The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP022086	Escherichia coli O104:H4 strain FDAARGOS_348 chromosome, complete genome	5256950	345172	387606	5256950	head,portal,terminase,lysis,capsid,tail,integrase	Enterobacteria_phage(57.69%)	60	343450:343465	366601:366616
343450:343465	attL	CTGACTGCTGAAGAGC	NA	NA	NA	NA
ASF01262.1|345172_346243_-|integrase	integrase	integrase	Q9MCR4	Enterobacteria_phage	100.0	5.1e-202
ASF01263.1|346220_346439_-	excisionase	NA	Q77WA4	Escherichia_phage	100.0	3.7e-35
ASF01264.1|346478_346646_-	hypothetical protein	NA	A5VWB7	Enterobacteria_phage	98.2	2.9e-27
ASF05753.1|346578_346764_+	hypothetical protein	NA	NA	NA	NA	NA
ASF01265.1|346818_347070_+	hypothetical protein	NA	NA	NA	NA	NA
ASF01266.1|346960_347491_+	hypothetical protein	NA	NA	NA	NA	NA
ASF01267.1|347701_347923_-	conjugal transfer protein TraR	NA	A0A0K2FI84	Escherichia_phage	100.0	2.9e-35
ASF01268.2|348021_348303_-	cell division protein ZapA	NA	A0A0P0ZE02	Stx2-converting_phage	98.9	5.5e-47
ASF01269.1|348313_348505_-	DUF1382 domain-containing protein	NA	A0A0P0ZC67	Stx2-converting_phage	98.4	4.7e-26
ASF01270.1|348477_348660_-	DUF1317 domain-containing protein	NA	A0A0N7CHV0	Escherichia_phage	98.3	1.3e-28
ASF01271.1|348656_349337_-	exonuclease	NA	B6DZ61	Enterobacteria_phage	98.2	5.1e-131
ASF01272.1|349333_350119_-	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
ASF01273.1|350124_350421_-	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	99.0	6.2e-49
ASF01274.1|350496_350703_-	cell division inhibitor protein	NA	K7P6H3	Enterobacteria_phage	85.3	3.2e-28
ASF01275.1|351300_352053_-	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	75.0	1.4e-92
ASF01276.1|352095_352326_+	transcriptional regulator	NA	A0A2H4FNF3	Salmonella_phage	68.0	1.5e-21
ASF01277.1|352395_352935_+	regulator	NA	M9NZI6	Enterobacteria_phage	66.1	1.2e-61
ASF01278.1|352931_353951_+	Replication protein O	NA	A0A0M5M7Y1	Salmonella_phage	63.4	9.7e-110
ASF01279.1|353947_354649_+	Replication protein P	NA	M1FJ72	Enterobacteria_phage	98.7	1.4e-128
ASF01280.1|354645_354948_+	protein ren	NA	M1FPD5	Enterobacteria_phage	97.8	6.1e-44
ASF01282.1|355193_355988_+	recombinase	NA	A0A2K9V406	Faecalibacterium_phage	28.9	7.5e-09
ASF01283.1|356099_356339_+	hypothetical protein	NA	NA	NA	NA	NA
ASF01284.1|356657_357167_+	hypothetical protein	NA	NA	NA	NA	NA
ASF01285.1|357263_357365_+	hypothetical protein	NA	NA	NA	NA	NA
ASF01286.1|357361_357817_+	hypothetical protein	NA	I6PD71	Cronobacter_phage	67.5	4.9e-61
ASF01287.1|357816_357987_+	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	69.8	1.4e-13
ASF01288.1|357979_358270_+	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	92.7	2.8e-46
ASF01289.1|358624_358765_+	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	69.8	6.5e-09
ASF01290.1|358850_359234_+	antitermination protein Q	NA	A0A088CD47	Shigella_phage	83.3	4.4e-55
ASF01291.1|359422_360505_-	porin OmpD	NA	Q1MVN1	Enterobacteria_phage	78.7	4.4e-161
ASF01292.1|361093_361309_+|lysis	lysis protein S	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
ASF01293.1|361308_361806_+	lysozyme	NA	M1FJA0	Enterobacteria_phage	97.6	3.2e-90
ASF01294.1|361802_362240_+|lysis	lysis protein	lysis	K7P710	Enterobacteria_phage	94.5	3.0e-68
ASF01295.1|362444_362966_+	DNA-binding protein	NA	K7P7K9	Enterobacteria_phage	100.0	1.5e-93
ASF01296.1|363105_363270_-	hypothetical protein	NA	NA	NA	NA	NA
ASF01297.2|363315_363726_-	hypothetical protein	NA	C6ZCX4	Enterobacteria_phage	76.3	1.3e-52
ASF01298.1|363782_364016_-	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	94.4	7.3e-21
ASF01299.1|364121_364265_+	DNA-packaging protein	NA	NA	NA	NA	NA
ASF01300.1|364404_364950_+|terminase	terminase small subunit	terminase	A0A0K2FIG2	Enterobacteria_phage	100.0	2.8e-95
ASF01302.1|366845_367052_+|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
366601:366616	attR	CTGACTGCTGAAGAGC	NA	NA	NA	NA
ASF01303.1|367048_368650_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	99.8	1.2e-311
ASF01304.1|368630_369950_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	97.7	1.4e-230
ASF01305.1|369959_370292_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	100.0	1.7e-55
ASF01306.1|370347_371373_+|capsid	minor capsid protein E	capsid	C6ZCY2	Enterobacteria_phage	97.9	4.7e-189
ASF01307.1|371414_371810_+	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	95.5	1.1e-58
ASF01308.1|371821_372175_+|tail	phage tail protein	tail	A0A2R9YJJ5	Escherichia_phage	97.4	6.4e-61
AVL26729.1|372186_372765_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.5	5.9e-80
ASF01309.1|372761_373157_+|tail	phage tail protein	tail	A0A2R9YJI2	Escherichia_phage	98.5	8.5e-70
ASF01310.2|373164_373905_+|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	97.2	6.8e-129
ASF01311.1|373920_374343_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	85.0	1.4e-59
ASF01312.1|374324_374759_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
ASF01313.1|374751_377313_+|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	97.8	0.0e+00
ASF01314.1|377309_377639_+|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	100.0	9.6e-59
ASF01315.1|377638_378337_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	98.3	4.7e-132
ASF01316.1|378342_379086_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.8	2.1e-146
ASF01317.1|378983_379655_+|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	100.0	8.1e-105
ASF01318.1|379715_383213_+	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	97.6	0.0e+00
ASF01319.1|383283_383883_+	Ail/Lom family protein	NA	A5LH44	Enterobacteria_phage	97.5	8.2e-109
ASF05754.1|383947_387022_+|tail	phage tail protein	tail	U5N099	Enterobacteria_phage	82.1	2.5e-68
ASF01320.1|387021_387606_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	95.4	9.2e-105
>prophage 2
CP022086	Escherichia coli O104:H4 strain FDAARGOS_348 chromosome, complete genome	5256950	652531	716579	5256950	bacteriocin,portal,terminase,lysis,capsid,tail,holin	Escherichia_phage(90.79%)	78	NA	NA
ASF01550.1|652531_653842_-	DUF3596 domain-containing protein	NA	A0A0P0ZGT7	Escherichia_phage	100.0	2.4e-254
ASF01551.1|653894_654179_-	DNA-binding protein	NA	A0A0P0ZGY2	Escherichia_phage	100.0	7.0e-50
ASF01552.1|654224_654476_-	DUF4222 domain-containing protein	NA	G3CFG8	Escherichia_phage	100.0	2.9e-39
ASF01553.1|654839_655220_-	DUF1627 domain-containing protein	NA	A0A0P0ZFT6	Escherichia_phage	100.0	1.2e-52
ASF01554.1|655255_655468_-	DUF1382 domain-containing protein	NA	A0A0P0ZGA1	Escherichia_phage	100.0	7.1e-31
ASF01555.1|655427_656054_-	adenine methylase	NA	G9L6F9	Escherichia_phage	100.0	1.8e-122
ASF01556.1|656050_656482_-	regulator	NA	A0A2R2Z303	Escherichia_phage	100.0	7.3e-75
ASF01557.1|656537_657167_-	phage antirepressor Ant	NA	G9L6G1	Escherichia_phage	100.0	2.3e-117
ASF01558.1|657416_657701_-	phage antirepressor Ant	NA	G9L6G2	Escherichia_phage	100.0	4.1e-50
ASF01559.1|658056_658953_-	DUF551 domain-containing protein	NA	A0A0N7KZV3	Escherichia_phage	100.0	5.4e-173
ASF01560.1|658955_659147_-	hypothetical protein	NA	A0A0P0ZG45	Escherichia_phage	100.0	3.3e-27
ASF01561.1|659148_659556_-	hypothetical protein	NA	A0A125RPT9	Escherichia_phage	100.0	1.3e-70
ASF01562.1|659552_660278_-	hypothetical protein	NA	A0A0P0ZFU9	Escherichia_phage	100.0	3.3e-128
ASF01563.1|660428_660824_-	hypothetical protein	NA	A0A0P0ZG44	Escherichia_phage	100.0	1.1e-69
ASF01564.1|660900_661722_-	DUF2303 domain-containing protein	NA	A0A2R2Z323	Escherichia_phage	100.0	2.3e-149
ASF01565.1|661785_662133_-	hypothetical protein	NA	A0A0P0ZGH3	Escherichia_phage	100.0	5.9e-59
ASF01566.1|662207_662795_-	DUF669 domain-containing protein	NA	A0A0N7KZV4	Escherichia_phage	100.0	1.2e-107
ASF01567.1|662794_663484_-	exonuclease	NA	A0A0P0ZFI7	Escherichia_phage	100.0	3.5e-135
ASF01568.1|663480_664431_-	recombinase RecT	NA	A0A0P0ZFY9	Escherichia_phage	100.0	1.1e-179
ASF01569.1|664447_664729_-	host nuclease inhibitor GamL	NA	A0A0P0ZFG3	Escherichia_phage	100.0	1.1e-47
ASF01570.1|664749_665031_-	AbrB family transcriptional regulator	NA	A0A0P0ZGC3	Escherichia_phage	100.0	3.0e-45
ASF01571.1|665042_665255_-	cell division inhibitor protein	NA	A0A0P0ZGD1	Escherichia_phage	100.0	5.8e-33
ASF01572.1|665325_666000_-	hypothetical protein	NA	A0A0P0ZGP9	Escherichia_phage	100.0	1.3e-123
ASF01573.1|666155_666350_+	hypothetical protein	NA	A0A0N7KZV5	Escherichia_phage	100.0	1.3e-31
ASF05764.1|666255_666903_-	hypothetical protein	NA	A0A0P0ZGC2	Escherichia_phage	100.0	9.5e-119
ASF01574.1|667658_668612_-	restriction endonuclease	NA	A0A0P0ZG22	Escherichia_phage	100.0	7.0e-187
ASF01575.1|668608_670078_-	SAM-dependent methyltransferase	NA	A0A2R2Z316	Escherichia_phage	100.0	3.5e-286
ASF01576.1|670172_670886_-	LexA family transcriptional repressor	NA	A0A2R2X2B0	Escherichia_phage	100.0	6.3e-132
ASF01577.1|670981_671185_+	Cro/Cl family transcriptional regulator	NA	A0A2R2Z333	Escherichia_phage	100.0	2.0e-30
ASF01578.1|671355_671550_+	hypothetical protein	NA	NA	NA	NA	NA
ASF01579.1|671716_672094_+	hypothetical protein	NA	A0A2R2Z329	Escherichia_phage	100.0	4.0e-61
AVL26735.1|672087_673608_+	ATP-dependent helicase	NA	A0A0N7KZV6	Escherichia_phage	100.0	1.4e-306
ASF01580.1|673597_674569_+	DNA primase	NA	A0A0P0ZFY3	Escherichia_phage	100.0	6.5e-196
ASF01581.1|674568_675018_+	DUF1367 domain-containing protein	NA	A0A0P0ZFW0	Escherichia_phage	100.0	7.6e-83
ASF01582.1|675025_675589_+	recombination protein NinG	NA	A0A0P0ZG59	Escherichia_phage	100.0	8.9e-105
ASF01583.1|675585_675780_+	protein ninH	NA	A0A0P0ZGE1	Escherichia_phage	100.0	8.4e-31
AVL26736.1|675772_676207_+	antitermination protein	NA	A0A0P0ZGJ3	Escherichia_phage	100.0	4.8e-82
ASF01584.1|676195_676441_-	hypothetical protein	NA	A0A0P0ZGS0	Escherichia_phage	100.0	5.0e-36
ASF01585.1|676455_676608_+	DNA methylase	NA	A0A2R2Z327	Escherichia_phage	100.0	4.0e-20
ASF01586.1|676990_677950_+	Shiga toxin Stx2 subunit A	NA	Q776Q3	Enterobacteria_phage	100.0	5.6e-176
ASF01587.1|677961_678231_+	Shiga toxin Stx2 subunit B	NA	A0A2R2Z326	Escherichia_phage	100.0	1.2e-43
ASF01588.1|678716_680654_+	DUF1737 domain-containing protein	NA	A0A0P0ZGW7	Escherichia_phage	100.0	0.0e+00
ASF01589.1|680790_680970_+	DUF1378 domain-containing protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
ASF01590.1|681010_681256_+	DUF826 domain-containing protein	NA	A0A0P0ZGR2	Escherichia_phage	100.0	8.8e-17
ASF01591.1|681333_681549_+|holin	holin	holin	A0A0P0ZFW5	Escherichia_phage	100.0	9.0e-34
ASF01592.1|681553_682087_+	lysozyme	NA	V5USG4	Shigella_phage	100.0	7.9e-103
ASF01593.1|682361_682931_+	hypothetical protein	NA	A0A2R2Z339	Escherichia_phage	100.0	1.8e-105
ASF01594.1|683087_683552_+|lysis	lysis protein	lysis	A0A2R2Z341	Escherichia_phage	100.0	5.8e-78
ASF01595.1|683583_683877_-	lipoprotein bor	NA	A0A2R2X2B2	Escherichia_phage	100.0	6.8e-48
ASF01596.1|683984_684230_+	hypothetical protein	NA	A0A2R2Z338	Escherichia_phage	100.0	8.4e-44
ASF01597.1|684285_685092_+|terminase	terminase	terminase	A0A2R2Z334	Escherichia_phage	100.0	7.6e-134
ASF01598.1|685072_686779_+|terminase	terminase	terminase	A0A2R2Z350	Escherichia_phage	100.0	0.0e+00
ASF01599.1|686778_688923_+|portal	portal protein	portal	A0A0P0ZGR1	Escherichia_phage	100.0	0.0e+00
ASF01600.1|689080_690088_+	hypothetical protein	NA	A0A0P0ZGF7	Escherichia_phage	100.0	2.3e-180
ASF01601.1|690111_691326_+|capsid	N4-gp56 family major capsid protein	capsid	A0A0N7KZY1	Escherichia_phage	100.0	1.7e-233
ASF01602.1|691380_691770_+	hypothetical protein	NA	A0A0P0ZFT7	Escherichia_phage	100.0	3.8e-62
ASF01603.1|691820_692282_+	hypothetical protein	NA	A0A2R2Z354	Escherichia_phage	100.0	7.8e-75
ASF01604.1|692265_692829_+	hypothetical protein	NA	A0A0P0ZGG2	Escherichia_phage	100.0	4.1e-102
ASF01605.1|692828_693479_+	hypothetical protein	NA	A0A0P0ZG46	Escherichia_phage	100.0	4.6e-121
ASF01606.1|693475_696067_+|tail	phage tail protein	tail	A0A0P0ZGL7	Escherichia_phage	100.0	6.1e-209
AVL26737.1|696153_696666_+	hypothetical protein	NA	A0A0P0ZFL3	Escherichia_phage	100.0	1.2e-92
ASF05765.1|696899_698525_+	hypothetical protein	NA	A0A0P0ZG99	Escherichia_phage	100.0	0.0e+00
ASF01607.1|698521_699790_+	host specificity protein J	NA	A0A2R2Z364	Escherichia_phage	100.0	4.9e-220
ASF01608.1|699804_700083_+	hypothetical protein	NA	A0A088CD71	Shigella_phage	100.0	1.1e-50
AVL26738.1|700088_700706_+	hypothetical protein	NA	A0A2R2Z362	Escherichia_phage	100.0	1.1e-121
ASF01609.1|700796_701531_+	hypothetical protein	NA	A0A0P0ZH34	Escherichia_phage	100.0	9.7e-136
ASF01610.1|701761_701902_+	Hok/Gef family protein	NA	A0A2R2X2B4	Escherichia_phage	100.0	3.1e-19
ASF01611.1|701958_702360_+	hypothetical protein	NA	A0A088CC37	Shigella_phage	100.0	1.2e-71
ASF01612.1|702454_703111_+	hypothetical protein	NA	A0A0P0ZGF6	Escherichia_phage	100.0	5.1e-104
ASF01613.1|703113_703560_+	hypothetical protein	NA	A0A2R2Z357	Escherichia_phage	100.0	6.2e-77
ASF01614.1|703569_703821_+|bacteriocin	bacteriocin	bacteriocin	A0A2R2Z351	Escherichia_phage	100.0	7.9e-13
ASF01615.1|703831_705097_+	hypothetical protein	NA	A0A0P0ZFI5	Escherichia_phage	100.0	2.4e-206
AVL26739.1|705166_713548_+	hypothetical protein	NA	A0A0P0ZGX9	Escherichia_phage	100.0	0.0e+00
ASF01617.1|713885_714113_+	hypothetical protein	NA	Q7Y2P9	Escherichia_phage	92.7	2.0e-23
ASF01618.1|714316_714547_+	hypothetical protein	NA	NA	NA	NA	NA
ASF01619.1|714479_714653_+	stress-induced protein	NA	Q9KX95	Enterobacteria_phage	96.3	4.9e-06
ASF01620.1|714735_716064_-	transporter	NA	Q9KX94	Enterobacteria_phage	99.1	3.7e-234
ASF01621.1|716084_716579_-	FMN reductase	NA	Q9KX93	Enterobacteria_phage	96.9	1.1e-50
>prophage 3
CP022086	Escherichia coli O104:H4 strain FDAARGOS_348 chromosome, complete genome	5256950	1031492	1092962	5256950	protease,head,portal,terminase,lysis,capsid,tail,integrase,holin	Enterobacteria_phage(42.31%)	80	1027308:1027322	1048247:1048261
1027308:1027322	attL	AAACAAGAACACGGT	NA	NA	NA	NA
ASF01916.1|1031492_1032623_-|integrase	integrase	integrase	O21940	Phage_21	51.4	4.4e-103
ASF01917.1|1032600_1032849_-	excisionase	NA	NA	NA	NA	NA
ASF01918.1|1032913_1035385_-	exonuclease	NA	K7PLW7	Enterobacteria_phage	59.2	1.8e-56
ASF01919.1|1035477_1035669_-	DUF1482 domain-containing protein	NA	NA	NA	NA	NA
ASF01920.1|1035665_1035854_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
ASF05788.1|1036203_1036419_+	hypothetical protein	NA	NA	NA	NA	NA
ASF01921.2|1036348_1036615_+	hypothetical protein	NA	NA	NA	NA	NA
ASF01922.1|1036603_1036942_-	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	51.0	2.5e-06
ASF05789.1|1036953_1037106_-	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	55.3	6.0e-08
ASF01923.1|1037402_1037822_-	transcriptional regulator	NA	A0A2I6PIE7	Escherichia_phage	47.5	4.2e-19
ASF01924.1|1037901_1038156_+	hypothetical protein	NA	A0A2I6PIE5	Escherichia_phage	60.3	2.8e-18
ASF01925.1|1038152_1038578_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
ASF05790.1|1038600_1039563_+	DNA-binding protein	NA	U5P0A0	Shigella_phage	51.2	2.1e-69
ASF01926.1|1039603_1040029_+	hypothetical protein	NA	A0A0U2QQN3	Escherichia_phage	94.0	1.3e-63
ASF01927.1|1040203_1040869_+	hypothetical protein	NA	NA	NA	NA	NA
ASF01928.1|1041049_1041262_+	Hok/Gef family protein	NA	A0A0U2QV81	Escherichia_phage	90.0	5.2e-26
ASF01929.1|1041303_1041483_-	hypothetical protein	NA	NA	NA	NA	NA
ASF01930.1|1041429_1041702_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	49.2	5.5e-12
ASF01931.1|1041703_1042750_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	55.0	5.9e-110
ASF01932.1|1042762_1043137_+	hypothetical protein	NA	V5URS4	Shigella_phage	63.6	5.8e-36
ASF01933.1|1043133_1043955_+	antitermination protein	NA	K7P7B9	Enterobacteria_phage	60.1	8.5e-80
ASF01934.1|1044181_1044379_+	TrmB family transcriptional regulator	NA	Q9MC00	Enterobacteria_phage	96.9	1.4e-28
ASF01935.1|1044529_1045579_+	site-specific DNA-methyltransferase	NA	A0A0N7KZF8	Stx2-converting_phage	95.7	8.8e-199
ASF01936.1|1046015_1046342_+	hypothetical protein	NA	NA	NA	NA	NA
AVL26749.1|1046377_1046509_+	DUF3927 domain-containing protein	NA	H6WZJ7	Escherichia_phage	96.4	1.1e-05
ASF01937.1|1046789_1047125_-	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	74.8	5.2e-44
ASF01938.1|1047385_1049239_+	9-O-acetyl-N-acetylneuraminic acid deacetylase	NA	Q08JA2	Stx2-converting_phage	90.5	0.0e+00
1048247:1048261	attR	AAACAAGAACACGGT	NA	NA	NA	NA
AVL26750.1|1049389_1049605_+|holin	holin	holin	G9L6J5	Escherichia_phage	100.0	9.0e-34
ASF05791.1|1049609_1050416_+	hypothetical protein	NA	Q08JA0	Stx2-converting_phage	94.8	3.3e-145
ASF01939.1|1050458_1050992_+	lysozyme	NA	Q6H9V6	Enterobacteria_phage	97.2	8.7e-102
ASF01940.1|1051069_1051282_+	hypothetical protein	NA	A0A0M4S639	Salmonella_phage	60.5	2.7e-06
ASF05792.1|1051546_1051633_+	hypothetical protein	NA	NA	NA	NA	NA
ASF01941.1|1051634_1052102_+|lysis	lysis protein	lysis	Q9AZ06	Salmonella_phage	81.5	2.6e-62
ASF01942.1|1052089_1052242_+	hypothetical protein	NA	K7PKL2	Enterobacteria_phage	98.0	2.8e-21
ASF01943.1|1052320_1052608_+	hypothetical protein	NA	A0A1P8DTP0	Salmonella_phage	58.9	4.0e-29
ASF01944.1|1052701_1052926_+	hypothetical protein	NA	NA	NA	NA	NA
AVL26751.1|1053061_1053466_+	hypothetical protein	NA	NA	NA	NA	NA
ASF05793.1|1053593_1053785_+	DNA-packaging protein	NA	NA	NA	NA	NA
ASF01945.1|1053866_1054415_+|terminase	terminase small subunit	terminase	A0A0U2S671	Escherichia_phage	84.2	1.0e-57
AVL26752.1|1054344_1056315_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	67.5	1.6e-262
ASF01946.1|1056298_1056505_+|tail	phage tail protein	tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
ASF01947.1|1056501_1058094_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	61.1	3.8e-185
ASF01948.1|1058083_1059589_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	52.8	3.0e-99
ASF01949.1|1059625_1059973_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	58.1	8.9e-23
ASF01950.1|1060030_1061059_+|capsid	minor capsid protein E	capsid	C6ZCY2	Enterobacteria_phage	60.4	2.8e-112
ASF01951.1|1061110_1061479_+	hypothetical protein	NA	NA	NA	NA	NA
AVL26753.1|1061471_1061825_+|tail	phage tail protein	tail	A0A0K2FJB7	Enterobacteria_phage	70.1	3.0e-42
ASF01952.1|1061839_1062415_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	57.3	9.2e-49
ASF01953.1|1062411_1062807_+|tail	phage tail protein	tail	A0A2R9YJI2	Escherichia_phage	82.4	1.5e-58
ASF01954.1|1062814_1063567_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	97.6	6.7e-132
ASF01955.1|1063580_1064012_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.8	6.2e-42
ASF01956.1|1064038_1064452_+|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
ASF01957.1|1064432_1067006_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	83.9	0.0e+00
ASF01958.1|1067002_1067332_+|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	100.0	9.6e-59
ASF01959.1|1067331_1068030_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	97.4	3.4e-130
ASF01960.1|1068034_1068778_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	94.7	1.8e-145
ASF01961.1|1068675_1069317_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	86.0	8.6e-96
AVL26754.1|1069449_1069635_-	hypothetical protein	NA	NA	NA	NA	NA
ASF01962.1|1069795_1073275_+	host specificity protein J	NA	A5LH43	Enterobacteria_phage	89.6	0.0e+00
ASF01963.1|1073342_1073942_+	Ail/Lom family protein	NA	Q9EV15	Enterobacteria_phage	97.0	9.1e-108
ASF01964.1|1074093_1076928_+|tail	phage tail protein	tail	X2KTY7	Enterobacteria_phage	59.1	5.7e-83
ASF01965.1|1076927_1077512_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	95.4	1.7e-103
ASF01966.1|1077484_1077622_+|capsid	nucleocapsid protein	capsid	NA	NA	NA	NA
ASF05794.2|1077566_1078193_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
ASF01967.1|1078291_1078561_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	77.8	2.7e-19
ASF01969.1|1079334_1079841_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
ASF01970.1|1079886_1080387_-	YciE/YciF family protein	NA	NA	NA	NA	NA
ASF01971.1|1080472_1080652_-	hypothetical protein	NA	NA	NA	NA	NA
ASF01972.1|1081032_1081839_-	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
ASF01973.1|1081838_1083032_-	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
ASF05795.1|1083043_1084402_-	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	40.7	8.6e-37
ASF01974.1|1084405_1086001_-	bifunctional glutamine amidotransferase/anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	38.5	3.8e-52
ASF01975.1|1086000_1087563_-	anthranilate synthase component I	NA	NA	NA	NA	NA
AVL26901.1|1087654_1087699_-	trp operon leader peptide	NA	NA	NA	NA	NA
ASF01976.1|1087836_1088718_+	phosphatase	NA	NA	NA	NA	NA
ASF01977.1|1088714_1089335_+	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
ASF01978.1|1089435_1090308_+	23S rRNA pseudouridylate synthase B	NA	NA	NA	NA	NA
ASF01979.1|1090347_1090938_-	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
ASF01980.1|1090934_1091693_-	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.4	8.8e-07
ASF01981.1|1091912_1092962_+|protease	protease	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
>prophage 4
CP022086	Escherichia coli O104:H4 strain FDAARGOS_348 chromosome, complete genome	5256950	1382785	1449757	5256950	bacteriocin,portal,terminase,capsid,lysis,tail,integrase,holin	Escherichia_phage(43.42%)	84	1425248:1425265	1453298:1453315
ASF02234.1|1382785_1385212_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.1	2.3e-213
ASF05805.1|1385272_1387696_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.6	9.8e-209
ASF02235.1|1387706_1387820_+	dimethylsulfoxide reductase	NA	A0A077SL61	Escherichia_phage	72.0	2.1e-05
ASF02236.1|1388227_1388863_+	phage antirepressor Ant	NA	A0A088CBR4	Shigella_phage	81.0	2.8e-91
ASF02237.1|1388910_1389132_+	conjugal transfer protein TraR	NA	V5USD3	Shigella_phage	98.6	2.9e-35
ASF02238.1|1389128_1389413_+	DUF4752 domain-containing protein	NA	A0A088CD82	Shigella_phage	98.9	6.1e-46
ASF02239.1|1389399_1390236_+	hypothetical protein	NA	A0A2I6TD51	Escherichia_phage	87.7	6.1e-126
ASF05806.1|1390465_1390753_+	hypothetical protein	NA	A0A0P0ZBM8	Stx2-converting_phage	100.0	9.5e-55
ASF02240.1|1390749_1391253_+	DUF551 domain-containing protein	NA	V5UT79	Shigella_phage	98.2	2.6e-95
ASF02241.1|1391254_1391530_-	hypothetical protein	NA	A0A088CD78	Shigella_phage	89.3	4.0e-18
ASF02242.1|1391653_1400005_-	hypothetical protein	NA	Q08J70	Stx2-converting_phage	95.8	0.0e+00
ASF02243.1|1400073_1401339_-	hypothetical protein	NA	A0A2L1IV65	Escherichia_phage	95.0	1.5e-192
ASF02244.1|1401349_1401601_-|bacteriocin	bacteriocin	bacteriocin	A0A0P0ZDW9	Stx2-converting_phage	97.5	7.9e-13
ASF02245.1|1401610_1402057_-	hypothetical protein	NA	A0A2L1IV89	Escherichia_phage	100.0	4.0e-76
ASF02246.1|1402059_1402716_-	hypothetical protein	NA	A0A0H4IPM7	Shigella_phage	99.1	7.4e-103
ASF02247.1|1402807_1403209_-	hypothetical protein	NA	Q08J75	Stx2-converting_phage	98.5	5.0e-70
ASF02248.1|1403265_1403406_-	Hok/Gef family protein	NA	A0A2R2X2B4	Escherichia_phage	97.8	2.0e-18
ASF02249.1|1403485_1403710_+	hypothetical protein	NA	Q7Y2U2	Escherichia_phage	78.8	5.4e-21
AVL26761.1|1403640_1404378_-	hypothetical protein	NA	A0A2L1IV31	Escherichia_phage	80.8	1.2e-109
ASF02250.1|1404457_1405075_-	hypothetical protein	NA	A0A2L1IV83	Escherichia_phage	98.0	6.3e-120
ASF02251.1|1405080_1405359_-	outer membrane protein	NA	A0A2L1IV69	Escherichia_phage	100.0	2.6e-49
ASF02252.1|1405373_1406642_-	host specificity protein J	NA	A0A0N7C124	Escherichia_phage	94.3	1.6e-218
AVL26762.1|1406638_1408264_-	hypothetical protein	NA	A0A1I9LJT3	Stx_converting_phage	96.7	0.0e+00
ASF02253.1|1408604_1408832_-	hypothetical protein	NA	A0A088CBQ7	Shigella_phage	98.7	2.6e-39
ASF02254.1|1408844_1409390_-	hypothetical protein	NA	A0A088CD67	Shigella_phage	99.4	2.0e-93
ASF02255.1|1409472_1411380_-|tail	phage tail protein	tail	V5USF3	Shigella_phage	66.0	4.2e-82
ASF02256.1|1411376_1412027_-	hypothetical protein	NA	A0A2L1IV63	Escherichia_phage	99.1	1.5e-119
ASF02257.1|1412026_1412590_-	hypothetical protein	NA	A0A2L1IV64	Escherichia_phage	99.5	8.3e-103
ASF02258.1|1412573_1413035_-	hypothetical protein	NA	A0A2L1IV43	Escherichia_phage	99.3	6.9e-71
ASF02259.1|1413085_1413475_-	hypothetical protein	NA	V5UT93	Shigella_phage	97.7	1.9e-61
AVL26763.1|1413529_1414744_-|capsid	N4-gp56 family major capsid protein	capsid	A0A2L1IV46	Escherichia_phage	99.0	1.8e-232
AVL26764.1|1414766_1415774_-	hypothetical protein	NA	A0A2L1IV47	Escherichia_phage	93.4	1.2e-168
ASF02260.1|1415931_1418076_-|portal	portal protein	portal	A0A088CE71	Shigella_phage	99.6	0.0e+00
ASF02261.1|1418075_1419782_-|terminase	terminase	terminase	A0A2L1IV76	Escherichia_phage	99.1	0.0e+00
ASF02262.1|1419762_1420578_-|terminase	terminase	terminase	A0A2L1IV66	Escherichia_phage	99.6	6.6e-125
ASF02263.2|1421180_1421762_+	histidine phosphatase family protein	NA	A0A2L1IV13	Escherichia_phage	100.0	6.7e-47
ASF05808.1|1421895_1422081_-|lysis	lysis protein	lysis	A0A0P0ZDR7	Stx2-converting_phage	96.7	2.8e-23
ASF02264.1|1422302_1422416_-	hypothetical protein	NA	A0A2L1IV24	Escherichia_phage	100.0	6.6e-12
ASF02265.1|1422636_1423170_-	lysozyme	NA	A0A088CC28	Shigella_phage	91.5	5.6e-93
ASF02266.1|1423174_1423390_-|holin	holin	holin	Q9ZWW2	Enterobacteria_phage	100.0	6.9e-34
ASF02267.1|1423466_1423712_-	DUF826 domain-containing protein	NA	S5MW40	Escherichia_phage	87.7	1.1e-14
ASF02268.1|1423737_1423920_-	DUF1378 domain-containing protein	NA	S5MBZ5	Escherichia_phage	91.7	1.6e-23
ASF02269.1|1424058_1425969_-	DUF1737 domain-containing protein	NA	A0A0N7CGH9	Escherichia_phage	74.8	6.4e-280
1425248:1425265	attL	AACAGCACATTTTTCGGG	NA	NA	NA	NA
ASF02270.1|1426500_1426746_+	hypothetical protein	NA	Q7Y2J1	Escherichia_phage	93.8	1.3e-31
AVL26765.1|1426734_1427169_-	antitermination protein	NA	G9L695	Escherichia_phage	98.6	2.4e-81
ASF02271.1|1427161_1427356_-	protein ninH	NA	A0A088CC23	Shigella_phage	100.0	1.4e-30
ASF02272.1|1427355_1427718_-	hypothetical protein	NA	A0A088CBJ1	Shigella_phage	98.3	9.2e-63
ASF02273.1|1427714_1428005_-	DUF1364 domain-containing protein	NA	A0A088CE53	Shigella_phage	96.9	9.3e-50
ASF02274.1|1428028_1428220_-	NinE family protein	NA	A0A0P0ZDL7	Stx2-converting_phage	87.7	8.9e-25
ASF02275.1|1428216_1428627_-	recombination protein NinB	NA	A0A088CBP6	Shigella_phage	98.5	3.9e-70
ASF02276.1|1428681_1429353_-	hypothetical protein	NA	A0A088CD42	Shigella_phage	82.6	9.0e-96
ASF02277.1|1430059_1430377_+	transcriptional regulator	NA	NA	NA	NA	NA
ASF02278.1|1430427_1430913_-	type II toxin-antitoxin system death-on-curing family toxin	NA	NA	NA	NA	NA
ASF02279.1|1430931_1431111_-	hypothetical protein	NA	NA	NA	NA	NA
ASF02280.1|1431320_1431533_-	Hok/Gef family protein	NA	A0A0U2QV81	Escherichia_phage	62.9	8.4e-16
ASF02281.1|1431577_1431733_+	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	81.1	4.2e-09
ASF02282.1|1431721_1431826_-	hypothetical protein	NA	NA	NA	NA	NA
ASF02283.1|1431941_1432526_-	DUF551 domain-containing protein	NA	A0A0P0ZD75	Stx2-converting_phage	83.5	5.5e-33
ASF02284.1|1432582_1432978_-	DUF977 domain-containing protein	NA	A0A0U2QQN3	Escherichia_phage	52.9	2.0e-31
ASF02285.1|1432993_1433764_-	DUF1627 domain-containing protein	NA	A0A088CE47	Shigella_phage	82.4	8.1e-109
ASF02286.1|1433789_1434530_-	DNA replication protein DnaC	NA	A0A088CBP4	Shigella_phage	87.4	2.3e-121
ASF02287.1|1434536_1435619_-	DNA-binding protein	NA	V5URT9	Shigella_phage	96.4	2.8e-200
ASF02288.1|1435639_1435858_-	hypothetical protein	NA	A0A088CC17	Shigella_phage	100.0	1.1e-21
ASF02289.1|1435872_1436169_-	hypothetical protein	NA	A0A088CBI6	Shigella_phage	98.0	3.4e-47
ASF02290.1|1436307_1436508_-	hypothetical protein	NA	A4KWT7	Enterobacteria_phage	97.0	1.3e-29
ASF02291.1|1436608_1437322_+	LexA family transcriptional repressor	NA	A4KWV9	Enterobacteria_phage	99.6	4.1e-131
ASF02292.1|1437368_1437911_+	hypothetical protein	NA	NA	NA	NA	NA
ASF02293.1|1437898_1438675_+	DUF1828 domain-containing protein	NA	NA	NA	NA	NA
ASF02294.1|1439169_1439553_+	antitermination protein	NA	G9L671	Escherichia_phage	99.2	6.7e-64
AVL26766.1|1439964_1440270_+	hypothetical protein	NA	A0A088CC14	Shigella_phage	98.0	2.5e-45
ASF02296.1|1440301_1440661_+	hypothetical protein	NA	A0A088CBI5	Shigella_phage	72.6	2.3e-37
ASF02297.1|1440629_1440839_-	hypothetical protein	NA	NA	NA	NA	NA
ASF02298.1|1441295_1441517_+	cell division protein FtsZ	NA	A0A0U2RTC4	Escherichia_phage	94.4	1.1e-34
ASF02299.1|1441600_1441987_+	hypothetical protein	NA	V5USC5	Shigella_phage	78.9	9.5e-50
ASF02300.1|1442094_1444167_+	exodeoxyribonuclease VIII	NA	V5UQJ3	Shigella_phage	87.4	0.0e+00
ASF02301.1|1444163_1444460_+	host-nuclease inhibitor protein Gam	NA	V5URU8	Shigella_phage	93.9	5.8e-47
ASF02302.1|1444465_1445251_+	phage recombination protein Bet	NA	A0A088CBI3	Shigella_phage	97.3	9.4e-145
ASF02303.1|1445247_1445928_+	exonuclease	NA	A0A0P0ZBV6	Stx2-converting_phage	98.2	1.5e-130
ASF02304.1|1445975_1446227_+	DUF4222 domain-containing protein	NA	A0A088CBN9	Shigella_phage	100.0	1.3e-39
ASF02305.1|1446261_1446633_+	DNA-binding protein	NA	B9UDM0	Salmonella_phage	74.8	7.8e-41
ASF02306.1|1446488_1447652_+|integrase	site-specific integrase	integrase	A0A088CD23	Shigella_phage	99.7	3.8e-227
ASF02307.1|1447689_1448244_+	dimethylsulfoxide reductase, chain B	NA	A0A077SL61	Escherichia_phage	57.7	1.4e-62
ASF02308.1|1448245_1449100_+	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
ASF02309.1|1449142_1449757_+	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	36.3	8.7e-29
1453298:1453315	attR	AACAGCACATTTTTCGGG	NA	NA	NA	NA
>prophage 5
CP022086	Escherichia coli O104:H4 strain FDAARGOS_348 chromosome, complete genome	5256950	1577162	1623539	5256950	portal,terminase,capsid,tail,plate,integrase,tRNA,holin	Enterobacteria_phage(82.61%)	60	1573155:1573171	1624163:1624179
1573155:1573171	attL	GAGCTGGCGCGCAAATT	NA	NA	NA	NA
ASF02425.1|1577162_1577912_-	vitamin B12 import ATP-binding protein BtuD	NA	A0A2R8FG22	Brazilian_cedratvirus	28.2	9.3e-09
ASF02426.1|1577911_1578463_-	glutathione peroxidase	NA	NA	NA	NA	NA
ASF02427.1|1578525_1579506_-	vitamin B12 import system permease BtuC	NA	NA	NA	NA	NA
ASF02428.1|1579695_1580091_-	hypothetical protein	NA	NA	NA	NA	NA
ASF02429.1|1580101_1581037_-|integrase	integrase	integrase	A0A0M4RTQ0	Salmonella_phage	50.5	4.8e-79
ASF02430.1|1581125_1581437_-	XRE family transcriptional regulator	NA	Q1JS45	Enterobacteria_phage	55.9	8.8e-22
ASF02431.1|1581528_1581807_+	DNA-binding protein	NA	NA	NA	NA	NA
ASF02432.1|1581821_1582160_+	DUF4761 domain-containing protein	NA	A0A0A7NV42	Enterobacteria_phage	85.3	2.2e-50
ASF02433.1|1582170_1582458_+	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	77.9	2.7e-33
ASF02434.1|1582469_1582712_+	DUF4754 domain-containing protein	NA	A0A0A7NQ71	Enterobacteria_phage	100.0	2.3e-38
ASF02435.1|1582910_1583231_+	hypothetical protein	NA	NA	NA	NA	NA
ASF02436.1|1583220_1583424_+	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	94.0	3.4e-30
ASF02437.1|1583420_1583666_+	MarR family transcriptional regulator	NA	A0A0A7NV47	Enterobacteria_phage	87.7	8.4e-36
ASF02438.1|1583662_1583962_+	hypothetical protein	NA	A0A0A7NRX6	Enterobacteria_phage	88.9	6.2e-41
ASF02439.1|1584284_1584515_+	derepression protein	NA	A0A0A7NV48	Enterobacteria_phage	93.4	5.0e-30
ASF02440.1|1584587_1584977_+	inositol monophosphatase	NA	NA	NA	NA	NA
ASF02441.1|1584973_1587814_+	replication endonuclease	NA	A0A0A7NQ77	Enterobacteria_phage	89.4	0.0e+00
ASF02442.1|1587890_1588850_+	recombinase	NA	A0A0A7NPX4	Enterobacteria_phage	99.4	1.3e-180
ASF02443.1|1588854_1589169_+	peptide transporter	NA	A0A0A7NPT5	Enterobacteria_phage	51.9	3.5e-18
ASF02444.1|1589188_1589620_+	hypothetical protein	NA	A0A0A7NRY2	Enterobacteria_phage	43.3	4.7e-21
ASF02445.1|1589621_1589885_+	hypothetical protein	NA	A0A2P0P958	Salmonella_phage	72.4	1.1e-30
AVL26902.1|1589907_1590252_-	hypothetical protein	NA	NA	NA	NA	NA
ASF02446.1|1590396_1591443_-|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	100.0	1.5e-206
AVL26773.1|1591442_1593194_-	oxidoreductase	NA	A0A0A7NV54	Enterobacteria_phage	97.6	0.0e+00
ASF02447.1|1593348_1594185_+|capsid	phage capsid protein	capsid	A0A0A7NRY7	Enterobacteria_phage	99.3	1.8e-149
ASF02448.1|1594208_1595261_+|capsid	phage major capsid protein, P2 family	capsid	A0A0A7NQ82	Enterobacteria_phage	94.3	3.2e-188
ASF02449.1|1595306_1596107_+|terminase	terminase	terminase	A0A0A7NPX9	Enterobacteria_phage	91.4	6.6e-130
ASF02450.1|1596208_1596703_+|capsid	capsid assembly protein	capsid	A0A0A7NPU2	Enterobacteria_phage	99.4	1.2e-89
ASF02451.1|1596702_1596903_+|tail	phage tail protein	tail	A0A0A7NV57	Enterobacteria_phage	98.5	6.0e-32
ASF02452.1|1596905_1597229_+|holin	holin	holin	A0A0A7NRY9	Enterobacteria_phage	99.1	1.6e-50
ASF02453.1|1597225_1597618_+	peptidase M15	NA	A0A0A7NQ86	Enterobacteria_phage	97.7	6.4e-70
ASF02454.1|1597614_1598022_+	DUF2570 domain-containing protein	NA	A0A0A7NPY2	Enterobacteria_phage	95.6	1.2e-63
AVL26774.1|1598160_1600041_+	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	81.0	3.8e-301
ASF02455.1|1600064_1600532_+|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	96.1	2.1e-83
ASF02456.1|1600524_1601160_+	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	99.5	5.3e-114
ASF02457.1|1601156_1601738_+|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	97.4	1.2e-101
ASF02458.1|1601734_1602085_+|plate	baseplate assembly protein	plate	A0A0A7NQ90	Enterobacteria_phage	100.0	9.2e-60
ASF02459.1|1602088_1602985_+|plate	baseplate assembly protein	plate	A0A0A7NPY5	Enterobacteria_phage	97.3	5.7e-154
ASF02460.1|1602977_1603508_+|tail	phage tail protein I	tail	A0A0A7NPV1	Enterobacteria_phage	99.4	1.1e-93
ASF02461.1|1603510_1605643_+|tail	phage tail protein	tail	U5N099	Enterobacteria_phage	66.4	1.2e-130
ASF02462.1|1605642_1606221_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	89.0	7.7e-96
ASF05813.1|1606264_1606741_-	serine acetyltransferase	NA	NA	NA	NA	NA
ASF02463.1|1606993_1607488_-|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	98.8	5.2e-85
ASF02464.1|1607494_1610302_-|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	92.5	0.0e+00
ASF02465.1|1610288_1610525_-|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	96.1	1.9e-21
ASF02466.1|1610452_1610818_-|tail	phage tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	96.7	1.4e-55
AVL26775.1|1610872_1611385_-|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	98.8	2.7e-92
ASF02467.1|1611384_1612569_-|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	98.0	3.8e-222
ASF02468.1|1612726_1613836_+	late control protein	NA	A0A0A7NQ97	Enterobacteria_phage	94.8	3.7e-195
ASF05814.1|1613927_1615010_-	hypothetical protein	NA	NA	NA	NA	NA
ASF02469.1|1615329_1615590_+	hypothetical protein	NA	NA	NA	NA	NA
ASF02470.1|1615780_1615921_+	Hok/Gef family protein	NA	A0A0A7NPZ4	Enterobacteria_phage	97.8	1.5e-18
ASF02471.1|1616222_1616522_-	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	7.2e-13
ASF02472.1|1616526_1618914_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
ASF02473.1|1618928_1619912_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	38.5	1.1e-33
AVL26903.1|1620194_1620239_-|tRNA	phenylalanyl--tRNA ligase operon leader peptide	tRNA	NA	NA	NA	NA
ASF02474.1|1620361_1620718_-	50S ribosomal protein L20	NA	NA	NA	NA	NA
ASF02475.1|1620770_1620968_-	50S ribosomal protein L35	NA	NA	NA	NA	NA
ASF02476.1|1621064_1621607_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	32.9	6.3e-15
ASF02477.1|1621610_1623539_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.3	5.5e-130
1624163:1624179	attR	AATTTGCGCGCCAGCTC	NA	NA	NA	NA
>prophage 6
CP022086	Escherichia coli O104:H4 strain FDAARGOS_348 chromosome, complete genome	5256950	1735642	1827005	5256950	protease,head,portal,terminase,capsid,lysis,tail,integrase,tRNA,holin	Enterobacteria_phage(44.44%)	112	1755515:1755530	1832325:1832340
ASF02591.1|1735642_1736524_-|protease	protease HtpX	protease	NA	NA	NA	NA
ASF02592.1|1736715_1738764_-	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.5	6.8e-86
ASF02593.1|1738783_1739482_-	RNA chaperone ProQ	NA	NA	NA	NA	NA
ASF02594.1|1739578_1740076_-	GAF domain-containing protein	NA	NA	NA	NA	NA
ASF02595.1|1740205_1741489_+	paraquat-inducible membrane protein A	NA	NA	NA	NA	NA
ASF02596.1|1741457_1744091_+	MCE family protein	NA	NA	NA	NA	NA
ASF05820.1|1744170_1745610_+	16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF	NA	NA	NA	NA	NA
ASF02597.1|1745727_1745964_+	DUF1480 domain-containing protein	NA	NA	NA	NA	NA
ASF05821.1|1746068_1746260_+	DUF1482 domain-containing protein	NA	NA	NA	NA	NA
ASF02598.1|1746260_1746917_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	50.7	3.6e-57
ASF02599.1|1747312_1747654_-	DUF2511 domain-containing protein	NA	NA	NA	NA	NA
ASF02600.1|1747666_1748539_-	copper resistance protein D	NA	NA	NA	NA	NA
ASF02601.1|1748542_1748917_-	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
ASF02602.1|1749055_1749286_+	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	61.8	1.3e-14
ASF02603.1|1749387_1750044_+	carbon-nitrogen hydrolase family protein	NA	NA	NA	NA	NA
ASF02604.1|1750067_1750730_+	DNA polymerase III subunit epsilon	NA	Q6UAU3	Klebsiella_phage	41.6	2.0e-07
ASF02605.1|1750726_1752787_-	oligopeptidase B	NA	NA	NA	NA	NA
ASF02607.1|1752995_1753655_-	DUF533 domain-containing protein	NA	NA	NA	NA	NA
ASF02608.1|1753981_1754338_-	protein YebF	NA	NA	NA	NA	NA
ASF02609.1|1754404_1754695_-	damage-inducible protein YebG	NA	NA	NA	NA	NA
ASF02610.1|1754828_1756007_+	phosphoribosylglycinamide formyltransferase 2	NA	NA	NA	NA	NA
1755515:1755530	attL	CTACCGTGAATCCTGG	NA	NA	NA	NA
ASF02611.1|1756062_1756704_-	KHG/KDPG aldolase	NA	NA	NA	NA	NA
ASF02612.1|1756740_1758552_-	phosphogluconate dehydratase	NA	NA	NA	NA	NA
ASF02613.1|1758786_1760262_-	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	37.3	9.9e-79
ASF02614.1|1760599_1761469_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
ASF02615.1|1761596_1763039_+	pyruvate kinase	NA	NA	NA	NA	NA
ASF05822.2|1763169_1764141_-	lauroyl-Kdo(2)-lipid IV(A) myristoyltransferase	NA	NA	NA	NA	NA
ASF02616.1|1764260_1765583_-	murein DD-endopeptidase MepM	NA	A8ATH6	Listeria_phage	40.9	1.2e-14
ASF05823.1|1765598_1766531_-	zinc ABC transporter substrate-binding protein ZnuA	NA	NA	NA	NA	NA
ASF02617.1|1766609_1767365_+	Mn2+/Zn2+ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	28.3	1.3e-18
ASF02618.1|1767361_1768147_+	zinc ABC transporter permease subunit ZnuB	NA	NA	NA	NA	NA
ASF02619.1|1768293_1769304_-	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	25.5	5.6e-09
ASF02620.1|1769312_1769924_-	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
ASF05824.1|1770062_1770128_-	hypothetical protein	NA	NA	NA	NA	NA
ASF02621.1|1770198_1770801_+	hypothetical protein	NA	NA	NA	NA	NA
ASF02622.1|1770802_1771324_-	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	35.1	2.0e-10
ASF02623.1|1771358_1772099_-	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
ASF02624.1|1772127_1772580_-	dihydroneopterin triphosphate diphosphatase	NA	NA	NA	NA	NA
ASF02625.1|1772572_1774345_-|tRNA	aspartate--tRNA ligase	tRNA	NA	NA	NA	NA
ASF02626.1|1774654_1775221_+	hydrolase	NA	NA	NA	NA	NA
ASF05825.1|1775302_1775419_-	preprotein translocase subunit SecY	NA	NA	NA	NA	NA
ASF02627.1|1775575_1775824_+	damage-inducible protein DinI	NA	K7PLW4	Enterobacteria_phage	100.0	1.8e-38
ASF02628.2|1775820_1775967_-|capsid	nucleocapsid protein	capsid	NA	NA	NA	NA
ASF02629.1|1775939_1776524_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.3	4.3e-102
ASF02630.1|1776523_1779694_-|tail	phage tail protein	tail	X2KTY7	Enterobacteria_phage	59.1	1.3e-83
ASF02631.1|1779845_1780445_-	Ail/Lom family protein	NA	Q9EV15	Enterobacteria_phage	95.5	1.0e-106
AVL26779.1|1780512_1783992_-	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	90.0	0.0e+00
ASF02632.1|1784052_1784724_-|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.6	3.1e-104
ASF02633.1|1784621_1785365_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.8	2.5e-147
ASF02634.1|1785369_1786068_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	98.7	2.8e-132
ASF02635.1|1786067_1786397_-|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	100.0	9.6e-59
ASF02636.1|1786393_1788955_-|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	99.6	0.0e+00
ASF02637.1|1788947_1789382_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	98.3	1.7e-63
ASF02638.1|1789363_1789786_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	100.0	6.7e-73
ASF05826.1|1789801_1790542_-|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	99.2	5.0e-132
ASF02639.1|1790549_1790945_-|tail	phage tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	99.2	2.2e-70
AVL26780.1|1790941_1791520_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	90.6	4.9e-74
ASF02640.1|1791535_1791889_-|tail	phage tail protein	tail	A0A0K2FJB7	Enterobacteria_phage	70.1	1.9e-41
AVL26781.1|1791881_1792250_-	hypothetical protein	NA	NA	NA	NA	NA
ASF02641.1|1792302_1793331_-|capsid	minor capsid protein E	capsid	C6ZCY2	Enterobacteria_phage	61.0	1.1e-113
ASF02642.1|1793388_1793736_-|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	57.0	4.4e-22
ASF02643.1|1793772_1795278_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.0	1.2e-100
ASF02644.1|1795267_1796860_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.5	4.2e-184
ASF02645.1|1796856_1797063_-|tail	phage tail protein	tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
AVL26782.1|1797046_1798975_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	66.6	7.4e-260
ASF02646.1|1798946_1799495_-|terminase	phage terminase small subunit	terminase	A0A0U2S671	Escherichia_phage	84.2	1.0e-57
ASF02647.1|1799889_1800075_+	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	81.4	4.1e-19
ASF02648.1|1800207_1800348_-	hypothetical protein	NA	NA	NA	NA	NA
ASF02649.1|1800698_1801166_-|lysis	lysis protein	lysis	Q9ZXB6	Enterobacteria_phage	99.4	3.4e-78
ASF02650.1|1801464_1801998_-	lysozyme	NA	Q6H9V6	Enterobacteria_phage	95.5	4.8e-100
ASF02651.1|1802048_1802393_-	DUF1327 domain-containing protein	NA	A0A0P0ZD64	Stx2-converting_phage	97.4	7.2e-57
ASF02652.1|1802397_1802613_-|holin	holin	holin	G9L6J5	Escherichia_phage	100.0	9.0e-34
ASF02653.1|1802688_1802958_-	DUF826 domain-containing protein	NA	A0A2R2Z348	Escherichia_phage	74.2	8.2e-08
ASF02654.1|1802983_1803178_-	DUF1378 domain-containing protein	NA	S5MBZ5	Escherichia_phage	86.7	9.4e-22
ASF02655.1|1803313_1805275_-	DUF1737 domain-containing protein	NA	A0A0P0ZBH7	Stx2-converting_phage	64.2	3.9e-240
ASF02656.1|1805392_1805596_+	hypothetical protein	NA	Q8VNP0	Enterobacteria_phage	96.7	1.8e-28
ASF02657.2|1806041_1806755_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
ASF02658.1|1806889_1807087_-	TrmB family transcriptional regulator	NA	S5MQK8	Escherichia_phage	95.4	3.4e-27
AVL26783.1|1807353_1808529_+	hypothetical protein	NA	NA	NA	NA	NA
ASF02660.1|1808531_1809746_+	hypothetical protein	NA	NA	NA	NA	NA
ASF02661.1|1809725_1810082_-	antitermination protein	NA	A0A0P0ZCW0	Stx2-converting_phage	92.0	2.3e-58
ASF02662.2|1810099_1811089_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	99.4	4.7e-194
ASF02663.1|1811096_1811912_-	KilA-N domain-containing protein	NA	U5P4K5	Shigella_phage	99.3	8.5e-149
ASF02664.1|1812074_1812470_-	hypothetical protein	NA	A0A0P0ZD39	Stx2-converting_phage	98.4	5.7e-66
ASF02665.1|1812466_1812793_-	LexA family transcriptional regulator	NA	A0A291AWY9	Escherichia_phage	98.1	2.7e-53
ASF02666.1|1812789_1813443_-	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	99.5	1.9e-127
ASF02667.1|1813442_1813937_-	PerC family transcriptional regulator	NA	A0A291AWV6	Escherichia_phage	96.3	1.5e-84
ASF02668.1|1813933_1814752_-	helix-turn-helix domain-containing protein	NA	A5LH71	Enterobacteria_phage	88.1	2.8e-123
ASF02669.1|1814748_1814973_-	hypothetical protein	NA	A5LH70	Enterobacteria_phage	95.9	2.4e-37
ASF02670.1|1814969_1816115_-	peptidase	NA	A5LH69	Enterobacteria_phage	83.5	3.1e-173
ASF02671.1|1816111_1816669_-	hypothetical protein	NA	Q8SBF4	Shigella_phage	94.1	5.3e-94
ASF02672.1|1816661_1816922_-	XRE family transcriptional regulator	NA	K7PJQ8	Enterobacteria_phage	100.0	5.4e-41
ASF02673.1|1816893_1817046_-	amino acid permease	NA	NA	NA	NA	NA
ASF02674.1|1817019_1817712_+	XRE family transcriptional regulator	NA	S5FUZ3	Shigella_phage	96.1	6.4e-121
ASF02675.1|1817791_1818046_+	hypothetical protein	NA	A0A291AWY6	Escherichia_phage	97.4	2.7e-13
AVL26784.1|1818147_1818342_-	hypothetical protein	NA	A0A291AWX8	Escherichia_phage	96.9	7.1e-30
ASF02676.1|1818414_1818777_+	hypothetical protein	NA	Q8SBF8	Shigella_phage	94.2	7.5e-57
ASF02677.1|1818842_1819667_+	hypothetical protein	NA	K7PJQ6	Enterobacteria_phage	98.9	1.1e-148
ASF02678.1|1819794_1820331_+	HD family hydrolase	NA	A0A0P0ZCH9	Stx2-converting_phage	99.4	2.2e-100
ASF02679.1|1820321_1820684_+	hypothetical protein	NA	K7PH61	Enterobacteria_phage	97.5	6.8e-66
ASF02680.1|1820680_1820884_+	hypothetical protein	NA	K7PLX1	Enterobacteria_phage	98.5	1.0e-31
ASF02681.1|1820876_1821116_+	hypothetical protein	NA	S5MQM0	Escherichia_phage	96.2	9.1e-35
ASF02682.1|1821112_1821661_+	hypothetical protein	NA	A0A1I9LJM5	Stx_converting_phage	97.5	1.4e-59
ASF05827.1|1821890_1822178_+	hypothetical protein	NA	G9L6B3	Escherichia_phage	97.9	1.4e-53
ASF02683.1|1822174_1822933_+	dTDP-6-deoxy-L-hexose 3-O-methyltransferase	NA	A0A1U9AJ59	Stx1_converting_phage	82.0	2.7e-109
ASF02684.1|1823017_1823260_+	DUF4222 domain-containing protein	NA	Q6H9Z8	Enterobacteria_phage	87.5	4.3e-32
ASF02685.1|1823263_1823410_+	hypothetical protein	NA	A0A1B5FPC2	Escherichia_phage	93.8	1.6e-21
ASF02686.1|1823418_1823655_+	excisionase	NA	Q8W657	Enterobacteria_phage	100.0	6.4e-41
ASF02687.1|1823710_1825021_+|integrase	integrase	integrase	Q8W658	Enterobacteria_phage	95.4	3.0e-244
ASF02688.2|1825002_1825773_+	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	99.2	6.1e-72
ASF02689.1|1825825_1826221_+	hypothetical protein	NA	NA	NA	NA	NA
ASF02690.1|1826261_1827005_+	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	30.0	4.6e-24
1832325:1832340	attR	CCAGGATTCACGGTAG	NA	NA	NA	NA
>prophage 7
CP022086	Escherichia coli O104:H4 strain FDAARGOS_348 chromosome, complete genome	5256950	2127990	2137432	5256950		Enterobacteria_phage(85.71%)	10	NA	NA
ASF02950.1|2127990_2129127_+	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.1	4.6e-161
ASF02951.1|2129123_2131124_+	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	96.3	0.0e+00
ASF02952.1|2131248_2131710_+	hypothetical protein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
ASF02953.1|2131750_2132221_-	DUF1456 domain-containing protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
ASF02954.1|2132267_2132987_-	DNA-binding response regulator	NA	NA	NA	NA	NA
ASF02955.1|2132983_2134669_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
ASF02956.1|2134890_2135622_+	transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
ASF02957.1|2135681_2135789_+	hypothetical protein	NA	NA	NA	NA	NA
ASF02958.1|2135769_2136501_-	osmoprotectant uptake system permease	NA	NA	NA	NA	NA
ASF02959.1|2136505_2137432_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.8	2.8e-23
>prophage 8
CP022086	Escherichia coli O104:H4 strain FDAARGOS_348 chromosome, complete genome	5256950	2372620	2386443	5256950	protease	Enterobacteria_phage(60.0%)	17	NA	NA
ASF03172.1|2372620_2374531_+	acyltransferase	NA	C6ZR20	Salmonella_phage	32.6	4.7e-57
ASF03174.1|2377258_2377390_+|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	A5VWA4	Enterobacteria_phage	100.0	1.4e-16
ASF03175.1|2377374_2377527_+	host cell division inhibitory peptide Kil	NA	A5VWA5	Enterobacteria_phage	100.0	4.7e-21
ASF03176.1|2377783_2378389_+	recombinase	NA	K7P6W7	Enterobacteria_phage	100.0	4.1e-108
ASF03177.1|2378388_2378772_+	hypothetical protein	NA	K7P7R8	Enterobacteria_phage	97.6	1.2e-65
ASF03178.1|2378795_2379092_+	RecBCD nuclease inhibitor	NA	A5VWB0	Enterobacteria_phage	98.0	1.9e-50
ASF03179.1|2379102_2379393_+	hypothetical protein	NA	K7P7M4	Enterobacteria_phage	99.0	2.4e-45
ASF03180.1|2379389_2379557_+	DUF2737 domain-containing protein	NA	Q716F2	Shigella_phage	98.2	8.6e-24
ASF03181.1|2379553_2380225_+	hypothetical protein	NA	A0A0F6R7P8	Escherichia_coli_O157_typing_phage	73.2	3.0e-83
ASF03182.1|2380397_2380586_+	hypothetical protein	NA	Q286W7	Escherichia_phage	92.6	6.3e-23
ASF03183.1|2380587_2380797_+	hypothetical protein	NA	A0A0F6TJE4	Escherichia_coli_O157_typing_phage	91.2	1.3e-32
ASF03184.1|2380793_2381423_+	DUF550 domain-containing protein	NA	K7P7E3	Enterobacteria_phage	58.6	1.1e-55
ASF03185.1|2381519_2381699_+	Eag protein	NA	K7PL40	Enterobacteria_phage	100.0	2.5e-29
ASF03186.1|2381830_2382031_+	transcriptional regulator	NA	K7P7V0	Enterobacteria_phage	100.0	2.4e-33
ASF03187.1|2382560_2383808_-	MFS transporter	NA	NA	NA	NA	NA
ASF03188.1|2383879_2384794_-	aminoimidazole riboside kinase	NA	NA	NA	NA	NA
ASF03189.2|2385009_2386443_+	glycoside hydrolase family 32 protein	NA	F8WPR5	Bacillus_phage	25.4	7.0e-29
>prophage 9
CP022086	Escherichia coli O104:H4 strain FDAARGOS_348 chromosome, complete genome	5256950	2747045	2754185	5256950		Escherichia_phage(83.33%)	6	NA	NA
ASF03509.1|2747045_2749607_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	1.7e-30
ASF03510.1|2749712_2750369_+	serine/threonine protein phosphatase	NA	A0A077SLQ6	Escherichia_phage	46.8	1.5e-50
ASF03511.1|2750419_2751187_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.7	3.3e-70
ASF03512.1|2751382_2752291_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
ASF03513.1|2752287_2753550_+	3-oxo-tetronate kinase	NA	A0A077SLJ7	Escherichia_phage	61.4	1.3e-135
ASF03514.1|2753546_2754185_+	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
>prophage 10
CP022086	Escherichia coli O104:H4 strain FDAARGOS_348 chromosome, complete genome	5256950	3007109	3045303	5256950	tRNA,transposase,protease,integrase	Pseudomonas_phage(15.38%)	30	2999217:2999231	3021537:3021551
2999217:2999231	attL	TCAATAATTCAAACA	NA	NA	NA	NA
ASF03736.1|3007109_3007829_-|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
ASF03737.1|3007898_3008036_+	adenine glycosylase	NA	NA	NA	NA	NA
ASF03738.1|3007989_3009042_+	adenine DNA glycosylase	NA	NA	NA	NA	NA
ASF03739.1|3009069_3009345_+	Fe(2+)-trafficking protein	NA	NA	NA	NA	NA
ASF03740.1|3009409_3010489_+	lytic murein transglycosylase	NA	NA	NA	NA	NA
ASF03741.1|3010690_3011947_+	nucleoside permease NupG	NA	NA	NA	NA	NA
ASF03742.1|3011996_3014132_-	ornithine decarboxylase	NA	NA	NA	NA	NA
ASF03743.1|3014211_3014415_-	hypothetical protein	NA	NA	NA	NA	NA
ASF03744.1|3014529_3015237_+	hypothetical protein	NA	NA	NA	NA	NA
ASF03745.1|3015615_3016878_+|integrase	integrase	integrase	A0A1B0VMI6	Pseudomonas_phage	43.1	6.9e-81
AVL26821.1|3018012_3018222_+	hypothetical protein	NA	NA	NA	NA	NA
ASF03746.1|3018375_3018591_-	hypothetical protein	NA	NA	NA	NA	NA
AVL26822.1|3018857_3019376_-	DUF2931 domain-containing protein	NA	NA	NA	NA	NA
ASF05861.1|3019378_3019561_-	hypothetical protein	NA	NA	NA	NA	NA
ASF03747.1|3019861_3022711_+	helicase SNF2	NA	A0A2H4J643	uncultured_Caudovirales_phage	39.6	2.2e-183
3021537:3021551	attR	TGTTTGAATTATTGA	NA	NA	NA	NA
ASF03748.1|3022736_3023717_+	ATP-binding protein	NA	A0A1B2RW50	Lymphocystis_disease_virus	30.2	4.2e-17
ASF03749.1|3023726_3026114_+|protease	serine protease	protease	NA	NA	NA	NA
ASF03750.1|3026123_3027752_+	site-specific DNA-methyltransferase	NA	A0A0K1LNZ9	Escherichia_phage	42.6	4.6e-85
ASF03751.1|3027754_3030625_+	restriction endonuclease subunit R	NA	NA	NA	NA	NA
ASF03752.1|3030713_3031007_+	hypothetical protein	NA	NA	NA	NA	NA
ASF03753.2|3031076_3031427_+	hypothetical protein	NA	Q716C1	Shigella_phage	98.9	1.8e-39
ASF03754.1|3031346_3032498_-|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	3.4e-42
ASF03755.1|3032920_3033352_-	hypothetical protein	NA	NA	NA	NA	NA
ASF03757.1|3033645_3035169_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.8	6.2e-44
ASF03758.1|3040980_3041418_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	60.3	1.5e-19
ASF03759.1|3041414_3041765_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBY2	Stx2-converting_phage	63.8	6.2e-40
ASF03760.1|3041795_3043409_+|transposase	IS66 family transposase ISEc43	transposase	A0A0P0ZEB3	Stx2-converting_phage	61.4	8.3e-172
ASF03761.1|3043592_3044573_+|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.1	6.8e-185
AVL26823.1|3044610_3044727_-	sugar kinase	NA	Q6QLL3	Human_immunodeficiency_virus	100.0	4.7e-13
ASF03762.1|3044940_3045303_-|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	62.5	6.4e-40
>prophage 11
CP022086	Escherichia coli O104:H4 strain FDAARGOS_348 chromosome, complete genome	5256950	3856883	3882602	5256950	tRNA,transposase,integrase	Escherichia_phage(30.0%)	21	3874691:3874750	3879944:3880764
ASF04516.1|3856883_3857573_+|tRNA	tRNA (guanosine(18)-2'-O)-methyltransferase TrmH	tRNA	NA	NA	NA	NA
ASF04517.1|3857578_3859660_+	DNA helicase RecG	NA	NA	NA	NA	NA
ASF04518.1|3859825_3861031_-	sodium/glutamate symport carrier protein	NA	NA	NA	NA	NA
ASF04519.1|3861310_3862702_+	xanthine permease XanP	NA	H9YQ34	environmental_Halophage	100.0	1.4e-71
ASF04520.1|3862822_3864532_+	AsmA family protein	NA	NA	NA	NA	NA
ASF04521.1|3864584_3866903_-	alpha-xylosidase	NA	NA	NA	NA	NA
ASF04522.1|3866912_3868295_-	inner membrane symporter YicJ	NA	NA	NA	NA	NA
ASF04523.1|3868981_3870166_+	DUF4102 domain-containing protein	NA	Q7M297	Enterobacteria_phage	69.9	3.4e-162
ASF04524.1|3871015_3871105_-	acetyltransferase	NA	NA	NA	NA	NA
ASF04525.1|3871171_3874138_-|transposase	Tn3-like element TnAs3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.6	0.0e+00
ASF04526.1|3874140_3874695_-	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	86.2	4.0e-49
3874691:3874750	attL	GGCACTGTTGCAAATAGTCGGTGGTGATAAACTTATCATCCCCTTTTGCTGATGGAGCTG	NA	NA	NA	NA
ASF04527.1|3874753_3875458_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
ASF04528.1|3875491_3876271_-	dihydropteroate synthase	NA	NA	NA	NA	NA
ASF04529.1|3876264_3876612_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
ASF05890.1|3876841_3877315_-	trimethoprim-resistant dihydrofolate reductase DfrA7	NA	A0A1B2IBQ4	Erwinia_phage	32.0	8.4e-16
ASF04530.1|3877472_3878486_+|integrase	integron integrase	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
ASF04531.1|3878424_3879039_+	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
ASF04532.1|3879235_3879940_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
ASF04533.1|3879986_3880388_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
ASF04534.1|3880537_3881398_-	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
3879944:3880764	attR	CAGCTCCATCAGCAAAAGGGGATGATAAGTTTATCACCACCGACTATTTGCAACAGTGCCATATCAAGCGACTTCTCCTATCCCCTGGGAACACATCAATCTCACCGGAGAATATCGCTGGCCAAAGCCTTAGCGTAGGATTCCGCCCCTTCCCGCAAACGACCCCAAACAGGAAACGCAGCTGAAACGGGAAGCTCAACACCCACTGACGCATGGGTTGTTCAGGCAGTACTTCATCAACCAGCAAGGCGGCACTTTCGGCCATCCGCCGCGCCCCACAGCTCGGGCAGAAACCGCGACGCTTACAGCTGAAAGCGACCAGGTGCTCGGCGTGGCAAGACTCGCAGCGAACCCGTAGAAAGCCATGCTCCAGCCGCCCGCATTGGAGAAATTCTTCAAATTCCCGTTGCACATAGCCCGGCAATTCCTTTCCCTGCTCTGCCATAAGGGGTCTGACGCTCAGTGGAACGAAAACTCACGTTAAGGGATTTTGGTCATGAGATTATCAAAAAGGATCTTCACCTAGATCCTTTTAAATTAAAAATGAAGTTTTAAATCAATCTAAAGTATATATGAGTAAACTTGGTCTGACAGTTACCAATGCTTAATCAGTGAGGCACCTATCTCAGCGATCTGTCTATTTCGTTCATCCATAGTTGCCTGACTCCCCGTCGTGTAGATAACTACGATACGGGAGGGCTTACCATCTGGCCCCAGTGCTGCAATGATACCGCGAGACCCACGCTCACCGGCTCCAGATTTATCAGCAATAAACCAGCCAGCCGGAAGGGCCGAGCGCAGAAGTGGTCCTGCAACTTTAT	NA	NA	NA	NA
ASF04535.1|3881897_3882602_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
>prophage 12
CP022086	Escherichia coli O104:H4 strain FDAARGOS_348 chromosome, complete genome	5256950	4443223	4502860	5256950	tRNA,transposase,protease,integrase	Enterobacteria_phage(28.57%)	40	4445390:4445404	4504142:4504156
AVL26867.1|4443223_4444741_-|tRNA	lysine--tRNA ligase heat inducible	tRNA	A0A1V0SAC0	Catovirus	38.0	2.7e-87
ASF05033.1|4444977_4446435_-	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	29.4	5.2e-48
4445390:4445404	attL	AAGCCAAAGGCAAAC	NA	NA	NA	NA
ASF05034.1|4446493_4448641_-	lysine decarboxylase CadA	NA	NA	NA	NA	NA
ASF05035.1|4448720_4450055_-	cadaverine/lysine antiporter	NA	NA	NA	NA	NA
ASF05036.1|4450284_4450530_+	hypothetical protein	NA	NA	NA	NA	NA
ASF05037.1|4450420_4451959_-	transcriptional regulator	NA	NA	NA	NA	NA
ASF05038.1|4452245_4452464_+	hypothetical protein	NA	NA	NA	NA	NA
ASF05039.1|4452707_4453550_-	DUF4942 domain-containing protein	NA	NA	NA	NA	NA
ASF05040.1|4453634_4453832_-	DUF957 domain-containing protein	NA	NA	NA	NA	NA
ASF05041.1|4453851_4454340_-	hypothetical protein	NA	NA	NA	NA	NA
ASF05042.1|4454336_4454714_-	toxin	NA	NA	NA	NA	NA
ASF05043.1|4454760_4455138_-	type IV toxin-antitoxin system YeeU family antitoxin	NA	NA	NA	NA	NA
ASF05044.1|4455217_4455439_-	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.9e-10
ASF05045.1|4456016_4456490_-	antirestriction protein	NA	A9J566	Pseudomonas_phage	30.3	1.1e-12
AVL26868.1|4456863_4457052_-	hypothetical protein	NA	NA	NA	NA	NA
ASF05046.1|4457745_4458117_-	hypothetical protein	NA	NA	NA	NA	NA
ASF05048.1|4458410_4459934_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.8	6.2e-44
ASF05049.1|4465940_4467065_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	99.7	3.3e-199
ASF05050.1|4467642_4468855_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	98.3	6.0e-167
ASF05051.1|4468895_4470038_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
ASF05053.1|4470777_4471704_+	shiE	NA	NA	NA	NA	NA
ASF05054.1|4471653_4472847_-	MFS transporter	NA	NA	NA	NA	NA
AVL26869.1|4472919_4474707_+	aerobactin synthase IucA	NA	NA	NA	NA	NA
ASF05055.1|4474707_4475655_+	N-acetyltransferase	NA	NA	NA	NA	NA
ASF05056.1|4475654_4477397_+	IucA/IucC family siderophore biosynthesis protein	NA	NA	NA	NA	NA
ASF05057.1|4477393_4478731_+	lysine 6-monooxygenase	NA	NA	NA	NA	NA
ASF05058.1|4478652_4480932_+	TonB-dependent receptor	NA	NA	NA	NA	NA
ASF05059.1|4481896_4483420_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.8	6.2e-44
ASF05916.1|4483713_4484085_+	hypothetical protein	NA	NA	NA	NA	NA
ASF05062.1|4485090_4485516_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	97.9	4.4e-48
AVL26870.1|4487754_4487946_-	hypothetical protein	NA	NA	NA	NA	NA
ASF05063.1|4488052_4488490_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	60.3	1.5e-19
ASF05064.1|4488486_4488837_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBY2	Stx2-converting_phage	63.8	6.2e-40
ASF05065.1|4488867_4490481_+|transposase	IS66 family transposase ISEc43	transposase	A0A0P0ZEB3	Stx2-converting_phage	61.4	8.3e-172
ASF05066.1|4490672_4491254_-	hypothetical protein	NA	NA	NA	NA	NA
ASF05067.1|4491300_4495158_-|protease	serine protease	protease	Q9LA58	Enterobacterial_phage	38.3	2.4e-225
ASF05068.1|4495337_4495529_+	hypothetical protein	NA	NA	NA	NA	NA
AVL26871.1|4495518_4496556_-	type IX secretion system membrane protein PorP/SprF	NA	NA	NA	NA	NA
ASF05070.1|4501233_4501497_+	hypothetical protein	NA	NA	NA	NA	NA
ASF05071.1|4501597_4502860_-|integrase	integrase	integrase	Q7M297	Enterobacteria_phage	38.3	9.3e-78
4504142:4504156	attR	GTTTGCCTTTGGCTT	NA	NA	NA	NA
>prophage 13
CP022086	Escherichia coli O104:H4 strain FDAARGOS_348 chromosome, complete genome	5256950	4985241	5047567	5256950	protease,transposase,plate,tRNA	Emiliania_huxleyi_virus(12.5%)	53	NA	NA
ASF05511.1|4985241_4986594_+|protease	sigma E protease regulator RseP	protease	NA	NA	NA	NA
ASF05512.1|4986623_4989056_+	outer membrane protein assembly factor BamA	NA	NA	NA	NA	NA
ASF05513.1|4989177_4989663_+	chaperone protein Skp	NA	NA	NA	NA	NA
ASF05514.1|4989666_4990692_+	UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase	NA	NA	NA	NA	NA
ASF05515.1|4990796_4991252_+	beta-hydroxyacyl-ACP dehydratase	NA	NA	NA	NA	NA
ASF05516.1|4991255_4992044_+	acyl-[acyl-carrier-protein]--UDP-N- acetylglucosamine O-acyltransferase	NA	NA	NA	NA	NA
ASF05517.1|4992043_4993192_+	lipid-A-disaccharide synthase	NA	NA	NA	NA	NA
ASF05518.1|4993188_4993785_+	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	40.0	1.0e-26
ASF05519.1|4993821_4997304_+	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	36.9	2.2e-209
ASF05520.1|4997316_4998276_+	acetyl-CoA carboxylase carboxyl transferase subunit alpha	NA	NA	NA	NA	NA
ASF05521.1|4998374_5000516_+	lysine decarboxylase LdcC	NA	NA	NA	NA	NA
ASF05522.1|5000572_5000962_+	VOC family protein	NA	NA	NA	NA	NA
ASF05523.1|5001026_5002325_+|tRNA	tRNA(Ile)-lysidine synthetase	tRNA	NA	NA	NA	NA
ASF05936.1|5002373_5002628_-	protein rof	NA	NA	NA	NA	NA
ASF05524.1|5002620_5002821_-	hypothetical protein	NA	NA	NA	NA	NA
ASF05525.1|5002986_5003532_+	hypothetical protein	NA	NA	NA	NA	NA
ASF05526.1|5003528_5003951_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
ASF05527.1|5003964_5004675_+	copper homeostasis/adhesion lipoprotein NlpE	NA	NA	NA	NA	NA
ASF05528.1|5004681_5004933_-	hypothetical protein	NA	NA	NA	NA	NA
ASF05529.1|5004924_5005905_+|transposase	IS110 family transposase IS621	transposase	NA	NA	NA	NA
ASF05530.1|5006984_5008703_-|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
ASF05531.1|5008814_5009522_-|tRNA	tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO	tRNA	NA	NA	NA	NA
ASF05532.1|5009518_5009923_-	Rcs stress response system protein RcsF	NA	NA	NA	NA	NA
ASF05533.1|5010040_5010856_-	methionine ABC transporter substrate-binding protein MetQ	NA	NA	NA	NA	NA
ASF05534.1|5010895_5011549_-	methionine ABC transporter	NA	NA	NA	NA	NA
ASF05535.1|5011541_5012573_-	methionine import ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	40.2	7.2e-36
ASF05536.1|5012760_5013333_+	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
ASF05537.1|5019230_5020034_+	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	36.6	3.2e-39
ASF05538.1|5020030_5020945_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
ASF05539.1|5021185_5021986_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
ASF05540.1|5022063_5022834_+	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
ASF05541.1|5022881_5024240_-	lytic transglycosylase	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	36.0	5.8e-09
ASF05542.1|5024311_5025067_-	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
ASF05543.1|5025100_5025823_+	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
ASF05544.1|5025819_5026287_-	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.7	1.0e-50
ASF05937.1|5026351_5027083_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	39.0	3.4e-40
AVL26888.1|5027022_5027202_-	hypothetical protein	NA	NA	NA	NA	NA
ASF05545.1|5027618_5028404_+	aminopeptidase	NA	NA	NA	NA	NA
ASF05546.1|5028540_5029020_-	hypothetical protein	NA	NA	NA	NA	NA
ASF05547.2|5029029_5029944_-	hypothetical protein	NA	NA	NA	NA	NA
ASF05548.1|5029987_5030470_-	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
ASF05549.1|5030493_5031846_-	hypothetical protein	NA	NA	NA	NA	NA
ASF05938.1|5031856_5035321_-	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
ASF05550.1|5035399_5036815_-	type VI secretion system protein TssA	NA	NA	NA	NA	NA
ASF05551.1|5036819_5037563_-	type VI secretion system-associated protein TagO	NA	NA	NA	NA	NA
ASF05552.1|5037559_5040319_-	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	30.6	9.4e-83
ASF05553.1|5040327_5041089_-	hypothetical protein	NA	NA	NA	NA	NA
ASF05554.1|5041093_5042425_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
ASF05555.1|5042427_5042952_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
ASF05556.1|5042948_5044229_-	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
ASF05557.1|5044253_5045336_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
ASF05558.1|5045299_5047150_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
ASF05559.1|5047153_5047567_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
>prophage 1
CP022085	Escherichia coli O104:H4 strain FDAARGOS_348 plasmid unnamed1, complete sequence	109945	0	109693	109945	integrase,tRNA,capsid,tail,protease,terminase	Salmonella_phage(80.17%)	130	2177:2191	30254:30268
ASF00832.1|1081_3190_-	cobalamin biosynthesis protein CobT	NA	J9Q7G6	Salmonella_phage	65.9	1.5e-226
2177:2191	attL	TGAAGAGCCGTCTTC	NA	NA	NA	NA
ASF00833.1|3290_3503_-	hypothetical protein	NA	NA	NA	NA	NA
ASF00834.1|3750_4137_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
ASF00952.2|4131_5235_-|integrase	integrase	integrase	A0A1P8DTG6	Proteus_phage	33.8	2.9e-27
ASF00835.1|5442_7356_-	DUF1737 domain-containing protein	NA	B6DZ89	Enterobacteria_phage	49.9	3.3e-175
ASF00836.1|7469_8036_+	hypothetical protein	NA	Q71T98	Escherichia_phage	81.0	1.7e-18
ASF00837.1|9181_9472_-	C-type natriuretic protein	NA	J9Q7S1	Salmonella_phage	78.1	6.9e-37
ASF00839.1|9617_9833_-	hypothetical protein	NA	J9Q6I3	Salmonella_phage	72.5	5.7e-20
ASF00840.1|9816_9996_-	hypothetical protein	NA	J9Q729	Salmonella_phage	70.7	5.4e-16
ASF00841.1|9992_11315_-	DNA ligase	NA	J9Q7G5	Salmonella_phage	91.1	1.5e-240
ASF00842.1|11311_11569_-	hypothetical protein	NA	J9Q7R9	Salmonella_phage	59.0	3.9e-15
ASF00843.1|11849_12632_-	hypothetical protein	NA	J9Q7Z0	Salmonella_phage	41.1	1.7e-53
ASF00844.1|12707_13889_-	DNA primase	NA	J9Q720	Salmonella_phage	93.0	2.0e-207
ASF00845.1|13970_15311_-	DNA helicase	NA	J9Q7G4	Salmonella_phage	93.5	5.7e-235
ASF00846.1|15354_16095_-	hypothetical protein	NA	J9Q7R8	Salmonella_phage	88.8	1.4e-126
AVL26712.1|16275_17970_-	hypothetical protein	NA	X2KLG0	Campylobacter_phage	24.7	4.1e-12
ASF00847.1|18021_18381_-	hypothetical protein	NA	J9Q7G3	Salmonella_phage	97.9	1.5e-44
ASF00848.1|18380_19049_-	plasmid stability protein	NA	J9Q7R7	Salmonella_phage	91.4	1.7e-110
ASF00849.1|19367_19637_+	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
ASF00850.1|19644_20166_+	N-acetyltransferase	NA	NA	NA	NA	NA
ASF00851.1|20197_20383_-	hypothetical protein	NA	J9Q7G2	Salmonella_phage	75.0	4.9e-20
ASF00852.1|20333_20585_-	hypothetical protein	NA	J9Q7R6	Salmonella_phage	78.0	1.1e-25
ASF00853.1|20586_21279_-	hypothetical protein	NA	J9Q7Y7	Salmonella_phage	93.9	1.4e-123
ASF00854.1|21292_21616_-	hypothetical protein	NA	J9Q6E7	Salmonella_phage	84.1	3.2e-43
ASF00855.1|21713_22226_-	hypothetical protein	NA	A0A0P0ZFL3	Escherichia_phage	68.2	8.2e-65
AVL26713.1|22311_25683_-	hypothetical protein	NA	A0A077SK37	Escherichia_phage	42.8	8.5e-86
ASF00856.1|25777_30484_-	DUF1983 domain-containing protein	NA	J9Q713	Salmonella_phage	73.7	0.0e+00
30254:30268	attR	TGAAGAGCCGTCTTC	NA	NA	NA	NA
ASF00857.1|30500_31091_-|tail	tail assembly protein	tail	J9Q7F8	Salmonella_phage	95.9	2.9e-106
ASF00858.1|31078_31876_-|tail	phage tail protein	tail	J9Q7R4	Salmonella_phage	93.6	3.9e-154
ASF00859.1|31868_32600_-|tail	phage minor tail protein L	tail	J9Q7Y5	Salmonella_phage	96.6	1.5e-133
ASF00860.1|32649_32985_-|tail	phage tail protein	tail	J9Q6E1	Salmonella_phage	86.4	3.0e-52
ASF00861.1|33027_37590_-|tail	phage tail tape measure protein	tail	J9Q712	Salmonella_phage	82.6	0.0e+00
ASF00862.1|37597_37867_-	hypothetical protein	NA	J9Q7F7	Salmonella_phage	93.5	8.7e-34
ASF00863.1|37947_38265_-	hypothetical protein	NA	J9Q7R3	Salmonella_phage	95.2	1.5e-48
ASF00864.1|38332_39070_-	hypothetical protein	NA	J9Q7Y4	Salmonella_phage	88.6	1.0e-113
ASF00865.1|39143_39527_-	hypothetical protein	NA	J9Q6D8	Salmonella_phage	79.5	1.5e-55
ASF00866.1|39528_40002_-	hypothetical protein	NA	J9Q711	Salmonella_phage	89.2	2.8e-75
ASF00867.1|39992_40337_-	hypothetical protein	NA	J9Q7F6	Salmonella_phage	94.7	5.1e-55
ASF00868.1|40408_41242_-	hypothetical protein	NA	J9Q7R2	Salmonella_phage	88.8	1.8e-138
ASF00869.1|41241_41676_-	hypothetical protein	NA	J9Q7Y3	Salmonella_phage	81.2	1.0e-60
ASF00870.1|41773_42694_-|capsid	phage major capsid protein	capsid	J9Q710	Salmonella_phage	87.9	8.7e-150
ASF00871.1|42719_43607_-	hypothetical protein	NA	J9Q7F4	Salmonella_phage	88.3	2.4e-133
ASF00872.1|43628_45203_-	hypothetical protein	NA	J9Q7R1	Salmonella_phage	93.1	2.2e-286
ASF00873.1|45229_46486_-|terminase	terminase	terminase	J9Q7Y2	Salmonella_phage	96.9	3.4e-245
ASF00874.1|46485_47118_-	DNA-binding protein	NA	J9Q6D4	Salmonella_phage	84.6	8.2e-91
ASF00875.1|47313_47580_-	hypothetical protein	NA	J9Q757	Salmonella_phage	88.6	1.4e-36
ASF00876.1|47589_48480_-	hypothetical protein	NA	J9Q7I6	Salmonella_phage	98.3	2.9e-166
ASF00877.1|48476_49142_-	adenylyl-sulfate kinase	NA	J9Q807	Salmonella_phage	98.6	2.8e-110
ASF00878.1|49138_49807_-	chromosome partitioning protein ParB	NA	J9Q6L1	Salmonella_phage	89.6	5.6e-106
ASF00879.1|49806_50505_-	chromosome partitioning protein ParB	NA	J9Q756	Salmonella_phage	86.6	8.7e-110
ASF00880.1|50569_52129_+	ATP-dependent helicase	NA	J9Q7I4	Salmonella_phage	93.1	5.8e-279
ASF00881.1|52131_52410_+	hypothetical protein	NA	J9Q7T9	Salmonella_phage	58.2	4.6e-22
ASF00882.1|52442_53042_+	hypothetical protein	NA	NA	NA	NA	NA
ASF00883.1|53187_53676_+	hypothetical protein	NA	NA	NA	NA	NA
ASF00884.1|53691_54291_+	hypothetical protein	NA	NA	NA	NA	NA
ASF00885.1|54287_54812_+	transcriptional regulator	NA	J9Q6L0	Salmonella_phage	79.1	1.5e-66
ASF00886.1|55100_55751_+	hypothetical protein	NA	J9Q754	Salmonella_phage	84.7	1.1e-98
ASF00887.1|55799_56003_+	hypothetical protein	NA	J9Q7I3	Salmonella_phage	91.0	5.9e-27
ASF00888.1|56024_56255_+	hypothetical protein	NA	NA	NA	NA	NA
ASF00889.1|56870_57353_-	hypothetical protein	NA	J9Q805	Salmonella_phage	69.2	3.0e-61
ASF00890.1|57703_58078_-	hypothetical protein	NA	NA	NA	NA	NA
ASF00891.1|58196_58592_-	hypothetical protein	NA	J9Q7I1	Salmonella_phage	54.6	1.8e-32
ASF00892.1|58718_59030_-	hypothetical protein	NA	J9Q7T7	Salmonella_phage	64.1	3.3e-29
ASF00954.1|59184_59514_-	hypothetical protein	NA	NA	NA	NA	NA
ASF00893.1|59652_59871_-	hypothetical protein	NA	J9Q804	Salmonella_phage	91.7	2.3e-32
ASF00894.1|61411_61597_-	hypothetical protein	NA	NA	NA	NA	NA
ASF00955.1|61633_61855_-	hypothetical protein	NA	J9Q750	Salmonella_phage	55.2	1.6e-17
ASF00895.1|62094_64128_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SEZ7	Hokovirus	24.1	1.7e-44
ASF00896.1|64285_65386_+	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
ASF00897.1|65423_65813_-	DNA repair protein	NA	A0A077SK24	Escherichia_phage	92.2	1.2e-65
ASF00957.1|65985_66510_-	hypothetical protein	NA	A0A2D2W4T4	Escherichia_phage	48.5	3.8e-33
ASF00956.2|66523_67378_-	hypothetical protein	NA	A0A0F6TJ66	Escherichia_coli_O157_typing_phage	94.8	1.5e-23
ASF00898.1|67374_67596_-	hypothetical protein	NA	G8C7S3	Escherichia_phage	52.1	3.6e-09
ASF00899.1|67588_68164_-	DUF551 domain-containing protein	NA	K7P7E4	Enterobacteria_phage	55.3	5.6e-38
ASF00900.1|68165_68552_-	hypothetical protein	NA	A0A088CE95	Shigella_phage	74.2	9.5e-42
ASF00901.1|68562_68826_-	hypothetical protein	NA	A0A2P0P958	Salmonella_phage	72.4	1.1e-30
ASF00902.1|68827_69223_-	hypothetical protein	NA	C6ZR27	Salmonella_phage	50.4	1.8e-19
ASF00903.1|69233_69497_-	hypothetical protein	NA	A0A2P0P958	Salmonella_phage	71.3	1.5e-30
ASF00904.1|69498_70020_-	hypothetical protein	NA	A0A2I6TCG8	Escherichia_phage	72.6	1.8e-35
ASF00905.1|70016_70340_-	carboxylate--amine ligase	NA	A0A222YZB4	Escherichia_phage	86.3	4.7e-42
ASF00906.1|70341_70872_-	hypothetical protein	NA	A0A077SLK5	Escherichia_phage	47.3	5.9e-34
ASF00907.1|70858_71113_-	hypothetical protein	NA	A0A1V0E5L1	Salmonella_phage	95.2	4.2e-38
ASF00908.1|71109_71652_-	hypothetical protein	NA	A5VWB1	Enterobacteria_phage	78.6	1.3e-44
ASF00909.1|71790_72171_-	hypothetical protein	NA	J9Q801	Salmonella_phage	66.3	1.9e-26
ASF00910.1|72170_72875_-	hypothetical protein	NA	J9Q6K2	Salmonella_phage	75.0	2.6e-85
ASF00911.1|72936_74622_-	DUF4942 domain-containing protein	NA	J9Q747	Salmonella_phage	91.6	0.0e+00
ASF00958.2|74725_75400_-	hypothetical protein	NA	A0A0E3GMH9	Enterobacteria_phage	80.4	6.9e-96
ASF00912.1|75345_75627_-	hypothetical protein	NA	A0A0E3JPW0	Enterobacteria_phage	69.9	2.8e-35
ASF00913.1|75681_76251_-	hypothetical protein	NA	J9Q7H6	Salmonella_phage	60.3	1.5e-51
ASF00914.1|76390_76549_-	DUF3927 domain-containing protein	NA	NA	NA	NA	NA
ASF00915.1|76548_76974_-	tellurite/colicin resistance protein	NA	Q71TK7	Escherichia_phage	80.1	4.4e-56
ASF00916.1|77067_77256_-	hypothetical protein	NA	J9Q800	Salmonella_phage	51.6	9.4e-11
ASF00917.1|77252_77504_-	hypothetical protein	NA	NA	NA	NA	NA
ASF00918.1|77905_78499_-	ribonuclease HI	NA	J9Q745	Salmonella_phage	83.8	4.8e-93
ASF00919.1|79080_79311_-	hypothetical protein	NA	J9Q7H5	Salmonella_phage	84.2	3.4e-31
ASF00920.1|79498_80092_-	phage N-6-adenine-methyltransferase	NA	J9Q7T2	Salmonella_phage	85.3	5.0e-98
ASF00921.1|80274_81084_-	hypothetical protein	NA	J9Q7Z9	Salmonella_phage	53.6	1.2e-65
ASF00922.1|81244_81802_-	3'-5' exonuclease	NA	J9Q6J8	Salmonella_phage	83.6	2.8e-87
ASF00923.1|81811_82231_-	hypothetical protein	NA	J9Q743	Salmonella_phage	71.2	9.3e-51
AVL26714.1|82292_82937_-	hypothetical protein	NA	J9Q7H4	Salmonella_phage	81.8	4.6e-97
ASF00924.1|82936_83413_-	dihydrofolate reductase	NA	J9Q7T1	Salmonella_phage	89.2	1.3e-80
ASF00925.1|83409_83823_-	hypothetical protein	NA	J9Q7Z8	Salmonella_phage	86.9	1.1e-64
ASF00926.1|83824_84928_-	thymidylate synthase	NA	J9Q6J6	Salmonella_phage	87.2	1.7e-192
AVL26715.1|85095_85965_-	phosphoribosyl-ATP pyrophosphohydrolase	NA	J9Q742	Salmonella_phage	80.6	5.3e-133
ASF00927.1|86042_87185_-	ribonucleotide-diphosphate reductase subunit beta	NA	J9Q7H3	Salmonella_phage	88.4	7.6e-196
ASF00928.1|87293_89609_-	ribonucleoside-diphosphate reductase subunit alpha	NA	J9Q7T0	Salmonella_phage	84.0	0.0e+00
ASF00929.1|89682_90252_-	hypothetical protein	NA	J9Q7Z7	Salmonella_phage	85.7	1.1e-89
ASF00930.1|90261_91005_-	hypothetical protein	NA	J9Q6J5	Salmonella_phage	46.8	7.5e-51
ASF00931.1|90994_92911_-	exonuclease	NA	J9Q741	Salmonella_phage	72.7	1.1e-247
ASF00959.1|92907_93099_-	hypothetical protein	NA	J9Q7H1	Salmonella_phage	74.6	8.3e-23
ASF00932.1|93140_94226_-	exonuclease	NA	J9Q7S9	Salmonella_phage	87.5	8.0e-187
ASF00933.1|94480_95125_-	hypothetical protein	NA	J9Q739	Salmonella_phage	85.8	4.1e-106
ASF00934.1|95446_96541_+	replication initiation protein	NA	J9Q7H0	Salmonella_phage	45.4	1.3e-75
ASF00935.1|97120_97333_-	hypothetical protein	NA	J9Q7S8	Salmonella_phage	94.3	3.4e-33
ASF00936.1|97332_97668_-	hypothetical protein	NA	J9Q7Z5	Salmonella_phage	73.9	8.6e-39
ASF00937.1|97664_97844_-	hypothetical protein	NA	J9Q6J1	Salmonella_phage	67.8	4.0e-11
ASF00938.1|97883_98159_-	hypothetical protein	NA	J9Q738	Salmonella_phage	73.6	9.8e-33
ASF00960.1|98214_98631_-	hypothetical protein	NA	J9Q7G9	Salmonella_phage	76.1	1.3e-60
ASF00939.1|98701_99091_-	hypothetical protein	NA	Q9EYC4	Enterobacteria_phage	82.5	4.3e-58
ASF00940.1|99111_99852_-	hypothetical protein	NA	G4KK93	Yersinia_phage	32.7	9.8e-27
ASF00941.1|99899_100724_-	hypothetical protein	NA	A0A0U4IID7	Pseudomonas_phage	25.3	4.1e-18
ASF00942.1|100819_101650_-|protease	serine protease	protease	J9Q7Z4	Salmonella_phage	94.9	3.1e-122
ASF00943.1|101653_101854_-	hypothetical protein	NA	J9Q6J0	Salmonella_phage	60.6	3.2e-09
ASF00944.1|101946_103020_-	recombinase	NA	J9Q736	Salmonella_phage	95.2	1.4e-196
ASF00945.1|103022_103289_-	hypothetical protein	NA	J9Q7G8	Salmonella_phage	78.4	6.8e-31
ASF00946.1|103288_104233_-	exonuclease	NA	J9Q7S6	Salmonella_phage	90.8	2.3e-166
ASF00947.1|104293_105322_-	regulator	NA	J9Q7Z3	Salmonella_phage	87.6	5.5e-145
ASF00948.1|105439_105871_-	hypothetical protein	NA	J9Q6I8	Salmonella_phage	86.7	1.5e-64
ASF00949.1|105996_109515_-	DNA polymerase III subunit alpha	NA	J9Q7Z2	Salmonella_phage	94.1	0.0e+00
ASF00950.1|109489_109693_-	hypothetical protein	NA	J9Q6I7	Salmonella_phage	92.5	5.2e-31
>prophage 1
CP022087	Escherichia coli O104:H4 strain FDAARGOS_348 plasmid unnamed2, complete sequence	75559	14901	63791	75559	transposase,integrase,protease	Stx2-converting_phage(21.05%)	46	29582:29599	67999:68016
ASF05955.1|14901_16470_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	59.9	5.6e-141
ASF05956.1|16579_17713_-|transposase	IS110 family transposase ISEc45	transposase	NA	NA	NA	NA
ASF05957.1|18687_19899_-	acyltransferase	NA	NA	NA	NA	NA
ASF05958.1|19915_20545_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.4	1.2e-20
ASF05959.1|20537_21176_-	hypothetical protein	NA	NA	NA	NA	NA
ASF05960.1|21255_22494_-	hypothetical protein	NA	NA	NA	NA	NA
ASF05961.1|22490_23621_-	permease	NA	NA	NA	NA	NA
ASF05962.1|24000_24249_+|transposase	IS3 family transposase	transposase	A0A0N7BVE9	Escherichia_phage	82.4	1.2e-24
ASF05963.1|24242_24335_+|transposase	IS66 family transposase	transposase	NA	NA	NA	NA
ASF05964.1|24391_24628_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	63.8	2.0e-18
ASF05965.2|24599_25775_-|protease	serine protease	protease	Q9LA58	Enterobacterial_phage	46.8	4.2e-72
AVL26920.1|25746_26394_-|protease	serine protease	protease	Q9LA58	Enterobacterial_phage	43.1	6.1e-33
ASF05966.1|27915_28116_-	hypothetical protein	NA	NA	NA	NA	NA
ASF05967.1|28708_29689_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.1	6.8e-185
29582:29599	attL	ATTCTGCCATGGCAGAAT	NA	NA	NA	NA
ASF05969.1|30409_30634_-	hypothetical protein	NA	A0A0N7BTS3	Escherichia_phage	96.0	6.4e-06
ASF05970.1|33878_34034_-	reverse transcriptase	NA	NA	NA	NA	NA
ASF06012.1|34327_34699_+	hypothetical protein	NA	NA	NA	NA	NA
ASF05972.1|36164_36962_+	transcriptional activator AggR	NA	NA	NA	NA	NA
ASF05973.1|38895_39876_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	98.8	3.4e-184
ASF05974.1|40690_41230_-	isopentenyl-diphosphate Delta-isomerase	NA	NA	NA	NA	NA
ASF05975.2|41233_42262_-	hypothetical protein	NA	NA	NA	NA	NA
ASF05977.1|42697_43198_+|transposase	transposase	transposase	A0A1B1P776	Bacillus_phage	28.2	2.4e-08
ASF05980.1|44213_45752_-|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	93.9	1.2e-281
ASF05981.1|45801_46149_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
ASF06013.1|46145_46526_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	98.4	2.7e-65
ASF05982.1|47319_47823_-	AAF/I fimbrial subunit	NA	NA	NA	NA	NA
AVL26921.1|48374_50903_-	pilin outer membrane usher protein SafC	NA	NA	NA	NA	NA
AVL26922.1|50916_51675_-	molecular chaperone	NA	NA	NA	NA	NA
ASF05983.1|51815_52019_-	hypothetical protein	NA	NA	NA	NA	NA
ASF05984.1|51988_52099_-	invasion protein	NA	NA	NA	NA	NA
ASF05985.1|52331_52511_+	hypothetical protein	NA	NA	NA	NA	NA
ASF06015.1|52517_53084_-	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	45.6	4.8e-34
ASF05986.1|53215_53593_+	peptidase	NA	A0A1W6JNS2	Morganella_phage	47.2	6.1e-25
ASF06014.1|54794_54866_+	DUF4113 domain-containing protein	NA	NA	NA	NA	NA
ASF05987.1|54867_55284_-	recombinase	NA	NA	NA	NA	NA
ASF05988.1|55276_56257_-	recombinase	NA	A0A0A7NPX4	Enterobacteria_phage	51.4	2.2e-79
ASF05989.1|56670_56979_-	molecular chaperone GroEL	NA	NA	NA	NA	NA
ASF05990.1|57065_57710_-	ParA family protein	NA	NA	NA	NA	NA
ASF05991.1|57888_58695_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	93.9	2.7e-54
ASF05992.1|58695_59001_-	plasmid maintenance protein CcdB	NA	NA	NA	NA	NA
ASF05993.1|59002_59221_-	plasmid maintenance protein CcdA	NA	NA	NA	NA	NA
AVL26923.1|59815_60046_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
ASF06016.1|60069_60471_+	PIN domain-containing protein	NA	NA	NA	NA	NA
ASF05994.2|60996_61485_+	hypothetical protein	NA	NA	NA	NA	NA
AVL26924.1|61794_62772_+	replication initiation protein	NA	J9Q7H0	Salmonella_phage	59.2	8.8e-100
ASF05995.1|63050_63791_-|integrase	site-specific integrase	integrase	I3WFA4	Macacine_betaherpesvirus	57.6	1.6e-24
67999:68016	attR	ATTCTGCCATGGCAGAAT	NA	NA	NA	NA
>prophage 2
CP022087	Escherichia coli O104:H4 strain FDAARGOS_348 plasmid unnamed2, complete sequence	75559	67908	74862	75559	transposase	Stx2-converting_phage(50.0%)	9	NA	NA
ASF06002.1|67908_68889_+|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	98.8	3.4e-184
AVL26926.1|68926_69049_-	sugar kinase	NA	Q6QLL3	Human_immunodeficiency_virus	92.5	9.0e-15
ASF06003.1|69616_70294_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
ASF06004.1|70293_70641_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
ASF06005.1|70660_72232_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.5	2.2e-169
ASF06006.1|72544_72841_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZDM8	Stx2-converting_phage	64.4	3.4e-31
ASF06007.1|72837_73275_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	60.3	3.4e-19
ASF06008.1|73500_74061_-	conjugal transfer protein	NA	NA	NA	NA	NA
ASF06009.1|74115_74862_-	conjugal transfer pilus acetylase TraX	NA	A0A077JBM8	Xanthomonas_phage	30.9	3.2e-09
