The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP022059	Enterococcus faecalis strain FDAARGOS_338 chromosome, complete genome	2861022	76979	133759	2861022	transposase	Staphylococcus_phage(33.33%)	54	NA	NA
ASE64501.1|76979_77939_+|transposase	IS30 family transposase IS6770	transposase	NA	NA	NA	NA
ASE64504.1|79319_79769_+	hypothetical protein	NA	NA	NA	NA	NA
ASE64505.1|80671_82015_-	PFL family protein	NA	NA	NA	NA	NA
ASE64506.1|82029_82296_-	ACT domain-containing protein	NA	NA	NA	NA	NA
ASE64507.1|82398_83067_-	2,3-bisphosphoglycerate-dependent phosphoglycerate mutase	NA	NA	NA	NA	NA
ASE64508.1|83412_84255_+	MATE family efflux transporter	NA	NA	NA	NA	NA
ASE64509.1|84839_85136_-	PTS ascorbate transporter subunit IIB	NA	NA	NA	NA	NA
ASE64510.1|85128_85593_-	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
ASE64512.1|88077_88461_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
ASE64513.1|88701_89316_-	N-acetyltransferase	NA	NA	NA	NA	NA
ASE64514.1|89459_90020_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
ASE64515.1|90095_91295_-	MFS transporter	NA	NA	NA	NA	NA
ASE64516.1|91737_92229_-	hypothetical protein	NA	NA	NA	NA	NA
ASE64517.1|92255_93401_-	galactonate dehydratase	NA	Q6A202	Oenococcus_phage	33.4	1.2e-52
AVK72511.1|93415_94783_-	PTS galactitol transporter subunit IIC	NA	NA	NA	NA	NA
ASE64518.1|94807_95086_-	PTS galactitol transporter subunit IIB	NA	NA	NA	NA	NA
ASE64519.1|95104_95563_-	PTS galactitol transporter subunit IIA	NA	NA	NA	NA	NA
ASE64520.1|95574_96195_-	2-dehydro-3-deoxyphosphogluconate aldolase	NA	NA	NA	NA	NA
ASE64521.1|96205_98248_-	PRD domain-containing protein	NA	NA	NA	NA	NA
ASE64522.1|98529_99765_-|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
ASE64523.1|99761_100346_-	DUF262 domain-containing protein	NA	NA	NA	NA	NA
ASE64524.1|100535_103568_-	restriction endonuclease subunit R	NA	A0A220A398	Liberibacter_phage	23.3	3.1e-18
ASE64525.1|103797_104757_+|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
ASE64526.1|105761_107252_-	xylulokinase	NA	NA	NA	NA	NA
ASE64527.1|107313_108621_-	xylose isomerase	NA	NA	NA	NA	NA
ASE64528.1|108725_109133_-	PTS mannose transporter subunit IIA	NA	NA	NA	NA	NA
ASE64529.1|109144_109627_-	PTS mannose/fructose/sorbose transporter subunit IIB	NA	NA	NA	NA	NA
ASE66899.1|109651_110464_-	PTS trehalose transporter subunit IIBC	NA	NA	NA	NA	NA
AVK72512.1|110456_111242_-	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
ASE66900.1|111241_113308_-	family 31 glucosidase	NA	NA	NA	NA	NA
ASE64530.1|113673_114840_+	ROK family transcriptional regulator	NA	NA	NA	NA	NA
ASE64531.2|115348_115624_+	hypothetical protein	NA	A0A0N9S8A3	Staphylococcus_phage	40.9	1.1e-10
ASE64532.1|115729_116041_+|transposase	IS3 family transposase	transposase	A0A0N9SIX5	Staphylococcus_phage	65.6	1.6e-23
ASE64533.1|116780_116909_+	PTS lactose transporter subunit IIC	NA	NA	NA	NA	NA
AVK72513.1|117109_118243_-	pyridine nucleotide-disulfide oxidoreductase	NA	V9VEY6	Lactococcus_phage	26.7	2.2e-06
ASE64535.1|118345_119416_-	ammonium transporter	NA	NA	NA	NA	NA
AVK72514.1|119609_120014_-	NusG domain II-containing protein	NA	NA	NA	NA	NA
ASE64536.1|120065_120452_-	hypothetical protein	NA	NA	NA	NA	NA
ASE64537.2|120464_120638_-	50S ribosomal protein L32	NA	NA	NA	NA	NA
ASE64538.1|120988_122041_+	YibE/F family protein	NA	NA	NA	NA	NA
ASE64539.1|122027_122792_+	YibE/F family protein	NA	NA	NA	NA	NA
ASE64540.1|123424_123907_-	sugar permease	NA	NA	NA	NA	NA
ASE64542.2|123917_125420_-	PTS glucose transporter subunit IIBC	NA	NA	NA	NA	NA
ASE64543.1|125412_126120_-	putative N-acetylmannosamine-6-phosphate 2-epimerase	NA	NA	NA	NA	NA
ASE64544.1|126275_127094_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
AVK72515.1|127173_127380_-	hypothetical protein	NA	NA	NA	NA	NA
AVK72739.1|127392_127653_-	Sin recombinase	NA	NA	NA	NA	NA
ASE64545.1|127820_128294_+	recombinase family protein	NA	A0A1V0E035	Clostridioides_phage	38.0	1.4e-10
ASE66901.1|128339_129005_-	hypothetical protein	NA	NA	NA	NA	NA
ASE64546.1|129149_129272_-	hypothetical protein	NA	NA	NA	NA	NA
AVK72516.1|129301_129718_-	hypothetical protein	NA	NA	NA	NA	NA
ASE64547.1|129849_131028_-|transposase	IS256 family transposase ISEf1	transposase	NA	NA	NA	NA
ASE64548.1|131193_132402_-	YSIRK-targeted surface antigen transcriptional regulator	NA	NA	NA	NA	NA
ASE64549.1|132580_133759_+|transposase	IS256 family transposase ISEf1	transposase	NA	NA	NA	NA
>prophage 2
CP022059	Enterococcus faecalis strain FDAARGOS_338 chromosome, complete genome	2861022	173864	193340	2861022	transposase,integrase,protease	Streptococcus_phage(22.22%)	19	183101:183115	199611:199625
AVK72522.1|173864_175979_-|protease	ATP-dependent Clp protease ATP-binding subunit	protease	K4FB40	Cronobacter_phage	38.7	5.9e-117
ASE64584.1|176397_176634_-	XRE family transcriptional regulator	NA	A0A097PBE6	Streptococcus_pyogenes_phage	50.7	1.6e-12
ASE64585.1|176734_176887_+	DNA-binding protein	NA	NA	NA	NA	NA
ASE64586.1|177188_178448_+|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
ASE64587.1|178492_179434_-	lysophospholipase	NA	NA	NA	NA	NA
ASE66904.1|179552_179894_+	hypothetical protein	NA	NA	NA	NA	NA
ASE64588.1|180009_180363_-	hypothetical protein	NA	NA	NA	NA	NA
ASE64589.1|180363_180888_-|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	38.6	4.3e-21
ASE64590.1|181037_181298_-	DUF3102 domain-containing protein	NA	J7KDG2	Streptococcus_phage	49.4	1.4e-12
ASE64591.1|181652_182228_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
ASE64592.1|182227_182416_+	hypothetical protein	NA	NA	NA	NA	NA
ASE64593.1|182492_183116_+	cysteine hydrolase	NA	NA	NA	NA	NA
183101:183115	attL	TCTTGAAGAGCTTTG	NA	NA	NA	NA
ASE64594.1|183253_184603_+	pyridine nucleotide-disulfide oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	51.4	5.8e-118
ASE64595.1|184985_186357_+|transposase	IS3-like element ISLla3 family transposase	transposase	A0A1B1P773	Bacillus_phage	43.1	3.5e-54
AVK72523.1|186652_187249_-	HTH domain-containing protein	NA	NA	NA	NA	NA
AVK72524.1|187422_188382_-|transposase	IS30 family transposase IS6770	transposase	NA	NA	NA	NA
ASE64596.1|188539_189733_-	glycosyl transferase	NA	M1H5V3	Paramecium_bursaria_Chlorella_virus	32.4	1.1e-43
ASE64597.1|189769_190957_-	nucleotide sugar dehydrogenase	NA	M1HV26	Paramecium_bursaria_Chlorella_virus	48.6	4.2e-96
AVK72525.1|192740_193340_-|integrase	site-specific integrase	integrase	D2XR58	Bacillus_phage	35.6	2.5e-28
199611:199625	attR	CAAAGCTCTTCAAGA	NA	NA	NA	NA
>prophage 3
CP022059	Enterococcus faecalis strain FDAARGOS_338 chromosome, complete genome	2861022	631943	706967	2861022	holin,integrase,tRNA,protease	uncultured_Mediterranean_phage(14.29%)	59	673980:673994	709943:709957
ASE64974.1|631943_633215_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	53.6	3.9e-92
ASE64975.1|633549_634731_-	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	27.5	7.7e-26
ASE64976.1|634720_635410_-	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	38.5	1.6e-39
AVK72555.1|635635_635719_+	hypothetical protein	NA	NA	NA	NA	NA
ASE64977.1|641807_642665_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
AVK72556.1|642810_644118_+	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
ASE64978.1|644137_645325_+	cystathionine gamma-synthase	NA	NA	NA	NA	NA
ASE64979.1|645629_646097_+	CtsR family transcriptional regulator	NA	NA	NA	NA	NA
ASE64980.1|646099_648595_+|protease	ATP-dependent Clp protease ATP-binding subunit	protease	A0A0A8J958	Klebsiella_phage	39.5	1.9e-127
AVK72557.1|648728_649763_+	FUSC family protein	NA	NA	NA	NA	NA
ASE64981.1|649943_650864_+	U32 family peptidase	NA	NA	NA	NA	NA
ASE64982.1|650891_652139_+|protease	collagenase-like protease	protease	Q6DW11	Phage_TP	34.2	8.7e-44
ASE64983.1|652162_653725_+	PucR family transcriptional regulator	NA	NA	NA	NA	NA
ASE64984.1|653913_654138_+	hypothetical protein	NA	NA	NA	NA	NA
ASE64985.1|654412_655681_+	cytosine permease	NA	NA	NA	NA	NA
ASE64986.1|655700_656795_+	DUF917 domain-containing protein	NA	NA	NA	NA	NA
ASE64987.1|656795_658349_+	hydantoinase/oxoprolinase family protein	NA	NA	NA	NA	NA
ASE66925.1|658803_659277_+	hypothetical protein	NA	NA	NA	NA	NA
ASE64988.1|659254_660394_+	ImmA/IrrE family metallo-endopeptidase	NA	B6SBZ6	Clostridium_virus	33.2	5.1e-43
ASE64989.1|660416_660815_+	hypothetical protein	NA	NA	NA	NA	NA
ASE64990.1|660900_662250_+	glutathione-disulfide reductase	NA	NA	NA	NA	NA
ASE64991.1|662447_662810_+	dihydroneopterin aldolase	NA	NA	NA	NA	NA
ASE64992.1|662810_663296_+	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
ASE64993.1|663289_663859_+	GTP cyclohydrolase I FolE	NA	S4VV34	Pandoravirus	49.1	2.0e-32
ASE64994.1|663862_664456_+	non-canonical purine NTP pyrophosphatase	NA	A0A1K0ISQ7	Cassava_brown_streak_virus	34.3	1.5e-09
AVK72558.1|664448_665240_+	dihydropteroate synthase	NA	A0A0B5J4J5	Pandoravirus	29.8	5.4e-23
ASE64995.1|665280_665382_+	hypothetical protein	NA	NA	NA	NA	NA
ASE64996.1|666151_667138_-	polyprenyl synthetase family protein	NA	NA	NA	NA	NA
ASE64997.1|667175_667733_-	heptaprenyl diphosphate synthase	NA	NA	NA	NA	NA
ASE64998.1|667744_668167_-	hypothetical protein	NA	NA	NA	NA	NA
ASE64999.1|668384_670331_-	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
ASE65000.1|670608_671538_+	FMN-binding domain-containing protein	NA	NA	NA	NA	NA
ASE65001.1|671792_672860_+	FAD:protein FMN transferase	NA	NA	NA	NA	NA
ASE65002.1|672873_673821_+	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
673980:673994	attL	TTTTGATAAAAATTG	NA	NA	NA	NA
ASE65003.1|674228_674570_+	cell surface protein	NA	NA	NA	NA	NA
ASE65004.1|674556_678402_+	WxL domain-containing protein	NA	NA	NA	NA	NA
ASE65005.1|678733_681730_+	WxL domain-containing protein	NA	NA	NA	NA	NA
ASE65006.1|682078_686770_+	WxL domain-containing protein	NA	NA	NA	NA	NA
ASE65007.1|686964_687108_-|holin	putative holin-like toxin	holin	NA	NA	NA	NA
ASE66926.1|687337_687478_-|holin	putative holin-like toxin	holin	NA	NA	NA	NA
ASE65008.1|687596_687740_-|holin	putative holin-like toxin	holin	NA	NA	NA	NA
ASE65009.1|688069_689686_-	LytR family transcriptional regulator	NA	NA	NA	NA	NA
AVK72559.1|689720_689813_-	hypothetical protein	NA	NA	NA	NA	NA
ASE65010.1|690378_691008_+	chitin-binding protein	NA	NA	NA	NA	NA
ASE65011.1|691271_692264_-	biotin--[acetyl-CoA-carboxylase] ligase	NA	NA	NA	NA	NA
ASE65012.1|692402_692618_+	DNA-binding protein	NA	NA	NA	NA	NA
ASE65013.1|693024_693255_+	AbrB family transcriptional regulator	NA	NA	NA	NA	NA
ASE65014.1|693254_693596_+	type II toxin-antitoxin system PemK/MazF family toxin	NA	A0A1S5SAB3	Streptococcus_phage	42.5	4.2e-17
ASE65015.1|693769_693949_+	hypothetical protein	NA	NA	NA	NA	NA
ASE65016.1|693957_697581_+	DNA-directed RNA polymerase subunit beta	NA	A0A1B1ISA9	uncultured_Mediterranean_phage	24.5	2.0e-48
ASE65017.1|697747_701401_+	DNA-directed RNA polymerase subunit beta'	NA	R4TQM7	Phaeocystis_globosa_virus	24.8	1.4e-65
ASE65018.1|701450_702143_-	prepilin peptidase	NA	NA	NA	NA	NA
ASE65019.1|702251_703772_+	gluconate kinase	NA	NA	NA	NA	NA
ASE65020.1|703855_704575_+	DUF5105 domain-containing protein	NA	NA	NA	NA	NA
ASE65021.1|704702_705170_+	DNA starvation/stationary phase protection protein	NA	C1KFH1	Lactobacillus_virus	25.9	1.0e-05
AVK72560.1|705222_705330_-	hypothetical protein	NA	NA	NA	NA	NA
ASE65022.1|705391_705835_+	50S ribosomal protein L13	NA	NA	NA	NA	NA
ASE65023.1|705848_706241_+	30S ribosomal protein S9	NA	NA	NA	NA	NA
ASE65024.1|706346_706967_-|integrase	integrase	integrase	A0A097BYJ7	Leuconostoc_phage	26.1	5.9e-09
709943:709957	attR	TTTTGATAAAAATTG	NA	NA	NA	NA
>prophage 4
CP022059	Enterococcus faecalis strain FDAARGOS_338 chromosome, complete genome	2861022	725092	743838	2861022	integrase	Streptococcus_phage(94.74%)	23	724841:724854	742627:742640
724841:724854	attL	AATTTACTACTTAT	NA	NA	NA	NA
ASE65038.1|725092_725407_+	DUF961 domain-containing protein	NA	A0A1S5SF38	Streptococcus_phage	100.0	5.2e-54
ASE65039.1|725422_725809_+	DUF961 domain-containing protein	NA	A0A1S5SF96	Streptococcus_phage	100.0	3.0e-64
ASE65040.1|725837_727223_+	DNA translocase FtsK	NA	A0A1S5SFB5	Streptococcus_phage	100.0	1.1e-265
AVK72563.1|727225_727378_+	conjugal transfer protein	NA	NA	NA	NA	NA
ASE65041.1|727400_728606_+	XRE family transcriptional regulator	NA	A0A1S5SEX3	Streptococcus_phage	100.0	2.8e-233
ASE65042.1|728648_728870_+	hypothetical protein	NA	A0A1S5SEY0	Streptococcus_phage	100.0	4.3e-31
ASE65043.1|728986_729484_+	antirestriction protein ArdA	NA	A0A1S5SF25	Streptococcus_phage	100.0	1.7e-91
ASE65044.1|729458_729965_+	conjugal transfer protein	NA	A0A1S5SEX7	Streptococcus_phage	100.0	8.6e-91
ASE65045.1|729948_732396_+	ATP/GTP-binding protein	NA	A0A1S5SF64	Streptococcus_phage	100.0	0.0e+00
ASE65046.1|732398_734576_+	hypothetical protein	NA	A0A1S5SF30	Streptococcus_phage	100.0	0.0e+00
ASE65047.1|734572_735574_+	peptidase P60	NA	A0A1S5SEZ8	Streptococcus_phage	100.0	5.0e-191
ASE65048.1|735570_736503_+	conjugal transfer protein	NA	A0A1S5SF22	Streptococcus_phage	99.4	3.1e-171
ASE65049.1|736777_736864_+	tetracycline resistance protein	NA	NA	NA	NA	NA
ASE65050.1|736879_738799_+	tetracycline resistance ribosomal protection protein	NA	A0A1S5SF82	Streptococcus_phage	98.6	0.0e+00
AVK72564.1|738899_739085_+	conjugal transfer protein	NA	D0R0F6	Streptococcus_phage	67.9	3.9e-17
ASE65051.1|739144_739498_-	XRE family transcriptional regulator	NA	A0A1S5SFA6	Streptococcus_phage	100.0	1.3e-58
AVK72744.1|739702_739774_+	hypothetical protein	NA	NA	NA	NA	NA
ASE65052.1|740002_740425_+	sigma-70 family RNA polymerase sigma factor	NA	A0A1S5SEW0	Streptococcus_phage	100.0	2.5e-72
ASE65053.1|740421_740652_+	helix-turn-helix domain-containing protein	NA	A0A1S5SEX1	Streptococcus_phage	100.0	2.7e-36
ASE65054.1|740877_741129_-	hypothetical protein	NA	NA	NA	NA	NA
ASE65055.1|741112_741316_+	excisionase	NA	A0A1S5SF07	Streptococcus_phage	100.0	4.0e-31
ASE65056.1|741397_742615_+|integrase	site-specific integrase	integrase	A0A1S5SEW7	Streptococcus_phage	100.0	3.7e-233
ASE65057.1|742902_743838_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	29.4	2.4e-22
742627:742640	attR	AATTTACTACTTAT	NA	NA	NA	NA
>prophage 5
CP022059	Enterococcus faecalis strain FDAARGOS_338 chromosome, complete genome	2861022	1078702	1088442	2861022		Streptococcus_phage(57.14%)	11	NA	NA
ASE65360.1|1078702_1079341_+	thymidylate kinase	NA	M1PSC7	Streptococcus_phage	53.8	2.1e-54
ASE65361.1|1079360_1079690_+	hypothetical protein	NA	NA	NA	NA	NA
ASE65362.1|1079691_1080642_+	DNA polymerase III subunit delta'	NA	M1NSC1	Streptococcus_phage	33.0	4.8e-34
ASE65363.1|1080758_1081598_+	signal peptidase	NA	NA	NA	NA	NA
ASE65364.1|1081590_1081938_+	initiation-control protein YabA	NA	M1PFV3	Streptococcus_phage	37.6	1.2e-16
ASE65365.1|1082049_1082922_+	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	57.2	1.1e-80
ASE65366.1|1082936_1083599_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.1	6.7e-19
ASE65367.1|1083582_1084341_+	iron export ABC transporter permease subunit FetB	NA	NA	NA	NA	NA
ASE65368.1|1084466_1085585_+	DNA polymerase IV	NA	NA	NA	NA	NA
ASE65369.1|1085629_1086226_-	anaerobic ribonucleoside-triphosphate reductase activating protein	NA	A0A0C5K925	Enterococcus_phage	56.4	6.0e-51
ASE65370.1|1086258_1088442_-	anaerobic ribonucleoside-triphosphate reductase	NA	A0A0C5KKX3	Enterococcus_phage	66.8	4.0e-286
>prophage 6
CP022059	Enterococcus faecalis strain FDAARGOS_338 chromosome, complete genome	2861022	1211631	1219548	2861022	transposase	Planktothrix_phage(16.67%)	11	NA	NA
ASE65472.1|1211631_1212690_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.1	2.0e-17
ASE65473.1|1212689_1213646_+	ABC transporter ATP-binding protein	NA	A0A1J0FA64	Only_Syngen_Nebraska_virus	23.9	3.2e-06
ASE65474.1|1213686_1214757_+|transposase	transposase	transposase	A0A288TXV8	Enterococcus_phage	49.0	7.6e-89
ASE65475.1|1215155_1215677_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	33.3	3.0e-14
ASE65476.1|1215790_1215991_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
ASE65477.1|1216051_1216411_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
ASE65478.1|1216457_1216808_-	hypothetical protein	NA	NA	NA	NA	NA
ASE65479.1|1216730_1216994_+	hypothetical protein	NA	NA	NA	NA	NA
ASE65480.1|1216905_1217265_+	DUF1304 domain-containing protein	NA	NA	NA	NA	NA
ASE65482.1|1217841_1218357_+	GrpB family protein	NA	A0A2K5B2B6	Erysipelothrix_phage	48.8	1.7e-38
ASE65483.1|1218372_1219548_-	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	47.7	2.5e-85
>prophage 7
CP022059	Enterococcus faecalis strain FDAARGOS_338 chromosome, complete genome	2861022	1577324	1586311	2861022	tail	Staphylococcus_phage(25.0%)	15	NA	NA
ASE65796.1|1577324_1579721_+	translation initiation factor IF-2	NA	A0A2H4UTS4	Bodo_saltans_virus	24.1	1.7e-19
ASE65797.1|1579745_1580096_+	30S ribosome-binding factor RbfA	NA	NA	NA	NA	NA
ASE65798.1|1580178_1580409_+	hypothetical protein	NA	NA	NA	NA	NA
ASE65799.1|1580468_1580942_-	toxin	NA	A0A097BY56	Enterococcus_phage	71.2	1.1e-60
ASE65800.1|1580988_1581471_-	XRE family transcriptional regulator	NA	R9QTP6	Staphylococcus_phage	48.6	1.2e-20
ASE65801.1|1581639_1581822_+	hypothetical protein	NA	NA	NA	NA	NA
ASE65802.1|1581852_1582623_+	DnaD domain protein	NA	A0A0K0MX39	Streptococcus_phage	57.0	2.5e-33
ASE65803.2|1582641_1583484_+	ATP-binding protein	NA	A0A0P0I3L9	Lactobacillus_phage	31.0	2.6e-31
ASE65804.1|1583486_1583579_+	hypothetical protein	NA	NA	NA	NA	NA
ASE65805.1|1583571_1583943_+	hypothetical protein	NA	NA	NA	NA	NA
ASE65806.1|1583962_1584370_+	transcriptional regulator	NA	NA	NA	NA	NA
ASE65807.1|1584615_1585008_+	hypothetical protein	NA	NA	NA	NA	NA
ASE65808.1|1585020_1585533_+|tail	phage major tail protein, TP901-1 family	tail	W6LP72	Streptococcus_phage	49.4	8.8e-35
ASE65809.1|1585565_1585925_+	hypothetical protein	NA	A0A0F6N4J9	Staphylococcus_phage	32.2	7.6e-09
ASE65810.1|1585942_1586311_+	hypothetical protein	NA	A0A1P8BLR3	Lactococcus_phage	39.7	4.6e-09
>prophage 8
CP022059	Enterococcus faecalis strain FDAARGOS_338 chromosome, complete genome	2861022	2033318	2041962	2861022		Synechococcus_phage(50.0%)	9	NA	NA
ASE66192.1|2033318_2033891_-	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	35.1	5.4e-25
AVK72658.1|2033887_2034919_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	M4QRQ6	Synechococcus_phage	45.6	2.2e-56
ASE66193.1|2034920_2036360_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	33.0	2.1e-49
AVK72659.1|2036335_2038555_-	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	39.9	3.7e-146
ASE66194.1|2038551_2039226_-	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
ASE66195.1|2039226_2039478_-	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
AVK72660.1|2039491_2040205_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3ELR0	Synechococcus_phage	43.0	4.3e-48
ASE66196.1|2040356_2041481_-	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
ASE66197.1|2041473_2041962_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	42.0	8.4e-19
>prophage 9
CP022059	Enterococcus faecalis strain FDAARGOS_338 chromosome, complete genome	2861022	2156834	2209325	2861022	terminase,head,portal,capsid,tail,holin,integrase,tRNA	Enterococcus_phage(38.24%)	66	2172237:2172255	2209381:2209399
ASE66294.1|2156834_2158604_-|tRNA	aspartate--tRNA ligase	tRNA	A0A2K9L424	Tupanvirus	30.3	3.0e-13
ASE66295.1|2158621_2159923_-|tRNA	histidine--tRNA ligase	tRNA	A0A2I2L577	Orpheovirus	26.4	1.3e-21
ASE66296.1|2159919_2160168_-	hypothetical protein	NA	NA	NA	NA	NA
ASE66297.1|2160280_2160727_-|tRNA	D-aminoacyl-tRNA deacylase	tRNA	NA	NA	NA	NA
ASE66298.1|2160750_2162964_-	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	A0A2I2L310	Orpheovirus	38.0	1.3e-10
AVK72673.1|2163178_2163931_-	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
AVK72674.1|2163932_2164880_-	50S ribosomal protein L11 methyltransferase	NA	NA	NA	NA	NA
ASE66299.1|2164895_2165381_-	DUF3013 domain-containing protein	NA	NA	NA	NA	NA
ASE66300.1|2165337_2166027_-	DNA-3-methyladenine glycosylase	NA	NA	NA	NA	NA
ASE66301.1|2166143_2167421_+	replication-associated recombination protein A	NA	A0A127AWE7	Bacillus_phage	49.9	3.1e-105
ASE66302.1|2167748_2168027_+	hypothetical protein	NA	NA	NA	NA	NA
ASE66303.1|2168203_2168677_+	universal stress protein	NA	NA	NA	NA	NA
ASE66304.1|2168788_2169976_-	acetate kinase	NA	NA	NA	NA	NA
ASE66305.1|2170000_2171008_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
ASE66306.1|2171136_2171490_-	hypothetical protein	NA	NA	NA	NA	NA
ASE66307.1|2171489_2171924_-	competence protein ComG	NA	NA	NA	NA	NA
ASE66308.1|2171913_2172381_-	type II secretion system protein	NA	NA	NA	NA	NA
2172237:2172255	attL	CCACTCCCCATCTGAAATT	NA	NA	NA	NA
ASE66309.1|2172617_2172743_+	hypothetical protein	NA	NA	NA	NA	NA
ASE66310.1|2173039_2173981_-	ferrochelatase	NA	NA	NA	NA	NA
ASE66311.1|2174696_2174942_-	hypothetical protein	NA	NA	NA	NA	NA
ASE66312.1|2175040_2175241_-	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	80.3	1.6e-24
ASE66313.1|2176087_2177347_-	LysM peptidoglycan-binding domain-containing protein	NA	C9E2L1	Enterococcus_phage	89.2	3.3e-208
ASE66314.2|2177359_2177740_-|holin	holin	holin	A0A097QQ04	Enterococcus_phage	100.0	1.1e-61
ASE66315.1|2177750_2177873_-	XkdX family protein	NA	NA	NA	NA	NA
AVK72675.1|2177874_2178270_-	hypothetical protein	NA	NA	NA	NA	NA
AVK72676.1|2178288_2178741_-	hypothetical protein	NA	C0LZY6	Enterococcus_phage	40.3	3.3e-17
ASE66316.1|2178757_2179498_-	hypothetical protein	NA	A0A1X9IGH6	Lactococcus_phage	34.6	1.2e-27
ASE66317.1|2179503_2180949_-	peptidase M23	NA	A0A1X9IGI5	Lactococcus_phage	39.2	9.0e-77
AVK72677.1|2180948_2181671_-	hypothetical protein	NA	C5IUK4	Streptococcus_phage	39.2	1.2e-42
ASE66318.1|2181667_2186122_-|tail	phage tail tape measure protein	tail	M1PKM6	Streptococcus_phage	49.0	2.2e-89
ASE66319.1|2186108_2186414_-	hypothetical protein	NA	NA	NA	NA	NA
ASE66320.1|2186482_2186881_-	hypothetical protein	NA	NA	NA	NA	NA
ASE66321.1|2186943_2187252_-	hypothetical protein	NA	L0P8M2	Lactobacillus_phage	77.1	2.7e-07
ASE66322.1|2187254_2187860_-|tail	phage major tail protein, TP901-1 family	tail	NA	NA	NA	NA
ASE66323.1|2187879_2188272_-	hypothetical protein	NA	NA	NA	NA	NA
ASE66324.1|2188268_2188607_-	hypothetical protein	NA	A0A1L2K255	Streptococcus_phage	38.7	5.3e-12
ASE66325.1|2188603_2188879_-	hypothetical protein	NA	NA	NA	NA	NA
ASE66326.1|2188875_2189208_-	hypothetical protein	NA	A0A1W6JNH7	Staphylococcus_phage	38.5	2.7e-08
ASE66327.1|2189278_2190175_-|capsid	capsid protein	capsid	U3PDP8	Lactobacillus_phage	50.2	2.3e-70
ASE66328.1|2190187_2190841_-	hypothetical protein	NA	NA	NA	NA	NA
ASE66329.1|2190945_2191872_-|head	phage head morphogenesis protein	head	A0A097QPZ9	Enterococcus_phage	98.0	1.8e-131
ASE66330.1|2191864_2193349_-|portal	phage portal protein	portal	A0A097QPZ5	Enterococcus_phage	99.6	3.8e-139
ASE66331.1|2193348_2194632_-|terminase	PBSX family phage terminase large subunit	terminase	Q9AZ91	Lactobacillus_prophage	65.0	5.1e-156
ASE66332.1|2194612_2195047_-|terminase	terminase small subunit	terminase	A7J290	Streptococcus_phage	64.5	1.8e-44
ASE66977.1|2195078_2195243_-	hypothetical protein	NA	NA	NA	NA	NA
ASE66333.1|2196294_2197284_-	hypothetical protein	NA	NA	NA	NA	NA
ASE66334.1|2197985_2198402_-	autolysin	NA	D2IZ17	Enterococcus_phage	99.3	1.4e-67
ASE66335.1|2198769_2199030_-	hypothetical protein	NA	NA	NA	NA	NA
ASE66336.1|2199309_2199735_-	RusA family crossover junction endodeoxyribonuclease	NA	D2IYU2	Enterococcus_phage	81.4	1.5e-59
ASE66337.1|2199752_2200052_-	hypothetical protein	NA	D2IZY1	Enterococcus_phage	89.9	5.1e-43
ASE66338.1|2200052_2200355_-	hypothetical protein	NA	D2IZR3	Enterococcus_phage	96.0	2.2e-46
ASE66339.1|2200358_2201240_-	helix-turn-helix domain-containing protein	NA	A0A2P1CD59	Lactobacillus_phage	58.5	1.1e-24
ASE66340.1|2201239_2201440_-	hypothetical protein	NA	NA	NA	NA	NA
ASE66341.1|2201444_2202086_-	hypothetical protein	NA	U5U4M2	Lactobacillus_phage	36.0	4.8e-30
ASE66342.1|2202090_2202825_-	single-stranded DNA-binding protein	NA	A0A1W6JNQ5	Staphylococcus_phage	29.9	2.3e-20
ASE66345.1|2203355_2203910_+	hypothetical protein	NA	NA	NA	NA	NA
ASE66346.1|2203890_2204097_-	hypothetical protein	NA	NA	NA	NA	NA
ASE66347.1|2204567_2204777_-	hypothetical protein	NA	D2IZ57	Enterococcus_phage	75.8	1.8e-18
ASE66348.1|2204831_2205020_+	DUF1508 domain-containing protein	NA	NA	NA	NA	NA
ASE66349.1|2205045_2205771_-	phage regulatory protein	NA	A0A0P0IDD0	Lactobacillus_phage	54.7	2.2e-31
ASE66350.1|2205809_2206121_-	hypothetical protein	NA	NA	NA	NA	NA
ASE66351.1|2206131_2206308_-	XRE family transcriptional regulator	NA	D2IZW2	Enterococcus_phage	65.5	1.7e-14
ASE66352.1|2206619_2206952_+	XRE family transcriptional regulator	NA	A0A097QQ00	Enterococcus_phage	69.1	2.6e-35
ASE66353.1|2206968_2207313_+	ImmA/IrrE family metallo-endopeptidase	NA	A0A097QQ08	Enterococcus_phage	70.8	4.7e-40
ASE66354.1|2207348_2208077_+	ion transporter	NA	A0A1B0Y2S3	Lactobacillus_phage	49.5	3.2e-22
ASE66355.1|2208176_2209325_+|integrase	site-specific integrase	integrase	A0A1C8E994	Bacillus_phage	30.7	2.3e-38
2209381:2209399	attR	CCACTCCCCATCTGAAATT	NA	NA	NA	NA
>prophage 10
CP022059	Enterococcus faecalis strain FDAARGOS_338 chromosome, complete genome	2861022	2273233	2360325	2861022	terminase,head,portal,capsid,tail,holin,integrase,tRNA	Enterococcus_phage(73.77%)	99	2319423:2319449	2360400:2360426
ASE66403.1|2273233_2274163_-|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
AVK72685.1|2274163_2274910_-	glycerophosphodiester phosphodiesterase	NA	A0A0S2MYI4	Enterococcus_phage	40.4	8.1e-13
ASE66405.1|2276832_2277792_-	epimerase	NA	A0A1V0SKV4	Klosneuvirus	36.2	1.0e-47
ASE66406.1|2277879_2278785_-	hypothetical protein	NA	NA	NA	NA	NA
AVK72686.1|2278781_2280248_-	oligosaccharide repeat unit polymerase	NA	NA	NA	NA	NA
ASE66981.1|2280364_2280472_-	hypothetical protein	NA	NA	NA	NA	NA
ASE66407.2|2280532_2283412_-	glycosyl hydrolase family 25	NA	U3PJ04	Lactobacillus_phage	34.2	2.8e-21
ASE66408.1|2283440_2283839_-	glycerol-3-phosphate cytidylyltransferase	NA	A0A1V0SGE7	Hokovirus	41.5	2.1e-20
ASE66409.1|2283844_2284699_-	LicD family protein	NA	A0A1V0SD50	Indivirus	50.9	3.6e-09
ASE66410.1|2284790_2285924_-	glycosyl transferase	NA	NA	NA	NA	NA
AVK72687.1|2285930_2287469_-	transporter	NA	NA	NA	NA	NA
ASE66411.1|2287609_2288584_-	glycosyl transferase family 2	NA	A0A0F7L2F7	uncultured_marine_virus	34.3	2.5e-06
ASE66412.1|2288570_2289644_-	dTDP-glucose 4,6-dehydratase	NA	NA	NA	NA	NA
ASE66413.1|2289656_2290361_-	2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
ASE66414.1|2290593_2291436_-	LicD family protein	NA	NA	NA	NA	NA
ASE66415.1|2291451_2292285_-	ammonia monooxygenase	NA	F2Y1U7	Organic_Lake_phycodnavirus	31.6	4.1e-13
ASE66416.1|2292404_2293802_-	sugar transferase	NA	NA	NA	NA	NA
ASE66417.1|2293907_2295209_-	hypothetical protein	NA	NA	NA	NA	NA
ASE66418.1|2295237_2297208_-	hypothetical protein	NA	NA	NA	NA	NA
AVK72688.1|2297241_2299383_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
ASE66420.1|2299394_2302538_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
ASE66421.1|2302527_2303745_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	24.0	1.5e-08
ASE66422.1|2303757_2304552_-	ABC transporter permease	NA	NA	NA	NA	NA
ASE66423.1|2304799_2305141_+	hypothetical protein	NA	NA	NA	NA	NA
ASE66424.1|2305214_2305565_-	DUF2304 domain-containing protein	NA	NA	NA	NA	NA
ASE66425.1|2305564_2306290_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
ASE66426.1|2306348_2307248_-	dTDP-4-dehydrorhamnose reductase	NA	A0A1D8EQE2	Escherichia_phage	33.2	3.5e-26
ASE66427.1|2307283_2308312_-	dTDP-glucose 4,6-dehydratase	NA	A0A1D7XFE8	Escherichia_phage	41.9	1.9e-68
AVK72689.1|2308336_2308909_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	50.3	2.4e-41
ASE66428.1|2308921_2309788_-	glucose-1-phosphate thymidylyltransferase	NA	I7I009	Enterobacteria_phage	63.9	6.1e-105
ASE66429.1|2309909_2310623_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
ASE66430.1|2310626_2311454_-	glycosyl transferase family 2	NA	NA	NA	NA	NA
ASE66431.1|2311453_2312242_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
ASE66432.1|2312363_2313500_-	undecaprenyl/decaprenyl-phosphate alpha-N-acetylglucosaminyl 1-phosphate transferase	NA	NA	NA	NA	NA
ASE66433.1|2313610_2314519_-	YihY/virulence factor BrkB family protein	NA	NA	NA	NA	NA
ASE66434.1|2314534_2315299_-	type I methionyl aminopeptidase	NA	NA	NA	NA	NA
ASE66435.1|2315473_2315917_+	flavodoxin	NA	NA	NA	NA	NA
AVK72690.1|2315991_2316465_-	tryptophan-rich sensory protein	NA	NA	NA	NA	NA
ASE66436.1|2316622_2317195_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
ASE66437.1|2317445_2318684_+	aminopeptidase	NA	NA	NA	NA	NA
ASE66438.1|2318943_2319324_+	PH domain-containing protein	NA	A6N235	Microbacterium_phage	33.0	2.5e-10
2319423:2319449	attL	TCAGACACATGGCGGCACTTGCTTAGT	NA	NA	NA	NA
ASE66439.1|2319694_2320276_+	DUF4950 domain-containing protein	NA	C9E2L5	Enterococcus_phage	99.5	4.2e-65
ASE66982.2|2320632_2322135_+	hypothetical protein	NA	C9E2L4	Enterococcus_phage	99.6	6.3e-275
ASE66440.1|2322198_2323491_-	peptidase M23	NA	C9E2L3	Enterococcus_phage	100.0	1.3e-252
AVK72691.1|2323552_2323933_-	transcriptional regulator	NA	C9E2L2	Enterococcus_phage	100.0	1.1e-63
ASE66441.1|2323945_2325205_-	LysM peptidoglycan-binding domain-containing protein	NA	A0A0S2MYF3	Enterococcus_phage	93.6	3.7e-228
ASE66442.1|2325210_2325414_-|holin	holin	holin	C9E2L0	Enterococcus_phage	100.0	1.2e-30
ASE66443.1|2325410_2325638_-	hypothetical protein	NA	A0A0S2MYL7	Enterococcus_phage	98.6	1.3e-30
ASE66444.1|2325711_2327475_-	hypothetical protein	NA	C9E2K8	Enterococcus_phage	99.8	1.8e-268
AVK72692.1|2327659_2329675_-	hypothetical protein	NA	C9E2K6	Enterococcus_phage	100.0	0.0e+00
ASE66445.1|2329691_2330621_-|tail	phage tail protein	tail	C9E2K5	Enterococcus_phage	99.4	1.5e-178
ASE66446.1|2330621_2334029_-|tail	phage tail tape measure protein	tail	A0A0S2MYN1	Enterococcus_phage	97.8	0.0e+00
ASE66447.1|2334044_2334302_-	hypothetical protein	NA	A0A097BYA4	Enterococcus_phage	100.0	7.0e-41
ASE66448.1|2334394_2334745_-	hypothetical protein	NA	A0A097BYB6	Enterococcus_phage	100.0	3.3e-57
ASE66449.1|2334800_2335259_-|tail	phage tail protein	tail	C9E2K1	Enterococcus_phage	95.4	4.3e-73
ASE66450.1|2335336_2335867_-|tail	phage major tail protein, TP901-1 family	tail	A0A097BY59	Enterococcus_phage	99.4	4.3e-93
ASE66451.1|2335882_2336272_-|capsid	phage capsid protein	capsid	A0A0S2MYG3	Enterococcus_phage	99.2	8.6e-67
ASE66452.1|2336268_2336649_-	hypothetical protein	NA	A0A0S2MYE9	Enterococcus_phage	99.2	7.9e-65
ASE66453.1|2336623_2336959_-	hypothetical protein	NA	A0A097BYB2	Enterococcus_phage	96.4	7.7e-56
ASE66454.1|2336955_2337288_-	hypothetical protein	NA	A0A097BY55	Enterococcus_phage	100.0	4.2e-54
ASE66455.1|2337361_2338294_-|capsid	phage major capsid protein	capsid	A0A1B1V000	Enterococcus_phage	99.7	8.7e-174
ASE66456.1|2338306_2338906_-	DUF4355 domain-containing protein	NA	A0A097BY91	Enterococcus_phage	98.5	3.5e-75
ASE66457.1|2339100_2339322_-	hypothetical protein	NA	A0A097BYA7	Enterococcus_phage	98.6	1.9e-34
ASE66458.1|2339318_2339588_-	hypothetical protein	NA	A0A097BY49	Enterococcus_phage	98.9	6.4e-45
ASE66459.1|2339588_2340527_-|head	phage head morphogenesis protein	head	A0A097BY50	Enterococcus_phage	98.1	4.5e-170
ASE66460.1|2340531_2342070_-|portal	phage portal protein	portal	A0A097BY86	Enterococcus_phage	99.2	1.8e-285
ASE66461.2|2342083_2343478_-|terminase	terminase	terminase	A0A097BY88	Enterococcus_phage	99.6	1.2e-272
ASE66462.1|2343464_2343938_-|terminase	terminase small subunit	terminase	Q9XJG1	Enterococcus_phage	51.4	7.4e-20
ASE66463.1|2344006_2344651_-	hypothetical protein	NA	NA	NA	NA	NA
ASE66464.1|2344901_2345321_-	transcriptional regulator	NA	NA	NA	NA	NA
ASE66465.1|2345321_2345534_-	hypothetical protein	NA	D2IZL5	Enterococcus_phage	87.7	4.3e-28
ASE66466.1|2345527_2345845_-	replicase	NA	NA	NA	NA	NA
ASE66467.1|2345845_2346349_-	hypothetical protein	NA	A0A0E3T929	Enterococcus_phage	42.7	3.5e-20
ASE66468.1|2346345_2346612_-	hypothetical protein	NA	NA	NA	NA	NA
ASE66469.1|2346608_2346803_-	hypothetical protein	NA	NA	NA	NA	NA
ASE66470.1|2346957_2347356_-	hypothetical protein	NA	D2IZY8	Enterococcus_phage	67.4	2.7e-39
ASE66471.1|2347339_2347519_-	hypothetical protein	NA	D2IZY7	Enterococcus_phage	93.2	6.4e-25
ASE66472.1|2347541_2347748_-	hypothetical protein	NA	A0A1B1V001	Enterococcus_phage	96.8	7.4e-25
ASE66473.1|2347767_2348097_-	hypothetical protein	NA	NA	NA	NA	NA
ASE66474.1|2348109_2348637_-	single-stranded DNA-binding protein	NA	A0A097PAQ3	Streptococcus_pyogenes_phage	54.9	1.2e-42
ASE66475.1|2348626_2348935_-	hypothetical protein	NA	D2IZR4	Enterococcus_phage	90.9	1.6e-44
ASE66476.1|2348934_2349741_-	helix-turn-helix domain-containing protein	NA	A0A2D1GQ66	Lysinibacillus_phage	53.3	2.3e-21
ASE66477.1|2349744_2350386_-	hypothetical protein	NA	U5U4M2	Lactobacillus_phage	35.1	1.8e-29
ASE66478.1|2350382_2351321_-	hypothetical protein	NA	A0A0S2MYB3	Enterococcus_phage	47.8	1.4e-67
ASE66479.1|2351320_2352064_-	single-stranded DNA-binding protein	NA	A0A2H4IYS6	uncultured_Caudovirales_phage	33.2	1.8e-25
ASE66480.1|2352149_2352452_-	hypothetical protein	NA	NA	NA	NA	NA
ASE66482.1|2352611_2352803_+	DUF1508 domain-containing protein	NA	NA	NA	NA	NA
ASE66483.1|2353204_2353663_+	hypothetical protein	NA	NA	NA	NA	NA
ASE66484.1|2353725_2353926_-	hypothetical protein	NA	D2J031	Enterococcus_phage	45.9	1.0e-07
ASE66485.1|2354449_2354974_+	hypothetical protein	NA	NA	NA	NA	NA
ASE66486.1|2355085_2355334_-	hypothetical protein	NA	A0A0S2MYC6	Enterococcus_phage	91.5	2.4e-38
ASE66487.1|2355349_2356069_-	oxidoreductase	NA	C9E2M3	Enterococcus_phage	100.0	4.0e-134
ASE66488.2|2356150_2356384_-	DUF739 domain-containing protein	NA	A0A0S2MYC3	Enterococcus_phage	100.0	7.8e-39
ASE66489.1|2356542_2357115_+	transcriptional regulator	NA	C9E2M1	Enterococcus_phage	100.0	1.1e-99
AVK72693.1|2357089_2357605_+	toxin	NA	A0A0S2MYA6	Enterococcus_phage	100.0	1.0e-86
ASE66490.1|2357692_2358247_+	hypothetical protein	NA	C9E2L9	Enterococcus_phage	99.5	4.3e-96
ASE66491.1|2358288_2358489_+	hypothetical protein	NA	A0A0S2MYA2	Enterococcus_phage	100.0	7.4e-30
ASE66492.1|2358549_2359122_+	hypothetical protein	NA	A0A1B1UZZ9	Enterococcus_phage	97.4	2.2e-82
AVK72694.1|2359188_2360325_+|integrase	site-specific integrase	integrase	A0A0S2MYI6	Enterococcus_phage	99.2	5.4e-210
2360400:2360426	attR	TCAGACACATGGCGGCACTTGCTTAGT	NA	NA	NA	NA
