended-spectrum beta-lactamase CTX-M-3	NA	A0A1B0VBP7	Salmonella_phage	82.1	5.4e-125
QAS87972.1|29534_30239_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
