The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP024116	Bacillus cytotoxicus strain CH_2 chromosome, complete genome	4252735	157126	210994	4252735	protease,integrase,transposase	Bacillus_phage(26.67%)	55	156919:156967	174087:174135
156919:156967	attL	TGCTTCCATAGCTCAGCTGGTAGAGCACTTCCATGGTAAGGAAGAGGTC	NA	NA	NA	NA
AWC55327.1|157126_158053_+|integrase	integrase	integrase	A0A2I6UG75	Salinibacter_virus	24.5	5.5e-11
AWC59009.1|158358_159084_+	helix-turn-helix domain-containing protein	NA	A0A1I9S595	Bacillus_phage	28.6	2.0e-08
AWC55328.1|159576_159951_-	hypothetical protein	NA	NA	NA	NA	NA
AWC55329.1|161944_162559_+	hypothetical protein	NA	NA	NA	NA	NA
AWC55330.1|162564_162795_+	hypothetical protein	NA	NA	NA	NA	NA
AWC55331.1|162808_163045_+	hypothetical protein	NA	NA	NA	NA	NA
AWC55332.1|163074_163755_+	hypothetical protein	NA	NA	NA	NA	NA
AWC55333.1|163993_164818_+	hypothetical protein	NA	NA	NA	NA	NA
AWC55334.1|164832_165252_+	hypothetical protein	NA	NA	NA	NA	NA
AWC55335.1|165274_165484_+	hypothetical protein	NA	NA	NA	NA	NA
AWC55336.1|165504_165909_+	hypothetical protein	NA	NA	NA	NA	NA
AWC55337.1|166143_166794_+	hypothetical protein	NA	M1HN75	Bacillus_virus	34.6	2.1e-17
AWC55338.1|166901_167324_+	hypothetical protein	NA	A0A2P1JUJ6	Bacillus_phage	58.6	1.0e-33
AWC55339.1|167410_169597_+	hypothetical protein	NA	A0A2P1JUK2	Bacillus_phage	41.2	2.0e-11
AWC55340.1|169734_170019_+	hypothetical protein	NA	NA	NA	NA	NA
AWC55341.1|170035_170344_+	hypothetical protein	NA	NA	NA	NA	NA
AWC55342.1|170494_171346_+	DNA methyltransferase	NA	A0A1S5PRR3	Streptococcus_phage	52.3	6.7e-80
AWC55343.1|171329_172610_+	translation elongation factor	NA	NA	NA	NA	NA
AWC55344.1|172863_173187_+	hypothetical protein	NA	NA	NA	NA	NA
AWC55345.1|173249_173447_+	hypothetical protein	NA	NA	NA	NA	NA
AWC55346.1|173650_173866_+	hypothetical protein	NA	NA	NA	NA	NA
AWC55347.1|174908_176051_+	glycerate kinase	NA	W6LM47	Streptococcus_phage	41.7	5.1e-51
174087:174135	attR	TGCTTCCATAGCTCAGCTGGTAGAGCACTTCCATGGTAAGGAAGAGGTC	NA	NA	NA	NA
AWC55348.1|176248_177142_+	arginase	NA	A0A1V0SJM8	Klosneuvirus	31.1	7.9e-23
AWC55349.1|177395_178226_+	TIGR00159 family protein	NA	NA	NA	NA	NA
AWC55350.1|178218_179664_+	hypothetical protein	NA	NA	NA	NA	NA
AWC55351.1|179656_181003_+	phosphoglucosamine mutase	NA	NA	NA	NA	NA
AWC55352.1|181487_183290_+	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	Q84421	Paramecium_bursaria_Chlorella_virus	40.3	3.1e-103
AWC55353.1|183520_184192_-	hypothetical protein	NA	A0A146ICT8	Staphylococcus_phage	55.6	1.1e-16
AWC55354.1|184617_185370_-|transposase	transposase	transposase	A0A059NT77	Lactococcus_phage	46.9	2.7e-56
AWC55355.1|185359_186655_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	27.1	8.5e-10
AWC55356.1|187526_188396_+	hypothetical protein	NA	A0A1X9I6E0	Streptococcus_phage	26.1	1.6e-07
AWC55357.1|188836_190030_+	radical SAM protein	NA	NA	NA	NA	NA
AWC55358.1|190022_191948_+	hypothetical protein	NA	NA	NA	NA	NA
AWC55359.1|191940_192531_+	radical SAM protein	NA	NA	NA	NA	NA
AWC55360.1|192517_193327_+	hypothetical protein	NA	NA	NA	NA	NA
AWC55361.1|194833_195538_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
AWC55362.1|196054_196798_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
AWC55363.1|197421_197661_-	hypothetical protein	NA	NA	NA	NA	NA
AWC55364.1|197707_197860_+	hypothetical protein	NA	NA	NA	NA	NA
AWC55365.1|198163_198820_+	hypothetical protein	NA	NA	NA	NA	NA
AWC59010.1|199053_199467_+	DUF1648 domain-containing protein	NA	NA	NA	NA	NA
AWC55366.1|200460_201627_+	MFS transporter	NA	NA	NA	NA	NA
AWC55367.1|201632_202094_+	hypothetical protein	NA	NA	NA	NA	NA
AWC55368.1|202096_202909_+	hypothetical protein	NA	NA	NA	NA	NA
AWC55369.1|202942_203224_+	hypothetical protein	NA	NA	NA	NA	NA
AWC55370.1|203228_204221_+	hypothetical protein	NA	NA	NA	NA	NA
AWC55371.1|204225_204480_+	hypothetical protein	NA	NA	NA	NA	NA
AWC55372.1|204476_205640_+	hypothetical protein	NA	NA	NA	NA	NA
AWC55373.1|205658_206894_+	ATP-grasp domain-containing protein	NA	NA	NA	NA	NA
AWC55374.1|206911_207643_+	adenylyltransferase	NA	S4VW33	Pandoravirus	31.3	4.1e-09
AWC55375.1|207783_208149_+	hypothetical protein	NA	NA	NA	NA	NA
AWC55376.1|208158_208362_+	hypothetical protein	NA	NA	NA	NA	NA
AWC55377.1|208303_208471_-	hypothetical protein	NA	NA	NA	NA	NA
AWC59011.1|209063_209486_+	hypothetical protein	NA	NA	NA	NA	NA
AWC55378.1|209842_210994_+|transposase	transposase	transposase	S6AND0	Bacillus_phage	80.4	9.1e-173
>prophage 2
CP024116	Bacillus cytotoxicus strain CH_2 chromosome, complete genome	4252735	287352	295330	4252735		uncultured_virus(33.33%)	6	NA	NA
AWC55446.1|287352_287637_+	co-chaperone GroES	NA	A0A221S3C8	uncultured_virus	52.7	5.8e-20
AWC55447.1|287671_289300_+	molecular chaperone GroEL	NA	A0A219YK78	uncultured_virus	56.9	1.5e-157
AWC55448.1|289726_291274_+	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	30.6	2.2e-20
AWC55449.1|291647_292973_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	31.8	4.4e-46
AWC55450.1|293115_293817_+	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	38.7	8.6e-41
AWC59014.1|293842_295330_+	sensor histidine kinase	NA	W8CYF6	Bacillus_phage	31.2	1.3e-33
>prophage 3
CP024116	Bacillus cytotoxicus strain CH_2 chromosome, complete genome	4252735	328310	336682	4252735		Synechococcus_phage(33.33%)	8	NA	NA
AWC55461.1|328310_329612_+	adenylosuccinate lyase	NA	A0A1B3B081	Gordonia_phage	31.6	2.0e-19
AWC55462.1|329706_330426_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	G8EYA2	Synechococcus_phage	43.9	9.8e-48
AWC55463.1|330418_330673_+	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
AWC55464.1|330669_331353_+	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
AWC55465.1|331336_333556_+	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	41.2	2.0e-160
AWC55466.1|333540_334956_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	35.2	3.6e-54
AWC55467.1|335058_336102_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	48.0	2.7e-70
AWC55468.1|336094_336682_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	34.2	1.6e-24
>prophage 4
CP024116	Bacillus cytotoxicus strain CH_2 chromosome, complete genome	4252735	758224	796413	4252735	coat,transposase	Thermus_phage(20.0%)	39	NA	NA
AWC55810.1|758224_759355_+|transposase	transposase	transposase	S6C485	Thermus_phage	32.1	1.2e-12
AWC55811.1|759358_761449_+|transposase	transposase	transposase	NA	NA	NA	NA
AWC55812.1|761450_761831_+|transposase	transposase	transposase	NA	NA	NA	NA
AWC55813.1|761909_762383_+	8-oxo-dGTP diphosphatase	NA	NA	NA	NA	NA
AWC55814.1|762618_763317_-	recombinase	NA	M9Q1K0	Clostridium_phage	25.4	2.9e-12
AWC55815.1|763558_763966_+	transcriptional repressor	NA	NA	NA	NA	NA
AWC55816.1|763980_764952_+	ornithine cyclodeaminase	NA	NA	NA	NA	NA
AWC55817.1|764966_766079_-	hypothetical protein	NA	NA	NA	NA	NA
AWC55818.1|766163_766535_+	hypothetical protein	NA	NA	NA	NA	NA
AWC55819.1|767088_767745_-	hypothetical protein	NA	NA	NA	NA	NA
AWC55820.1|768070_768469_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
AWC55821.1|768619_769474_+	patatin family protein	NA	NA	NA	NA	NA
AWC55822.1|769609_770911_-	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	34.1	4.5e-51
AWC55823.1|771198_772065_+	NAD(P)-dependent oxidoreductase	NA	A0A2N9QUX2	Trichoplusia_ni_ascovirus	43.3	6.6e-59
AWC55824.1|772237_772999_+	L,D-transpeptidase	NA	NA	NA	NA	NA
AWC55825.1|773091_773364_+	hypothetical protein	NA	NA	NA	NA	NA
AWC55826.1|773414_773630_-	DUF1540 domain-containing protein	NA	NA	NA	NA	NA
AWC55827.1|773701_774112_-	thioredoxin	NA	NA	NA	NA	NA
AWC55828.1|774124_774544_-	disulfide bond formation protein B	NA	NA	NA	NA	NA
AWC55829.1|774674_775550_-	LytR family transcriptional regulator	NA	NA	NA	NA	NA
AWC55830.1|775737_775986_-	hypothetical protein	NA	NA	NA	NA	NA
AWC55831.1|776086_776584_-	hypothetical protein	NA	NA	NA	NA	NA
AWC55832.1|776638_777739_-	spore gernimation protein GerB	NA	NA	NA	NA	NA
AWC55833.1|777751_778834_-	Ger(x)C family spore germination protein	NA	NA	NA	NA	NA
AWC55834.1|778830_780342_-	spore germination protein	NA	NA	NA	NA	NA
AWC55835.1|780617_781178_+	nitroreductase	NA	NA	NA	NA	NA
AWC55836.1|781862_783275_+	stage V sporulation protein R	NA	NA	NA	NA	NA
AWC55837.1|783474_783915_-	hypothetical protein	NA	NA	NA	NA	NA
AWC55838.1|784070_785237_-	LytR family transcriptional regulator	NA	NA	NA	NA	NA
AWC55839.1|785584_787240_-	sodium:phosphate symporter	NA	NA	NA	NA	NA
AWC55840.1|787582_788785_-	MFS transporter	NA	NA	NA	NA	NA
AWC55841.1|789105_790194_+	DUF871 domain-containing protein	NA	NA	NA	NA	NA
AWC55842.1|790234_791416_-	ABC transporter permease	NA	NA	NA	NA	NA
AWC55843.1|791418_792093_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	39.5	6.1e-36
AWC55844.1|792089_793193_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
AWC55845.1|793812_795129_-	branched-chain amino acid transport system II carrier protein	NA	NA	NA	NA	NA
AWC55846.1|795343_795913_-|coat	spore coat protein CotJC	coat	NA	NA	NA	NA
AWC55847.1|795925_796189_-|coat	spore coat protein CotJB	coat	NA	NA	NA	NA
AWC55848.1|796197_796413_-|coat	spore coat associated protein CotJA	coat	NA	NA	NA	NA
>prophage 5
CP024116	Bacillus cytotoxicus strain CH_2 chromosome, complete genome	4252735	1109704	1177156	4252735	coat,integrase,bacteriocin	Bacillus_phage(36.36%)	60	1170590:1170607	1178026:1178043
AWC56113.1|1109704_1110442_+|coat	spore coat protein	coat	I7I009	Enterobacteria_phage	44.7	2.8e-50
AWC56114.1|1110450_1110999_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A218MN57	uncultured_virus	43.2	1.7e-31
AWC56115.1|1111010_1111982_+	dTDP-glucose 4,6-dehydratase	NA	A0A1D7XFE8	Escherichia_phage	42.9	8.5e-71
AWC56116.1|1111993_1112845_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	40.2	9.5e-42
AWC56117.1|1113048_1113549_-	hypothetical protein	NA	NA	NA	NA	NA
AWC56118.1|1113984_1114458_-|coat	spore coat protein	coat	NA	NA	NA	NA
AWC56119.1|1114624_1116679_-	ATP-dependent helicase	NA	S5MMD7	Bacillus_phage	31.9	6.2e-79
AWC56120.1|1117204_1117723_-	hypothetical protein	NA	NA	NA	NA	NA
AWC56121.1|1117815_1118547_-	esterase family protein	NA	NA	NA	NA	NA
AWC56122.1|1118767_1119679_+	EamA/RhaT family transporter	NA	NA	NA	NA	NA
AWC56123.1|1119899_1120289_-	hypothetical protein	NA	A0A0E3TB73	Enterococcus_phage	36.6	8.2e-09
AWC56124.1|1120460_1121927_-	sodium/proline symporter PutP	NA	NA	NA	NA	NA
AWC56125.1|1123758_1125252_+	lactate permease	NA	NA	NA	NA	NA
AWC56126.1|1125356_1126040_+	DUF2278 domain-containing protein	NA	NA	NA	NA	NA
AWC56127.1|1126086_1126920_-	hypothetical protein	NA	NA	NA	NA	NA
AWC56128.1|1127048_1127795_+	zinc ribbon domain-containing protein	NA	NA	NA	NA	NA
AWC56129.1|1127969_1129304_+	CoA-disulfide reductase	NA	NA	NA	NA	NA
AWC56130.1|1129432_1129843_+	DUF3908 domain-containing protein	NA	NA	NA	NA	NA
AWC56131.1|1130056_1131601_-	NADH oxidase	NA	NA	NA	NA	NA
AWC56132.1|1131661_1133614_-|bacteriocin	bacteriocin biosynthesis protein SagD	bacteriocin	NA	NA	NA	NA
AWC56133.1|1133607_1135533_-|bacteriocin	putative thiazole-containing bacteriocin maturation protein	bacteriocin	NA	NA	NA	NA
AWC56134.1|1135691_1136936_-	dihydrolipoyllysine-residue succinyltransferase	NA	NA	NA	NA	NA
AWC56135.1|1137056_1139933_-	2-oxoglutarate dehydrogenase subunit E1	NA	NA	NA	NA	NA
AWC56136.1|1140901_1141084_+	DUF3976 domain-containing protein	NA	NA	NA	NA	NA
AWC56137.1|1141145_1142030_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AWC56138.1|1142216_1143143_+	2,4-dihydroxyhept-2-ene-1,7-dioic acid aldolase	NA	NA	NA	NA	NA
AWC56139.1|1143212_1144736_+	5-carboxymethyl-2-hydroxymuconate semialdehyde dehydrogenase	NA	NA	NA	NA	NA
AWC56140.1|1144789_1146262_+	4-hydroxyphenylacetate 3-monooxygenase, oxygenase component	NA	NA	NA	NA	NA
AWC56141.1|1146281_1147265_+	3,4-dihydroxyphenylacetate 2,3-dioxygenase	NA	NA	NA	NA	NA
AWC56142.1|1147322_1148189_+	cytidyltransferase	NA	NA	NA	NA	NA
AWC56143.1|1148249_1148579_+	DUF485 domain-containing protein	NA	NA	NA	NA	NA
AWC56144.1|1148568_1150119_+	cation acetate symporter	NA	NA	NA	NA	NA
AWC56145.1|1150139_1150931_+	4-hydroxyphenylacetate isomerase	NA	NA	NA	NA	NA
AWC56146.1|1150927_1151686_+	2-hydroxyhepta-2,4-diene-1,7-dioate isomerase	NA	NA	NA	NA	NA
AWC56147.1|1151758_1152157_+	5-carboxymethyl-2-hydroxymuconate isomerase	NA	NA	NA	NA	NA
AWC56148.1|1152475_1153588_+	tetratricopeptide repeat-containing protein	NA	A0A2H4J8G3	uncultured_Caudovirales_phage	49.1	2.4e-93
AWC56149.1|1154238_1154607_+	NUDIX domain-containing protein	NA	NA	NA	NA	NA
AWC56150.1|1155431_1155638_+	hypothetical protein	NA	NA	NA	NA	NA
AWC56151.1|1156288_1156606_+	DUF3884 domain-containing protein	NA	NA	NA	NA	NA
AWC59039.1|1158164_1158641_+	hypothetical protein	NA	NA	NA	NA	NA
AWC56152.1|1158663_1159071_+	hypothetical protein	NA	NA	NA	NA	NA
AWC56153.1|1160478_1160754_-	hypothetical protein	NA	NA	NA	NA	NA
AWC56154.1|1161751_1162672_-	gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
AWC56155.1|1162871_1163099_-	hypothetical protein	NA	NA	NA	NA	NA
AWC56156.1|1163148_1163409_-	hypothetical protein	NA	NA	NA	NA	NA
AWC56157.1|1163544_1163799_+	hypothetical protein	NA	NA	NA	NA	NA
AWC56158.1|1164305_1164959_+	hypothetical protein	NA	NA	NA	NA	NA
AWC56159.1|1165156_1165432_+	hypothetical protein	NA	NA	NA	NA	NA
AWC56160.1|1165749_1166844_-	tetratricopeptide repeat-containing protein	NA	A0A2H4J8G3	uncultured_Caudovirales_phage	51.8	1.2e-100
AWC56161.1|1167106_1167478_+|integrase	site-specific integrase	integrase	A0A1B0T6A8	Bacillus_phage	54.4	2.1e-25
AWC56162.1|1167995_1168700_-	hypothetical protein	NA	NA	NA	NA	NA
AWC56163.1|1169084_1169258_-	hypothetical protein	NA	NA	NA	NA	NA
AWC56164.1|1169264_1169564_-	hypothetical protein	NA	NA	NA	NA	NA
AWC56165.1|1169609_1169843_-	TIGR04197 family type VII secretion effector	NA	NA	NA	NA	NA
1170590:1170607	attL	GTGACCAATATGTGACCA	NA	NA	NA	NA
AWC56166.1|1170618_1172325_-	hypothetical protein	NA	NA	NA	NA	NA
AWC56167.1|1172393_1173515_-	DUF4297 domain-containing protein	NA	NA	NA	NA	NA
AWC56168.1|1173637_1174339_-	hypothetical protein	NA	NA	NA	NA	NA
AWC56169.1|1174757_1175834_+	replication initiation factor	NA	NA	NA	NA	NA
AWC56170.1|1175848_1176046_+	DNA-binding protein	NA	A0A1B0T6C2	Bacillus_phage	41.2	4.3e-06
AWC56171.1|1176046_1177156_+|integrase	site-specific integrase	integrase	A0A0U3U8Y8	Bacillus_phage	40.9	2.6e-60
1178026:1178043	attR	GTGACCAATATGTGACCA	NA	NA	NA	NA
>prophage 6
CP024116	Bacillus cytotoxicus strain CH_2 chromosome, complete genome	4252735	2353062	2421038	4252735	integrase,tail,holin,bacteriocin,transposase	Bacillus_phage(36.84%)	56	2348228:2348244	2382038:2382054
2348228:2348244	attL	TCCTTCTGCATCTAATA	NA	NA	NA	NA
AWC57216.1|2353062_2354210_-|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	66.4	1.8e-99
AWC57217.1|2354486_2356655_-|bacteriocin	bacteriocin-associated protein	bacteriocin	NA	NA	NA	NA
AWC57218.1|2356778_2356967_-	hypothetical protein	NA	NA	NA	NA	NA
AWC57219.1|2356951_2357221_-	hypothetical protein	NA	NA	NA	NA	NA
AWC57220.1|2357943_2358297_+|integrase	integrase	integrase	A0A2H4J6I5	uncultured_Caudovirales_phage	34.1	6.5e-05
AWC57221.1|2358317_2358566_-	DUF4176 domain-containing protein	NA	NA	NA	NA	NA
AWC57222.1|2358566_2358755_-	hypothetical protein	NA	NA	NA	NA	NA
AWC57223.1|2358785_2358977_-	hypothetical protein	NA	NA	NA	NA	NA
AWC57224.1|2360264_2360627_-	DUF3958 domain-containing protein	NA	NA	NA	NA	NA
AWC57225.1|2360667_2360943_-	TIGR04197 family type VII secretion effector	NA	NA	NA	NA	NA
AWC57226.1|2361647_2364218_-	permease	NA	NA	NA	NA	NA
AWC57227.1|2364235_2364982_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.1	5.0e-31
AWC57228.1|2365347_2365671_-	hypothetical protein	NA	NA	NA	NA	NA
AWC57229.1|2365678_2366203_-	hypothetical protein	NA	NA	NA	NA	NA
AWC57230.1|2368336_2368720_-	hypothetical protein	NA	NA	NA	NA	NA
AWC57231.1|2369008_2369734_-	ATP-binding protein	NA	A0A059NT77	Lactococcus_phage	37.8	1.3e-36
AWC57232.1|2370298_2370487_-	transcriptional regulator	NA	S5M643	Brevibacillus_phage	42.4	3.7e-07
AWC57233.1|2370476_2370800_-	hypothetical protein	NA	NA	NA	NA	NA
AWC57234.1|2372056_2373037_+	ketoacyl-ACP synthase III	NA	NA	NA	NA	NA
AWC57235.1|2373099_2373348_-	hypothetical protein	NA	A0A288WFY7	Bacillus_phage	46.2	3.9e-12
AWC57236.1|2373620_2374670_-	oxidoreductase	NA	NA	NA	NA	NA
AWC57237.1|2375152_2375551_+	DUF2871 domain-containing protein	NA	NA	NA	NA	NA
AWC57238.1|2376449_2376710_-	DUF2642 domain-containing protein	NA	NA	NA	NA	NA
AWC57239.1|2376849_2377512_-	bacillithiol biosynthesis deacetylase BshB2	NA	NA	NA	NA	NA
AWC57240.1|2377527_2377878_-	DUF1806 domain-containing protein	NA	NA	NA	NA	NA
AWC57241.1|2378119_2379445_+	hypothetical protein	NA	NA	NA	NA	NA
AWC57242.1|2379784_2380312_-	N-acetyltransferase	NA	A0A1P8CWJ6	Bacillus_phage	66.3	4.8e-60
AWC57243.1|2380318_2382220_-	mannonate oxidoreductase	NA	F2Y0V3	Organic_Lake_phycodnavirus	25.0	3.4e-15
2382038:2382054	attR	TCCTTCTGCATCTAATA	NA	NA	NA	NA
AWC57244.1|2382772_2383564_+	arylamine N-acetyltransferase	NA	NA	NA	NA	NA
AWC57245.1|2383692_2385480_+	oligoendopeptidase F	NA	NA	NA	NA	NA
AWC57246.1|2385665_2386898_-	MFS transporter	NA	NA	NA	NA	NA
AWC57247.1|2387001_2387865_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AWC57248.1|2388032_2389091_+	acyltransferase	NA	NA	NA	NA	NA
AWC57249.1|2389135_2390080_-	glycerophosphodiester phosphodiesterase	NA	A0A076G4Q2	Staphylococcus_phage	35.0	2.4e-38
AWC57250.1|2390558_2391101_-	N-acetyltransferase	NA	NA	NA	NA	NA
AWC57251.1|2391351_2391765_-	hypothetical protein	NA	NA	NA	NA	NA
AWC57252.1|2392307_2393156_-	chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	47.9	1.4e-08
AWC57253.1|2393574_2394213_-	hypothetical protein	NA	NA	NA	NA	NA
AWC57254.1|2394239_2395052_-	hypothetical protein	NA	NA	NA	NA	NA
AWC57255.1|2395533_2396913_+	chitin-binding protein	NA	A0A0K1Y848	Apis_mellifera_filamentous_virus	35.7	1.4e-21
AWC57256.1|2397066_2398737_-	peptidase M4 family protein	NA	NA	NA	NA	NA
AWC57257.1|2399386_2400862_+	SELO family protein	NA	A0A075BSJ0	Microcystis_phage	30.7	3.4e-47
AWC57258.1|2400977_2402363_-	2-hydroxy-acid oxidase	NA	NA	NA	NA	NA
AWC57259.1|2402787_2403465_-	methyltransferase	NA	G3MA03	Bacillus_virus	43.3	8.1e-20
AWC57260.1|2404280_2405192_-	hypothetical protein	NA	NA	NA	NA	NA
AWC57261.1|2405597_2405945_+	hypothetical protein	NA	NA	NA	NA	NA
AWC57262.1|2406086_2407163_+	hypothetical protein	NA	NA	NA	NA	NA
AWC57263.1|2408433_2408766_-	hypothetical protein	NA	NA	NA	NA	NA
AWC57264.1|2408935_2409148_+	XRE family transcriptional regulator	NA	A0A076G7N2	Bacillus_phage	51.5	9.0e-10
AWC57265.1|2409247_2409832_+	hypothetical protein	NA	NA	NA	NA	NA
AWC57266.1|2409872_2410697_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A2H4J966	uncultured_Caudovirales_phage	51.1	7.2e-79
AWC57267.1|2410712_2410943_-|holin	phage holin	holin	A0A0S2MVE8	Bacillus_phage	73.3	4.1e-24
AWC57268.1|2410957_2411242_-	hypothetical protein	NA	NA	NA	NA	NA
AWC57269.1|2411281_2415778_-	hypothetical protein	NA	A0A0M4RER0	Bacillus_phage	45.3	2.8e-262
AWC57270.1|2415777_2417280_-|tail	phage tail protein	tail	A0A1B1P7W7	Bacillus_phage	73.9	5.0e-203
AWC57271.1|2417294_2421038_-|tail	phage tail tape measure protein	tail	A6M961	Geobacillus_virus	38.8	8.1e-53
>prophage 7
CP024116	Bacillus cytotoxicus strain CH_2 chromosome, complete genome	4252735	2429385	2442496	4252735		Bacillus_phage(41.67%)	17	NA	NA
AWC57285.1|2429385_2431089_-	hypothetical protein	NA	A0A142F1L6	Bacillus_phage	50.5	2.9e-159
AWC57286.1|2431088_2431562_-	hypothetical protein	NA	NA	NA	NA	NA
AWC57287.1|2432630_2433455_-	hypothetical protein	NA	NA	NA	NA	NA
AWC57288.1|2433850_2434417_-	hypothetical protein	NA	A0A2H4J2L4	uncultured_Caudovirales_phage	45.8	9.7e-35
AWC57289.1|2434428_2434806_-	hypothetical protein	NA	A0A0N9RZI0	Paenibacillus_phage	43.1	2.0e-15
AWC57290.1|2435190_2435829_-	hypothetical protein	NA	NA	NA	NA	NA
AWC57291.1|2435840_2436074_-	glutaredoxin family protein	NA	A0A1B1P8E0	Bacillus_phage	64.5	1.2e-23
AWC57292.1|2436070_2436676_-	hypothetical protein	NA	A0A2H4JAZ2	uncultured_Caudovirales_phage	41.2	7.7e-38
AWC57293.1|2436736_2437363_-	hypothetical protein	NA	J9Q953	Bacillus_phage	43.2	1.4e-34
AWC57294.1|2437364_2437997_-	hypothetical protein	NA	NA	NA	NA	NA
AWC57295.1|2438139_2438448_-	transglycosylase	NA	A0A0K2CZP5	Paenibacillus_phage	36.9	2.6e-05
AWC57296.1|2438447_2438843_-	alpha/beta hydrolase	NA	A0A2H4IZM2	uncultured_Caudovirales_phage	68.9	6.1e-44
AWC57297.1|2439128_2439656_-	hypothetical protein	NA	A0A0N9ST03	Paenibacillus_phage	44.6	3.2e-08
AWC57298.1|2439652_2439877_-	hypothetical protein	NA	U5Q038	Bacillus_phage	70.6	8.3e-22
AWC57299.1|2439876_2440923_-	hypothetical protein	NA	A0A0N9SHN6	Paenibacillus_phage	58.6	4.8e-88
AWC57300.1|2440936_2441092_-	hypothetical protein	NA	NA	NA	NA	NA
AWC57301.1|2441992_2442496_-	hypothetical protein	NA	A0A0A0RUN2	Bacillus_phage	47.3	3.8e-30
>prophage 8
CP024116	Bacillus cytotoxicus strain CH_2 chromosome, complete genome	4252735	2448104	2458901	4252735		uncultured_Caudovirales_phage(37.5%)	18	NA	NA
AWC57306.1|2448104_2449328_-	hypothetical protein	NA	A0A288WGM1	Bacillus_phage	47.8	9.9e-101
AWC57307.1|2449442_2449646_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AWC59093.1|2449709_2449895_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AWC57308.1|2449902_2450919_-	hypothetical protein	NA	A0A2H4J6E6	uncultured_Caudovirales_phage	43.2	6.8e-71
AWC57309.1|2450945_2452289_-	DNA helicase	NA	A0A2H4IZL9	uncultured_Caudovirales_phage	55.8	7.5e-134
AWC57310.1|2452385_2452670_-	hypothetical protein	NA	A0A0H3V0M3	Geobacillus_virus	44.0	5.4e-10
AWC57311.1|2452917_2453334_-	hypothetical protein	NA	A0A0K2CNU6	Brevibacillus_phage	57.1	8.5e-12
AWC57312.1|2453354_2453606_-	hypothetical protein	NA	NA	NA	NA	NA
AWC57313.1|2453652_2453904_-	hypothetical protein	NA	NA	NA	NA	NA
AWC57314.1|2453950_2454139_-	hypothetical protein	NA	NA	NA	NA	NA
AWC57315.1|2454502_2455267_-	DNA replication protein	NA	A0A0N7GFF0	Paenibacillus_phage	56.5	3.7e-77
AWC57316.1|2455266_2455941_-	DUF723 domain-containing protein	NA	NA	NA	NA	NA
AWC59094.1|2455956_2456343_-	hypothetical protein	NA	A0A2H4J134	uncultured_Caudovirales_phage	36.2	5.5e-13
AWC57317.1|2456348_2456681_-	hypothetical protein	NA	NA	NA	NA	NA
AWC57318.1|2456667_2456826_-	Fur-regulated basic protein FbpA	NA	NA	NA	NA	NA
AWC57319.1|2456907_2457252_-	hypothetical protein	NA	NA	NA	NA	NA
AWC57320.1|2457381_2457996_-	hypothetical protein	NA	NA	NA	NA	NA
AWC57321.1|2458007_2458901_-	hypothetical protein	NA	A0A0N9RZE9	Paenibacillus_phage	30.9	5.5e-16
>prophage 9
CP024116	Bacillus cytotoxicus strain CH_2 chromosome, complete genome	4252735	2620588	2636069	4252735	integrase	Bacillus_phage(72.73%)	29	2632303:2632317	2638827:2638841
AWC57461.1|2620588_2620798_-	DNA-binding protein	NA	A0A1Z1LZP5	Bacillus_phage	62.1	1.4e-15
AWC57462.1|2621045_2621261_-	hypothetical protein	NA	NA	NA	NA	NA
AWC57463.1|2621591_2622059_-	ArpU family transcriptional regulator	NA	S6AVV9	Thermus_phage	51.8	3.5e-30
AWC59100.1|2622796_2623072_-	DNA-binding protein	NA	A0A2H4JBQ8	uncultured_Caudovirales_phage	43.2	2.0e-09
AWC57464.1|2623040_2623238_-	hypothetical protein	NA	NA	NA	NA	NA
AWC57465.1|2623311_2623503_-	hypothetical protein	NA	NA	NA	NA	NA
AWC57466.1|2623601_2623982_-	ArpU family transcriptional regulator	NA	A0A0M4R397	Bacillus_phage	84.7	4.1e-53
AWC57467.1|2623986_2624274_-	hypothetical protein	NA	A6M999	Geobacillus_virus	70.2	4.2e-34
AWC57468.1|2624303_2624504_-	hypothetical protein	NA	NA	NA	NA	NA
AWC57469.1|2624535_2624742_-	hypothetical protein	NA	NA	NA	NA	NA
AWC57470.1|2624783_2625026_-	hypothetical protein	NA	A0A0S2MV78	Bacillus_phage	73.8	9.9e-29
AWC57471.1|2625055_2625283_-	hypothetical protein	NA	A0A288WFX6	Bacillus_phage	98.7	3.5e-36
AWC57472.1|2625323_2625962_-	hypothetical protein	NA	A0A0K2CP60	Brevibacillus_phage	49.0	1.5e-52
AWC57473.1|2625993_2626197_-	hypothetical protein	NA	NA	NA	NA	NA
AWC57474.1|2626610_2627399_-	hypothetical protein	NA	A0A0M4RU33	Bacillus_phage	39.7	1.5e-28
AWC57475.1|2627391_2627580_-	hypothetical protein	NA	A0A0M4RD83	Bacillus_phage	56.7	3.6e-10
AWC57476.1|2627564_2627780_-	hypothetical protein	NA	NA	NA	NA	NA
AWC57477.1|2627790_2628663_-	DNA replication protein	NA	A0A0M4RD64	Bacillus_phage	72.0	5.6e-114
AWC57478.1|2628592_2629381_-	phage replication protein	NA	A0A0M4S6Y4	Bacillus_phage	76.8	9.6e-89
AWC57479.1|2629381_2629651_-	hypothetical protein	NA	A0A0M4S680	Bacillus_phage	83.1	5.3e-39
AWC57480.1|2629631_2630486_-	hypothetical protein	NA	Q38143	Bacillus_phage	44.6	5.4e-53
AWC57481.1|2631636_2631876_-	hypothetical protein	NA	A0A0M4S677	Bacillus_phage	77.9	2.3e-22
AWC57482.1|2632202_2632385_-	hypothetical protein	NA	A0A2H4J4V8	uncultured_Caudovirales_phage	43.5	4.4e-05
2632303:2632317	attL	ATTTCTTTCACTTCT	NA	NA	NA	NA
AWC57483.1|2632419_2632695_-	group-specific protein	NA	S5MC08	Brevibacillus_phage	59.3	3.6e-27
AWC57484.1|2632721_2633558_-	hypothetical protein	NA	A0A0M5M1L9	Bacillus_phage	84.9	2.6e-129
AWC57485.1|2633554_2633743_-	XRE family transcriptional regulator	NA	A0A1C8E998	Bacillus_phage	83.6	2.0e-21
AWC57486.1|2634015_2634435_+	XRE family transcriptional regulator	NA	A0A1C8E9A4	Bacillus_phage	89.2	1.1e-64
AWC57487.1|2634449_2634875_+	ImmA/IrrE family metallo-endopeptidase	NA	A0A1C8E988	Bacillus_phage	92.9	1.2e-72
AWC57488.1|2634911_2636069_+|integrase	site-specific integrase	integrase	A0A0S2SXP1	Bacillus_phage	76.1	1.2e-76
2638827:2638841	attR	ATTTCTTTCACTTCT	NA	NA	NA	NA
>prophage 10
CP024116	Bacillus cytotoxicus strain CH_2 chromosome, complete genome	4252735	2818261	2892229	4252735	capsid,portal,integrase,tail,protease,tRNA,holin,terminase,head	Bacillus_phage(77.78%)	85	2849804:2849821	2898950:2898967
AWC57645.1|2818261_2821027_-|tRNA	isoleucine--tRNA ligase	tRNA	A0A2K9L9X8	Tupanvirus	27.3	2.8e-87
AWC57646.1|2821371_2821878_-	septum formation initiator	NA	NA	NA	NA	NA
AWC57647.1|2821970_2822744_-	RNA-binding protein	NA	NA	NA	NA	NA
AWC57648.1|2822758_2823022_-	YggT family protein	NA	NA	NA	NA	NA
AWC57649.1|2823028_2823499_-	cell division protein SepF	NA	NA	NA	NA	NA
AWC57650.1|2823517_2824192_-	YggS family pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
AWC57651.1|2824198_2825008_-	laccase domain-containing protein	NA	NA	NA	NA	NA
AWC57652.1|2825125_2825404_-	YlmC/YmxH family sporulation protein	NA	NA	NA	NA	NA
AWC57653.1|2825667_2826447_-	RNA polymerase sporulation sigma factor SigG	NA	A0A0Y0AU18	Bacillus_phage	43.4	3.4e-46
AWC57654.1|2826638_2827358_-	RNA polymerase sporulation sigma factor SigE	NA	A0A2H4JC68	uncultured_Caudovirales_phage	42.9	2.5e-19
AWC57655.1|2827377_2828304_-	sigma-E processing peptidase SpoIIGA	NA	NA	NA	NA	NA
AWC57656.1|2828519_2829674_-	cell division protein FtsZ	NA	NA	NA	NA	NA
AWC57657.1|2829713_2831018_-	cell division protein FtsA	NA	NA	NA	NA	NA
AWC57658.1|2831418_2832186_-	cell division protein DivIB	NA	NA	NA	NA	NA
AWC59107.1|2832283_2833189_-	UDP-N-acetylenolpyruvoylglucosamine reductase	NA	NA	NA	NA	NA
AWC57659.1|2833249_2834344_-	undecaprenyldiphospho-muramoylpentapeptide beta-N- acetylglucosaminyltransferase	NA	NA	NA	NA	NA
AWC59108.1|2834528_2835620_-	stage V sporulation protein E	NA	NA	NA	NA	NA
AWC57660.1|2835711_2837067_-	UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase	NA	NA	NA	NA	NA
AWC57661.1|2837067_2838042_-	phospho-N-acetylmuramoyl-pentapeptide- transferase	NA	NA	NA	NA	NA
AWC57662.1|2838064_2839540_-	UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2, 6-diaminopimelate ligase	NA	NA	NA	NA	NA
AWC57663.1|2839812_2841729_-	stage V sporulation protein D	NA	NA	NA	NA	NA
AWC59109.1|2841826_2843977_-	dihydropteridine reductase	NA	NA	NA	NA	NA
AWC57664.1|2843999_2844356_-	cell division protein FtsL	NA	NA	NA	NA	NA
AWC57665.1|2844371_2845304_-	ribosomal RNA small subunit methyltransferase H	NA	NA	NA	NA	NA
AWC59110.1|2845667_2847284_-	bacillithiol biosynthesis cysteine-adding enzyme BshC	NA	NA	NA	NA	NA
AWC59111.1|2847363_2848248_-	2-dehydropantoate 2-reductase	NA	NA	NA	NA	NA
AWC57666.1|2848549_2849023_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AWC57667.1|2849118_2849640_-	RsfA family transcriptional regulator	NA	G3MB11	Bacillus_virus	47.8	4.0e-11
2849804:2849821	attL	GCTGCCCTAAAATAGCGG	NA	NA	NA	NA
AWC57668.1|2849899_2850073_-	50S ribosomal protein L32	NA	NA	NA	NA	NA
AWC57669.1|2850134_2850635_-	hypothetical protein	NA	NA	NA	NA	NA
AWC57670.1|2850916_2851537_-	hypothetical protein	NA	Q2LIA9	Bacillus_phage	76.8	1.0e-85
AWC57671.1|2851478_2852660_-	cell division protein FtsK	NA	Q3HKZ7	Bacillus_phage	84.5	3.0e-195
AWC57672.1|2852777_2852960_-	hypothetical protein	NA	Q2I8E2	Bacillus_phage	88.3	2.2e-20
AWC57673.1|2852956_2853265_-	hypothetical protein	NA	A0A288WG08	Bacillus_phage	78.4	3.8e-41
AWC57674.1|2853448_2853658_+	XRE family transcriptional regulator	NA	Q2I8E4	Bacillus_phage	79.4	2.7e-22
AWC57675.1|2853660_2854149_+	hypothetical protein	NA	Q3HL01	Bacillus_phage	61.7	8.1e-46
AWC57676.1|2854184_2855249_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A0A7AQV3	Bacillus_phage	85.9	2.3e-178
AWC57677.1|2855245_2855485_-|holin	holin	holin	A0A2H4J378	uncultured_Caudovirales_phage	87.3	1.2e-29
AWC57678.1|2855484_2855721_-	hypothetical protein	NA	A0A2H4J382	uncultured_Caudovirales_phage	78.2	1.2e-07
AWC57679.1|2855762_2859794_-	peptidase S74	NA	H0USX5	Bacillus_phage	44.9	1.7e-242
AWC57680.1|2859790_2861284_-|tail	phage tail protein	tail	A0A2H4JC38	uncultured_Caudovirales_phage	83.7	1.2e-254
AWC57681.1|2861292_2865333_-|tail	phage tail tape measure protein	tail	H0USX3	Bacillus_phage	75.1	0.0e+00
AWC57682.1|2865549_2865864_-	hypothetical protein	NA	A0A288WFU6	Bacillus_phage	70.2	1.8e-35
AWC57683.1|2865912_2866524_-|tail	phage tail protein	tail	A0A2H4J8F3	uncultured_Caudovirales_phage	94.5	8.4e-101
AWC57684.1|2866524_2866884_-	DUF3168 domain-containing protein	NA	A0A0S2GLE3	Bacillus_phage	90.8	1.4e-55
AWC57685.1|2866880_2867315_-	hypothetical protein	NA	A0A288WGB7	Bacillus_phage	84.9	8.2e-66
AWC57686.1|2867307_2867631_-|head,tail	head-tail adaptor protein	head,tail	A0A288WG18	Bacillus_phage	85.0	8.0e-50
AWC57687.1|2867627_2867918_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A288WGQ6	Bacillus_phage	88.5	3.6e-41
AWC57688.1|2867935_2869111_-|capsid	phage major capsid protein	capsid	A0A288WG01	Bacillus_phage	88.0	2.5e-186
AWC59112.1|2869152_2869725_-|head,protease	HK97 family phage prohead protease	head,protease	Q2I8F8	Bacillus_phage	91.1	1.3e-95
AWC57689.1|2869714_2871025_-|portal	phage portal protein	portal	Q2LIC9	Bacillus_phage	89.2	6.4e-215
AWC57690.1|2871040_2872738_-|terminase	terminase large subunit	terminase	A0A288WFW5	Bacillus_phage	91.7	0.0e+00
AWC57691.1|2872734_2873217_-|terminase	phage terminase small subunit P27 family	terminase	Q2I8G1	Bacillus_phage	92.5	1.4e-74
AWC57692.1|2873316_2873700_-	HNH endonuclease	NA	Q2I8B2	Bacillus_phage	90.6	2.2e-62
AWC57693.1|2873765_2874005_-	hypothetical protein	NA	NA	NA	NA	NA
AWC57694.1|2874671_2874926_-	hypothetical protein	NA	A0A288WG25	Bacillus_phage	73.8	2.5e-30
AWC57695.1|2874945_2875137_-	hypothetical protein	NA	A0A288WFV5	Bacillus_phage	88.9	1.7e-23
AWC57696.1|2875142_2875361_-	hypothetical protein	NA	D2XR60	Bacillus_phage	73.6	3.3e-23
AWC57697.1|2875655_2876033_-	ArpU family transcriptional regulator	NA	Q9ZXB9	Bacillus_phage	39.7	1.0e-16
AWC59113.1|2876090_2876411_-	hypothetical protein	NA	NA	NA	NA	NA
AWC59114.1|2876451_2876679_-	hypothetical protein	NA	A0A288WFX6	Bacillus_phage	68.0	2.2e-22
AWC57698.1|2876724_2877270_-	hypothetical protein	NA	A0A1I9S5V4	Bacillus_phage	78.0	3.5e-66
AWC57699.1|2877330_2877594_-	hypothetical protein	NA	NA	NA	NA	NA
AWC57700.1|2878354_2878753_-	hypothetical protein	NA	NA	NA	NA	NA
AWC57701.1|2878761_2879652_-	zinc-finger domain-containing protein	NA	NA	NA	NA	NA
AWC57702.1|2879722_2880433_-	2-methylcitrate dehydratase	NA	NA	NA	NA	NA
AWC57703.1|2880452_2880866_-	DUF1064 domain-containing protein	NA	A0A2P1JTY5	Anoxybacillus_phage	58.5	1.2e-34
AWC57704.1|2880858_2881353_-	deoxyuridine 5'-triphosphate nucleotidohydrolase	NA	A0A1B1P8C0	Bacillus_phage	70.6	3.2e-58
AWC57705.1|2881569_2882022_-	MFS transporter	NA	A0A0A7AQW3	Bacillus_phage	43.4	3.3e-33
AWC57706.1|2882036_2882519_-	hypothetical protein	NA	NA	NA	NA	NA
AWC57707.1|2882499_2882694_-	hypothetical protein	NA	NA	NA	NA	NA
AWC59115.1|2882699_2883392_-	DNA replication protein	NA	A0A0S2GLK2	Bacillus_phage	50.6	7.9e-63
AWC57708.1|2883462_2884428_-	DnaD domain protein	NA	H0USU2	Bacillus_phage	51.9	9.7e-43
AWC57709.1|2884602_2885409_-	recombinase RecT	NA	S6AVW6	Thermus_phage	66.9	3.4e-97
AWC57710.1|2885408_2885648_-	hypothetical protein	NA	NA	NA	NA	NA
AWC57711.1|2885662_2886598_-	hypothetical protein	NA	S6C475	Thermus_phage	59.5	1.9e-99
AWC57712.1|2886679_2886895_-	hypothetical protein	NA	NA	NA	NA	NA
AWC59116.1|2887070_2887364_-	hypothetical protein	NA	A0A0S2GLB6	Bacillus_phage	62.4	1.7e-27
AWC57713.1|2887371_2887692_-	hypothetical protein	NA	NA	NA	NA	NA
AWC57714.1|2887839_2888049_-	DNA-binding protein	NA	A0A0U4IIS1	Bacillus_phage	50.9	4.4e-09
AWC59117.1|2888171_2888381_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AWC57715.1|2888546_2888885_+	XRE family transcriptional regulator	NA	H0UST7	Bacillus_phage	53.3	1.3e-21
AWC57716.1|2889166_2889301_-	hypothetical protein	NA	NA	NA	NA	NA
AWC57717.1|2889314_2890412_-	hypothetical protein	NA	NA	NA	NA	NA
AWC57718.1|2891098_2892229_+|integrase	site-specific integrase	integrase	A0A0U4JNS1	Bacillus_phage	37.4	1.7e-62
2898950:2898967	attR	CCGCTATTTTAGGGCAGC	NA	NA	NA	NA
>prophage 11
CP024116	Bacillus cytotoxicus strain CH_2 chromosome, complete genome	4252735	3162416	3197830	4252735	portal,tail,holin,terminase,head	Bacillus_phage(87.18%)	47	NA	NA
AWC58014.1|3162416_3162989_+	DUF4352 domain-containing protein	NA	A0A1B1P898	Bacillus_phage	84.9	1.5e-54
AWC58015.1|3163300_3163741_+	hypothetical protein	NA	NA	NA	NA	NA
AWC58016.1|3163815_3164637_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A0S2GLD4	Bacillus_phage	85.3	5.9e-142
AWC58017.1|3164636_3165077_-|holin	holin	holin	A0A1B1P7S2	Bacillus_phage	86.3	8.3e-66
AWC59131.1|3165088_3165394_-	hypothetical protein	NA	A0A0S2MVE0	Bacillus_phage	58.0	1.4e-27
AWC58018.1|3165459_3169896_-	hypothetical protein	NA	A0A0S2MVB4	Bacillus_phage	48.8	0.0e+00
AWC58019.1|3169892_3171386_-|tail	phage tail protein	tail	A0A1B1P7W7	Bacillus_phage	75.5	4.4e-228
AWC58020.1|3171398_3174326_-|tail	phage tail tape measure protein	tail	A0A0A7AR36	Bacillus_phage	55.7	2.9e-183
AWC58021.1|3174331_3174598_-	hypothetical protein	NA	A0A0M4S6X7	Bacillus_phage	60.2	8.3e-21
AWC58022.1|3174633_3175071_-	hypothetical protein	NA	A0A0M4QX42	Bacillus_phage	32.7	3.6e-13
AWC58023.1|3175116_3175749_-	hypothetical protein	NA	A0A0M4R5F9	Bacillus_phage	79.1	5.7e-76
AWC58024.1|3175766_3176147_-	hypothetical protein	NA	A0A0M4RD75	Bacillus_phage	83.3	1.8e-56
AWC58025.1|3176143_3176560_-	hypothetical protein	NA	A0A0M4S6Z2	Bacillus_phage	76.8	2.7e-58
AWC58026.1|3176543_3176903_-	hypothetical protein	NA	A0A0M4S6Z9	Bacillus_phage	81.2	5.7e-49
AWC58027.1|3176884_3177223_-	hypothetical protein	NA	W8CYS9	Bacillus_phage	39.6	2.9e-10
AWC58028.1|3177259_3178102_-	hypothetical protein	NA	A0A0M5M1L4	Bacillus_phage	77.7	5.2e-117
AWC58029.1|3178115_3178706_-	DUF4355 domain-containing protein	NA	A0A0M3ULE7	Bacillus_phage	55.8	4.6e-19
AWC58030.1|3178775_3179801_-|head	phage head morphogenesis protein	head	A0A0M5M7Z2	Bacillus_phage	84.1	5.1e-159
AWC58031.1|3179787_3181143_-|portal	phage portal protein	portal	A0A0M4S669	Bacillus_phage	85.6	3.5e-200
AWC58032.1|3181154_3182459_-|terminase	PBSX family phage terminase large subunit	terminase	A0A0M4R5F3	Bacillus_phage	95.2	9.5e-251
AWC58033.1|3182445_3182877_-|terminase	terminase small subunit	terminase	A0A0M4RU19	Bacillus_phage	74.1	6.4e-55
AWC58034.1|3183640_3183886_-	DNA-binding protein	NA	A0A290FZJ4	Caldibacillus_phage	57.5	5.1e-17
AWC58035.1|3184289_3184670_-	ArpU family transcriptional regulator	NA	A0A0M4R397	Bacillus_phage	84.7	1.1e-53
AWC58036.1|3184674_3184962_-	hypothetical protein	NA	A6M999	Geobacillus_virus	70.2	4.2e-34
AWC58037.1|3184989_3185412_-	hypothetical protein	NA	R9TLR2	Paenibacillus_phage	41.3	2.0e-21
AWC59132.1|3185662_3185947_-	hypothetical protein	NA	I7J4K9	Bacillus_phage	48.9	4.3e-15
AWC58038.1|3185981_3186176_-	hypothetical protein	NA	NA	NA	NA	NA
AWC58039.1|3186212_3186416_-	hypothetical protein	NA	NA	NA	NA	NA
AWC58040.1|3186451_3186694_-	hypothetical protein	NA	NA	NA	NA	NA
AWC58041.1|3186741_3187287_-	hypothetical protein	NA	A0A1I9S5V4	Bacillus_phage	78.0	3.5e-66
AWC59133.1|3187641_3188214_-	dUTPase	NA	A0A0A7AQI4	Bacillus_phage	77.0	1.2e-80
AWC58042.1|3188367_3189159_-	hypothetical protein	NA	A0A0M4RU33	Bacillus_phage	42.5	4.5e-30
AWC58043.1|3189145_3189340_-	hypothetical protein	NA	NA	NA	NA	NA
AWC58044.1|3189324_3189540_-	hypothetical protein	NA	NA	NA	NA	NA
AWC58045.1|3189542_3189725_-	hypothetical protein	NA	NA	NA	NA	NA
AWC59134.1|3189751_3190534_-	hypothetical protein	NA	U5PWH5	Bacillus_phage	38.3	2.9e-37
AWC58046.1|3190517_3191270_-	phage replication protein	NA	A0A0M4S6Y4	Bacillus_phage	67.4	2.1e-56
AWC58047.1|3191270_3191540_-	hypothetical protein	NA	A0A0M4S680	Bacillus_phage	83.1	5.3e-39
AWC58048.1|3191536_3192376_-	hypothetical protein	NA	Q38143	Bacillus_phage	45.1	3.1e-53
AWC58049.1|3192587_3193475_-	hypothetical protein	NA	S6C475	Thermus_phage	49.1	5.9e-71
AWC58050.1|3193519_3193753_-	hypothetical protein	NA	A0A0M4S677	Bacillus_phage	80.3	4.9e-25
AWC58051.1|3194072_3194267_-	hypothetical protein	NA	NA	NA	NA	NA
AWC58052.1|3194295_3195072_-	hypothetical protein	NA	A0A288WFS9	Bacillus_phage	62.9	2.7e-59
AWC58053.1|3195068_3195257_-	XRE family transcriptional regulator	NA	A0A0M3ULF9	Bacillus_phage	91.4	1.1e-22
AWC58054.1|3195529_3195952_+	XRE family transcriptional regulator	NA	A0A0M4QX29	Bacillus_phage	97.1	2.0e-69
AWC59135.1|3195966_3196392_+	ImmA/IrrE family metallo-endopeptidase	NA	A0A0M4RD70	Bacillus_phage	92.2	7.5e-72
AWC58055.1|3196405_3197830_+	recombinase family protein	NA	A0A1L2JY12	Aeribacillus_phage	41.0	3.0e-101
>prophage 1
CP024117	Bacillus cytotoxicus strain CH_2 plasmid pCh2_53, complete sequence	53095	22572	29189	53095		Bacillus_phage(33.33%)	9	NA	NA
AWC59187.1|22572_23007_+	sporulation protein	NA	F8WPS9	Bacillus_phage	50.7	4.1e-33
AWC59188.1|23196_24462_+	DNA repair protein	NA	O64031	Bacillus_phage	47.4	1.7e-103
AWC59189.1|24458_24809_+	YolD-like family protein	NA	A0A1Q1PW34	Staphylococcus_phage	39.7	3.0e-10
AWC59190.1|24882_25167_-	CRISPR-associated protein Cas2	NA	A0A0M3LS55	Mannheimia_phage	38.9	3.5e-09
AWC59191.1|25387_25957_+	resolvase	NA	A0A0A8WIK3	Clostridium_phage	49.7	4.8e-42
AWC59192.1|25999_26422_+	hypothetical protein	NA	NA	NA	NA	NA
AWC59193.1|26813_27314_+	hypothetical protein	NA	NA	NA	NA	NA
AWC59194.1|27378_27684_-	hypothetical protein	NA	NA	NA	NA	NA
AWC59195.1|28070_29189_+	hypothetical protein	NA	A0A2H4J8G3	uncultured_Caudovirales_phage	51.3	3.6e-97
>prophage 1
CP024118	Bacillus cytotoxicus strain CH_2 plasmid pCh2_83, complete sequence	83527	35017	42271	83527	integrase	Bacillus_phage(33.33%)	8	31941:31956	48149:48164
31941:31956	attL	AAATGGATTAATGAAA	NA	NA	NA	NA
AWC59249.1|35017_35590_+	hypothetical protein	NA	A0A0K2SUB9	Clostridium_phage	44.4	3.3e-14
AWC59250.1|36066_36252_-	DNA-binding protein	NA	A6M9A5	Geobacillus_virus	64.9	6.8e-14
AWC59251.1|36290_36629_-	hypothetical protein	NA	NA	NA	NA	NA
AWC59252.1|37072_38029_-|integrase	integrase	integrase	A0A1B1P793	Bacillus_phage	34.3	1.2e-37
AWC59253.1|38145_38760_-	DNA recombinase	NA	A0A1V0E035	Clostridioides_phage	32.5	7.1e-15
AWC59254.1|39962_40169_+	hypothetical protein	NA	NA	NA	NA	NA
AWC59255.1|40398_40998_+	hypothetical protein	NA	A0A1Z1LZN4	Bacillus_phage	35.6	5.1e-10
AWC59256.1|41551_42271_+	DNA (cytosine-5-)-methyltransferase	NA	A0A1I9KKE7	Lactobacillus_phage	52.0	7.4e-64
48149:48164	attR	TTTCATTAATCCATTT	NA	NA	NA	NA
