The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP024101	Bacillus cytotoxicus strain CH_25 chromosome, complete genome	4225378	269590	277568	4225378		uncultured_virus(33.33%)	6	NA	NA
AWC31288.1|269590_269875_+	co-chaperone GroES	NA	A0A221S3C8	uncultured_virus	52.7	5.8e-20
AWC31289.1|269909_271538_+	molecular chaperone GroEL	NA	A0A219YK78	uncultured_virus	56.9	1.5e-157
AWC31290.1|271964_273512_+	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	30.6	2.2e-20
AWC31291.1|273885_275211_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	31.8	4.4e-46
AWC31292.1|275353_276055_+	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	38.7	8.6e-41
AWC34824.1|276080_277568_+	sensor histidine kinase	NA	W8CYF6	Bacillus_phage	30.4	2.8e-33
>prophage 2
CP024101	Bacillus cytotoxicus strain CH_25 chromosome, complete genome	4225378	310544	318916	4225378		Synechococcus_phage(33.33%)	8	NA	NA
AWC31303.1|310544_311846_+	adenylosuccinate lyase	NA	A0A1B3B081	Gordonia_phage	31.6	2.0e-19
AWC31304.1|311940_312660_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	G8EYA2	Synechococcus_phage	43.9	9.8e-48
AWC31305.1|312652_312907_+	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
AWC31306.1|312903_313587_+	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
AWC31307.1|313570_315790_+	phosphoribosylformylglycinamidine synthase II	NA	A6N228	Microbacterium_phage	41.2	2.0e-160
AWC31308.1|315774_317190_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	35.4	9.5e-55
AWC31309.1|317292_318336_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	48.0	2.7e-70
AWC31310.1|318328_318916_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	34.2	1.6e-24
>prophage 3
CP024101	Bacillus cytotoxicus strain CH_25 chromosome, complete genome	4225378	975821	1028274	4225378	capsid,tail,portal,terminase,holin,protease,head	Bacillus_phage(43.48%)	63	NA	NA
AWC31825.1|975821_976640_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
AWC31826.1|976676_977036_+	hypothetical protein	NA	NA	NA	NA	NA
AWC34841.1|977085_977385_+	hypothetical protein	NA	NA	NA	NA	NA
AWC31827.1|977567_978830_+	peptidase M48	NA	NA	NA	NA	NA
AWC31828.1|978967_980689_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	30.6	6.2e-16
AWC34842.1|980911_981799_+	EamA/RhaT family transporter	NA	NA	NA	NA	NA
AWC31829.1|982271_982931_+	S-layer homology domain-containing protein	NA	NA	NA	NA	NA
AWC31830.1|983248_983893_+	S-layer protein	NA	NA	NA	NA	NA
AWC31831.1|985720_986998_+	isocitrate lyase	NA	NA	NA	NA	NA
AWC31832.1|987328_987532_+	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	61.3	1.0e-15
AWC31833.1|988169_989603_-	recombinase family protein	NA	A0A2P1JU08	Anoxybacillus_phage	47.3	7.0e-114
AWC31834.1|989634_990072_-	ImmA/IrrE family metallo-endopeptidase	NA	D6R412	Bacillus_phage	50.4	3.9e-31
AWC31835.1|990094_990502_-	XRE family transcriptional regulator	NA	A0A0M4QX29	Bacillus_phage	47.1	5.0e-25
AWC31836.1|990779_990980_+	XRE family transcriptional regulator	NA	A0A0C5AJQ3	Paenibacillus_phage	50.9	3.2e-09
AWC31837.1|991326_991677_+	hypothetical protein	NA	A0A2H4JBP9	uncultured_Caudovirales_phage	77.4	7.1e-44
AWC31838.1|991766_992084_+	hypothetical protein	NA	A0A2H4J830	uncultured_Caudovirales_phage	48.8	2.1e-15
AWC31839.1|992031_992232_+	hypothetical protein	NA	NA	NA	NA	NA
AWC31840.1|992233_992425_+	hypothetical protein	NA	NA	NA	NA	NA
AWC31841.1|992430_993132_+	DNA-binding protein	NA	A0A2H4JHI2	uncultured_Caudovirales_phage	58.1	3.6e-71
AWC31842.1|993131_993608_+	DUF669 domain-containing protein	NA	A0A1B2AQ07	Phage_Wrath	49.4	1.6e-30
AWC31843.1|993712_996067_+	DNA primase	NA	A0A1B2AQ05	Phage_Wrath	83.2	0.0e+00
AWC31844.1|996332_996761_+	hypothetical protein	NA	A0A2H4JFQ6	uncultured_Caudovirales_phage	78.7	3.4e-64
AWC31845.1|996763_997303_+	nuclease	NA	A0A0S2SXQ1	Bacillus_phage	53.1	8.6e-49
AWC31846.1|997304_997589_+	hypothetical protein	NA	A0A0H3V0M3	Geobacillus_virus	52.3	3.9e-16
AWC31847.1|997669_998014_+	organic solvent tolerance protein OstA	NA	A0A1B1P7N6	Bacillus_phage	56.6	2.5e-25
AWC31848.1|998097_998298_+	hypothetical protein	NA	A0A1L2JY31	Aeribacillus_phage	53.0	6.9e-12
AWC31849.1|998400_999204_+	hypothetical protein	NA	NA	NA	NA	NA
AWC31850.1|999227_1000412_+	transcriptional regulator	NA	A0A0A7RTT7	Clostridium_phage	27.9	1.6e-34
AWC31851.1|1000513_1000909_+	DUF1492 domain-containing protein	NA	A0A2H4JFW6	uncultured_Caudovirales_phage	86.3	2.2e-57
AWC31852.1|1001086_1002001_+	hypothetical protein	NA	C9E2Q0	Enterococcus_phage	35.9	5.6e-24
AWC31853.1|1002062_1002593_-	pilus assembly protein HicB	NA	A0A090DBV2	Clostridium_phage	51.1	7.5e-29
AWC34843.1|1002688_1002859_-	type II toxin-antitoxin system HicA family toxin	NA	NA	NA	NA	NA
AWC31854.1|1003093_1003333_+	hydrolase	NA	NA	NA	NA	NA
AWC31855.1|1003346_1003643_+	HNH endonuclease	NA	A0A0S2SXR6	Bacillus_phage	64.0	1.7e-27
AWC31856.1|1003629_1003866_+	hypothetical protein	NA	A0A0S2GM40	Bacillus_phage	82.9	1.4e-24
AWC31857.1|1003980_1004367_+	hypothetical protein	NA	A0A0S2SXN4	Bacillus_phage	87.8	4.4e-55
AWC31858.1|1004363_1006082_+|terminase	terminase large subunit	terminase	A0A0S2SXJ7	Bacillus_phage	86.5	2.0e-301
AWC31859.1|1006104_1007274_+|portal	phage portal protein	portal	A0A1S5SFK2	Streptococcus_phage	58.1	2.5e-133
AWC31860.1|1007266_1007839_+|head,protease	HK97 family phage prohead protease	head,protease	A0A0S2SXJ4	Bacillus_phage	69.5	1.0e-71
AWC31861.1|1007831_1009004_+|capsid	phage major capsid protein	capsid	A0A0S2SXJ6	Bacillus_phage	74.6	1.1e-154
AWC31862.1|1009021_1009201_+	hypothetical protein	NA	A0A0S2SXV2	Bacillus_phage	64.3	1.2e-12
AWC31863.1|1009193_1009487_+	hypothetical protein	NA	A0A0S2SXS0	Bacillus_phage	57.3	1.5e-23
AWC31864.1|1009473_1009818_+	hypothetical protein	NA	NA	NA	NA	NA
AWC31865.1|1009810_1010167_+	hypothetical protein	NA	D2XR21	Bacillus_phage	59.0	7.5e-33
AWC31866.1|1010163_1010493_+	hypothetical protein	NA	D2XR22	Bacillus_phage	96.3	1.4e-54
AWC31867.1|1010493_1011087_+|tail	phage tail protein	tail	D2XR23	Bacillus_phage	85.6	1.5e-94
AWC31868.1|1011093_1011450_+	hypothetical protein	NA	A0A2H4JAG8	uncultured_Caudovirales_phage	70.8	2.0e-41
AWC31869.1|1011680_1013144_+	hypothetical protein	NA	A0A2H4JAI2	uncultured_Caudovirales_phage	86.8	1.0e-189
AWC31870.1|1013362_1015543_+	hypothetical protein	NA	A0A2H4JC82	uncultured_Caudovirales_phage	70.4	2.1e-29
AWC31871.1|1015584_1017060_+|tail	phage tail protein	tail	D2XR27	Bacillus_phage	95.1	8.7e-285
AWC31872.1|1017056_1021751_+	peptidase S74	NA	D2XR28	Bacillus_phage	64.9	0.0e+00
AWC31873.1|1021773_1022223_+	hypothetical protein	NA	A0A2H4J6F8	uncultured_Caudovirales_phage	94.6	1.4e-76
AWC31874.1|1022392_1022629_+	hypothetical protein	NA	A0A2H4J382	uncultured_Caudovirales_phage	96.2	1.5e-18
AWC31875.1|1022628_1022868_+|holin	holin	holin	A0A2H4J378	uncultured_Caudovirales_phage	98.7	1.7e-33
AWC31876.1|1022864_1023929_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A1B1P878	Bacillus_phage	94.4	9.3e-196
AWC31877.1|1023967_1024510_-	hypothetical protein	NA	NA	NA	NA	NA
AWC31878.1|1024645_1024891_+	hypothetical protein	NA	NA	NA	NA	NA
AWC31879.1|1024892_1025741_+	AraC family transcriptional regulator	NA	A0A1B0RXG1	Streptococcus_phage	38.6	2.7e-20
AWC31880.1|1026045_1026408_-	hypothetical protein	NA	NA	NA	NA	NA
AWC31881.1|1026469_1026802_-	hypothetical protein	NA	A0A1B2AQ49	Phage_Wrath	49.1	4.1e-17
AWC31882.1|1026880_1027129_-	hypothetical protein	NA	A0A1B1P7Q5	Bacillus_phage	97.6	1.1e-38
AWC31883.1|1027125_1027350_-	transcriptional regulator	NA	A0A1B1P7Q3	Bacillus_phage	100.0	7.7e-36
AWC31884.1|1027443_1028274_-	cytosolic protein	NA	A0A2H4J9W9	uncultured_Caudovirales_phage	89.1	3.8e-120
>prophage 4
CP024101	Bacillus cytotoxicus strain CH_25 chromosome, complete genome	4225378	1098883	1164988	4225378	coat,bacteriocin,integrase	Escherichia_phage(18.18%)	59	1138598:1138625	1167610:1167637
AWC31953.1|1098883_1099459_-|coat	spore coat protein	coat	NA	NA	NA	NA
AWC31954.1|1099580_1099940_+	DUF1360 domain-containing protein	NA	NA	NA	NA	NA
AWC34847.1|1100064_1100223_+	cytochrome C oxidase subunit III	NA	NA	NA	NA	NA
AWC34848.1|1100289_1101225_-	glycosyl transferase family 2	NA	NA	NA	NA	NA
AWC31955.1|1101247_1102003_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AWC31956.1|1102192_1103038_-	macrocin O-methyltransferase	NA	A0A2R8FFV8	Cedratvirus	55.2	5.5e-58
AWC31957.1|1103162_1104149_-	hypothetical protein	NA	NA	NA	NA	NA
AWC34849.1|1104282_1105380_+	beta 1,4 glucosyltransferase	NA	A0A0N9QAD0	Chrysochromulina_ericina_virus	25.2	1.5e-10
AWC31958.1|1105464_1106151_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AWC31959.1|1106147_1106825_+	streptomycin biosynthesis protein StrF	NA	NA	NA	NA	NA
AWC31960.1|1106844_1107525_+	streptomycin biosynthesis protein StrF	NA	NA	NA	NA	NA
AWC31961.1|1107601_1108339_+|coat	spore coat protein	coat	I7I009	Enterobacteria_phage	44.7	2.8e-50
AWC31962.1|1108347_1108896_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A218MN57	uncultured_virus	43.2	1.7e-31
AWC31963.1|1108907_1109879_+	dTDP-glucose 4,6-dehydratase	NA	A0A1D7XFE8	Escherichia_phage	42.9	8.5e-71
AWC31964.1|1109890_1110742_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	40.2	9.5e-42
AWC31965.1|1110944_1111445_-	hypothetical protein	NA	NA	NA	NA	NA
AWC31966.1|1111879_1112353_-|coat	spore coat protein	coat	NA	NA	NA	NA
AWC31967.1|1112519_1114574_-	ATP-dependent helicase	NA	S5MMD7	Bacillus_phage	31.9	6.2e-79
AWC31968.1|1115099_1115618_-	hypothetical protein	NA	NA	NA	NA	NA
AWC31969.1|1115710_1116442_-	esterase family protein	NA	NA	NA	NA	NA
AWC31970.1|1116662_1117574_+	EamA/RhaT family transporter	NA	NA	NA	NA	NA
AWC31971.1|1117794_1118184_-	hypothetical protein	NA	A0A0E3TB73	Enterococcus_phage	36.6	6.3e-09
AWC31972.1|1118355_1119822_-	sodium/proline symporter PutP	NA	NA	NA	NA	NA
AWC31973.1|1121654_1123148_+	lactate permease	NA	NA	NA	NA	NA
AWC31974.1|1123252_1123936_+	DUF2278 domain-containing protein	NA	NA	NA	NA	NA
AWC31975.1|1123982_1124816_-	hypothetical protein	NA	NA	NA	NA	NA
AWC31976.1|1124944_1125691_+	zinc ribbon domain-containing protein	NA	NA	NA	NA	NA
AWC31977.1|1125865_1127200_+	CoA-disulfide reductase	NA	NA	NA	NA	NA
AWC31978.1|1127328_1127739_+	DUF3908 domain-containing protein	NA	NA	NA	NA	NA
AWC31979.1|1127952_1129497_-	NADH oxidase	NA	NA	NA	NA	NA
AWC31980.1|1129557_1131510_-|bacteriocin	bacteriocin biosynthesis protein SagD	bacteriocin	NA	NA	NA	NA
AWC31981.1|1131503_1133429_-|bacteriocin	putative thiazole-containing bacteriocin maturation protein	bacteriocin	NA	NA	NA	NA
AWC31982.1|1133587_1134832_-	dihydrolipoyllysine-residue succinyltransferase	NA	NA	NA	NA	NA
AWC31983.1|1134952_1137829_-	2-oxoglutarate dehydrogenase subunit E1	NA	NA	NA	NA	NA
1138598:1138625	attL	TCAAGATTCAGAGAGAAGCAAGGAAGAT	NA	NA	NA	NA
AWC31984.1|1138796_1138979_+	DUF3976 domain-containing protein	NA	NA	NA	NA	NA
AWC31985.1|1139040_1139925_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AWC31986.1|1140111_1141038_+	2,4-dihydroxyhept-2-ene-1,7-dioic acid aldolase	NA	NA	NA	NA	NA
AWC31987.1|1141107_1142631_+	5-carboxymethyl-2-hydroxymuconate semialdehyde dehydrogenase	NA	NA	NA	NA	NA
AWC31988.1|1142684_1144157_+	4-hydroxyphenylacetate 3-monooxygenase, oxygenase component	NA	NA	NA	NA	NA
AWC31989.1|1144176_1145160_+	3,4-dihydroxyphenylacetate 2,3-dioxygenase	NA	NA	NA	NA	NA
AWC31990.1|1145217_1146084_+	cytidyltransferase	NA	NA	NA	NA	NA
AWC31991.1|1146144_1146474_+	DUF485 domain-containing protein	NA	NA	NA	NA	NA
AWC31992.1|1146463_1148014_+	cation acetate symporter	NA	NA	NA	NA	NA
AWC31993.1|1148034_1148826_+	4-hydroxyphenylacetate isomerase	NA	NA	NA	NA	NA
AWC31994.1|1148822_1149581_+	2-hydroxyhepta-2,4-diene-1,7-dioate isomerase	NA	NA	NA	NA	NA
AWC31995.1|1149653_1150052_+	5-carboxymethyl-2-hydroxymuconate isomerase	NA	NA	NA	NA	NA
AWC31996.1|1150370_1151483_+	tetratricopeptide repeat-containing protein	NA	A0A2H4J8G3	uncultured_Caudovirales_phage	49.1	2.4e-93
AWC31997.1|1152133_1152502_+	NUDIX domain-containing protein	NA	NA	NA	NA	NA
AWC31998.1|1153325_1153532_+	hypothetical protein	NA	NA	NA	NA	NA
AWC31999.1|1154182_1154500_+	DUF3884 domain-containing protein	NA	NA	NA	NA	NA
AWC32000.1|1156557_1156965_+	hypothetical protein	NA	NA	NA	NA	NA
AWC32001.1|1159263_1160184_-	gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
AWC32002.1|1160265_1160643_-	hypothetical protein	NA	NA	NA	NA	NA
AWC32003.1|1160659_1160920_-	hypothetical protein	NA	NA	NA	NA	NA
AWC32004.1|1161055_1161310_+	hypothetical protein	NA	NA	NA	NA	NA
AWC32005.1|1161816_1162470_+	hypothetical protein	NA	NA	NA	NA	NA
AWC32006.1|1162667_1162943_+	hypothetical protein	NA	NA	NA	NA	NA
AWC32007.1|1163260_1164355_-	tetratricopeptide repeat-containing protein	NA	A0A2H4J8G3	uncultured_Caudovirales_phage	51.8	1.2e-100
AWC32008.1|1164616_1164988_+|integrase	site-specific integrase	integrase	A0A1B0T6A8	Bacillus_phage	54.4	2.1e-25
1167610:1167637	attR	TCAAGATTCAGAGAGAAGCAAGGAAGAT	NA	NA	NA	NA
>prophage 5
CP024101	Bacillus cytotoxicus strain CH_25 chromosome, complete genome	4225378	1978402	1986535	4225378		Bacillus_phage(50.0%)	9	NA	NA
AWC34884.1|1978402_1979320_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	43.3	7.6e-45
AWC32742.1|1979316_1980069_+	ABC transporter permease	NA	NA	NA	NA	NA
AWC32743.1|1980081_1980813_+	multidrug ABC transporter permease	NA	NA	NA	NA	NA
AWC32744.1|1981245_1981959_+	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	41.5	3.7e-39
AWC32745.1|1981959_1983366_+	two-component sensor histidine kinase	NA	A0A1V0SGX0	Hokovirus	24.4	3.2e-10
AWC32746.1|1983722_1984061_-	DUF4064 domain-containing protein	NA	A0A0S2MVJ2	Bacillus_phage	80.4	2.1e-40
AWC32747.1|1984077_1984581_-	DUF4352 domain-containing protein	NA	NA	NA	NA	NA
AWC32748.1|1985243_1985522_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	A0A2I7SC16	Paenibacillus_phage	61.9	5.1e-13
AWC32749.1|1985740_1986535_+	peptigoglycan-binding protein LysM	NA	A0A141HRV8	Bacillus_phage	40.7	6.3e-32
>prophage 6
CP024101	Bacillus cytotoxicus strain CH_25 chromosome, complete genome	4225378	2278076	2344241	4225378	holin,bacteriocin,transposase	Bacillus_phage(42.86%)	53	NA	NA
AWC33009.1|2278076_2278694_+|transposase	transposase	transposase	NA	NA	NA	NA
AWC34903.1|2279192_2279936_-	hypothetical protein	NA	A0A127AXI2	Bacillus_phage	44.5	1.7e-18
AWC33010.1|2280396_2281626_-	MFS transporter	NA	NA	NA	NA	NA
AWC33011.1|2282371_2282608_-	hypothetical protein	NA	NA	NA	NA	NA
AWC33012.1|2282638_2283580_-|transposase	transposase	transposase	NA	NA	NA	NA
AWC33013.1|2285745_2286171_+	hypothetical protein	NA	NA	NA	NA	NA
AWC33014.1|2286145_2286439_+	hypothetical protein	NA	NA	NA	NA	NA
AWC33015.1|2286720_2287862_-|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	66.4	5.1e-99
AWC33016.1|2287897_2288515_-|bacteriocin	bacteriocin ABC transporter ATP-binding protein	bacteriocin	G9BWD6	Planktothrix_phage	34.3	2.9e-16
AWC33017.1|2288519_2290688_-|bacteriocin	bacteriocin-associated protein	bacteriocin	NA	NA	NA	NA
AWC33018.1|2290811_2291000_-	hypothetical protein	NA	NA	NA	NA	NA
AWC33019.1|2290984_2291254_-	hypothetical protein	NA	NA	NA	NA	NA
AWC33020.1|2292350_2292599_-	DUF4176 domain-containing protein	NA	NA	NA	NA	NA
AWC34904.1|2292599_2292761_-	hypothetical protein	NA	NA	NA	NA	NA
AWC33021.1|2292799_2292991_-	hypothetical protein	NA	NA	NA	NA	NA
AWC33022.1|2294680_2294956_-	TIGR04197 family type VII secretion effector	NA	NA	NA	NA	NA
AWC33023.1|2298247_2298994_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.1	5.0e-31
AWC33024.1|2299363_2299687_-	hypothetical protein	NA	NA	NA	NA	NA
AWC33025.1|2299694_2300219_-	hypothetical protein	NA	NA	NA	NA	NA
AWC33026.1|2302351_2302735_-	hypothetical protein	NA	NA	NA	NA	NA
AWC33027.1|2302953_2303274_-	hypothetical protein	NA	NA	NA	NA	NA
AWC33028.1|2305123_2306104_+	ketoacyl-ACP synthase III	NA	NA	NA	NA	NA
AWC33029.1|2306166_2306415_-	hypothetical protein	NA	A0A288WFY7	Bacillus_phage	46.2	3.9e-12
AWC33030.1|2306687_2307737_-	oxidoreductase	NA	NA	NA	NA	NA
AWC33031.1|2308219_2308618_+	DUF2871 domain-containing protein	NA	NA	NA	NA	NA
AWC33032.1|2309516_2309777_-	DUF2642 domain-containing protein	NA	NA	NA	NA	NA
AWC33033.1|2309916_2310579_-	bacillithiol biosynthesis deacetylase BshB2	NA	NA	NA	NA	NA
AWC33034.1|2310594_2310945_-	DUF1806 domain-containing protein	NA	NA	NA	NA	NA
AWC33035.1|2311186_2312512_+	hypothetical protein	NA	NA	NA	NA	NA
AWC33036.1|2312851_2313379_-	N-acetyltransferase	NA	A0A1P8CWJ6	Bacillus_phage	66.3	4.8e-60
AWC33037.1|2313385_2315287_-	mannonate oxidoreductase	NA	F2Y0V3	Organic_Lake_phycodnavirus	25.4	2.0e-15
AWC33038.1|2316760_2318548_+	oligoendopeptidase F	NA	NA	NA	NA	NA
AWC33039.1|2318733_2319966_-	MFS transporter	NA	NA	NA	NA	NA
AWC33040.1|2320069_2320933_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AWC33041.1|2321100_2322159_+	acyltransferase	NA	NA	NA	NA	NA
AWC33042.1|2322203_2323148_-	glycerophosphodiester phosphodiesterase	NA	A0A076G4Q2	Staphylococcus_phage	35.0	2.4e-38
AWC33043.1|2323622_2324165_-	N-acetyltransferase	NA	NA	NA	NA	NA
AWC33044.1|2324415_2324829_-	hypothetical protein	NA	NA	NA	NA	NA
AWC33045.1|2325407_2326256_-	chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	47.9	1.4e-08
AWC33046.1|2327338_2328151_-	hypothetical protein	NA	NA	NA	NA	NA
AWC33047.1|2328632_2330012_+	chitin-binding protein	NA	A0A0K1Y848	Apis_mellifera_filamentous_virus	35.7	1.4e-21
AWC33048.1|2330165_2331836_-	peptidase M4 family protein	NA	NA	NA	NA	NA
AWC33049.1|2332571_2334047_+	SELO family protein	NA	A0A075BSJ0	Microcystis_phage	30.9	1.2e-47
AWC33050.1|2334162_2335548_-	2-hydroxy-acid oxidase	NA	NA	NA	NA	NA
AWC33051.1|2335972_2336650_-	methyltransferase	NA	G3MA03	Bacillus_virus	43.3	8.1e-20
AWC33052.1|2337465_2338377_-	hypothetical protein	NA	NA	NA	NA	NA
AWC33053.1|2338782_2339130_+	hypothetical protein	NA	NA	NA	NA	NA
AWC33054.1|2339271_2340339_+	hypothetical protein	NA	NA	NA	NA	NA
AWC33055.1|2341588_2341921_-	hypothetical protein	NA	NA	NA	NA	NA
AWC33056.1|2342092_2342296_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AWC33057.1|2342375_2342960_+	hypothetical protein	NA	NA	NA	NA	NA
AWC33058.1|2343000_2343801_-	N-acetylmuramoyl-L-alanine amidase	NA	D2XR33	Bacillus_phage	74.9	3.0e-122
AWC33059.1|2343800_2344241_-|holin	holin	holin	A0A1B1P7S2	Bacillus_phage	86.3	8.3e-66
>prophage 7
CP024101	Bacillus cytotoxicus strain CH_25 chromosome, complete genome	4225378	2348769	2392476	4225378	capsid,tail,integrase,portal	Bacillus_phage(46.67%)	56	2339816:2339875	2392566:2393087
2339816:2339875	attL	TGCCTGAAGAAGGTATGGTCGAAGTCGGCGAATTAAAAATACACCAAGCATCGCATGCCC	NA	NA	NA	NA
AWC33061.1|2348769_2350272_-|tail	phage tail protein	tail	A0A1B1P7W7	Bacillus_phage	72.4	7.2e-202
AWC33062.1|2350286_2353940_-|tail	phage tail tape measure protein	tail	A6M961	Geobacillus_virus	46.6	2.4e-57
AWC33063.1|2353986_2354304_-	hypothetical protein	NA	NA	NA	NA	NA
AWC33064.1|2354345_2354720_-	hypothetical protein	NA	NA	NA	NA	NA
AWC33065.1|2354777_2355308_-|tail	phage major tail protein, TP901-1 family	tail	NA	NA	NA	NA
AWC33066.1|2355326_2355734_-	hypothetical protein	NA	NA	NA	NA	NA
AWC33067.1|2355736_2356096_-	hypothetical protein	NA	NA	NA	NA	NA
AWC33068.1|2356095_2356470_-	hypothetical protein	NA	NA	NA	NA	NA
AWC33069.1|2356473_2357280_-	hypothetical protein	NA	NA	NA	NA	NA
AWC33070.1|2357276_2357633_-	hypothetical protein	NA	A0A142F1M2	Bacillus_phage	34.5	2.0e-09
AWC33071.1|2357638_2357851_-	hypothetical protein	NA	NA	NA	NA	NA
AWC33072.1|2357850_2358876_-|capsid	minor capsid protein E	capsid	A0A142F1M0	Bacillus_phage	60.1	5.4e-108
AWC33073.1|2358939_2359326_-	hypothetical protein	NA	A0A142F1L9	Bacillus_phage	68.2	3.2e-45
AWC33074.1|2359348_2359900_-	hypothetical protein	NA	NA	NA	NA	NA
AWC33075.1|2359900_2361442_-|portal	phage portal protein	portal	A0A142F1L7	Bacillus_phage	48.4	8.3e-137
AWC33076.1|2361457_2363161_-	hypothetical protein	NA	A0A142F1L6	Bacillus_phage	50.3	2.5e-158
AWC33077.1|2363160_2363634_-	hypothetical protein	NA	NA	NA	NA	NA
AWC33078.1|2364702_2365527_-	hypothetical protein	NA	NA	NA	NA	NA
AWC33079.1|2365922_2366489_-	hypothetical protein	NA	A0A2H4J2L4	uncultured_Caudovirales_phage	45.8	9.7e-35
AWC33080.1|2366500_2366878_-	hypothetical protein	NA	A0A0N9RZI0	Paenibacillus_phage	43.1	2.0e-15
AWC33081.1|2366882_2368460_-	DNA cytosine methyltransferase	NA	Q02778	Bacillus_phage	42.4	8.3e-108
AWC33082.1|2368456_2368687_-	hypothetical protein	NA	NA	NA	NA	NA
AWC33083.1|2368688_2369327_-	hypothetical protein	NA	NA	NA	NA	NA
AWC33084.1|2369338_2369572_-	glutaredoxin family protein	NA	A0A1B1P8E0	Bacillus_phage	64.5	1.2e-23
AWC33085.1|2369568_2370174_-	hypothetical protein	NA	A0A2H4JAZ2	uncultured_Caudovirales_phage	41.2	7.7e-38
AWC33086.1|2370234_2370861_-	hypothetical protein	NA	J9Q953	Bacillus_phage	44.9	3.3e-36
AWC34905.1|2370862_2371234_-	hypothetical protein	NA	NA	NA	NA	NA
AWC33087.1|2371661_2371970_-	transglycosylase	NA	A0A0K2CZP5	Paenibacillus_phage	35.7	9.7e-05
AWC33088.1|2371969_2372365_-	alpha/beta hydrolase	NA	A0A2H4IZM2	uncultured_Caudovirales_phage	68.9	6.1e-44
AWC33089.1|2372650_2373178_-	hypothetical protein	NA	A0A0N9ST03	Paenibacillus_phage	44.6	3.2e-08
AWC33090.1|2373174_2373399_-	hypothetical protein	NA	U5Q038	Bacillus_phage	70.6	8.3e-22
AWC33091.1|2373398_2374445_-	hypothetical protein	NA	A0A0N9SHN6	Paenibacillus_phage	58.6	4.8e-88
AWC33092.1|2374458_2374614_-	hypothetical protein	NA	NA	NA	NA	NA
AWC34906.1|2374606_2376790_-	DNA-directed DNA polymerase	NA	A0A142F1Q9	Bacillus_phage	54.6	7.2e-219
AWC33093.1|2376969_2378145_-	hypothetical protein	NA	NA	NA	NA	NA
AWC33094.1|2378137_2378545_-	hypothetical protein	NA	NA	NA	NA	NA
AWC33095.1|2378571_2379333_-	single-stranded DNA-binding protein	NA	A0A0N9SJW5	Paenibacillus_phage	49.2	7.9e-56
AWC33096.1|2379839_2380487_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
AWC33097.1|2380784_2382008_-	hypothetical protein	NA	A0A288WGM1	Bacillus_phage	47.8	9.9e-101
AWC33098.1|2382122_2382326_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AWC34907.1|2382389_2382575_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AWC33099.1|2382582_2383599_-	hypothetical protein	NA	A0A2H4J6E6	uncultured_Caudovirales_phage	43.2	6.8e-71
AWC33100.1|2383625_2384969_-	DNA helicase	NA	A0A2H4IZL9	uncultured_Caudovirales_phage	55.8	2.6e-134
AWC33101.1|2385065_2385350_-	hypothetical protein	NA	A0A0H3V0M3	Geobacillus_virus	44.0	5.4e-10
AWC33102.1|2385597_2386014_-	hypothetical protein	NA	A0A0K2CNU6	Brevibacillus_phage	57.1	8.5e-12
AWC33103.1|2386051_2386591_-	hypothetical protein	NA	A0A1I9S5V4	Bacillus_phage	76.7	2.8e-71
AWC33104.1|2386636_2386822_-	hypothetical protein	NA	NA	NA	NA	NA
AWC33105.1|2387188_2387953_-	DNA replication protein	NA	A0A0N7GFF0	Paenibacillus_phage	56.5	3.7e-77
AWC33106.1|2387952_2388627_-	DUF723 domain-containing protein	NA	NA	NA	NA	NA
AWC34908.1|2388642_2389029_-	hypothetical protein	NA	A0A2H4J134	uncultured_Caudovirales_phage	36.2	3.2e-13
AWC33107.1|2389034_2389367_-	hypothetical protein	NA	NA	NA	NA	NA
AWC33108.1|2389353_2389512_-	Fur-regulated basic protein FbpA	NA	NA	NA	NA	NA
AWC33109.1|2389593_2389938_-	hypothetical protein	NA	NA	NA	NA	NA
AWC33110.1|2390367_2390739_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
AWC33111.1|2390735_2391137_-	helix-turn-helix domain-containing protein	NA	A0A142F1P0	Bacillus_phage	58.5	2.3e-30
AWC33112.1|2391345_2392476_+|integrase	site-specific integrase	integrase	A0A2H4JCB7	uncultured_Caudovirales_phage	36.5	3.1e-64
2392566:2393087	attR	TGCCTGAAGAAGGTATGGTCGAAGTCGGCGAATTAAAAATACACCAAGCATCGCATGCCCGCTACTTTGAAGACTTCTTAAAATTTGTCGAATATGAACGCTCCATGCCTGAAATTATGAAAACACAAGTAATGGACATGGTATACGACCAAATTGAAGATATATTTGAAGAAGGTACGGAAGAACGCGAACAATTCGACCAAGCGATGGAAGTATGGGCCGCTAGTCCGAAACGCGAAATTATGGAACAGTTTTCAACCGAAGAAATAATGGAAGCTACCGCTCAAATCGTCGAGCATGCTCCTGAAGTAGAATTAAAGGTTAAAGCCGATCACATTTCTGTGAAAGCTCTGCTTGCTGATTTCGGGGATCAAATACATATTGCAAAGGTAAATGACCGATACGTATTAATGATTGAGGCTGATACACTTACGTTTGAGAAAGGCTTCTCTCCGATTGAGTTTCTAAAGCCAGATGAATTGCAAGATGTGATTGAGCGGATTGAGAATAAGCAGCAATATT	NA	NA	NA	NA
>prophage 8
CP024101	Bacillus cytotoxicus strain CH_25 chromosome, complete genome	4225378	2550547	2594896	4225378	tail,portal,integrase,holin,terminase,tRNA,head	Bacillus_phage(90.24%)	53	2591126:2591140	2597652:2597666
AWC33248.1|2550547_2551543_+|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
AWC33249.1|2552206_2552866_+	hypothetical protein	NA	NA	NA	NA	NA
AWC33250.1|2553254_2553707_+	hypothetical protein	NA	NA	NA	NA	NA
AWC33251.1|2554921_2555134_+	hypothetical protein	NA	NA	NA	NA	NA
AWC33252.1|2556195_2556669_-	hypothetical protein	NA	NA	NA	NA	NA
AWC33253.1|2556801_2557299_+	exosporium protein D	NA	NA	NA	NA	NA
AWC33254.1|2559453_2560026_+	DUF4352 domain-containing protein	NA	A0A1B1P898	Bacillus_phage	84.9	1.5e-54
AWC33255.1|2560336_2560777_+	hypothetical protein	NA	NA	NA	NA	NA
AWC33256.1|2560851_2561673_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A0S2GLD4	Bacillus_phage	85.3	5.9e-142
AWC33257.1|2561672_2562113_-|holin	holin	holin	A0A1B1P7S2	Bacillus_phage	86.3	8.3e-66
AWC33258.1|2562147_2566641_-	hypothetical protein	NA	A0A0M4RER0	Bacillus_phage	45.7	1.2e-265
AWC33259.1|2566641_2568135_-|tail	phage tail protein	tail	A0A1B1P7W7	Bacillus_phage	76.3	2.4e-229
AWC33260.1|2568147_2571075_-|tail	phage tail tape measure protein	tail	A0A0A7AR36	Bacillus_phage	55.7	2.9e-183
AWC33261.1|2571080_2571347_-	hypothetical protein	NA	A0A0M4S6X7	Bacillus_phage	60.2	8.3e-21
AWC33262.1|2571382_2571820_-	hypothetical protein	NA	A0A0M4QX42	Bacillus_phage	32.7	3.6e-13
AWC33263.1|2571865_2572498_-	hypothetical protein	NA	A0A0M4R5F9	Bacillus_phage	79.1	5.7e-76
AWC33264.1|2572515_2572896_-	hypothetical protein	NA	A0A0M4RD75	Bacillus_phage	83.3	1.8e-56
AWC33265.1|2572892_2573309_-	hypothetical protein	NA	A0A0M4S6Z2	Bacillus_phage	76.8	2.7e-58
AWC33266.1|2573292_2573652_-	hypothetical protein	NA	A0A0M4S6Z9	Bacillus_phage	81.2	5.7e-49
AWC33267.1|2573633_2573972_-	hypothetical protein	NA	W8CYS9	Bacillus_phage	39.6	2.9e-10
AWC33268.1|2574008_2574851_-	hypothetical protein	NA	A0A0M5M1L4	Bacillus_phage	77.7	5.2e-117
AWC33269.1|2574864_2575455_-	DUF4355 domain-containing protein	NA	A0A0M3ULE7	Bacillus_phage	55.8	4.6e-19
AWC33270.1|2575524_2576550_-|head	phage head morphogenesis protein	head	A0A0M5M7Z2	Bacillus_phage	84.1	5.1e-159
AWC33271.1|2576536_2577892_-|portal	phage portal protein	portal	A0A0M4S669	Bacillus_phage	85.6	3.5e-200
AWC33272.1|2577903_2579208_-|terminase	PBSX family phage terminase large subunit	terminase	A0A0M4R5F3	Bacillus_phage	95.2	9.5e-251
AWC33273.1|2579194_2579626_-|terminase	terminase small subunit	terminase	A0A0M4RU19	Bacillus_phage	74.8	1.3e-55
AWC33274.1|2580389_2580635_-	DNA-binding protein	NA	A0A290FZJ4	Caldibacillus_phage	57.5	5.1e-17
AWC33275.1|2581038_2581419_-	ArpU family transcriptional regulator	NA	A0A0M4R397	Bacillus_phage	84.7	1.1e-53
AWC33276.1|2581423_2581711_-	hypothetical protein	NA	A6M999	Geobacillus_virus	73.4	2.9e-35
AWC34913.1|2582090_2582342_-	XRE family transcriptional regulator	NA	A0A0S2MV80	Bacillus_phage	92.7	1.3e-36
AWC33277.1|2582593_2582878_-	hypothetical protein	NA	I7J4K9	Bacillus_phage	48.9	4.3e-15
AWC33278.1|2582978_2583188_+	hypothetical protein	NA	NA	NA	NA	NA
AWC33279.1|2583248_2583680_-	hypothetical protein	NA	W8CYU3	Bacillus_phage	39.9	2.6e-19
AWC33280.1|2583709_2583913_-	hypothetical protein	NA	NA	NA	NA	NA
AWC33281.1|2583934_2584468_-	hypothetical protein	NA	U5PUK4	Bacillus_phage	60.0	8.8e-54
AWC33282.1|2584510_2584717_-	hypothetical protein	NA	NA	NA	NA	NA
AWC33283.1|2584795_2584996_-	hypothetical protein	NA	A0A1P8CWV4	Bacillus_phage	54.2	2.6e-06
AWC34914.1|2585032_2585605_-	dUTPase	NA	A0A0A7AQI4	Bacillus_phage	78.1	1.7e-82
AWC33284.1|2585758_2586550_-	hypothetical protein	NA	A0A0M4RU33	Bacillus_phage	42.1	3.8e-29
AWC33285.1|2586551_2586731_-	hypothetical protein	NA	NA	NA	NA	NA
AWC33286.1|2586940_2588545_-	hypothetical protein	NA	A0A0M4RD64	Bacillus_phage	72.0	1.6e-114
AWC33287.1|2588545_2588815_-	hypothetical protein	NA	A0A0M4S680	Bacillus_phage	83.1	5.3e-39
AWC33288.1|2588828_2589500_-	DUF1071 domain-containing protein	NA	A0A1B1P7F0	Bacillus_phage	44.2	8.0e-28
AWC33289.1|2589496_2589979_-	ATPase	NA	E5DV79	Deep-sea_thermophilic_phage	48.1	8.3e-35
AWC33290.1|2590042_2590411_-	XRE family transcriptional regulator	NA	A0A0M5M3T1	Bacillus_phage	81.0	2.9e-11
AWC33291.1|2590433_2590700_-	hypothetical protein	NA	A0A0M4S677	Bacillus_phage	80.9	2.3e-23
AWC33292.1|2591019_2591208_-	hypothetical protein	NA	NA	NA	NA	NA
2591126:2591140	attL	ATTTCTTTCACTTCT	NA	NA	NA	NA
AWC33293.1|2591242_2591518_-	group-specific protein	NA	S5MC08	Brevibacillus_phage	59.3	3.6e-27
AWC33294.1|2591544_2592381_-	hypothetical protein	NA	A0A0M5M1L9	Bacillus_phage	82.7	4.8e-123
AWC33295.1|2592377_2592566_-	transcriptional regulator	NA	A0A1C8E998	Bacillus_phage	86.9	8.2e-23
AWC33296.1|2592839_2593262_+	transcriptional regulator	NA	A0A1C8E9A4	Bacillus_phage	90.0	3.0e-65
AWC34915.1|2593276_2593702_+	toxin	NA	A0A0M4RD70	Bacillus_phage	91.5	1.7e-71
AWC33297.1|2593738_2594896_+|integrase	site-specific integrase	integrase	A0A0S2SXP1	Bacillus_phage	76.1	1.2e-76
2597652:2597666	attR	ATTTCTTTCACTTCT	NA	NA	NA	NA
>prophage 9
CP024101	Bacillus cytotoxicus strain CH_25 chromosome, complete genome	4225378	2778796	2853236	4225378	tail,capsid,portal,integrase,protease,holin,terminase,tRNA,head	Bacillus_phage(78.72%)	86	2810339:2810356	2859957:2859974
AWC33455.1|2778796_2781562_-|tRNA	isoleucine--tRNA ligase	tRNA	A0A2K9L9X8	Tupanvirus	27.3	2.8e-87
AWC33456.1|2781906_2782413_-	septum formation initiator	NA	NA	NA	NA	NA
AWC33457.1|2782505_2783279_-	RNA-binding protein	NA	NA	NA	NA	NA
AWC33458.1|2783293_2783557_-	YggT family protein	NA	NA	NA	NA	NA
AWC33459.1|2783563_2784034_-	cell division protein SepF	NA	NA	NA	NA	NA
AWC33460.1|2784052_2784727_-	YggS family pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
AWC33461.1|2784733_2785543_-	laccase domain-containing protein	NA	NA	NA	NA	NA
AWC33462.1|2785660_2785939_-	YlmC/YmxH family sporulation protein	NA	NA	NA	NA	NA
AWC33463.1|2786202_2786982_-	RNA polymerase sporulation sigma factor SigG	NA	A0A0Y0AU18	Bacillus_phage	43.4	3.4e-46
AWC33464.1|2787173_2787893_-	RNA polymerase sporulation sigma factor SigE	NA	A0A2H4JC68	uncultured_Caudovirales_phage	42.9	2.5e-19
AWC33465.1|2787912_2788839_-	sigma-E processing peptidase SpoIIGA	NA	NA	NA	NA	NA
AWC33466.1|2789054_2790209_-	cell division protein FtsZ	NA	NA	NA	NA	NA
AWC33467.1|2790248_2791553_-	cell division protein FtsA	NA	NA	NA	NA	NA
AWC33468.1|2791953_2792721_-	cell division protein DivIB	NA	NA	NA	NA	NA
AWC34920.1|2792818_2793724_-	UDP-N-acetylenolpyruvoylglucosamine reductase	NA	NA	NA	NA	NA
AWC33469.1|2793784_2794879_-	undecaprenyldiphospho-muramoylpentapeptide beta-N- acetylglucosaminyltransferase	NA	NA	NA	NA	NA
AWC34921.1|2795063_2796155_-	stage V sporulation protein E	NA	NA	NA	NA	NA
AWC33470.1|2796246_2797602_-	UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase	NA	NA	NA	NA	NA
AWC33471.1|2797602_2798577_-	phospho-N-acetylmuramoyl-pentapeptide- transferase	NA	NA	NA	NA	NA
AWC33472.1|2798599_2800075_-	UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2, 6-diaminopimelate ligase	NA	NA	NA	NA	NA
AWC33473.1|2800347_2802264_-	stage V sporulation protein D	NA	NA	NA	NA	NA
AWC34922.1|2802361_2804512_-	dihydropteridine reductase	NA	NA	NA	NA	NA
AWC33474.1|2804534_2804891_-	cell division protein FtsL	NA	NA	NA	NA	NA
AWC33475.1|2804906_2805839_-	ribosomal RNA small subunit methyltransferase H	NA	NA	NA	NA	NA
AWC34923.1|2806202_2807819_-	bacillithiol biosynthesis cysteine-adding enzyme BshC	NA	NA	NA	NA	NA
AWC34924.1|2807898_2808783_-	2-dehydropantoate 2-reductase	NA	NA	NA	NA	NA
AWC33476.1|2809084_2809558_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AWC33477.1|2809653_2810175_-	RsfA family transcriptional regulator	NA	G3MB11	Bacillus_virus	47.8	4.0e-11
2810339:2810356	attL	GCTGCCCTAAAATAGCGG	NA	NA	NA	NA
AWC33478.1|2810434_2810608_-	50S ribosomal protein L32	NA	NA	NA	NA	NA
AWC33479.1|2810669_2811170_-	hypothetical protein	NA	NA	NA	NA	NA
AWC33480.1|2811451_2812072_-	hypothetical protein	NA	Q2LIA9	Bacillus_phage	76.8	1.0e-85
AWC33481.1|2812013_2813195_-	cell division protein FtsK	NA	Q3HKZ7	Bacillus_phage	84.5	3.0e-195
AWC33482.1|2813312_2813495_-	hypothetical protein	NA	Q2I8E2	Bacillus_phage	88.3	2.2e-20
AWC33483.1|2813491_2813800_-	hypothetical protein	NA	A0A288WG08	Bacillus_phage	78.4	3.8e-41
AWC33484.1|2813983_2814193_+	XRE family transcriptional regulator	NA	Q2I8E4	Bacillus_phage	79.4	2.7e-22
AWC33485.1|2814195_2814684_+	hypothetical protein	NA	Q3HL01	Bacillus_phage	61.7	8.1e-46
AWC33486.1|2814719_2815784_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A0A7AQV3	Bacillus_phage	85.9	2.3e-178
AWC33487.1|2815780_2816020_-|holin	holin	holin	A0A2H4J378	uncultured_Caudovirales_phage	87.3	1.2e-29
AWC33488.1|2816019_2816256_-	hypothetical protein	NA	A0A2H4J382	uncultured_Caudovirales_phage	78.2	1.2e-07
AWC33489.1|2816297_2820944_-	hypothetical protein	NA	A0A1B1P7E6	Bacillus_phage	62.3	0.0e+00
AWC33490.1|2820940_2822434_-|tail	phage tail protein	tail	A0A2H4JC38	uncultured_Caudovirales_phage	83.7	1.2e-254
AWC33491.1|2822442_2826483_-|tail	phage tail tape measure protein	tail	H0USX3	Bacillus_phage	75.2	0.0e+00
AWC33492.1|2826699_2827014_-	hypothetical protein	NA	A0A288WFU6	Bacillus_phage	70.2	1.8e-35
AWC33493.1|2827062_2827674_-|tail	phage tail protein	tail	A0A2H4J8F3	uncultured_Caudovirales_phage	94.5	8.4e-101
AWC33494.1|2827674_2828034_-	DUF3168 domain-containing protein	NA	A0A0S2GLE3	Bacillus_phage	90.8	1.4e-55
AWC33495.1|2828030_2828465_-	hypothetical protein	NA	A0A288WGB7	Bacillus_phage	85.6	3.7e-66
AWC33496.1|2828457_2828781_-|head,tail	head-tail adaptor protein	head,tail	A0A288WG18	Bacillus_phage	85.0	8.0e-50
AWC33497.1|2828777_2829068_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A288WGQ6	Bacillus_phage	88.5	3.6e-41
AWC33498.1|2829085_2830261_-|capsid	phage major capsid protein	capsid	A0A288WG01	Bacillus_phage	88.0	2.5e-186
AWC34925.1|2830302_2830875_-|head,protease	HK97 family phage prohead protease	head,protease	Q2I8F8	Bacillus_phage	91.1	1.3e-95
AWC33499.1|2830864_2832175_-|portal	phage portal protein	portal	Q2LIC9	Bacillus_phage	89.2	6.4e-215
AWC33500.1|2832190_2833888_-|terminase	terminase large subunit	terminase	A0A288WFW5	Bacillus_phage	92.0	0.0e+00
AWC33501.1|2833884_2834370_-|terminase	phage terminase small subunit P27 family	terminase	A0A288WG26	Bacillus_phage	96.3	9.4e-79
AWC33502.1|2834469_2834853_-	HNH endonuclease	NA	Q2I8B2	Bacillus_phage	90.6	2.2e-62
AWC34926.1|2835059_2835425_-	hypothetical protein	NA	A0A288WG64	Bacillus_phage	75.0	1.2e-38
AWC33503.1|2835680_2835935_-	hypothetical protein	NA	A0A288WG25	Bacillus_phage	73.8	2.5e-30
AWC33504.1|2835954_2836146_-	hypothetical protein	NA	A0A288WFV5	Bacillus_phage	88.9	1.7e-23
AWC33505.1|2836151_2836370_-	hypothetical protein	NA	D2XR60	Bacillus_phage	73.6	3.3e-23
AWC33506.1|2836664_2837042_-	ArpU family transcriptional regulator	NA	Q9ZXB9	Bacillus_phage	39.7	1.0e-16
AWC34927.1|2837099_2837420_-	hypothetical protein	NA	NA	NA	NA	NA
AWC34928.1|2837460_2837688_-	hypothetical protein	NA	A0A288WFX6	Bacillus_phage	68.0	2.2e-22
AWC33507.1|2837733_2838279_-	hypothetical protein	NA	A0A1I9S5V4	Bacillus_phage	78.0	3.5e-66
AWC33508.1|2838339_2838603_-	hypothetical protein	NA	NA	NA	NA	NA
AWC33509.1|2838641_2839370_-	RNA polymerase subunit sigma-28	NA	A0A288WFV7	Bacillus_phage	46.9	6.4e-55
AWC33510.1|2839362_2839761_-	hypothetical protein	NA	NA	NA	NA	NA
AWC33511.1|2839769_2840660_-	zinc-finger domain-containing protein	NA	NA	NA	NA	NA
AWC33512.1|2840730_2841441_-	2-methylcitrate dehydratase	NA	NA	NA	NA	NA
AWC33513.1|2841456_2841873_-	DUF1064 domain-containing protein	NA	A0A2P1JTY5	Anoxybacillus_phage	56.3	1.2e-34
AWC33514.1|2841865_2842360_-	deoxyuridine 5'-triphosphate nucleotidohydrolase	NA	A0A1B1P8C0	Bacillus_phage	70.6	3.2e-58
AWC33515.1|2842576_2843029_-	MFS transporter	NA	A0A0A7AQW3	Bacillus_phage	43.4	3.3e-33
AWC33516.1|2843043_2843526_-	hypothetical protein	NA	NA	NA	NA	NA
AWC33517.1|2843506_2843701_-	hypothetical protein	NA	NA	NA	NA	NA
AWC34929.1|2843706_2844399_-	DNA replication protein	NA	A0A0S2GLK2	Bacillus_phage	50.6	7.9e-63
AWC33518.1|2844469_2845435_-	DnaD domain protein	NA	H0USU2	Bacillus_phage	51.9	9.7e-43
AWC33519.1|2845609_2846416_-	recombinase RecT	NA	S6AVW6	Thermus_phage	66.9	3.4e-97
AWC33520.1|2846415_2846655_-	hypothetical protein	NA	NA	NA	NA	NA
AWC33521.1|2846669_2847605_-	hypothetical protein	NA	S6C475	Thermus_phage	59.5	1.9e-99
AWC33522.1|2847686_2847902_-	hypothetical protein	NA	NA	NA	NA	NA
AWC34930.1|2848077_2848371_-	hypothetical protein	NA	A0A0S2GLB6	Bacillus_phage	62.4	1.7e-27
AWC33523.1|2848378_2848699_-	hypothetical protein	NA	NA	NA	NA	NA
AWC33524.1|2848846_2849056_-	DNA-binding protein	NA	A0A0U4IIS1	Bacillus_phage	50.9	4.4e-09
AWC34931.1|2849178_2849388_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AWC33525.1|2849553_2849892_+	XRE family transcriptional regulator	NA	H0UST7	Bacillus_phage	53.3	1.3e-21
AWC33526.1|2850173_2850308_-	hypothetical protein	NA	NA	NA	NA	NA
AWC33527.1|2850321_2851419_-	hypothetical protein	NA	NA	NA	NA	NA
AWC33528.1|2852105_2853236_+|integrase	site-specific integrase	integrase	A0A0U4JNS1	Bacillus_phage	37.4	1.7e-62
2859957:2859974	attR	CCGCTATTTTAGGGCAGC	NA	NA	NA	NA
>prophage 10
CP024101	Bacillus cytotoxicus strain CH_25 chromosome, complete genome	4225378	3116650	3151951	4225378	tail,portal,holin,terminase,head	Bacillus_phage(91.43%)	39	NA	NA
AWC33813.1|3116650_3117223_+	DUF4352 domain-containing protein	NA	A0A1B1P898	Bacillus_phage	84.9	1.5e-54
AWC33814.1|3117533_3117974_+	hypothetical protein	NA	NA	NA	NA	NA
AWC33815.1|3118048_3118870_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A0S2GLD4	Bacillus_phage	85.3	5.9e-142
AWC33816.1|3118869_3119310_-|holin	holin	holin	A0A1B1P7S2	Bacillus_phage	86.3	8.3e-66
AWC33817.1|3119344_3123838_-	hypothetical protein	NA	A0A0M4RER0	Bacillus_phage	45.7	9.5e-266
AWC33818.1|3123838_3125332_-|tail	phage tail protein	tail	A0A1B1P7W7	Bacillus_phage	76.3	2.4e-229
AWC33819.1|3125344_3128272_-|tail	phage tail tape measure protein	tail	A0A0A7AR36	Bacillus_phage	55.7	2.9e-183
AWC33820.1|3128277_3128544_-	hypothetical protein	NA	A0A0M4S6X7	Bacillus_phage	60.2	8.3e-21
AWC33821.1|3128579_3129017_-	hypothetical protein	NA	A0A0M4QX42	Bacillus_phage	32.7	3.6e-13
AWC33822.1|3129062_3129695_-	hypothetical protein	NA	A0A0M4R5F9	Bacillus_phage	79.1	5.7e-76
AWC33823.1|3129712_3130093_-	hypothetical protein	NA	A0A0M4RD75	Bacillus_phage	83.3	1.8e-56
AWC33824.1|3130089_3130506_-	hypothetical protein	NA	A0A0M4S6Z2	Bacillus_phage	76.8	2.7e-58
AWC33825.1|3130489_3130849_-	hypothetical protein	NA	A0A0M4S6Z9	Bacillus_phage	81.2	5.7e-49
AWC33826.1|3130830_3131169_-	hypothetical protein	NA	W8CYS9	Bacillus_phage	39.6	2.9e-10
AWC33827.1|3131205_3132048_-	hypothetical protein	NA	A0A0M5M1L4	Bacillus_phage	77.7	5.2e-117
AWC33828.1|3132061_3132652_-	DUF4355 domain-containing protein	NA	A0A0M3ULE7	Bacillus_phage	55.8	4.6e-19
AWC33829.1|3132721_3133747_-|head	phage head morphogenesis protein	head	A0A0M5M7Z2	Bacillus_phage	84.1	5.1e-159
AWC33830.1|3133733_3135089_-|portal	phage portal protein	portal	A0A0M4S669	Bacillus_phage	85.6	3.5e-200
AWC33831.1|3135100_3136405_-|terminase	PBSX family phage terminase large subunit	terminase	A0A0M4R5F3	Bacillus_phage	95.2	9.5e-251
AWC33832.1|3136391_3136823_-|terminase	terminase small subunit	terminase	A0A0M4RU19	Bacillus_phage	74.8	1.3e-55
AWC33833.1|3138233_3138614_-	ArpU family transcriptional regulator	NA	A0A0M4R397	Bacillus_phage	84.7	1.1e-53
AWC33834.1|3138618_3138906_-	hypothetical protein	NA	A6M999	Geobacillus_virus	73.4	2.9e-35
AWC34942.1|3139285_3139537_-	XRE family transcriptional regulator	NA	A0A0S2MV80	Bacillus_phage	92.7	1.3e-36
AWC33835.1|3139788_3140073_-	hypothetical protein	NA	I7J4K9	Bacillus_phage	48.9	4.3e-15
AWC33836.1|3140173_3140383_+	hypothetical protein	NA	NA	NA	NA	NA
AWC33837.1|3140443_3140875_-	hypothetical protein	NA	W8CYU3	Bacillus_phage	39.9	2.6e-19
AWC33838.1|3140904_3141108_-	hypothetical protein	NA	NA	NA	NA	NA
AWC33839.1|3141129_3141663_-	hypothetical protein	NA	U5PUK4	Bacillus_phage	60.0	8.8e-54
AWC33840.1|3141705_3141912_-	hypothetical protein	NA	NA	NA	NA	NA
AWC34943.1|3142226_3142799_-	dUTPase	NA	A0A0A7AQI4	Bacillus_phage	78.1	1.7e-82
AWC33841.1|3142951_3143575_-	hypothetical protein	NA	A0A0M4RU33	Bacillus_phage	42.1	2.3e-29
AWC33842.1|3144922_3145513_-	hypothetical protein	NA	A0A0M4S6Y4	Bacillus_phage	60.1	3.2e-36
AWC33843.1|3146670_3147153_-	ATPase	NA	E5DV79	Deep-sea_thermophilic_phage	48.1	8.3e-35
AWC33844.1|3147606_3147873_-	hypothetical protein	NA	A0A0M4S677	Bacillus_phage	80.9	2.3e-23
AWC33845.1|3148416_3149193_-	hypothetical protein	NA	A0A288WFS9	Bacillus_phage	62.9	2.7e-59
AWC33846.1|3149189_3149378_-	XRE family transcriptional regulator	NA	A0A0M3ULF9	Bacillus_phage	91.4	1.1e-22
AWC33847.1|3149650_3150073_+	XRE family transcriptional regulator	NA	A0A0M4QX29	Bacillus_phage	97.1	2.0e-69
AWC34944.1|3150087_3150513_+	ImmA/IrrE family metallo-endopeptidase	NA	A0A0M4RD70	Bacillus_phage	92.2	7.5e-72
AWC33848.1|3150526_3151951_+	recombinase family protein	NA	A0A1L2JY12	Aeribacillus_phage	42.4	7.2e-103
>prophage 1
CP024102	Bacillus cytotoxicus strain CH_25 plasmid pCh25_53, complete sequence	53029	15638	22255	53029		Bacillus_phage(33.33%)	9	NA	NA
AWC34977.1|15638_16757_-	hypothetical protein	NA	A0A2H4J8G3	uncultured_Caudovirales_phage	51.3	3.6e-97
AWC34978.1|17143_17449_+	hypothetical protein	NA	NA	NA	NA	NA
AWC34979.1|17513_18014_-	hypothetical protein	NA	NA	NA	NA	NA
AWC34980.1|18405_18828_-	hypothetical protein	NA	NA	NA	NA	NA
AWC34981.1|18870_19440_-	resolvase	NA	A0A0A8WIK3	Clostridium_phage	49.7	4.8e-42
AWC34982.1|19660_19945_+	CRISPR-associated protein Cas2	NA	A0A0M3LS55	Mannheimia_phage	38.9	3.5e-09
AWC34983.1|20018_20369_-	YolD-like family protein	NA	A0A1Q1PW34	Staphylococcus_phage	39.7	3.0e-10
AWC34984.1|20365_21631_-	DNA repair protein	NA	O64031	Bacillus_phage	47.4	1.7e-103
AWC34985.1|21820_22255_-	sporulation protein	NA	F8WPS9	Bacillus_phage	50.7	4.1e-33
>prophage 1
CP024103	Bacillus cytotoxicus strain CH_25 plasmid pCh25_67, complete sequence	67318	10107	17361	67318	integrase	Bacillus_phage(33.33%)	8	7031:7046	23239:23254
7031:7046	attL	AAATGGATTAATGAAA	NA	NA	NA	NA
AWC35029.1|10107_10680_+	hypothetical protein	NA	A0A0K2SUB9	Clostridium_phage	44.4	3.3e-14
AWC35030.1|11156_11342_-	DNA-binding protein	NA	A6M9A5	Geobacillus_virus	64.9	6.8e-14
AWC35031.1|11380_11719_-	hypothetical protein	NA	NA	NA	NA	NA
AWC35032.1|12162_13119_-|integrase	integrase	integrase	A0A1B1P793	Bacillus_phage	34.3	1.2e-37
AWC35033.1|13235_13850_-	DNA recombinase	NA	A0A1V0E035	Clostridioides_phage	32.5	7.1e-15
AWC35034.1|15052_15259_+	hypothetical protein	NA	NA	NA	NA	NA
AWC35035.1|15488_16088_+	hypothetical protein	NA	A0A1Z1LZN4	Bacillus_phage	35.6	5.1e-10
AWC35036.1|16641_17361_+	DNA (cytosine-5-)-methyltransferase	NA	A0A1I9KKE7	Lactobacillus_phage	52.0	7.4e-64
23239:23254	attR	TTTCATTAATCCATTT	NA	NA	NA	NA
