The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP024111	Bacillus cytotoxicus strain CH_4 chromosome, complete genome	4220037	157128	210996	4220037	integrase,protease,transposase	Bacillus_phage(26.67%)	55	156921:156969	174089:174137
156921:156969	attL	TGCTTCCATAGCTCAGCTGGTAGAGCACTTCCATGGTAAGGAAGAGGTC	NA	NA	NA	NA
AWC47177.1|157128_158055_+|integrase	integrase	integrase	A0A2I6UG75	Salinibacter_virus	24.5	5.5e-11
AWC50832.1|158360_159086_+	helix-turn-helix domain-containing protein	NA	A0A1I9S595	Bacillus_phage	28.6	2.0e-08
AWC47178.1|159578_159953_-	hypothetical protein	NA	NA	NA	NA	NA
AWC47179.1|161946_162561_+	hypothetical protein	NA	NA	NA	NA	NA
AWC47180.1|162566_162797_+	hypothetical protein	NA	NA	NA	NA	NA
AWC47181.1|162810_163047_+	hypothetical protein	NA	NA	NA	NA	NA
AWC47182.1|163076_163757_+	hypothetical protein	NA	NA	NA	NA	NA
AWC47183.1|163995_164820_+	hypothetical protein	NA	NA	NA	NA	NA
AWC47184.1|164834_165254_+	hypothetical protein	NA	NA	NA	NA	NA
AWC47185.1|165276_165486_+	hypothetical protein	NA	NA	NA	NA	NA
AWC47186.1|165506_165911_+	hypothetical protein	NA	NA	NA	NA	NA
AWC47187.1|166145_166796_+	hypothetical protein	NA	M1HN75	Bacillus_virus	34.6	2.1e-17
AWC47188.1|166903_167326_+	hypothetical protein	NA	A0A2P1JUJ6	Bacillus_phage	58.6	1.0e-33
AWC47189.1|167412_169599_+	hypothetical protein	NA	A0A2P1JUK2	Bacillus_phage	41.2	2.0e-11
AWC47190.1|169736_170021_+	hypothetical protein	NA	NA	NA	NA	NA
AWC47191.1|170037_170346_+	hypothetical protein	NA	NA	NA	NA	NA
AWC47192.1|170496_171348_+	DNA methyltransferase	NA	A0A1S5PRR3	Streptococcus_phage	52.3	6.7e-80
AWC47193.1|171331_172612_+	translation elongation factor	NA	NA	NA	NA	NA
AWC47194.1|172865_173189_+	hypothetical protein	NA	NA	NA	NA	NA
AWC47195.1|173251_173449_+	hypothetical protein	NA	NA	NA	NA	NA
AWC47196.1|173652_173868_+	hypothetical protein	NA	NA	NA	NA	NA
AWC47197.1|174910_176053_+	glycerate kinase	NA	W6LM47	Streptococcus_phage	41.7	5.1e-51
174089:174137	attR	TGCTTCCATAGCTCAGCTGGTAGAGCACTTCCATGGTAAGGAAGAGGTC	NA	NA	NA	NA
AWC47198.1|176250_177144_+	arginase	NA	A0A1V0SJM8	Klosneuvirus	31.1	7.9e-23
AWC47199.1|177397_178228_+	TIGR00159 family protein	NA	NA	NA	NA	NA
AWC47200.1|178220_179666_+	hypothetical protein	NA	NA	NA	NA	NA
AWC47201.1|179658_181005_+	phosphoglucosamine mutase	NA	NA	NA	NA	NA
AWC47202.1|181489_183292_+	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	Q84421	Paramecium_bursaria_Chlorella_virus	40.3	3.1e-103
AWC47203.1|183522_184194_-	hypothetical protein	NA	A0A146ICT8	Staphylococcus_phage	55.6	1.1e-16
AWC47204.1|184619_185372_-|transposase	transposase	transposase	A0A059NT77	Lactococcus_phage	46.9	2.7e-56
AWC47205.1|185361_186657_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	27.1	8.5e-10
AWC47206.1|187528_188398_+	hypothetical protein	NA	A0A1X9I6E0	Streptococcus_phage	26.1	1.6e-07
AWC47207.1|188838_190032_+	radical SAM protein	NA	NA	NA	NA	NA
AWC47208.1|190024_191950_+	hypothetical protein	NA	NA	NA	NA	NA
AWC47209.1|191942_192533_+	radical SAM protein	NA	NA	NA	NA	NA
AWC47210.1|192519_193329_+	hypothetical protein	NA	NA	NA	NA	NA
AWC47211.1|194835_195540_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
AWC47212.1|196056_196800_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
AWC47213.1|197423_197663_-	hypothetical protein	NA	NA	NA	NA	NA
AWC47214.1|197709_197862_+	hypothetical protein	NA	NA	NA	NA	NA
AWC47215.1|198165_198822_+	hypothetical protein	NA	NA	NA	NA	NA
AWC50833.1|199055_199469_+	DUF1648 domain-containing protein	NA	NA	NA	NA	NA
AWC47216.1|200462_201629_+	MFS transporter	NA	NA	NA	NA	NA
AWC47217.1|201634_202096_+	hypothetical protein	NA	NA	NA	NA	NA
AWC47218.1|202098_202911_+	hypothetical protein	NA	NA	NA	NA	NA
AWC47219.1|202944_203226_+	hypothetical protein	NA	NA	NA	NA	NA
AWC47220.1|203230_204223_+	hypothetical protein	NA	NA	NA	NA	NA
AWC47221.1|204227_204482_+	hypothetical protein	NA	NA	NA	NA	NA
AWC47222.1|204478_205642_+	hypothetical protein	NA	NA	NA	NA	NA
AWC47223.1|205660_206896_+	ATP-grasp domain-containing protein	NA	NA	NA	NA	NA
AWC47224.1|206913_207645_+	adenylyltransferase	NA	S4VW33	Pandoravirus	31.3	4.1e-09
AWC47225.1|207785_208151_+	hypothetical protein	NA	NA	NA	NA	NA
AWC47226.1|208160_208364_+	hypothetical protein	NA	NA	NA	NA	NA
AWC47227.1|208305_208473_-	hypothetical protein	NA	NA	NA	NA	NA
AWC50834.1|209065_209488_+	hypothetical protein	NA	NA	NA	NA	NA
AWC47228.1|209844_210996_+|transposase	transposase	transposase	S6AND0	Bacillus_phage	80.4	9.1e-173
>prophage 2
CP024111	Bacillus cytotoxicus strain CH_4 chromosome, complete genome	4220037	287352	295330	4220037		uncultured_virus(33.33%)	6	NA	NA
AWC47295.1|287352_287637_+	co-chaperone GroES	NA	A0A221S3C8	uncultured_virus	52.7	5.8e-20
AWC47296.1|287671_289300_+	molecular chaperone GroEL	NA	A0A219YK78	uncultured_virus	56.9	1.5e-157
AWC47297.1|289726_291274_+	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	30.6	2.2e-20
AWC47298.1|291647_292973_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	31.8	4.4e-46
AWC47299.1|293115_293817_+	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	38.7	8.6e-41
AWC50837.1|293842_295330_+	sensor histidine kinase	NA	W8CYF6	Bacillus_phage	31.2	1.3e-33
>prophage 3
CP024111	Bacillus cytotoxicus strain CH_4 chromosome, complete genome	4220037	328310	336682	4220037		Synechococcus_phage(33.33%)	8	NA	NA
AWC47310.1|328310_329612_+	adenylosuccinate lyase	NA	A0A1B3B081	Gordonia_phage	31.6	2.0e-19
AWC47311.1|329706_330426_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	G8EYA2	Synechococcus_phage	43.9	9.8e-48
AWC47312.1|330418_330673_+	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
AWC47313.1|330669_331353_+	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
AWC47314.1|331336_333556_+	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	41.2	2.0e-160
AWC47315.1|333540_334956_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	35.2	3.6e-54
AWC47316.1|335058_336102_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	48.0	2.7e-70
AWC47317.1|336094_336682_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	34.2	1.6e-24
>prophage 4
CP024111	Bacillus cytotoxicus strain CH_4 chromosome, complete genome	4220037	470834	523154	4220037	tail,integrase,capsid,holin,portal	Bacillus_phage(47.06%)	63	470242:470301	524952:525462
470242:470301	attL	TTCTCAATCCGCTCAATCACATCTTGCAATTCATCTGGCTTTAGAAACTCAATCGGAGAG	NA	NA	NA	NA
AWC47421.1|470834_471959_-|integrase	site-specific integrase	integrase	A0A2H4JCB7	uncultured_Caudovirales_phage	37.8	1.2e-63
AWC47422.1|472158_472560_+	helix-turn-helix domain-containing protein	NA	A0A142F1P0	Bacillus_phage	58.5	2.3e-30
AWC47423.1|472556_472928_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
AWC47424.1|473193_474087_+	hypothetical protein	NA	A0A0N9RZE9	Paenibacillus_phage	30.9	5.5e-16
AWC47425.1|474098_474713_+	hypothetical protein	NA	NA	NA	NA	NA
AWC47426.1|474842_475187_+	hypothetical protein	NA	NA	NA	NA	NA
AWC47427.1|475268_475427_+	Fur-regulated basic protein FbpA	NA	NA	NA	NA	NA
AWC47428.1|475413_475746_+	hypothetical protein	NA	NA	NA	NA	NA
AWC50839.1|475751_476138_+	hypothetical protein	NA	A0A2H4J134	uncultured_Caudovirales_phage	36.2	5.5e-13
AWC47429.1|476153_476828_+	DUF723 domain-containing protein	NA	NA	NA	NA	NA
AWC47430.1|476827_477592_+	DNA replication protein	NA	A0A0N7GFF0	Paenibacillus_phage	56.5	3.7e-77
AWC47431.1|477955_478144_+	hypothetical protein	NA	NA	NA	NA	NA
AWC47432.1|478190_478442_+	hypothetical protein	NA	NA	NA	NA	NA
AWC47433.1|478488_478740_+	hypothetical protein	NA	NA	NA	NA	NA
AWC47434.1|478760_479177_+	hypothetical protein	NA	A0A0K2CNU6	Brevibacillus_phage	57.1	8.5e-12
AWC47435.1|479424_479709_+	hypothetical protein	NA	A0A0H3V0M3	Geobacillus_virus	44.0	5.4e-10
AWC47436.1|479805_481149_+	DNA helicase	NA	A0A2H4IZL9	uncultured_Caudovirales_phage	55.8	7.5e-134
AWC47437.1|481175_482192_+	hypothetical protein	NA	A0A2H4J6E6	uncultured_Caudovirales_phage	43.2	6.8e-71
AWC50840.1|482199_482385_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AWC47438.1|482448_482652_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AWC47439.1|482766_483990_+	hypothetical protein	NA	A0A288WGM1	Bacillus_phage	47.8	9.9e-101
AWC47440.1|484284_484932_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
AWC47441.1|485438_486197_+	single-stranded DNA-binding protein	NA	A0A0N9SJW5	Paenibacillus_phage	47.6	6.0e-56
AWC47442.1|486208_486616_+	hypothetical protein	NA	NA	NA	NA	NA
AWC47443.1|486608_487802_+	hypothetical protein	NA	A0A142F1R1	Bacillus_phage	27.4	7.9e-10
AWC47444.1|489607_490102_+	hypothetical protein	NA	A0A0A0RUN2	Bacillus_phage	47.3	3.7e-30
AWC47445.1|491002_491158_+	hypothetical protein	NA	NA	NA	NA	NA
AWC47446.1|491171_492218_+	hypothetical protein	NA	A0A0N9SHN6	Paenibacillus_phage	58.6	4.8e-88
AWC47447.1|492217_492442_+	hypothetical protein	NA	U5Q038	Bacillus_phage	70.6	8.3e-22
AWC47448.1|492438_492966_+	hypothetical protein	NA	A0A0N9ST03	Paenibacillus_phage	44.6	3.2e-08
AWC47449.1|493251_493647_+	alpha/beta hydrolase	NA	A0A2H4IZM2	uncultured_Caudovirales_phage	68.9	6.1e-44
AWC47450.1|493646_493955_+	transglycosylase	NA	A0A0K2CZP5	Paenibacillus_phage	36.9	2.6e-05
AWC47451.1|494097_494730_+	hypothetical protein	NA	NA	NA	NA	NA
AWC47452.1|494731_495358_+	hypothetical protein	NA	J9Q953	Bacillus_phage	43.2	1.4e-34
AWC47453.1|495418_496024_+	hypothetical protein	NA	A0A2H4JAZ2	uncultured_Caudovirales_phage	41.2	7.7e-38
AWC47454.1|496020_496254_+	glutaredoxin family protein	NA	A0A1B1P8E0	Bacillus_phage	64.5	1.2e-23
AWC47455.1|496265_496904_+	hypothetical protein	NA	NA	NA	NA	NA
AWC47456.1|497288_497666_+	hypothetical protein	NA	A0A0N9RZI0	Paenibacillus_phage	43.1	2.0e-15
AWC47457.1|497677_498244_+	hypothetical protein	NA	A0A2H4J2L4	uncultured_Caudovirales_phage	45.8	9.7e-35
AWC47458.1|498639_499464_+	hypothetical protein	NA	NA	NA	NA	NA
AWC47459.1|500532_501006_+	hypothetical protein	NA	NA	NA	NA	NA
AWC47460.1|501005_502709_+	hypothetical protein	NA	A0A142F1L6	Bacillus_phage	50.5	2.9e-159
AWC47461.1|502724_504266_+|portal	phage portal protein	portal	A0A142F1L7	Bacillus_phage	48.4	8.3e-137
AWC47462.1|504266_504818_+	hypothetical protein	NA	NA	NA	NA	NA
AWC47463.1|504840_505227_+	hypothetical protein	NA	A0A142F1L9	Bacillus_phage	68.2	3.2e-45
AWC47464.1|505290_506316_+|capsid	major capsid protein E	capsid	A0A142F1M0	Bacillus_phage	59.8	5.4e-108
AWC47465.1|506315_506528_+	hypothetical protein	NA	NA	NA	NA	NA
AWC47466.1|506533_506890_+	hypothetical protein	NA	A0A142F1M2	Bacillus_phage	34.5	2.0e-09
AWC47467.1|508217_508469_+	hypothetical protein	NA	NA	NA	NA	NA
AWC47468.1|508555_508930_+	hypothetical protein	NA	NA	NA	NA	NA
AWC47469.1|508929_509289_+	hypothetical protein	NA	NA	NA	NA	NA
AWC47470.1|509291_509699_+	hypothetical protein	NA	NA	NA	NA	NA
AWC47471.1|509717_510227_+|tail	phage major tail protein, TP901-1 family	tail	NA	NA	NA	NA
AWC47472.1|510285_510660_+	hypothetical protein	NA	NA	NA	NA	NA
AWC47473.1|510701_511001_+	hypothetical protein	NA	NA	NA	NA	NA
AWC47474.1|511051_514795_+|tail	phage tail tape measure protein	tail	A6M961	Geobacillus_virus	38.8	8.1e-53
AWC47475.1|514809_516312_+|tail	phage tail protein	tail	A0A1B1P7W7	Bacillus_phage	73.9	5.0e-203
AWC47476.1|516311_520808_+	hypothetical protein	NA	A0A0M4RER0	Bacillus_phage	45.3	2.8e-262
AWC47477.1|520847_521132_+	hypothetical protein	NA	NA	NA	NA	NA
AWC47478.1|521146_521377_+|holin	phage holin	holin	A0A0S2MVE8	Bacillus_phage	73.3	4.1e-24
AWC47479.1|521392_522217_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A2H4J966	uncultured_Caudovirales_phage	51.1	7.2e-79
AWC47480.1|522257_522842_-	hypothetical protein	NA	NA	NA	NA	NA
AWC47481.1|522941_523154_-	XRE family transcriptional regulator	NA	A0A076G7N2	Bacillus_phage	51.5	9.0e-10
524952:525462	attR	TTCTCAATCCGCTCAATCACATCTTGCAATTCATCTGGCTTTAGAAACTCAATCGGAGAGAAGCCTTTCTCAAACGTAAGTGTATCAGCCTCAATCATTAATACGTATCGGTCATTTACCTTTGCAATATGTATTTGATCCCCGAAATCAGCAAGCAGAGCTTTCACAGAAATGTGATCGGCTTTAACCTTTAATTCTACTTCAGGAGCATGCTCGACGATTTGAGCGGTAGCTTCCATTATTTCTTCGGTTGAAAACTGTTCCATAATTTCGCGTTTCGGACTAGCGGCCCATACTTCCATCGCTTGGTCGAATTGTTCGCGTTCTTCCGTACCTTCTTCAAATATATCTTCAATTTGGTCGTATACCATGTCCATTACTTGTGTTTTCATAATTTCAGGCATGGAGCGTTCATATTCGACAAATTTTAAGAAGTCTTCAAAGTAGCGGGCATGCGATGCTTGGTGTATTTTTAATTCGCCGACTTCGACCATACCTTCTTCAGGCATGT	NA	NA	NA	NA
>prophage 5
CP024111	Bacillus cytotoxicus strain CH_4 chromosome, complete genome	4220037	1755102	1822555	4220037	integrase,bacteriocin,coat	Bacillus_phage(36.36%)	60	1762132:1762159	1791530:1791557
AWC48578.1|1755102_1756212_-|integrase	site-specific integrase	integrase	A0A0U3U8Y8	Bacillus_phage	40.9	2.6e-60
AWC48579.1|1756212_1756410_-	DNA-binding protein	NA	A0A1B0T6C2	Bacillus_phage	41.2	4.3e-06
AWC48580.1|1756424_1757501_-	replication initiation factor	NA	NA	NA	NA	NA
AWC48581.1|1757919_1758621_+	hypothetical protein	NA	NA	NA	NA	NA
AWC48582.1|1758743_1759865_+	DUF4297 domain-containing protein	NA	NA	NA	NA	NA
AWC48583.1|1759933_1761640_+	hypothetical protein	NA	NA	NA	NA	NA
1762132:1762159	attL	ATCTTCCTTGCTTCTCTCTGAATCTTGA	NA	NA	NA	NA
AWC48584.1|1762415_1762649_+	TIGR04197 family type VII secretion effector	NA	NA	NA	NA	NA
AWC48585.1|1762694_1762994_+	hypothetical protein	NA	NA	NA	NA	NA
AWC48586.1|1763000_1763174_+	hypothetical protein	NA	NA	NA	NA	NA
AWC48587.1|1763558_1764263_+	hypothetical protein	NA	NA	NA	NA	NA
AWC48588.1|1764780_1765152_-|integrase	site-specific integrase	integrase	A0A1B0T6A8	Bacillus_phage	54.4	2.1e-25
AWC48589.1|1765414_1766509_+	tetratricopeptide repeat-containing protein	NA	A0A2H4J8G3	uncultured_Caudovirales_phage	51.8	1.2e-100
AWC48590.1|1766826_1767102_-	hypothetical protein	NA	NA	NA	NA	NA
AWC48591.1|1767299_1767953_-	hypothetical protein	NA	NA	NA	NA	NA
AWC48592.1|1768459_1768714_-	hypothetical protein	NA	NA	NA	NA	NA
AWC48593.1|1768849_1769110_+	hypothetical protein	NA	NA	NA	NA	NA
AWC48594.1|1769159_1769387_+	hypothetical protein	NA	NA	NA	NA	NA
AWC48595.1|1769586_1770507_+	gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
AWC48596.1|1771504_1771780_+	hypothetical protein	NA	NA	NA	NA	NA
AWC48597.1|1773187_1773595_-	hypothetical protein	NA	NA	NA	NA	NA
AWC50894.1|1773617_1774094_-	hypothetical protein	NA	NA	NA	NA	NA
AWC48598.1|1775652_1775970_-	DUF3884 domain-containing protein	NA	NA	NA	NA	NA
AWC48599.1|1776620_1776827_-	hypothetical protein	NA	NA	NA	NA	NA
AWC48600.1|1777651_1778020_-	NUDIX domain-containing protein	NA	NA	NA	NA	NA
AWC48601.1|1778670_1779783_-	tetratricopeptide repeat-containing protein	NA	A0A2H4J8G3	uncultured_Caudovirales_phage	49.1	2.4e-93
AWC48602.1|1780101_1780500_-	5-carboxymethyl-2-hydroxymuconate isomerase	NA	NA	NA	NA	NA
AWC48603.1|1780572_1781331_-	2-hydroxyhepta-2,4-diene-1,7-dioate isomerase	NA	NA	NA	NA	NA
AWC48604.1|1781327_1782119_-	4-hydroxyphenylacetate isomerase	NA	NA	NA	NA	NA
AWC48605.1|1782139_1783690_-	cation acetate symporter	NA	NA	NA	NA	NA
AWC48606.1|1783679_1784009_-	DUF485 domain-containing protein	NA	NA	NA	NA	NA
AWC48607.1|1784069_1784936_-	cytidyltransferase	NA	NA	NA	NA	NA
AWC48608.1|1784993_1785977_-	3,4-dihydroxyphenylacetate 2,3-dioxygenase	NA	NA	NA	NA	NA
AWC48609.1|1785996_1787469_-	4-hydroxyphenylacetate 3-monooxygenase, oxygenase component	NA	NA	NA	NA	NA
AWC48610.1|1787522_1789046_-	5-carboxymethyl-2-hydroxymuconate semialdehyde dehydrogenase	NA	NA	NA	NA	NA
AWC48611.1|1789115_1790042_-	2,4-dihydroxyhept-2-ene-1,7-dioic acid aldolase	NA	NA	NA	NA	NA
AWC48612.1|1790228_1791113_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AWC48613.1|1791174_1791357_-	DUF3976 domain-containing protein	NA	NA	NA	NA	NA
AWC48614.1|1792325_1795202_+	2-oxoglutarate dehydrogenase subunit E1	NA	NA	NA	NA	NA
1791530:1791557	attR	ATCTTCCTTGCTTCTCTCTGAATCTTGA	NA	NA	NA	NA
AWC48615.1|1795322_1796567_+	dihydrolipoyllysine-residue succinyltransferase	NA	NA	NA	NA	NA
AWC48616.1|1796725_1798651_+|bacteriocin	putative thiazole-containing bacteriocin maturation protein	bacteriocin	NA	NA	NA	NA
AWC48617.1|1798644_1800597_+|bacteriocin	bacteriocin biosynthesis protein SagD	bacteriocin	NA	NA	NA	NA
AWC48618.1|1800657_1802202_+	NADH oxidase	NA	NA	NA	NA	NA
AWC48619.1|1802415_1802826_-	DUF3908 domain-containing protein	NA	NA	NA	NA	NA
AWC48620.1|1802954_1804289_-	CoA-disulfide reductase	NA	NA	NA	NA	NA
AWC48621.1|1804463_1805210_-	zinc ribbon domain-containing protein	NA	NA	NA	NA	NA
AWC48622.1|1805338_1806172_+	hypothetical protein	NA	NA	NA	NA	NA
AWC48623.1|1806218_1806902_-	DUF2278 domain-containing protein	NA	NA	NA	NA	NA
AWC48624.1|1807006_1808500_-	lactate permease	NA	NA	NA	NA	NA
AWC48625.1|1810332_1811799_+	sodium/proline symporter PutP	NA	NA	NA	NA	NA
AWC48626.1|1811970_1812360_+	hypothetical protein	NA	A0A0E3TB73	Enterococcus_phage	36.6	8.2e-09
AWC48627.1|1812580_1813492_-	EamA/RhaT family transporter	NA	NA	NA	NA	NA
AWC48628.1|1813712_1814444_+	esterase family protein	NA	NA	NA	NA	NA
AWC48629.1|1814536_1815055_+	hypothetical protein	NA	NA	NA	NA	NA
AWC48630.1|1815580_1817635_+	ATP-dependent helicase	NA	S5MMD7	Bacillus_phage	31.9	6.2e-79
AWC48631.1|1817801_1818275_+|coat	spore coat protein	coat	NA	NA	NA	NA
AWC48632.1|1818710_1819211_+	hypothetical protein	NA	NA	NA	NA	NA
AWC48633.1|1819414_1820266_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	40.2	9.5e-42
AWC48634.1|1820277_1821249_-	dTDP-glucose 4,6-dehydratase	NA	A0A1D7XFE8	Escherichia_phage	42.9	8.5e-71
AWC48635.1|1821260_1821809_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A218MN57	uncultured_virus	43.2	1.7e-31
AWC48636.1|1821817_1822555_-|coat	spore coat protein	coat	I7I009	Enterobacteria_phage	44.7	2.8e-50
>prophage 6
CP024111	Bacillus cytotoxicus strain CH_4 chromosome, complete genome	4220037	2123400	2172899	4220037	coat,transposase	Staphylococcus_prophage(12.5%)	55	NA	NA
AWC48886.1|2123400_2123793_+|transposase	IS1182 family transposase	transposase	Q9MBP7	Staphylococcus_prophage	47.0	5.3e-24
AWC48887.1|2123994_2124345_+	DUF3139 domain-containing protein	NA	NA	NA	NA	NA
AWC48888.1|2124741_2125194_+	hypothetical protein	NA	NA	NA	NA	NA
AWC48889.1|2125194_2125425_-	hypothetical protein	NA	NA	NA	NA	NA
AWC48890.1|2125403_2126000_-	hypothetical protein	NA	A0A146ICT8	Staphylococcus_phage	42.9	7.8e-35
AWC48891.1|2126277_2127645_-	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
AWC48892.1|2127668_2128553_-	N-acetylmuramic acid 6-phosphate etherase	NA	NA	NA	NA	NA
AWC48893.1|2128718_2129036_-	DUF4870 domain-containing protein	NA	A0A2H4JDX0	uncultured_Caudovirales_phage	37.6	3.3e-08
AWC48894.1|2129201_2130065_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
AWC48895.1|2130262_2131390_-	cation:proton antiporter	NA	NA	NA	NA	NA
AWC48896.1|2131826_2132027_-	hypothetical protein	NA	NA	NA	NA	NA
AWC48897.1|2132623_2133076_+	group-specific protein	NA	NA	NA	NA	NA
AWC48898.1|2133146_2133500_-	DUF3992 domain-containing protein	NA	NA	NA	NA	NA
AWC48899.1|2133513_2133894_-	DUF3992 domain-containing protein	NA	NA	NA	NA	NA
AWC48900.1|2134019_2134301_-	DUF1232 domain-containing protein	NA	NA	NA	NA	NA
AWC48901.1|2134519_2135299_-	DUF2935 domain-containing protein	NA	A0A2I2L551	Orpheovirus	34.0	9.9e-38
AWC50909.1|2135361_2135718_-	lactoylglutathione lyase	NA	NA	NA	NA	NA
AWC48902.1|2135844_2136060_+|coat	spore coat associated protein CotJA	coat	NA	NA	NA	NA
AWC48903.1|2136068_2136332_+|coat	spore coat protein CotJB	coat	NA	NA	NA	NA
AWC48904.1|2136344_2136914_+|coat	spore coat protein CotJC	coat	NA	NA	NA	NA
AWC48905.1|2137128_2138445_+	branched-chain amino acid transport system II carrier protein	NA	NA	NA	NA	NA
AWC48906.1|2139064_2140168_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
AWC48907.1|2140164_2140839_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	39.5	6.1e-36
AWC48908.1|2140841_2142023_+	ABC transporter permease	NA	NA	NA	NA	NA
AWC48909.1|2142063_2143152_-	DUF871 domain-containing protein	NA	NA	NA	NA	NA
AWC48910.1|2143472_2144675_+	MFS transporter	NA	NA	NA	NA	NA
AWC48911.1|2145017_2146673_+	sodium:phosphate symporter	NA	NA	NA	NA	NA
AWC48912.1|2147020_2148187_+	LytR family transcriptional regulator	NA	NA	NA	NA	NA
AWC48913.1|2148342_2148783_+	hypothetical protein	NA	NA	NA	NA	NA
AWC48914.1|2148982_2150395_-	stage V sporulation protein R	NA	NA	NA	NA	NA
AWC48915.1|2151079_2151640_-	nitroreductase	NA	NA	NA	NA	NA
AWC48916.1|2151915_2153427_+	spore germination protein	NA	NA	NA	NA	NA
AWC48917.1|2153423_2154506_+	Ger(x)C family spore germination protein	NA	NA	NA	NA	NA
AWC48918.1|2154518_2155619_+	spore gernimation protein GerB	NA	NA	NA	NA	NA
AWC48919.1|2155673_2156171_+	hypothetical protein	NA	NA	NA	NA	NA
AWC48920.1|2156271_2156520_+	hypothetical protein	NA	NA	NA	NA	NA
AWC48921.1|2156707_2157583_+	LytR family transcriptional regulator	NA	NA	NA	NA	NA
AWC48922.1|2157713_2158133_+	disulfide bond formation protein B	NA	NA	NA	NA	NA
AWC48923.1|2158145_2158556_+	thioredoxin	NA	NA	NA	NA	NA
AWC48924.1|2158627_2158843_+	DUF1540 domain-containing protein	NA	NA	NA	NA	NA
AWC48925.1|2158893_2159166_-	hypothetical protein	NA	NA	NA	NA	NA
AWC48926.1|2159258_2160020_-	L,D-transpeptidase	NA	NA	NA	NA	NA
AWC48927.1|2160192_2161059_-	NAD(P)-dependent oxidoreductase	NA	A0A2N9QUX2	Trichoplusia_ni_ascovirus	43.3	6.6e-59
AWC48928.1|2161346_2162648_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	34.1	4.5e-51
AWC48929.1|2162783_2163638_-	patatin family protein	NA	NA	NA	NA	NA
AWC48930.1|2163788_2164187_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
AWC48931.1|2164512_2165169_+	hypothetical protein	NA	NA	NA	NA	NA
AWC48932.1|2165722_2166094_-	hypothetical protein	NA	NA	NA	NA	NA
AWC48933.1|2166178_2167291_+	hypothetical protein	NA	NA	NA	NA	NA
AWC48934.1|2167305_2168277_-	ornithine cyclodeaminase	NA	NA	NA	NA	NA
AWC48935.1|2168291_2168699_-	transcriptional repressor	NA	NA	NA	NA	NA
AWC48936.1|2168940_2169639_+	recombinase	NA	M9Q1K0	Clostridium_phage	25.4	2.9e-12
AWC48937.1|2169874_2170348_-	8-oxo-dGTP diphosphatase	NA	NA	NA	NA	NA
AWC48938.1|2170426_2170807_-|transposase	transposase	transposase	NA	NA	NA	NA
AWC48939.1|2170808_2172899_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 7
CP024111	Bacillus cytotoxicus strain CH_4 chromosome, complete genome	4220037	2620740	2636221	4220037	integrase	Bacillus_phage(72.73%)	29	2632455:2632469	2638979:2638993
AWC49319.1|2620740_2620950_-	DNA-binding protein	NA	A0A1Z1LZP5	Bacillus_phage	62.1	1.4e-15
AWC49320.1|2621197_2621413_-	hypothetical protein	NA	NA	NA	NA	NA
AWC49321.1|2621743_2622211_-	ArpU family transcriptional regulator	NA	S6AVV9	Thermus_phage	51.8	3.5e-30
AWC50920.1|2622948_2623224_-	DNA-binding protein	NA	A0A2H4JBQ8	uncultured_Caudovirales_phage	43.2	2.0e-09
AWC49322.1|2623192_2623390_-	hypothetical protein	NA	NA	NA	NA	NA
AWC49323.1|2623463_2623655_-	hypothetical protein	NA	NA	NA	NA	NA
AWC49324.1|2623753_2624134_-	ArpU family transcriptional regulator	NA	A0A0M4R397	Bacillus_phage	84.7	4.1e-53
AWC49325.1|2624138_2624426_-	hypothetical protein	NA	A6M999	Geobacillus_virus	70.2	4.2e-34
AWC49326.1|2624455_2624656_-	hypothetical protein	NA	NA	NA	NA	NA
AWC49327.1|2624687_2624894_-	hypothetical protein	NA	NA	NA	NA	NA
AWC49328.1|2624935_2625178_-	hypothetical protein	NA	A0A0S2MV78	Bacillus_phage	73.8	9.9e-29
AWC49329.1|2625207_2625435_-	hypothetical protein	NA	A0A288WFX6	Bacillus_phage	98.7	3.5e-36
AWC49330.1|2625475_2626114_-	hypothetical protein	NA	A0A0K2CP60	Brevibacillus_phage	49.0	1.5e-52
AWC49331.1|2626145_2626349_-	hypothetical protein	NA	NA	NA	NA	NA
AWC49332.1|2626762_2627551_-	hypothetical protein	NA	A0A0M4RU33	Bacillus_phage	39.7	1.5e-28
AWC49333.1|2627543_2627732_-	hypothetical protein	NA	A0A0M4RD83	Bacillus_phage	56.7	3.6e-10
AWC49334.1|2627716_2627932_-	hypothetical protein	NA	NA	NA	NA	NA
AWC49335.1|2627942_2628815_-	DNA replication protein	NA	A0A0M4RD64	Bacillus_phage	72.0	5.6e-114
AWC49336.1|2628744_2629533_-	phage replication protein	NA	A0A0M4S6Y4	Bacillus_phage	76.8	9.6e-89
AWC49337.1|2629533_2629803_-	hypothetical protein	NA	A0A0M4S680	Bacillus_phage	83.1	5.3e-39
AWC49338.1|2629783_2630638_-	hypothetical protein	NA	Q38143	Bacillus_phage	44.6	5.4e-53
AWC49339.1|2631788_2632028_-	hypothetical protein	NA	A0A0M4S677	Bacillus_phage	77.9	2.3e-22
AWC49340.1|2632354_2632537_-	hypothetical protein	NA	A0A2H4J4V8	uncultured_Caudovirales_phage	43.5	4.4e-05
2632455:2632469	attL	ATTTCTTTCACTTCT	NA	NA	NA	NA
AWC49341.1|2632571_2632847_-	group-specific protein	NA	S5MC08	Brevibacillus_phage	59.3	3.6e-27
AWC49342.1|2632873_2633710_-	hypothetical protein	NA	A0A0M5M1L9	Bacillus_phage	84.9	2.6e-129
AWC49343.1|2633706_2633895_-	XRE family transcriptional regulator	NA	A0A1C8E998	Bacillus_phage	83.6	2.0e-21
AWC49344.1|2634167_2634587_+	XRE family transcriptional regulator	NA	A0A1C8E9A4	Bacillus_phage	89.2	1.1e-64
AWC49345.1|2634601_2635027_+	ImmA/IrrE family metallo-endopeptidase	NA	A0A1C8E988	Bacillus_phage	92.9	1.2e-72
AWC49346.1|2635063_2636221_+|integrase	site-specific integrase	integrase	A0A0S2SXP1	Bacillus_phage	76.1	1.2e-76
2638979:2638993	attR	ATTTCTTTCACTTCT	NA	NA	NA	NA
>prophage 8
CP024111	Bacillus cytotoxicus strain CH_4 chromosome, complete genome	4220037	2818503	2892471	4220037	tail,integrase,protease,head,terminase,capsid,holin,tRNA,portal	Bacillus_phage(77.78%)	85	2850046:2850063	2899192:2899209
AWC49504.1|2818503_2821269_-|tRNA	isoleucine--tRNA ligase	tRNA	A0A2K9L9X8	Tupanvirus	27.3	2.8e-87
AWC49505.1|2821613_2822120_-	septum formation initiator	NA	NA	NA	NA	NA
AWC49506.1|2822212_2822986_-	RNA-binding protein	NA	NA	NA	NA	NA
AWC49507.1|2823000_2823264_-	YggT family protein	NA	NA	NA	NA	NA
AWC49508.1|2823270_2823741_-	cell division protein SepF	NA	NA	NA	NA	NA
AWC49509.1|2823759_2824434_-	YggS family pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
AWC49510.1|2824440_2825250_-	laccase domain-containing protein	NA	NA	NA	NA	NA
AWC49511.1|2825367_2825646_-	YlmC/YmxH family sporulation protein	NA	NA	NA	NA	NA
AWC49512.1|2825909_2826689_-	RNA polymerase sporulation sigma factor SigG	NA	A0A0Y0AU18	Bacillus_phage	43.4	3.4e-46
AWC49513.1|2826880_2827600_-	RNA polymerase sporulation sigma factor SigE	NA	A0A2H4JC68	uncultured_Caudovirales_phage	42.9	2.5e-19
AWC49514.1|2827619_2828546_-	sigma-E processing peptidase SpoIIGA	NA	NA	NA	NA	NA
AWC49515.1|2828761_2829916_-	cell division protein FtsZ	NA	NA	NA	NA	NA
AWC49516.1|2829955_2831260_-	cell division protein FtsA	NA	NA	NA	NA	NA
AWC49517.1|2831660_2832428_-	cell division protein DivIB	NA	NA	NA	NA	NA
AWC50926.1|2832525_2833431_-	UDP-N-acetylenolpyruvoylglucosamine reductase	NA	NA	NA	NA	NA
AWC49518.1|2833491_2834586_-	undecaprenyldiphospho-muramoylpentapeptide beta-N- acetylglucosaminyltransferase	NA	NA	NA	NA	NA
AWC50927.1|2834770_2835862_-	stage V sporulation protein E	NA	NA	NA	NA	NA
AWC49519.1|2835953_2837309_-	UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase	NA	NA	NA	NA	NA
AWC49520.1|2837309_2838284_-	phospho-N-acetylmuramoyl-pentapeptide- transferase	NA	NA	NA	NA	NA
AWC49521.1|2838306_2839782_-	UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2, 6-diaminopimelate ligase	NA	NA	NA	NA	NA
AWC49522.1|2840054_2841971_-	stage V sporulation protein D	NA	NA	NA	NA	NA
AWC50928.1|2842068_2844219_-	dihydropteridine reductase	NA	NA	NA	NA	NA
AWC49523.1|2844241_2844598_-	cell division protein FtsL	NA	NA	NA	NA	NA
AWC49524.1|2844613_2845546_-	ribosomal RNA small subunit methyltransferase H	NA	NA	NA	NA	NA
AWC50929.1|2845909_2847526_-	bacillithiol biosynthesis cysteine-adding enzyme BshC	NA	NA	NA	NA	NA
AWC50930.1|2847605_2848490_-	2-dehydropantoate 2-reductase	NA	NA	NA	NA	NA
AWC49525.1|2848791_2849265_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AWC49526.1|2849360_2849882_-	RsfA family transcriptional regulator	NA	G3MB11	Bacillus_virus	47.8	4.0e-11
2850046:2850063	attL	GCTGCCCTAAAATAGCGG	NA	NA	NA	NA
AWC49527.1|2850141_2850315_-	50S ribosomal protein L32	NA	NA	NA	NA	NA
AWC49528.1|2850376_2850877_-	hypothetical protein	NA	NA	NA	NA	NA
AWC49529.1|2851158_2851779_-	hypothetical protein	NA	Q2LIA9	Bacillus_phage	76.8	1.0e-85
AWC49530.1|2851720_2852902_-	cell division protein FtsK	NA	Q3HKZ7	Bacillus_phage	84.5	3.0e-195
AWC49531.1|2853019_2853202_-	hypothetical protein	NA	Q2I8E2	Bacillus_phage	88.3	2.2e-20
AWC49532.1|2853198_2853507_-	hypothetical protein	NA	A0A288WG08	Bacillus_phage	78.4	3.8e-41
AWC49533.1|2853690_2853900_+	XRE family transcriptional regulator	NA	Q2I8E4	Bacillus_phage	79.4	2.7e-22
AWC49534.1|2853902_2854391_+	hypothetical protein	NA	Q3HL01	Bacillus_phage	61.7	8.1e-46
AWC49535.1|2854426_2855491_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A0A7AQV3	Bacillus_phage	85.9	2.3e-178
AWC49536.1|2855487_2855727_-|holin	holin	holin	A0A2H4J378	uncultured_Caudovirales_phage	87.3	1.2e-29
AWC49537.1|2855726_2855963_-	hypothetical protein	NA	A0A2H4J382	uncultured_Caudovirales_phage	78.2	1.2e-07
AWC49538.1|2856004_2860036_-	peptidase S74	NA	H0USX5	Bacillus_phage	44.9	1.7e-242
AWC49539.1|2860032_2861526_-|tail	phage tail protein	tail	A0A2H4JC38	uncultured_Caudovirales_phage	83.7	1.2e-254
AWC49540.1|2861534_2865575_-|tail	phage tail tape measure protein	tail	H0USX3	Bacillus_phage	75.1	0.0e+00
AWC49541.1|2865791_2866106_-	hypothetical protein	NA	A0A288WFU6	Bacillus_phage	70.2	1.8e-35
AWC49542.1|2866154_2866766_-|tail	phage tail protein	tail	A0A2H4J8F3	uncultured_Caudovirales_phage	94.5	8.4e-101
AWC49543.1|2866766_2867126_-	DUF3168 domain-containing protein	NA	A0A0S2GLE3	Bacillus_phage	90.8	1.4e-55
AWC49544.1|2867122_2867557_-	hypothetical protein	NA	A0A288WGB7	Bacillus_phage	84.9	8.2e-66
AWC49545.1|2867549_2867873_-|head,tail	head-tail adaptor protein	head,tail	A0A288WG18	Bacillus_phage	85.0	8.0e-50
AWC49546.1|2867869_2868160_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A288WGQ6	Bacillus_phage	88.5	3.6e-41
AWC49547.1|2868177_2869353_-|capsid	phage major capsid protein	capsid	A0A288WG01	Bacillus_phage	88.0	2.5e-186
AWC50931.1|2869394_2869967_-|head,protease	HK97 family phage prohead protease	head,protease	Q2I8F8	Bacillus_phage	91.1	1.3e-95
AWC49548.1|2869956_2871267_-|portal	phage portal protein	portal	Q2LIC9	Bacillus_phage	89.2	6.4e-215
AWC49549.1|2871282_2872980_-|terminase	terminase large subunit	terminase	A0A288WFW5	Bacillus_phage	91.7	0.0e+00
AWC49550.1|2872976_2873459_-|terminase	phage terminase small subunit P27 family	terminase	Q2I8G1	Bacillus_phage	92.5	1.4e-74
AWC49551.1|2873558_2873942_-	HNH endonuclease	NA	Q2I8B2	Bacillus_phage	90.6	2.2e-62
AWC49552.1|2874007_2874247_-	hypothetical protein	NA	NA	NA	NA	NA
AWC49553.1|2874913_2875168_-	hypothetical protein	NA	A0A288WG25	Bacillus_phage	73.8	2.5e-30
AWC49554.1|2875187_2875379_-	hypothetical protein	NA	A0A288WFV5	Bacillus_phage	88.9	1.7e-23
AWC49555.1|2875384_2875603_-	hypothetical protein	NA	D2XR60	Bacillus_phage	73.6	3.3e-23
AWC49556.1|2875897_2876275_-	ArpU family transcriptional regulator	NA	Q9ZXB9	Bacillus_phage	39.7	1.0e-16
AWC50932.1|2876332_2876653_-	hypothetical protein	NA	NA	NA	NA	NA
AWC50933.1|2876693_2876921_-	hypothetical protein	NA	A0A288WFX6	Bacillus_phage	68.0	2.2e-22
AWC49557.1|2876966_2877512_-	hypothetical protein	NA	A0A1I9S5V4	Bacillus_phage	78.0	3.5e-66
AWC49558.1|2877572_2877836_-	hypothetical protein	NA	NA	NA	NA	NA
AWC49559.1|2878596_2878995_-	hypothetical protein	NA	NA	NA	NA	NA
AWC49560.1|2879003_2879894_-	zinc-finger domain-containing protein	NA	NA	NA	NA	NA
AWC49561.1|2879964_2880675_-	2-methylcitrate dehydratase	NA	NA	NA	NA	NA
AWC49562.1|2880694_2881108_-	DUF1064 domain-containing protein	NA	A0A2P1JTY5	Anoxybacillus_phage	58.5	1.2e-34
AWC49563.1|2881100_2881595_-	deoxyuridine 5'-triphosphate nucleotidohydrolase	NA	A0A1B1P8C0	Bacillus_phage	70.6	3.2e-58
AWC49564.1|2881811_2882264_-	MFS transporter	NA	A0A0A7AQW3	Bacillus_phage	43.4	3.3e-33
AWC49565.1|2882278_2882761_-	hypothetical protein	NA	NA	NA	NA	NA
AWC49566.1|2882741_2882936_-	hypothetical protein	NA	NA	NA	NA	NA
AWC50934.1|2882941_2883634_-	DNA replication protein	NA	A0A0S2GLK2	Bacillus_phage	50.6	7.9e-63
AWC49567.1|2883704_2884670_-	DnaD domain protein	NA	H0USU2	Bacillus_phage	51.9	9.7e-43
AWC49568.1|2884844_2885651_-	recombinase RecT	NA	S6AVW6	Thermus_phage	66.9	3.4e-97
AWC49569.1|2885650_2885890_-	hypothetical protein	NA	NA	NA	NA	NA
AWC49570.1|2885904_2886840_-	hypothetical protein	NA	S6C475	Thermus_phage	59.5	1.9e-99
AWC49571.1|2886921_2887137_-	hypothetical protein	NA	NA	NA	NA	NA
AWC50935.1|2887312_2887606_-	hypothetical protein	NA	A0A0S2GLB6	Bacillus_phage	62.4	1.7e-27
AWC49572.1|2887613_2887934_-	hypothetical protein	NA	NA	NA	NA	NA
AWC49573.1|2888081_2888291_-	DNA-binding protein	NA	A0A0U4IIS1	Bacillus_phage	50.9	4.4e-09
AWC50936.1|2888413_2888623_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AWC49574.1|2888788_2889127_+	XRE family transcriptional regulator	NA	H0UST7	Bacillus_phage	53.3	1.3e-21
AWC49575.1|2889408_2889543_-	hypothetical protein	NA	NA	NA	NA	NA
AWC49576.1|2889556_2890654_-	hypothetical protein	NA	NA	NA	NA	NA
AWC49577.1|2891340_2892471_+|integrase	site-specific integrase	integrase	A0A0U4JNS1	Bacillus_phage	37.4	1.7e-62
2899192:2899209	attR	CCGCTATTTTAGGGCAGC	NA	NA	NA	NA
>prophage 1
CP024112	Bacillus cytotoxicus strain CH_4 plasmid pCh4_83, complete sequence	83510	72712	79966	83510	integrase	Bacillus_phage(33.33%)	8	66820:66835	83028:83043
66820:66835	attL	AAATGGATTAATGAAA	NA	NA	NA	NA
AWC51039.1|72712_73432_-	DNA (cytosine-5-)-methyltransferase	NA	A0A1I9KKE7	Lactobacillus_phage	52.0	7.4e-64
AWC51040.1|73985_74585_-	hypothetical protein	NA	A0A1Z1LZN4	Bacillus_phage	35.6	5.1e-10
AWC51041.1|74814_75021_-	hypothetical protein	NA	NA	NA	NA	NA
AWC51042.1|76223_76838_+	DNA recombinase	NA	A0A1V0E035	Clostridioides_phage	32.5	7.1e-15
AWC51043.1|76954_77911_+|integrase	integrase	integrase	A0A1B1P793	Bacillus_phage	34.3	1.2e-37
AWC51044.1|78354_78693_+	hypothetical protein	NA	NA	NA	NA	NA
AWC51045.1|78731_78917_+	DNA-binding protein	NA	A6M9A5	Geobacillus_virus	64.9	6.8e-14
AWC51046.1|79393_79966_-	hypothetical protein	NA	A0A0K2SUB9	Clostridium_phage	44.4	3.3e-14
83028:83043	attR	TTTCATTAATCCATTT	NA	NA	NA	NA
