The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP022040	Prevotella melaninogenica strain FDAARGOS_306 chromosome 1, complete sequence	1796407	1079793	1132954	1796407	integrase,tRNA,protease,transposase	Lysinibacillus_phage(18.18%)	41	1091372:1091391	1111384:1111403
ASE17371.1|1079793_1080705_+|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
ASE17372.1|1080782_1083308_+	penicillin-binding protein	NA	NA	NA	NA	NA
ASE17373.1|1083606_1085382_+	hypothetical protein	NA	H7BUJ6	unidentified_phage	40.9	1.1e-81
ASE17374.1|1085381_1085915_+	hypothetical protein	NA	NA	NA	NA	NA
ASE17375.1|1086036_1086522_-	ferritin	NA	NA	NA	NA	NA
ASE17376.1|1086987_1088004_-	branched-chain amino acid aminotransferase	NA	NA	NA	NA	NA
ASE17377.1|1088131_1088320_-	exodeoxyribonuclease VII small subunit	NA	NA	NA	NA	NA
ASE17378.1|1088360_1089665_-	exodeoxyribonuclease VII large subunit	NA	A0A167RNX3	Powai_lake_megavirus	39.8	1.8e-15
ASE17379.1|1089693_1091115_-|protease	serine protease	protease	NA	NA	NA	NA
1091372:1091391	attL	TTGCTCTACCAACTGAGCTA	NA	NA	NA	NA
ASE17380.1|1091918_1093334_-	hypothetical protein	NA	NA	NA	NA	NA
ASE17381.1|1094082_1094823_+	hypothetical protein	NA	NA	NA	NA	NA
AVV27025.1|1095323_1096370_+	DUF1016 domain-containing protein	NA	Q9JMP5	Wolbachia_phage	28.8	1.9e-28
ASE17930.1|1096362_1097367_+	restriction endonuclease subunit M	NA	NA	NA	NA	NA
ASE17382.1|1097386_1101349_+	DEAD/DEAH box helicase	NA	A0A1V0SII8	Klosneuvirus	24.3	7.3e-12
ASE17383.1|1101388_1102318_-	hypothetical protein	NA	NA	NA	NA	NA
ASE17384.1|1102369_1103602_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
ASE17385.1|1103685_1103949_-	hypothetical protein	NA	NA	NA	NA	NA
ASE17386.1|1103954_1104758_+|integrase	integrase	integrase	A0A0H4TI16	Erysipelothrix_phage	28.1	9.3e-23
ASE17387.1|1105228_1106281_-	glycerate kinase	NA	NA	NA	NA	NA
ASE17388.1|1106376_1108155_+	signal peptide peptidase SppA	NA	A0A2I6UH21	Salinibacter_virus	31.9	7.8e-14
ASE17389.1|1108161_1109343_+	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
ASE17390.1|1109224_1110034_+	purine-nucleoside phosphorylase	NA	Q5YBA4	Grouper_iridovirus	43.6	1.1e-60
ASE17391.1|1110133_1111243_+	thiamine-monophosphate kinase	NA	NA	NA	NA	NA
ASE17392.1|1111540_1112533_-|transposase	DDE transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	22.1	8.8e-07
1111384:1111403	attR	TAGCTCAGTTGGTAGAGCAA	NA	NA	NA	NA
ASE17393.1|1112498_1112885_-	hypothetical protein	NA	NA	NA	NA	NA
ASE17394.1|1113656_1115738_+	sialate O-acetylesterase	NA	NA	NA	NA	NA
ASE17395.1|1116044_1117607_+	DUF4976 domain-containing protein	NA	NA	NA	NA	NA
ASE17396.2|1118019_1119753_-	hypothetical protein	NA	NA	NA	NA	NA
ASE17397.1|1120189_1121542_-	sodium:alanine symporter family protein	NA	NA	NA	NA	NA
ASE17398.1|1122723_1123110_+	hypothetical protein	NA	NA	NA	NA	NA
ASE17399.1|1123075_1124068_+|transposase	DDE transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	23.2	1.2e-06
ASE17400.1|1124819_1125017_+	hypothetical protein	NA	NA	NA	NA	NA
ASE17401.1|1124997_1125657_+	hypothetical protein	NA	NA	NA	NA	NA
ASE17402.1|1126112_1126352_+	hypothetical protein	NA	NA	NA	NA	NA
ASE17403.1|1126333_1126678_+	hypothetical protein	NA	NA	NA	NA	NA
ASE17404.1|1126976_1127402_+	hypothetical protein	NA	NA	NA	NA	NA
ASE17405.1|1127933_1128581_+	hypothetical protein	NA	NA	NA	NA	NA
ASE17406.1|1128738_1130364_-	chaperonin GroEL	NA	A0A219YK78	uncultured_virus	62.3	5.6e-184
ASE17407.1|1130516_1130786_-	co-chaperone GroES	NA	A0A221S3C8	uncultured_virus	54.0	6.7e-18
ASE17408.1|1130986_1131694_+	DNA alkylation repair protein	NA	NA	NA	NA	NA
ASE17409.1|1132108_1132954_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 2
CP022040	Prevotella melaninogenica strain FDAARGOS_306 chromosome 1, complete sequence	1796407	1273406	1281876	1796407		Catovirus(16.67%)	9	NA	NA
ASE17513.1|1273406_1274216_+	molecular chaperone DjlA	NA	A0A1V0SBY2	Catovirus	51.8	1.4e-05
ASE17514.1|1274303_1275050_+	peptidylprolyl isomerase	NA	A0A076FI46	Aureococcus_anophage	32.4	1.3e-05
ASE17515.1|1275155_1275497_-	TM2 domain-containing protein	NA	A0A1B0T6B3	Bacillus_phage	50.8	1.4e-07
ASE17937.1|1275557_1275926_-	DUF2752 domain-containing protein	NA	NA	NA	NA	NA
ASE17516.1|1275942_1276221_-	hypothetical protein	NA	NA	NA	NA	NA
ASE17517.1|1277172_1278240_+	agmatine deiminase family protein	NA	M1I5R4	Acanthocystis_turfacea_Chlorella_virus	29.3	2.8e-43
ASE17518.1|1278327_1279212_+	acyltransferase	NA	M1H5W0	Paramecium_bursaria_Chlorella_virus	38.8	5.4e-56
ASE17519.1|1279753_1280140_+	hypothetical protein	NA	NA	NA	NA	NA
ASE17520.1|1280838_1281876_-	aspartate--ammonia ligase	NA	A0A1C9C5F0	Heterosigma_akashiwo_virus	38.8	3.8e-53
>prophage 1
CP022041	Prevotella melaninogenica strain FDAARGOS_306 chromosome 2, complete sequence	1371823	220916	251291	1371823	transposase,integrase,protease	unidentified_phage(33.33%)	29	246311:246325	256553:256567
ASE18091.1|220916_221261_+|transposase	transposase family protein	transposase	NA	NA	NA	NA
ASE18092.1|221376_222246_+|transposase	DDE transposase	transposase	NA	NA	NA	NA
ASE18093.1|222731_224462_-	glycosyl hydrolase family 25	NA	Q0SPG7	Clostridium_phage	33.9	5.8e-14
ASE18094.1|224524_224905_+	hypothetical protein	NA	NA	NA	NA	NA
ASE18095.1|225063_227112_+	TonB-dependent receptor	NA	NA	NA	NA	NA
ASE18096.1|227206_227536_+	heavy metal-binding protein	NA	NA	NA	NA	NA
ASE18097.1|228165_229167_-	NADP-dependent oxidoreductase	NA	NA	NA	NA	NA
ASE18098.1|229176_230010_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
ASE18891.1|230016_230373_-	transcriptional regulator	NA	NA	NA	NA	NA
ASE18099.1|230632_231460_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
ASE18100.1|231471_232443_-	bifunctional riboflavin kinase/FAD synthetase	NA	A0A1V0SJE1	Klosneuvirus	34.9	2.6e-11
ASE18101.1|233008_234277_+|transposase	transposase	transposase	H7BVW5	unidentified_phage	48.9	1.5e-67
ASE18102.1|234407_235283_+	hypothetical protein	NA	NA	NA	NA	NA
ASE18103.1|235480_236044_+	hypothetical protein	NA	NA	NA	NA	NA
ASE18104.1|236094_237903_+	hypothetical protein	NA	NA	NA	NA	NA
ASE18105.1|238665_239688_+	DUF3871 domain-containing protein	NA	NA	NA	NA	NA
ASE18106.1|239768_240041_+	hypothetical protein	NA	NA	NA	NA	NA
ASE18107.1|240067_240517_+	DNA repair protein	NA	NA	NA	NA	NA
ASE18108.1|240516_240720_+	hypothetical protein	NA	NA	NA	NA	NA
ASE18109.1|240833_241421_+|integrase	site-specific integrase	integrase	R9ZX86	Cellulophaga_phage	36.6	5.4e-20
ASE18110.1|241903_242110_+	hypothetical protein	NA	NA	NA	NA	NA
ASE18892.1|242162_243152_+	penicillin-binding protein	NA	NA	NA	NA	NA
ASE18111.1|243156_244032_+	hypothetical protein	NA	NA	NA	NA	NA
ASE18112.1|244049_244865_+	hypothetical protein	NA	NA	NA	NA	NA
ASE18113.1|245279_247349_+	hypothetical protein	NA	NA	NA	NA	NA
246311:246325	attL	TGAGGAACTATGGCA	NA	NA	NA	NA
ASE18114.1|247965_248586_+	hypothetical protein	NA	NA	NA	NA	NA
ASE18115.2|248863_249517_+	HNH endonuclease	NA	A0A2L0V0A9	Agrobacterium_phage	36.4	1.5e-18
ASE18116.1|249702_249963_+	hypothetical protein	NA	NA	NA	NA	NA
ASE18117.1|250067_251291_+|integrase	site-specific integrase	integrase	H7BUI8	unidentified_phage	39.8	4.4e-32
256553:256567	attR	TGAGGAACTATGGCA	NA	NA	NA	NA
>prophage 2
CP022041	Prevotella melaninogenica strain FDAARGOS_306 chromosome 2, complete sequence	1371823	918244	925858	1371823		Prochlorococcus_phage(33.33%)	6	NA	NA
ASE18571.1|918244_918955_-	DNA-binding response regulator	NA	A0A2R2ZGH8	Clostridioides_phage	30.3	7.2e-19
ASE18572.1|918929_920012_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	25.2	1.1e-07
ASE18573.1|920263_920869_-	riboflavin synthase	NA	A0A2I2L4R9	Orpheovirus	35.9	1.6e-22
ASE18574.1|921626_922991_-	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	33.5	2.3e-53
ASE18575.1|923025_924516_-	glycine dehydrogenase (aminomethyl-transferring)	NA	M4QFZ1	Prochlorococcus_phage	39.2	2.8e-81
ASE18576.1|924547_925858_-	aminomethyl-transferring glycine dehydrogenase subunit GcvPA	NA	E3ST28	Prochlorococcus_phage	37.3	2.6e-59
>prophage 3
CP022041	Prevotella melaninogenica strain FDAARGOS_306 chromosome 2, complete sequence	1371823	1279773	1354453	1371823	transposase,integrase	Staphylococcus_phage(22.22%)	52	1337644:1337658	1366005:1366019
ASE18823.1|1279773_1280643_-|transposase	DDE transposase	transposase	NA	NA	NA	NA
ASE18824.1|1280758_1281103_-|transposase	transposase family protein	transposase	NA	NA	NA	NA
ASE18825.1|1281625_1282603_+	DUF4974 domain-containing protein	NA	NA	NA	NA	NA
ASE18826.1|1282677_1285737_+	DUF4981 domain-containing protein	NA	L0N6M2	Herpes_simplex_virus	33.6	1.3e-152
ASE18827.1|1286245_1287136_-	RluA family pseudouridine synthase	NA	NA	NA	NA	NA
ASE18828.1|1287270_1287804_-	HDIG domain-containing protein	NA	NA	NA	NA	NA
ASE18829.1|1287893_1289672_-	oxaloacetate decarboxylase	NA	NA	NA	NA	NA
ASE18830.1|1289813_1290629_+	hypothetical protein	NA	NA	NA	NA	NA
ASE18831.1|1291368_1292202_+	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
ASE18938.1|1292489_1293005_+	hypothetical protein	NA	NA	NA	NA	NA
ASE18832.1|1293001_1293547_+	biopolymer transporter ExbD	NA	NA	NA	NA	NA
ASE18833.1|1293543_1294020_+	biopolymer transporter ExbD	NA	NA	NA	NA	NA
ASE18834.1|1294115_1294625_+	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
ASE18835.1|1295266_1296889_-	MFS transporter	NA	NA	NA	NA	NA
ASE18836.1|1297077_1299237_-	S9 family peptidase	NA	NA	NA	NA	NA
ASE18837.1|1299239_1301171_-	membrane protein insertase YidC	NA	NA	NA	NA	NA
ASE18838.1|1301171_1302782_-	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	47.2	2.2e-132
ASE18939.1|1303578_1303824_+	hypothetical protein	NA	NA	NA	NA	NA
ASE18839.1|1303820_1304546_+	KR domain-containing protein	NA	NA	NA	NA	NA
ASE18840.1|1304752_1305565_+	PepSY domain-containing protein	NA	NA	NA	NA	NA
ASE18841.1|1306499_1308119_+	hypothetical protein	NA	NA	NA	NA	NA
ASE18842.1|1308155_1309757_+	hypothetical protein	NA	NA	NA	NA	NA
ASE18843.1|1309772_1312529_+	T9SS C-terminal target domain-containing protein	NA	A0A1B0T6A2	Bacillus_phage	28.9	3.9e-20
ASE18844.1|1312540_1313494_+	hypothetical protein	NA	NA	NA	NA	NA
ASE18845.1|1313538_1315113_+	hypothetical protein	NA	NA	NA	NA	NA
ASE18846.1|1316250_1317927_+	N-6 DNA methylase	NA	A0A2H4PQP4	Staphylococcus_phage	25.7	8.4e-34
ASE18847.1|1317940_1319164_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
ASE18848.1|1319179_1322380_+	type I restriction endonuclease subunit R	NA	A0A220A398	Liberibacter_phage	29.1	7.6e-68
ASE18849.1|1322765_1323911_-	DUF1735 domain-containing protein	NA	NA	NA	NA	NA
ASE18850.1|1323951_1325070_-	endoglycosidase	NA	NA	NA	NA	NA
ASE18940.1|1325087_1326713_-	SusD/RagB family nutrient-binding outer membrane lipoprotein	NA	NA	NA	NA	NA
ASE18851.1|1326719_1329830_-	SusC/RagA family TonB-linked outer membrane protein	NA	NA	NA	NA	NA
ASE18852.1|1330183_1331287_-	MRP family ATP-binding protein	NA	NA	NA	NA	NA
ASE18853.1|1331417_1331795_-	hypothetical protein	NA	NA	NA	NA	NA
ASE18854.1|1333136_1333403_+	hypothetical protein	NA	NA	NA	NA	NA
ASE18855.1|1333821_1334337_+	hypothetical protein	NA	NA	NA	NA	NA
ASE18856.1|1335329_1335629_+	hypothetical protein	NA	NA	NA	NA	NA
ASE18857.1|1335636_1335981_+	hypothetical protein	NA	NA	NA	NA	NA
ASE18941.1|1336116_1336590_+	hypothetical protein	NA	NA	NA	NA	NA
1337644:1337658	attL	TATTAAAATGAAATT	NA	NA	NA	NA
ASE18942.1|1337805_1338279_+	hypothetical protein	NA	NA	NA	NA	NA
ASE18858.1|1338541_1339069_+	hypothetical protein	NA	NA	NA	NA	NA
ASE18859.1|1339055_1339493_+	hypothetical protein	NA	NA	NA	NA	NA
ASE18860.1|1341252_1341597_-|transposase	transposase family protein	transposase	NA	NA	NA	NA
ASE18861.1|1341802_1343464_-|transposase	IS5/IS1182 family transposase	transposase	A0A146ICT8	Staphylococcus_phage	32.7	5.2e-60
ASE18862.1|1343804_1344602_+	phosphatidylserine synthase	NA	NA	NA	NA	NA
ASE18863.1|1345736_1346954_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
ASE18864.1|1347047_1347404_+	hypothetical protein	NA	NA	NA	NA	NA
ASE18865.1|1347696_1349757_+	bifunctional DNA primase/helicase	NA	NA	NA	NA	NA
ASE18866.1|1349744_1350053_+	DNA-binding protein	NA	NA	NA	NA	NA
ASE18867.1|1350429_1351362_+	abortive phage resistance protein	NA	A0A059NT88	Lactococcus_phage	25.4	1.4e-14
ASE18868.1|1351403_1352921_-	helicase	NA	A0A248SL14	Klebsiella_phage	28.9	4.3e-37
ASE18869.1|1353232_1354453_+|integrase	site-specific integrase	integrase	H7BUI8	unidentified_phage	31.1	2.2e-23
1366005:1366019	attR	TATTAAAATGAAATT	NA	NA	NA	NA
