The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP022069	Salmonella enterica strain FDAARGOS_313 chromosome, complete genome	4916780	1017639	1067343	4916780	integrase,head,terminase,lysis,tail,protease	Salmonella_phage(69.01%)	74	1017580:1017625	1068323:1068368
1017580:1017625	attL	CTTCTAAGCCGTGGGTCGCAGGTTCGAATCCTGCAGGGCGCGCCAT	NA	NA	NA	NA
ASE72755.1|1017639_1018803_-|integrase	site-specific integrase	integrase	B9UDL9	Salmonella_phage	99.0	1.6e-225
AVK72778.1|1018658_1019030_-	DNA-binding protein	NA	B9UDM0	Salmonella_phage	99.2	7.2e-63
ASE72756.1|1019032_1019407_-	hypothetical protein	NA	A0A1V0E5M6	Salmonella_phage	85.5	7.8e-57
ASE72757.1|1019479_1019764_-	ASCH domain-containing protein	NA	A0A2D1GLL3	Escherichia_phage	98.9	1.2e-49
ASE72758.1|1019756_1020329_-	DUF551 domain-containing protein	NA	K7P7E4	Enterobacteria_phage	64.9	4.0e-68
ASE72759.1|1021014_1021269_-	hypothetical protein	NA	A0A1V0E5L1	Salmonella_phage	96.4	1.4e-38
ASE76382.1|1021297_1021432_-	DUF2737 domain-containing protein	NA	Q716F2	Shigella_phage	97.6	4.5e-15
ASE72760.1|1021442_1021739_-	RecBCD nuclease inhibitor	NA	A5VWB0	Enterobacteria_phage	96.9	3.3e-50
ASE72761.1|1021754_1022303_-	3'-5' exoribonuclease	NA	C6ZR35	Salmonella_phage	100.0	2.1e-106
ASE72762.1|1022311_1022818_-	single-stranded DNA-binding protein	NA	C6ZR36	Salmonella_phage	98.8	1.1e-90
ASE72763.1|1022818_1023526_-	recombinase	NA	E7C9Q0	Salmonella_phage	95.3	4.3e-133
ASE72764.1|1023534_1023723_-	hypothetical protein	NA	C6ZR38	Salmonella_phage	100.0	1.3e-28
ASE72765.1|1023719_1023833_-	host cell division inhibitory peptide Kil	NA	C6ZR39	Salmonella_phage	100.0	7.8e-13
ASE76383.1|1023825_1023987_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	E7C9Q3	Salmonella_phage	100.0	4.9e-24
ASE72766.1|1024056_1024371_-	superinfection exclusion protein	NA	E7C9Q4	Salmonella_phage	99.0	4.2e-56
ASE72767.1|1024522_1025533_-	hypothetical protein	NA	Q5G8T6	Enterobacteria_phage	79.8	5.0e-74
ASE72768.1|1025561_1025924_-	antitermination protein	NA	C6ZR44	Salmonella_phage	91.7	1.7e-56
ASE72769.1|1026302_1026506_+	hypothetical protein	NA	A0A2H5BFH9	Salmonella_phage	97.0	2.3e-26
ASE76385.1|1026642_1026996_-	hypothetical protein	NA	NA	NA	NA	NA
ASE76384.1|1027027_1027465_-	hypothetical protein	NA	C6ZR46	Salmonella_phage	97.2	3.7e-74
ASE72770.1|1027528_1028239_-	phage repressor protein	NA	G9L676	Escherichia_phage	87.3	6.8e-118
ASE72771.1|1028316_1028544_+	DNA-binding protein	NA	G9L677	Escherichia_phage	89.3	2.1e-33
ASE72772.1|1028680_1028974_+	hypothetical protein	NA	I6RSP4	Salmonella_phage	92.8	1.0e-40
ASE72773.1|1029154_1030003_+	replication protein	NA	C6ZR51	Salmonella_phage	94.3	5.2e-149
ASE72774.1|1030110_1031991_+	bifunctional DNA primase/helicase	NA	Q5G8S8	Enterobacteria_phage	98.6	0.0e+00
ASE72775.1|1031991_1032270_+	hypothetical protein	NA	Q5G8S7	Enterobacteria_phage	96.7	5.4e-47
ASE72776.1|1032342_1032669_+	hypothetical protein	NA	Q716D0	Shigella_phage	100.0	3.3e-59
ASE72777.1|1032665_1032866_+	hypothetical protein	NA	Q716C9	Shigella_phage	100.0	4.6e-32
ASE72778.1|1032877_1033207_+	hypothetical protein	NA	K7PHN9	Enterobacterial_phage	67.7	4.6e-37
ASE72779.1|1033163_1033610_+	recombination protein NinB	NA	I6R0N7	Salmonella_phage	96.6	7.8e-80
ASE72780.1|1033606_1033780_+	protein ninD	NA	C6ZR56	Salmonella_phage	100.0	5.2e-32
ASE72781.1|1033746_1033908_+	NinE family protein	NA	Q5G8S3	Enterobacteria_phage	100.0	1.7e-21
ASE72782.1|1033918_1034098_+	NinF family protein	NA	I6R994	Salmonella_phage	100.0	4.3e-29
ASE72783.1|1034072_1034681_+	protein NinG	NA	I6S604	Salmonella_phage	96.5	4.0e-95
ASE72784.1|1034677_1035349_+	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	95.5	2.0e-127
ASE72785.1|1035339_1035846_+	DUF1133 domain-containing protein	NA	Q716B8	Shigella_phage	98.8	2.7e-92
ASE72786.1|1036052_1036565_+	HNH endonuclease	NA	K7PL52	Enterobacteria_phage	99.4	1.4e-96
ASE72787.1|1037020_1037224_+	hypothetical protein	NA	I6R0S9	Salmonella_phage	98.5	1.5e-33
ASE76386.1|1037201_1037699_+	lysozyme	NA	I6R0P2	Salmonella_phage	98.2	1.2e-89
ASE72788.1|1037695_1038163_+|lysis	lysis protein	lysis	A0A192Y689	Salmonella_phage	94.8	9.7e-73
ASE72789.1|1038213_1038402_+	hypothetical protein	NA	A0A2I7RUD6	Vibrio_phage	82.0	3.2e-19
ASE72790.1|1038795_1039227_+|terminase	terminase small subunit	terminase	A0A1V0E5Q4	Salmonella_phage	100.0	7.6e-72
ASE72791.1|1039210_1040530_+|terminase	PBSX family phage terminase large subunit	terminase	H6WRS9	Salmonella_phage	99.5	1.6e-261
ASE72792.1|1040662_1042015_+	DUF1073 domain-containing protein	NA	H6WRT0	Salmonella_phage	99.8	1.5e-259
ASE72793.1|1041968_1042928_+|head	phage head morphogenesis protein	head	H6WRT1	Salmonella_phage	97.8	1.8e-174
ASE72794.1|1042943_1044206_+	hypothetical protein	NA	H6WRT2	Salmonella_phage	99.8	1.1e-238
ASE72795.1|1044218_1044665_+	hypothetical protein	NA	H6WRT3	Salmonella_phage	98.6	9.9e-75
ASE72796.1|1044682_1045759_+	hypothetical protein	NA	Q5G8Y0	Enterobacteria_phage	96.9	5.7e-201
ASE72797.1|1045768_1046062_+	hypothetical protein	NA	A0A1V0E5P8	Salmonella_phage	90.7	3.8e-43
ASE72798.1|1046123_1046330_+	hypothetical protein	NA	NA	NA	NA	NA
ASE72799.1|1046332_1046734_+	hypothetical protein	NA	I6S619	Salmonella_phage	75.2	3.0e-54
ASE72800.1|1046733_1046913_+	DUF551 domain-containing protein	NA	Q5G8X7	Enterobacteria_phage	94.9	2.8e-28
ASE72801.1|1046905_1047268_+	hypothetical protein	NA	H6WRT8	Salmonella_phage	96.7	5.2e-66
ASE72802.1|1047275_1047713_+	hypothetical protein	NA	H6WRT9	Salmonella_phage	97.2	3.3e-75
ASE72803.1|1047709_1048096_+	hypothetical protein	NA	A0A1V0E5P4	Salmonella_phage	94.5	4.3e-66
ASE72804.1|1048111_1048846_+	hypothetical protein	NA	A0A1V0E5P2	Salmonella_phage	89.3	1.2e-117
ASE72806.1|1049403_1050057_+	hypothetical protein	NA	I6R0Q2	Salmonella_phage	98.2	1.6e-118
ASE72807.1|1050278_1051007_+	DNA-binding protein	NA	H6WRU3	Salmonella_phage	100.0	3.1e-142
ASE72808.1|1051028_1051400_-	hypothetical protein	NA	H6WRU4	Salmonella_phage	99.2	1.9e-63
ASE72809.1|1051598_1051925_-	Arc family DNA-binding protein	NA	H6WRU6	Salmonella_phage	100.0	3.3e-51
ASE72810.1|1052035_1052209_+	toxin-antitoxin system HicB family antitoxin	NA	H6WRU7	Salmonella_phage	100.0	5.8e-23
ASE72811.1|1052198_1052921_+	hypothetical protein	NA	H6WRU8	Salmonella_phage	86.2	3.9e-113
ASE76387.1|1053004_1053778_+	phage antirepressor Ant	NA	H6WRU9	Salmonella_phage	66.1	1.0e-79
ASE72812.1|1053891_1054746_-	phage antirepressor Ant	NA	I6R977	Salmonella_phage	54.8	2.1e-81
AVK72779.1|1055055_1055700_+	hypothetical protein	NA	NA	NA	NA	NA
ASE72813.1|1055768_1058948_+	hypothetical protein	NA	Q5G8W8	Enterobacteria_phage	58.4	4.7e-235
ASE72814.1|1059113_1059461_+|tail	phage tail protein	tail	Q5G8W6	Enterobacteria_phage	93.9	5.9e-59
ASE72815.1|1059672_1059930_-	hypothetical protein	NA	K7P7V5	Enterobacteria_phage	87.7	9.5e-30
ASE76388.1|1060098_1060803_+|tail	phage minor tail protein L	tail	A0A1V0E5N2	Salmonella_phage	97.4	6.0e-135
ASE72816.1|1060802_1061522_+|tail	phage tail protein	tail	I6S1R8	Salmonella_phage	97.5	1.2e-143
ASE72817.1|1061464_1061992_+|tail	tail assembly protein	tail	H6WRW3	Salmonella_phage	82.2	4.2e-64
ASE72818.1|1062001_1065184_+	host specificity protein J	NA	H6WRW4	Salmonella_phage	93.3	0.0e+00
ASE72819.1|1065192_1066152_+	hypothetical protein	NA	H6WRW5	Salmonella_phage	96.6	7.9e-178
ASE72820.1|1066161_1067343_+	hypothetical protein	NA	S4TSP4	Salmonella_phage	74.0	1.0e-57
1068323:1068368	attR	CTTCTAAGCCGTGGGTCGCAGGTTCGAATCCTGCAGGGCGCGCCAT	NA	NA	NA	NA
>prophage 2
CP022069	Salmonella enterica strain FDAARGOS_313 chromosome, complete genome	4916780	1293042	1334157	4916780	integrase,portal,coat,terminase,lysis,tail,protease	Salmonella_phage(62.3%)	67	1292953:1292977	1334426:1334450
1292953:1292977	attL	CTGCTTTTTTATACTAAGTTGAACG	NA	NA	NA	NA
ASE73019.1|1293042_1294113_-|integrase	integrase	integrase	A0A1V0E5M7	Salmonella_phage	99.6	3.0e-154
ASE73020.1|1294090_1294309_-	excisionase	NA	A0A1V0E5M4	Salmonella_phage	100.0	5.7e-36
ASE73021.1|1294418_1295048_-	Eac protein	NA	A0A220NQT7	Salmonella_phage	93.3	7.6e-113
ASE73022.1|1295118_1295403_-	ASCH domain-containing protein	NA	A0A2D1GLL3	Escherichia_phage	97.9	1.7e-48
ASE73023.1|1295395_1295968_-	DUF551 domain-containing protein	NA	K7P7E4	Enterobacteria_phage	64.9	4.0e-68
ASE73024.1|1296653_1296908_-	hypothetical protein	NA	A0A1V0E5L1	Salmonella_phage	96.4	1.4e-38
ASE76401.1|1296936_1297071_-	DUF2737 domain-containing protein	NA	Q716F2	Shigella_phage	97.6	4.5e-15
ASE73025.1|1297081_1297378_-	RecBCD nuclease inhibitor	NA	A5VWB0	Enterobacteria_phage	96.9	3.3e-50
ASE73026.1|1297393_1297942_-	3'-5' exoribonuclease	NA	C6ZR35	Salmonella_phage	100.0	2.1e-106
ASE73027.1|1297950_1298457_-	single-stranded DNA-binding protein	NA	C6ZR36	Salmonella_phage	98.8	1.1e-90
ASE73028.1|1298457_1299165_-	recombinase	NA	E7C9Q0	Salmonella_phage	95.3	4.3e-133
ASE73029.1|1299173_1299362_-	hypothetical protein	NA	C6ZR38	Salmonella_phage	100.0	1.3e-28
ASE73030.1|1299358_1299472_-	host cell division inhibitory peptide Kil	NA	C6ZR39	Salmonella_phage	100.0	7.8e-13
ASE76402.1|1299464_1299626_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	E7C9Q3	Salmonella_phage	100.0	4.9e-24
ASE73031.1|1299695_1300010_-	superinfection exclusion protein	NA	E7C9Q4	Salmonella_phage	99.0	4.2e-56
ASE73032.1|1300161_1301172_-	hypothetical protein	NA	Q5G8T6	Enterobacteria_phage	79.5	1.5e-73
ASE73033.1|1301200_1301563_-	antitermination protein	NA	C6ZR44	Salmonella_phage	92.5	4.4e-57
ASE73034.1|1301930_1302140_+	fumarate hydratase FumD	NA	I6R0R9	Salmonella_phage	95.7	2.2e-29
ASE73035.1|1302281_1303040_-	DUF1828 domain-containing protein	NA	NA	NA	NA	NA
ASE73036.1|1303036_1303573_-	hypothetical protein	NA	NA	NA	NA	NA
ASE73037.1|1303667_1304321_-	helix-turn-helix domain-containing protein	NA	I6R0S2	Salmonella_phage	99.1	3.3e-127
ASE73038.1|1304430_1304640_+	XRE family transcriptional regulator	NA	I6S1U2	Salmonella_phage	100.0	2.1e-35
ASE73039.1|1304770_1305064_+	hypothetical protein	NA	I6RSP4	Salmonella_phage	92.8	1.0e-40
ASE73040.1|1305244_1306093_+	replication protein	NA	C6ZR51	Salmonella_phage	94.3	5.2e-149
ASE73041.1|1306200_1308081_+	bifunctional DNA primase/helicase	NA	Q5G8S8	Enterobacteria_phage	98.6	0.0e+00
ASE73042.1|1308081_1308360_+	hypothetical protein	NA	Q5G8S7	Enterobacteria_phage	96.7	5.4e-47
ASE73043.1|1308432_1308759_+	hypothetical protein	NA	Q716D0	Shigella_phage	100.0	3.3e-59
ASE73044.1|1308755_1308956_+	hypothetical protein	NA	Q716C9	Shigella_phage	100.0	4.6e-32
ASE73045.1|1308967_1309210_+	hypothetical protein	NA	NA	NA	NA	NA
ASE73046.1|1309212_1309401_+	hypothetical protein	NA	A0A1R3Y6Z7	Salmonella_virus	93.5	1.5e-24
ASE73047.1|1309357_1309804_+	recombination protein NinB	NA	A0A1R3Y605	Salmonella_virus	98.6	7.8e-80
ASE73048.1|1309800_1309974_+	protein ninD	NA	C6ZR56	Salmonella_phage	100.0	5.2e-32
ASE73049.1|1309940_1310117_+	NinE family protein	NA	I6RSI9	Salmonella_phage	100.0	2.3e-27
ASE73050.1|1310113_1310293_+	NinF family protein	NA	I6R994	Salmonella_phage	100.0	4.3e-29
ASE73051.1|1310267_1310876_+	protein NinG	NA	I6S604	Salmonella_phage	97.5	4.8e-96
ASE73052.1|1310872_1311079_+	protein ninH	NA	Q716C0	Shigella_phage	100.0	7.3e-33
ASE73053.1|1311056_1311728_+	serine/threonine protein phosphatase	NA	Q716B9	Shigella_phage	98.7	3.5e-132
ASE73054.1|1311718_1312237_+	DUF1133 domain-containing protein	NA	A5VW83	Enterobacteria_phage	98.3	7.7e-95
ASE73055.1|1312431_1312944_+	HNH endonuclease	NA	K7PL52	Enterobacteria_phage	99.4	1.4e-96
ASE73056.1|1313533_1313737_+	hypothetical protein	NA	I6R0S9	Salmonella_phage	100.0	1.1e-33
ASE76403.1|1313714_1314212_+	lysozyme	NA	I6R0P2	Salmonella_phage	98.8	6.4e-91
ASE73057.1|1314208_1314676_+|lysis	lysis protein	lysis	A0A192Y689	Salmonella_phage	94.8	9.7e-73
ASE73058.1|1314726_1314915_+	hypothetical protein	NA	A0A2I7RUD6	Vibrio_phage	82.0	3.2e-19
ASE73059.1|1315210_1315453_+	DUF2560 domain-containing protein	NA	A0A0M4R322	Salmonella_phage	98.8	8.3e-36
ASE73060.1|1315455_1315860_+	Decoration protein	NA	C6ZR73	Salmonella_phage	97.8	4.5e-66
ASE73061.1|1315872_1316331_+|terminase	terminase	terminase	A0A2P1MXF5	Escherichia_phage	66.2	3.3e-49
ASE73062.1|1316330_1317791_+|terminase	terminase	terminase	W6MW26	Pseudomonas_phage	76.7	2.0e-220
ASE73063.1|1317790_1319968_+|portal	portal protein	portal	A0A2H4FNE2	Salmonella_phage	99.9	0.0e+00
ASE73064.1|1319981_1320893_+	scaffolding protein	NA	A0A192Y6T4	Salmonella_phage	100.0	4.9e-161
ASE73065.1|1320892_1322185_+|coat	coat protein	coat	A0A192Y6V4	Salmonella_phage	99.8	7.2e-243
ASE73066.1|1322223_1322433_+	hypothetical protein	NA	A0A192Y697	Salmonella_phage	98.6	4.8e-32
ASE73067.1|1322416_1322917_+	hypothetical protein	NA	I1TEJ0	Salmonella_phage	100.0	3.2e-90
ASE73068.1|1322876_1324295_+	hypothetical protein	NA	A0A075B8I2	Enterobacteria_phage	97.9	2.5e-273
ASE73069.1|1324298_1324937_+|tail	phage tail protein	tail	A0A088CPT1	Enterobacteria_phage	94.3	5.7e-84
ASE73070.1|1324936_1325392_+	hypothetical protein	NA	B8K1I4	Salmonella_phage	98.7	6.7e-87
ASE73071.1|1325394_1326087_+	DNA transfer protein	NA	A5VW66	Enterobacteria_phage	96.5	1.4e-112
ASE73072.1|1326097_1327462_+	DNA transfer protein	NA	A0A2H4FND5	Salmonella_phage	98.0	6.2e-237
ASE73073.1|1327461_1329327_+	DNA transfer protein	NA	A0A2H4FNB8	Salmonella_phage	98.2	0.0e+00
ASE73074.1|1329344_1329533_-	hypothetical protein	NA	NA	NA	NA	NA
ASE73075.1|1329563_1329929_+	hypothetical protein	NA	A0A192Y6W5	Salmonella_phage	99.2	8.1e-67
ASE73076.1|1329942_1330167_-	hypothetical protein	NA	NA	NA	NA	NA
ASE73077.1|1330192_1330378_+	hypothetical protein	NA	I6RSG3	Salmonella_phage	93.4	5.3e-06
ASE73078.1|1330387_1330705_-	hypothetical protein	NA	NA	NA	NA	NA
ASE73079.1|1330701_1330953_-	Arc family DNA-binding protein	NA	A5VW59	Enterobacteria_phage	95.1	3.9e-36
ASE73080.1|1331057_1331204_+	Arc family DNA-binding protein	NA	A0A0M4S6R9	Salmonella_phage	95.8	8.0e-18
ASE73081.1|1331270_1332200_+	phage antirepressor Ant	NA	A5VW58	Enterobacteria_phage	90.9	2.9e-161
ASE73082.1|1332300_1334157_+|tail	phage tail protein	tail	S4TVJ1	Salmonella_phage	90.1	2.3e-274
1334426:1334450	attR	CTGCTTTTTTATACTAAGTTGAACG	NA	NA	NA	NA
>prophage 3
CP022069	Salmonella enterica strain FDAARGOS_313 chromosome, complete genome	4916780	1458655	1465966	4916780	integrase,protease	Dickeya_phage(16.67%)	8	1459906:1459920	1471338:1471352
ASE73194.2|1458655_1459774_+	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	38.9	1.4e-08
ASE73195.1|1459770_1461717_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	43.1	2.0e-39
1459906:1459920	attL	GGAAAATCAACGCTG	NA	NA	NA	NA
ASE73196.1|1461697_1461892_+	hypothetical protein	NA	NA	NA	NA	NA
ASE73197.1|1461846_1462068_-	cold shock domain protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	9.3e-18
ASE73198.1|1462391_1462712_+|protease	ATP-dependent Clp protease adaptor ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	4.5e-13
ASE73199.1|1462742_1465019_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	6.2e-165
ASE73200.1|1465229_1465427_-	hypothetical protein	NA	NA	NA	NA	NA
ASE73201.1|1465588_1465966_-|integrase	integrase	integrase	A0A077KET4	Ralstonia_phage	42.7	7.7e-20
1471338:1471352	attR	CAGCGTTGATTTTCC	NA	NA	NA	NA
>prophage 4
CP022069	Salmonella enterica strain FDAARGOS_313 chromosome, complete genome	4916780	1516608	1607264	4916780	holin,portal,transposase,head,terminase,lysis,tRNA,capsid,tail,protease	Salmonella_phage(42.37%)	100	NA	NA
ASE73241.1|1516608_1517412_+|tRNA	tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM	tRNA	NA	NA	NA	NA
ASE73242.1|1517404_1518727_+	chromosome partition protein MukF	NA	NA	NA	NA	NA
ASE73243.1|1518707_1519412_+	chromosome partition protein MukE	NA	NA	NA	NA	NA
ASE73244.1|1519411_1523878_+	chromosome partition protein MukB	NA	NA	NA	NA	NA
ASE73245.1|1524222_1526073_+	L,D-transpeptidase	NA	NA	NA	NA	NA
ASE73246.1|1526332_1526881_+	DUF882 domain-containing protein	NA	A0A0K1LKR7	Rhodobacter_phage	33.7	1.2e-05
ASE73247.1|1526908_1527556_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
ASE73248.1|1527617_1528808_-	aspartate aminotransferase	NA	NA	NA	NA	NA
ASE73249.1|1528992_1530084_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	51.7	1.3e-99
ASE73250.1|1530690_1532091_-|tRNA	asparagine--tRNA ligase	tRNA	A0A167RLM0	Powai_lake_megavirus	35.1	4.5e-81
ASE73251.1|1532291_1532753_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
ASE73252.1|1532749_1532983_-	hypothetical protein	NA	NA	NA	NA	NA
ASE73253.1|1533069_1534284_+	diaminopropionate ammonia-lyase	NA	NA	NA	NA	NA
ASE73254.1|1534529_1535963_+	sodium:alanine symporter family protein	NA	NA	NA	NA	NA
ASE73255.1|1536043_1537246_-	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
ASE73256.2|1537440_1538733_-	DUF3596 domain-containing protein	NA	S4TSP2	Salmonella_phage	100.0	3.4e-253
ASE73257.1|1538777_1539026_-	excisionase	NA	S4TND0	Salmonella_phage	100.0	4.7e-42
ASE73258.1|1539066_1539306_-	DUF4060 domain-containing protein	NA	S4TR31	Salmonella_phage	100.0	2.0e-37
ASE73259.1|1539348_1540506_-	enterohemolysin	NA	S4TTE8	Salmonella_phage	99.7	1.0e-216
ASE73260.1|1540468_1543669_-	DNA breaking-rejoining protein	NA	S4TNL0	Salmonella_phage	78.8	0.0e+00
ASE73261.1|1543795_1544146_-	DNA breaking-rejoining protein	NA	S4TSN6	Salmonella_phage	94.0	3.5e-59
ASE73262.1|1544194_1544326_-	hypothetical protein	NA	H6WRX3	Salmonella_phage	97.7	1.2e-17
ASE73263.1|1544622_1545057_-	transcriptional regulator	NA	H6WRX4	Salmonella_phage	38.2	2.5e-14
ASE73264.1|1545162_1545390_+	transcriptional regulator	NA	H6WRX5	Salmonella_phage	45.9	1.7e-14
ASE73265.1|1545424_1545745_+	hypothetical protein	NA	A0A0M4RU01	Salmonella_phage	100.0	1.3e-52
AVK72788.1|1545829_1546813_+	hypothetical protein	NA	H6WRX7	Salmonella_phage	99.3	2.1e-162
ASE73266.1|1546815_1547565_+	DNA replication protein DnaC	NA	S4TNF5	Salmonella_phage	100.0	4.3e-139
ASE73267.1|1547575_1547923_+	DUF977 domain-containing protein	NA	H6WRX9	Salmonella_phage	91.3	2.2e-53
ASE73268.1|1547919_1548378_+	hypothetical protein	NA	S4TNP2	Salmonella_phage	77.4	7.1e-44
ASE73269.1|1548381_1548690_+	hypothetical protein	NA	A0A1P8DTP0	Salmonella_phage	69.3	1.8e-30
ASE73270.1|1548693_1549338_+	hypothetical protein	NA	H6WRY2	Salmonella_phage	40.7	1.8e-29
ASE76412.1|1549337_1549595_+	hypothetical protein	NA	NA	NA	NA	NA
ASE73271.1|1549649_1550627_-	DUF4868 domain-containing protein	NA	NA	NA	NA	NA
AVK72789.1|1550638_1551235_-	hypothetical protein	NA	NA	NA	NA	NA
ASE73274.1|1551826_1552060_+	DNA damage-inducible protein I	NA	A0A0M4REN2	Salmonella_phage	87.0	1.2e-31
ASE73275.1|1552169_1552391_+	hypothetical protein	NA	NA	NA	NA	NA
ASE73276.1|1552475_1553078_+	DUF1367 domain-containing protein	NA	A0A0M4QX23	Salmonella_phage	99.0	7.5e-110
ASE73277.1|1553077_1553284_+	hypothetical protein	NA	S4TNP0	Salmonella_phage	98.5	4.6e-35
ASE73278.1|1553286_1553898_+	protein NinG	NA	A0A0M4RU10	Salmonella_phage	98.0	2.7e-91
ASE73279.1|1553894_1554035_+	YlcG family protein	NA	A0A0M5M7B2	Salmonella_phage	78.9	7.2e-08
ASE73280.1|1554031_1554721_+	antiterminator	NA	I6PDF8	Cronobacter_phage	50.6	1.1e-59
ASE73281.1|1554915_1555041_+	hypothetical protein	NA	NA	NA	NA	NA
AVK72790.1|1555176_1555626_-	hypothetical protein	NA	NA	NA	NA	NA
ASE73282.1|1555986_1556673_-|protease	type III secretion system effector protease GtgA	protease	Q9MBM0	Phage_Gifsy-2	100.0	2.1e-132
ASE76413.1|1556948_1557278_+|holin	phage holin, lambda family	holin	A0A0M3ULK9	Salmonella_phage	99.1	2.9e-55
ASE73283.1|1557261_1557714_+	lysozyme	NA	A0A0M4R365	Salmonella_phage	98.7	4.6e-80
ASE76414.1|1557731_1558181_+|lysis	lysis protein	lysis	A0A0M4RD57	Salmonella_phage	91.1	9.3e-65
ASE73284.1|1558509_1559013_+	hypothetical protein	NA	NA	NA	NA	NA
ASE73285.1|1559269_1559671_-	inhibitor of g-type lysozyme	NA	NA	NA	NA	NA
AVK72791.1|1559705_1559912_+	hypothetical protein	NA	NA	NA	NA	NA
ASE73286.1|1559956_1560502_+|terminase	terminase small subunit	terminase	A0A0U2S671	Escherichia_phage	80.6	1.5e-56
ASE73287.1|1560473_1562405_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	65.9	1.3e-259
ASE73288.1|1562388_1562592_+|tail	phage tail protein	tail	K7PM10	Enterobacteria_phage	73.8	1.9e-17
ASE73289.1|1562588_1564169_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	62.8	9.6e-189
ASE73290.1|1564158_1565655_+	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	52.2	1.1e-96
ASE73291.1|1565667_1566015_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	52.7	9.2e-20
ASE73292.1|1566069_1567098_+|capsid	minor capsid protein E	capsid	C6ZCY2	Enterobacteria_phage	61.1	2.3e-114
ASE73293.1|1567155_1567521_+	DNA packaging protein	NA	NA	NA	NA	NA
ASE73294.1|1567531_1567909_+|tail	phage tail protein	tail	A0A0K2FJB7	Enterobacteria_phage	55.6	1.5e-28
ASE73295.1|1567895_1568474_+|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	80.2	3.7e-82
ASE73296.1|1568470_1568872_+|tail	phage tail protein	tail	Q9G0F3	Phage_Gifsy-1	100.0	8.1e-52
ASE73297.1|1568879_1569626_+|tail	phage tail protein	tail	A0A291AWU6	Escherichia_phage	76.5	4.3e-99
ASE73298.1|1569676_1570072_+|tail	phage minor tail protein G	tail	A5LH36	Enterobacteria_phage	56.5	2.3e-30
ASE73299.1|1570068_1570407_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	62.4	1.3e-31
ASE73300.1|1570378_1573474_+|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	61.6	2.4e-276
ASE73301.1|1573476_1573806_+|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	71.3	7.3e-43
ASE73302.1|1573815_1574514_+|tail	phage minor tail protein L	tail	A0A1B5FP81	Escherichia_phage	75.9	2.1e-103
ASE73303.1|1574520_1575258_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	84.6	1.2e-128
ASE73304.1|1575155_1575803_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	78.1	2.7e-89
ASE73305.1|1575865_1579228_+	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	80.3	0.0e+00
ASE73306.1|1579266_1579500_+	hypothetical protein	NA	NA	NA	NA	NA
ASE73307.1|1579511_1580216_+|transposase	IS6 family transposase IS15DI	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
ASE73308.1|1580377_1581586_+	restriction endonuclease	NA	E5E3X4	Burkholderia_phage	42.5	2.1e-34
ASE73309.1|1581619_1583053_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	50.9	1.4e-106
ASE73310.1|1583412_1583775_-|transposase	transposase	transposase	NA	NA	NA	NA
ASE73311.1|1583787_1584456_+	putative tetracyline resistance transcriptional regulator TetC	NA	NA	NA	NA	NA
ASE73312.1|1584568_1585774_-	tetracycline efflux MFS transporter Tet(B)	NA	A0A2H4UVM2	Bodo_saltans_virus	24.4	2.3e-09
ASE73313.1|1585852_1586479_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
ASE73314.1|1586456_1587143_-	ArsR family transcriptional regulator	NA	NA	NA	NA	NA
ASE73315.1|1587150_1587537_-	amino acid-binding protein	NA	NA	NA	NA	NA
ASE73316.1|1587529_1587850_-	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
ASE73317.1|1588293_1589499_+	sodium/glutamate symporter	NA	NA	NA	NA	NA
ASE73319.1|1589864_1591073_-|transposase	IS4-like element ISVsa5 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	100.0	1.8e-235
ASE73320.1|1591358_1592162_+	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	Q75ZG1	Hepacivirus	34.3	4.9e-24
ASE73321.1|1592161_1592998_+	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
ASE73323.1|1593333_1594149_+	aminoglycoside O-phosphotransferase APH(3')-Ia	NA	A0A193DTG4	Autographa_californica_nuclear_polyhedrosis_virus	98.2	4.8e-160
ASE73324.1|1594302_1595178_-	acyl-CoA--6-aminopenicillanic acid acyl-transferase	NA	NA	NA	NA	NA
ASE73325.1|1595247_1598133_-|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	39.9	1.1e-190
ASE73326.1|1598418_1599123_-|transposase	IS6 family transposase IS15DI	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
ASE73327.1|1599113_1599353_+	hypothetical protein	NA	NA	NA	NA	NA
ASE73328.1|1599708_1600053_+	abortive infection protein	NA	NA	NA	NA	NA
ASE73329.1|1600843_1601659_-	sulfonamide-resistant dihydropteroate synthase Sul2	NA	NA	NA	NA	NA
ASE73330.1|1601757_1601880_-	invasion protein	NA	NA	NA	NA	NA
ASE73331.1|1601873_1602146_+	hypothetical protein	NA	NA	NA	NA	NA
ASE73332.1|1602126_1603335_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
ASE73333.2|1603449_1604364_-	DUF945 domain-containing protein	NA	A0A2C9CYF8	Yersinia_phage	37.0	4.1e-43
AVK72792.1|1604740_1604947_-	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
AVK72793.1|1605016_1605205_+	hypothetical protein	NA	NA	NA	NA	NA
ASE73334.2|1605636_1605894_-	type I toxin-antitoxin system hok family toxin	NA	NA	NA	NA	NA
ASE73335.1|1605894_1607264_-|transposase	IS3-like element IS150 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	100.0	1.3e-112
>prophage 5
CP022069	Salmonella enterica strain FDAARGOS_313 chromosome, complete genome	4916780	2429359	2472370	4916780	transposase,tail,protease	Salmonella_phage(27.27%)	41	NA	NA
ASE74122.1|2429359_2430568_+|transposase	IS4-like element ISVsa5 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	100.0	1.8e-235
ASE74123.1|2431097_2431439_+	type III secretion system chaperone SigE	NA	NA	NA	NA	NA
ASE76449.1|2431448_2431769_-	hypothetical protein	NA	E5G6P3	Salmonella_phage	76.6	1.2e-08
ASE74124.1|2431986_2432862_+	SPI-2 type III secretion system effector PipB	NA	NA	NA	NA	NA
ASE74125.1|2433083_2433764_+|protease	type III secretion system effector protease PipA	protease	Q9MBM0	Phage_Gifsy-2	70.6	8.3e-81
ASE74126.1|2434109_2434319_-	hypothetical protein	NA	NA	NA	NA	NA
ASE74127.1|2434384_2435044_+	transmembrane protein	NA	A0A2H4JFM9	uncultured_Caudovirales_phage	52.4	2.7e-44
ASE74128.1|2435130_2435460_+	sulfurtransferase TusE	NA	NA	NA	NA	NA
ASE74129.1|2435456_2435738_-	acylphosphatase	NA	NA	NA	NA	NA
ASE74130.1|2435786_2436566_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
ASE74131.1|2436591_2437140_-	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
ASE74132.1|2437354_2438566_+	ribosomal RNA large subunit methyltransferase I	NA	NA	NA	NA	NA
ASE74133.1|2438623_2438941_+	heat-shock protein HspQ	NA	NA	NA	NA	NA
ASE74134.1|2438985_2439402_-	CoA-binding protein	NA	NA	NA	NA	NA
ASE74135.1|2439572_2440235_+	DUF2057 domain-containing protein	NA	NA	NA	NA	NA
ASE74136.1|2440329_2440788_+	methylglyoxal synthase	NA	NA	NA	NA	NA
ASE74137.1|2440823_2442878_-	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.3	3.2e-19
ASE74138.1|2443001_2443448_+	YccF domain-containing protein	NA	NA	NA	NA	NA
ASE74139.1|2443466_2445620_+	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
ASE74140.1|2445606_2446212_-	DNA transformation protein	NA	NA	NA	NA	NA
ASE74141.1|2446428_2446938_+	cell division inhibitor SulA	NA	NA	NA	NA	NA
ASE76450.1|2447294_2448347_+	outer membrane protein A	NA	NA	NA	NA	NA
ASE74142.1|2448418_2448871_-	macrodomain Ter protein	NA	NA	NA	NA	NA
ASE74143.1|2449056_2450817_+|protease	Lon protease family protein	protease	NA	NA	NA	NA
ASE74144.1|2450885_2451404_+	beta-hydroxydecanoyl-ACP dehydratase	NA	NA	NA	NA	NA
ASE74145.1|2451503_2451671_-	ribosome modulation factor	NA	NA	NA	NA	NA
ASE74146.1|2451926_2452490_-	hypothetical protein	NA	NA	NA	NA	NA
ASE74147.1|2452486_2454127_-	intermembrane transport protein PqiB	NA	NA	NA	NA	NA
ASE74148.1|2454131_2455385_-	paraquat-inducible protein A	NA	NA	NA	NA	NA
ASE74149.1|2455399_2457307_-	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.8	2.4e-53
ASE74150.1|2457319_2459428_-	ribosomal RNA large subunit methyltransferase K/L	NA	NA	NA	NA	NA
ASE74151.1|2459526_2460636_+	MOSC domain-containing protein	NA	NA	NA	NA	NA
ASE74152.1|2460632_2461175_-	cell division protein ZapC	NA	NA	NA	NA	NA
ASE74153.1|2461340_2462351_-	dihydroorotate dehydrogenase (quinone)	NA	NA	NA	NA	NA
ASE74154.1|2462558_2465171_-	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.6	6.3e-20
ASE74155.1|2465597_2465804_+	DNA-damage-inducible protein I	NA	S4TNM0	Salmonella_phage	98.5	4.5e-30
ASE74156.1|2466279_2467080_+	hypothetical protein	NA	NA	NA	NA	NA
ASE74157.1|2467559_2468282_+	guanine nucleotide exchange factor SopE	NA	NA	NA	NA	NA
ASE74158.1|2468477_2469053_-|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	91.0	1.5e-96
AVK72822.1|2469052_2471491_-|tail	phage tail protein	tail	A0A0K2FIZ6	Escherichia_phage	65.8	4.9e-91
ASE74159.1|2471665_2472370_-|transposase	IS6 family transposase IS15DI	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
>prophage 6
CP022069	Salmonella enterica strain FDAARGOS_313 chromosome, complete genome	4916780	2623437	2634091	4916780		Morganella_phage(25.0%)	13	NA	NA
ASE74317.1|2623437_2624868_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	57.4	7.8e-105
ASE74318.1|2624941_2625637_-	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	27.7	9.5e-08
ASE74319.1|2625716_2626028_-	hypothetical protein	NA	NA	NA	NA	NA
ASE74320.1|2626677_2627874_+	porin OmpS1	NA	Q1MVN1	Enterobacteria_phage	56.1	5.1e-110
ASE76461.1|2628134_2628323_-	cold-shock protein	NA	NA	NA	NA	NA
ASE74321.1|2628333_2628546_-	cold-shock protein CspJ	NA	A0A1W6JNX5	Morganella_phage	70.0	3.9e-21
ASE74322.1|2629000_2630269_-	translesion error-prone DNA polymerase V subunit UmuC	NA	I6RSM4	Salmonella_phage	92.2	4.2e-227
ASE74323.1|2630271_2630691_-	DNA polymerase V subunit UmuD	NA	A0A1W6JNS2	Morganella_phage	60.5	8.5e-36
ASE74324.1|2630817_2630979_-	hypothetical protein	NA	NA	NA	NA	NA
ASE74325.1|2630956_2631199_-	hypothetical protein	NA	NA	NA	NA	NA
ASE74326.1|2631459_2632257_+	protein MtfA	NA	NA	NA	NA	NA
ASE74327.1|2632628_2632919_+	DUF4102 domain-containing protein	NA	B7SYF8	Stenotrophomonas_phage	49.1	5.2e-08
ASE74328.1|2633566_2634091_+	peptidase	NA	G9L6C4	Escherichia_phage	76.9	5.6e-37
>prophage 7
CP022069	Salmonella enterica strain FDAARGOS_313 chromosome, complete genome	4916780	2723457	2733964	4916780		Enterobacteria_phage(37.5%)	10	NA	NA
ASE74412.1|2723457_2724771_-	lipopolysaccharide biosynthesis protein RfbH	NA	H8ZJ36	Ostreococcus_tauri_virus	35.1	7.0e-52
ASE74413.1|2724797_2725877_-	CDP-glucose 4,6-dehydratase	NA	A0A222YY99	Synechococcus_phage	24.5	1.3e-16
ASE74414.1|2725881_2726655_-	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
ASE74415.1|2726670_2727645_-	CDP-6-deoxy-delta-3,4-glucoseen reductase	NA	NA	NA	NA	NA
ASE74416.1|2727650_2728202_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.0	1.0e-52
ASE76468.1|2728202_2729081_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	64.8	5.1e-107
ASE74417.1|2729128_2730028_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.0	5.1e-30
ASE74418.1|2730027_2731113_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.6e-102
ASE74419.1|2731489_2732383_-	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
ASE74420.1|2732560_2733964_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	27.1	2.3e-21
>prophage 8
CP022069	Salmonella enterica strain FDAARGOS_313 chromosome, complete genome	4916780	2821308	2830479	4916780	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
ASE74490.1|2821308_2823342_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.0e-54
ASE74491.1|2823582_2824041_+	lipoprotein	NA	Q9EYF5	Enterobacteria_phage	72.5	8.4e-53
ASE74492.1|2824212_2824743_+	lipoprotein	NA	NA	NA	NA	NA
ASE74493.1|2824799_2825267_-	DUF1456 domain-containing protein	NA	Q9EYF4	Enterobacteria_phage	90.3	3.9e-74
ASE74494.1|2825313_2826033_-	DNA-binding response regulator	NA	NA	NA	NA	NA
ASE74495.1|2826029_2827715_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.1	2.4e-278
ASE74496.1|2827937_2828669_+	transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
ASE74497.1|2828728_2828836_+	hypothetical protein	NA	NA	NA	NA	NA
ASE74498.1|2828816_2829548_-	ABC transporter permease	NA	NA	NA	NA	NA
ASE74499.1|2829531_2830479_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.2	1.7e-23
>prophage 9
CP022069	Salmonella enterica strain FDAARGOS_313 chromosome, complete genome	4916780	4666775	4729534	4916780	holin,integrase,portal,head,terminase,lysis,plate,tRNA,capsid,tail	Salmonella_phage(58.54%)	74	4699672:4699718	4729696:4729742
ASE76129.1|4666775_4667213_+|tRNA	D-aminoacyl-tRNA deacylase	tRNA	NA	NA	NA	NA
ASE76130.1|4667209_4668199_+	acetyltransferase	NA	NA	NA	NA	NA
ASE76131.1|4668213_4668660_-	type II toxin-antitoxin system HigA family antitoxin	NA	NA	NA	NA	NA
ASE76132.1|4668656_4668968_-	type II toxin-antitoxin system HigB family toxin	NA	NA	NA	NA	NA
ASE76133.1|4669053_4669983_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
ASE76134.1|4670200_4670512_+	toxin HigB-2	NA	NA	NA	NA	NA
ASE76532.1|4670548_4670803_+	transcriptional regulator	NA	NA	NA	NA	NA
ASE76135.2|4670849_4671779_-	formate dehydrogenase accessory protein FdhE	NA	NA	NA	NA	NA
ASE76136.1|4671775_4672411_-	formate dehydrogenase cytochrome b556 subunit	NA	NA	NA	NA	NA
ASE76137.1|4672407_4673310_-	formate dehydrogenase subunit beta	NA	NA	NA	NA	NA
ASE76138.1|4673322_4676373_-	formate dehydrogenase-N subunit alpha	NA	A0A077SK27	Escherichia_phage	24.1	4.6e-06
ASE76139.1|4676567_4677404_+	sulfurtransferase FdhD	NA	NA	NA	NA	NA
ASE76140.1|4677671_4678703_-	DUF3829 domain-containing protein	NA	NA	NA	NA	NA
ASE76141.1|4678885_4679986_+	DUF3829 domain-containing protein	NA	NA	NA	NA	NA
ASE76142.1|4680329_4680653_-	AzlD domain-containing protein	NA	NA	NA	NA	NA
ASE76143.1|4680652_4681312_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
ASE76533.1|4681394_4681961_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
ASE76144.1|4682049_4682364_-	L-rhamnose mutarotase	NA	NA	NA	NA	NA
ASE76145.1|4682360_4683509_-	lactaldehyde reductase	NA	NA	NA	NA	NA
ASE76146.1|4683635_4684463_-	rhamnulose-1-phosphate aldolase	NA	NA	NA	NA	NA
AVK72868.1|4684605_4685865_-	L-rhamnose isomerase	NA	NA	NA	NA	NA
ASE76147.1|4685861_4687331_-	rhamnulokinase	NA	NA	NA	NA	NA
ASE76148.1|4687618_4688455_+	transcriptional activator RhaS	NA	NA	NA	NA	NA
AVK72869.1|4688402_4688585_-	hypothetical protein	NA	NA	NA	NA	NA
ASE76149.1|4688607_4689456_+	HTH-type transcriptional activator RhaR	NA	NA	NA	NA	NA
ASE76150.1|4689452_4690487_-	rhamnose/proton symporter RhaT	NA	NA	NA	NA	NA
ASE76151.1|4691105_4691789_+	hypothetical protein	NA	NA	NA	NA	NA
ASE76152.1|4691946_4693254_-	TRAP transporter large permease	NA	NA	NA	NA	NA
ASE76153.1|4693246_4693762_-	TRAP transporter small permease	NA	NA	NA	NA	NA
ASE76154.1|4693780_4694764_-	TRAP transporter substrate-binding protein	NA	NA	NA	NA	NA
ASE76155.1|4695092_4695713_+	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	58.9	2.4e-63
ASE76156.1|4695719_4696472_+	6-N-hydroxylaminopurine resistance protein	NA	NA	NA	NA	NA
ASE76157.1|4696483_4696879_+	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
ASE76158.1|4696929_4698303_-	two-component system sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	25.6	7.2e-15
ASE76159.1|4698299_4698998_-	DNA-binding response regulator	NA	Q6XM27	Feldmannia_irregularis_virus	30.3	5.3e-06
ASE76160.1|4699148_4699649_+	stress adaptor protein CpxP	NA	NA	NA	NA	NA
4699672:4699718	attL	GACACCATCCCTGTCTTCCCCCACATGATGTGGGGGTTTTTTTTATC	NA	NA	NA	NA
ASE76161.1|4699833_4700814_-|integrase	integrase	integrase	S4TP66	Salmonella_phage	97.9	2.4e-182
ASE76162.1|4700883_4701177_-	XRE family transcriptional regulator	NA	Q1JS21	Enterobacteria_phage	100.0	4.0e-48
ASE76163.1|4701312_4701585_+	hypothetical protein	NA	Q1JS20	Enterobacteria_phage	100.0	5.3e-47
ASE76164.1|4701754_4702255_+	replication protein B	NA	M1SV55	Escherichia_phage	100.0	2.6e-92
ASE76165.1|4702318_4702543_+	DUF2732 domain-containing protein	NA	S4TP68	Salmonella_phage	100.0	4.7e-33
ASE76166.1|4702542_4702845_+	hypothetical protein	NA	A0A0F7LCL4	Escherichia_phage	99.0	5.9e-47
ASE76167.1|4702844_4703069_+	hypothetical protein	NA	S4TRY6	Salmonella_phage	100.0	2.9e-35
ASE76168.1|4703065_4703341_+	hypothetical protein	NA	Q858T5	Yersinia_virus	100.0	3.8e-45
ASE76169.1|4703330_4705610_+	replication endonuclease	NA	Q858T4	Yersinia_virus	96.7	0.0e+00
ASE76170.1|4705848_4708332_-	helicase	NA	NA	NA	NA	NA
ASE76171.1|4708711_4709758_-|portal	phage portal protein	portal	S4TNX7	Salmonella_phage	99.4	4.4e-190
ASE76172.1|4709757_4711527_-	oxidoreductase	NA	S4TT96	Salmonella_phage	100.0	0.0e+00
ASE76173.1|4711692_4712547_+|capsid	capsid scaffolding protein	capsid	S4TP53	Salmonella_phage	98.6	8.9e-157
ASE76174.1|4712622_4713690_+|capsid	phage major capsid protein, P2 family	capsid	O80304	Escherichia_phage	89.5	3.0e-178
ASE76175.1|4713693_4714443_+|terminase	terminase	terminase	Q6K1I5	Salmonella_virus	86.7	2.2e-111
ASE76176.1|4714536_4715043_+|head	head completion/stabilization protein	head	S4TNY1	Salmonella_phage	98.2	9.5e-90
ASE76177.1|4715042_4715246_+|tail	phage tail protein	tail	A0A0M3ULF4	Salmonella_phage	100.0	3.6e-32
ASE76178.1|4715249_4715546_+|holin	holin	holin	Q6K1I2	Salmonella_virus	100.0	5.8e-47
ASE76179.1|4715532_4716030_+	lysozyme	NA	S4TUB1	Salmonella_phage	98.8	1.3e-91
ASE76180.1|4716026_4716440_+	protein lysB	NA	S4TRW3	Salmonella_phage	100.0	2.6e-45
ASE76181.1|4716411_4716585_+|lysis	phage lysis protein	lysis	S4TNY4	Salmonella_phage	98.2	2.8e-25
ASE76182.1|4716547_4717015_+|tail	phage tail protein	tail	S4TTA5	Salmonella_phage	100.0	1.1e-84
ASE76183.1|4717007_4717457_+	phage virion morphogenesis protein	NA	A0A0M3UL83	Salmonella_phage	99.3	2.5e-73
ASE76184.1|4717525_4718167_+|plate	phage baseplate assembly protein V	plate	Q6K1H6	Salmonella_virus	98.1	3.5e-113
ASE76185.1|4718163_4718511_+|plate	baseplate assembly protein	plate	A0A0M4RE59	Salmonella_phage	98.3	2.1e-56
ASE76186.1|4718517_4719426_+|plate	baseplate assembly protein	plate	A0A1J0I2M3	Salmonella_phage	99.0	7.7e-159
ASE76187.1|4719418_4719949_+|tail	phage tail protein I	tail	A0A0M4R4W9	Salmonella_phage	100.0	1.9e-104
ASE76188.1|4719959_4721702_+	hypothetical protein	NA	A0A0M3ULF6	Salmonella_phage	98.4	4.2e-270
ASE76189.1|4721701_4722271_+|tail	tail fiber assembly protein	tail	A0A0M4QWM3	Salmonella_phage	98.9	1.2e-104
ASE76190.1|4722405_4723593_+|tail	phage tail protein	tail	Q6K1H0	Salmonella_virus	100.0	2.0e-223
ASE76191.1|4723608_4724127_+|tail	phage major tail tube protein	tail	S4TNZ0	Salmonella_phage	100.0	6.5e-94
ASE76192.1|4724189_4724525_+|tail	phage tail assembly protein	tail	A0A0M4S5P8	Salmonella_phage	100.0	1.8e-52
ASE76193.1|4724521_4724677_+|tail	GpE family phage tail protein	tail	Q6K1G8	Salmonella_virus	98.0	8.8e-23
ASE76194.1|4724669_4727114_+|tail	phage tail tape measure protein	tail	S4TP64	Salmonella_phage	97.5	0.0e+00
ASE76195.1|4727128_4727614_+|tail	phage tail protein	tail	Q6K1G5	Salmonella_virus	99.4	6.7e-85
ASE76196.1|4727610_4728780_+	hypothetical protein	NA	S4TRX8	Salmonella_phage	96.7	6.8e-208
ASE76197.1|4728857_4729076_+	transcriptional regulator	NA	S4TNZ3	Salmonella_phage	100.0	4.7e-38
ASE76198.1|4729126_4729534_-	hypothetical protein	NA	S4TTB4	Salmonella_phage	99.3	1.3e-70
4729696:4729742	attR	GACACCATCCCTGTCTTCCCCCACATGATGTGGGGGTTTTTTTTATC	NA	NA	NA	NA
>prophage 10
CP022069	Salmonella enterica strain FDAARGOS_313 chromosome, complete genome	4916780	4879112	4897267	4916780	plate,tail	Burkholderia_phage(40.0%)	23	NA	NA
ASE76315.1|4879112_4879628_-|tail	tail fiber assembly protein	tail	A0A0U2QV64	Escherichia_phage	41.2	3.4e-34
ASE76316.1|4879637_4881119_-|tail	phage tail protein	tail	A0A0M3ULF6	Salmonella_phage	51.7	1.3e-51
ASE76317.1|4881121_4881754_-|tail	phage tail protein I	tail	Q6QI98	Burkholderia_phage	55.6	2.5e-23
ASE76318.1|4881746_4882862_-|plate	baseplate protein	plate	Q6QI99	Burkholderia_phage	52.2	1.8e-101
ASE76319.1|4882852_4883212_-|plate	baseplate protein	plate	Q6QIA0	Burkholderia_phage	64.2	2.8e-35
ASE76320.1|4883375_4884923_-	hypothetical protein	NA	B9UDL6	Salmonella_phage	29.9	1.9e-48
ASE76321.1|4884922_4885852_-	glycosyltransferase	NA	S5FKN0	Shigella_phage	84.1	7.9e-151
ASE76322.1|4885848_4886211_-	GtrA family protein	NA	U5P0S6	Shigella_phage	70.8	9.6e-44
ASE76323.1|4886538_4887261_-|plate	phage baseplate assembly protein V	plate	A0A067ZIM2	Vibrio_phage	42.0	2.3e-12
ASE76324.1|4887270_4888314_-	phage protein D	NA	A4JWL3	Burkholderia_virus	45.6	1.9e-76
ASE76325.1|4888301_4888511_-	hypothetical protein	NA	A4JWL2	Burkholderia_virus	60.3	9.8e-17
ASE76326.1|4888510_4889464_-	chemotaxis protein	NA	A4JWL1	Burkholderia_virus	50.8	2.3e-36
ASE76327.1|4889463_4891818_-|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	30.6	5.2e-66
ASE76328.1|4891914_4892043_-|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
ASE76329.1|4892002_4892320_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
ASE76330.1|4892371_4892896_-|tail	phage major tail tube protein	tail	Q6QIA9	Burkholderia_phage	69.5	2.8e-68
ASE76331.1|4892895_4894323_-|tail	phage tail sheath family protein	tail	A4JWK5	Burkholderia_virus	70.9	1.1e-194
ASE76332.1|4894312_4894510_-	hypothetical protein	NA	Q6QIB1	Burkholderia_phage	52.9	8.6e-07
ASE76333.1|4894506_4894962_-	hypothetical protein	NA	NA	NA	NA	NA
ASE76334.1|4895121_4895436_-	hypothetical protein	NA	Q6QIC4	Burkholderia_phage	49.1	6.4e-20
ASE76335.1|4895448_4896054_-	lytic transglycosylase domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	58.5	1.0e-58
ASE76336.1|4896056_4896344_-	hypothetical protein	NA	Q6QIC8	Burkholderia_phage	48.1	3.0e-16
ASE76337.1|4896919_4897267_+	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	51.5	4.9e-21
>prophage 1
CP022068	Salmonella enterica strain FDAARGOS_313 plasmid unnamed3, complete sequence	19849	0	3929	19849		Mannheimia_phage(50.0%)	2	NA	NA
ASE71847.1|3007_3289_-	Killer protein	NA	A0A0M3LQB1	Mannheimia_phage	37.6	1.2e-12
ASE71848.1|3632_3929_+	addiction module antidote protein, HigA family	NA	I6ZVM3	Aeromonas_phage	58.3	3.9e-19
>prophage 2
CP022068	Salmonella enterica strain FDAARGOS_313 plasmid unnamed3, complete sequence	19849	8115	13854	19849	transposase	Enterobacteria_phage(60.0%)	5	NA	NA
ASE71853.1|8115_8976_-	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
ASE71854.1|9158_9716_-	recombinase	NA	Q1MVP4	Enterobacteria_phage	100.0	7.0e-94
ASE71855.1|9879_12885_+|transposase	Tn3-like element Tn3 family transposase	transposase	Q1MVP5	Enterobacteria_phage	100.0	0.0e+00
ASE71856.1|12931_13213_-	Killer protein	NA	A0A0M3LQB1	Mannheimia_phage	37.6	1.2e-12
ASE71857.1|13557_13854_+	addiction module antidote protein, HigA family	NA	I6ZVM3	Aeromonas_phage	58.3	3.9e-19
>prophage 3
CP022068	Salmonella enterica strain FDAARGOS_313 plasmid unnamed3, complete sequence	19849	18040	19641	19849		Enterobacteria_phage(100.0%)	2	NA	NA
ASE71862.1|18040_18901_-	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
ASE71863.1|19083_19641_-	recombinase	NA	Q1MVP4	Enterobacteria_phage	100.0	7.0e-94
