The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP024120	Bacillus cytotoxicus strain CH_1 chromosome, complete genome	4147576	269592	277570	4147576		uncultured_virus(33.33%)	6	NA	NA
AWC59556.1|269592_269877_+	co-chaperone GroES	NA	A0A221S3C8	uncultured_virus	52.7	5.8e-20
AWC59557.1|269911_271540_+	molecular chaperone GroEL	NA	A0A219YK78	uncultured_virus	56.9	1.5e-157
AWC59558.1|271966_273514_+	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	30.6	2.2e-20
AWC59559.1|273887_275213_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	31.8	4.4e-46
AWC59560.1|275355_276057_+	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	38.7	8.6e-41
AWC63036.1|276082_277570_+	sensor histidine kinase	NA	W8CYF6	Bacillus_phage	30.4	2.8e-33
>prophage 2
CP024120	Bacillus cytotoxicus strain CH_1 chromosome, complete genome	4147576	310546	318918	4147576		Synechococcus_phage(33.33%)	8	NA	NA
AWC59571.1|310546_311848_+	adenylosuccinate lyase	NA	A0A1B3B081	Gordonia_phage	31.6	2.0e-19
AWC59572.1|311942_312662_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	G8EYA2	Synechococcus_phage	43.9	9.8e-48
AWC59573.1|312654_312909_+	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
AWC59574.1|312905_313589_+	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
AWC59575.1|313572_315792_+	phosphoribosylformylglycinamidine synthase II	NA	A6N228	Microbacterium_phage	41.2	2.0e-160
AWC59576.1|315776_317192_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	35.4	9.5e-55
AWC59577.1|317294_318338_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	48.0	2.7e-70
AWC59578.1|318330_318918_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	34.2	1.6e-24
>prophage 3
CP024120	Bacillus cytotoxicus strain CH_1 chromosome, complete genome	4147576	975696	1028150	4147576	capsid,portal,holin,tail,head,protease,terminase	Bacillus_phage(43.48%)	64	NA	NA
AWC60102.1|975696_976515_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
AWC60103.1|976551_976911_+	hypothetical protein	NA	NA	NA	NA	NA
AWC63053.1|976960_977260_+	hypothetical protein	NA	NA	NA	NA	NA
AWC60104.1|977442_978705_+	peptidase M48	NA	NA	NA	NA	NA
AWC60105.1|978842_980564_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	30.6	6.2e-16
AWC63054.1|980786_981674_+	EamA/RhaT family transporter	NA	NA	NA	NA	NA
AWC60106.1|982146_982806_+	S-layer homology domain-containing protein	NA	NA	NA	NA	NA
AWC60107.1|983123_983768_+	S-layer protein	NA	NA	NA	NA	NA
AWC60108.1|983986_985576_+	malate synthase A	NA	NA	NA	NA	NA
AWC60109.1|985596_986874_+	isocitrate lyase	NA	NA	NA	NA	NA
AWC60110.1|987204_987408_+	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	61.3	1.0e-15
AWC60111.1|988045_989479_-	recombinase family protein	NA	A0A2P1JU08	Anoxybacillus_phage	47.3	7.0e-114
AWC60112.1|989510_989948_-	ImmA/IrrE family metallo-endopeptidase	NA	D6R412	Bacillus_phage	50.4	3.9e-31
AWC60113.1|989970_990378_-	XRE family transcriptional regulator	NA	A0A0M4QX29	Bacillus_phage	47.1	5.0e-25
AWC60114.1|990655_990856_+	XRE family transcriptional regulator	NA	A0A0C5AJQ3	Paenibacillus_phage	50.9	3.2e-09
AWC60115.1|991202_991553_+	hypothetical protein	NA	A0A2H4JBP9	uncultured_Caudovirales_phage	77.4	7.1e-44
AWC60116.1|991642_991960_+	hypothetical protein	NA	A0A2H4J830	uncultured_Caudovirales_phage	48.8	2.1e-15
AWC60117.1|991907_992108_+	hypothetical protein	NA	NA	NA	NA	NA
AWC60118.1|992109_992301_+	hypothetical protein	NA	NA	NA	NA	NA
AWC60119.1|992306_993008_+	DNA-binding protein	NA	A0A2H4JHI2	uncultured_Caudovirales_phage	58.1	3.6e-71
AWC60120.1|993007_993484_+	DUF669 domain-containing protein	NA	A0A1B2AQ07	Phage_Wrath	49.4	1.6e-30
AWC60121.1|993588_995943_+	DNA primase	NA	A0A1B2AQ05	Phage_Wrath	83.2	0.0e+00
AWC60122.1|996208_996637_+	hypothetical protein	NA	A0A2H4JFQ6	uncultured_Caudovirales_phage	78.7	3.4e-64
AWC60123.1|996639_997179_+	nuclease	NA	A0A0S2SXQ1	Bacillus_phage	53.1	8.6e-49
AWC60124.1|997180_997465_+	hypothetical protein	NA	A0A0H3V0M3	Geobacillus_virus	52.3	3.9e-16
AWC60125.1|997545_997890_+	organic solvent tolerance protein OstA	NA	A0A1B1P7N6	Bacillus_phage	56.6	2.5e-25
AWC60126.1|997973_998174_+	hypothetical protein	NA	A0A1L2JY31	Aeribacillus_phage	53.0	6.9e-12
AWC60127.1|998276_999080_+	hypothetical protein	NA	NA	NA	NA	NA
AWC60128.1|999103_1000288_+	transcriptional regulator	NA	A0A0A7RTT7	Clostridium_phage	27.9	1.6e-34
AWC60129.1|1000389_1000785_+	DUF1492 domain-containing protein	NA	A0A2H4JFW6	uncultured_Caudovirales_phage	86.3	2.2e-57
AWC60130.1|1000962_1001877_+	hypothetical protein	NA	C9E2Q0	Enterococcus_phage	35.9	5.6e-24
AWC60131.1|1001938_1002469_-	pilus assembly protein HicB	NA	A0A090DBV2	Clostridium_phage	51.1	7.5e-29
AWC63055.1|1002564_1002735_-	type II toxin-antitoxin system HicA family toxin	NA	NA	NA	NA	NA
AWC60132.1|1002969_1003209_+	hydrolase	NA	NA	NA	NA	NA
AWC60133.1|1003222_1003519_+	HNH endonuclease	NA	A0A0S2SXR6	Bacillus_phage	64.0	1.7e-27
AWC60134.1|1003505_1003742_+	hypothetical protein	NA	A0A0S2GM40	Bacillus_phage	82.9	1.4e-24
AWC60135.1|1003856_1004243_+	hypothetical protein	NA	A0A0S2SXN4	Bacillus_phage	87.8	4.4e-55
AWC60136.1|1004239_1005958_+|terminase	terminase large subunit	terminase	A0A0S2SXJ7	Bacillus_phage	86.5	2.0e-301
AWC60137.1|1005980_1007150_+|portal	phage portal protein	portal	A0A1S5SFK2	Streptococcus_phage	58.1	2.5e-133
AWC60138.1|1007142_1007715_+|head,protease	HK97 family phage prohead protease	head,protease	A0A0S2SXJ4	Bacillus_phage	69.5	1.0e-71
AWC60139.1|1007707_1008880_+|capsid	phage major capsid protein	capsid	A0A0S2SXJ6	Bacillus_phage	74.6	1.1e-154
AWC60140.1|1008897_1009077_+	hypothetical protein	NA	A0A0S2SXV2	Bacillus_phage	64.3	1.2e-12
AWC60141.1|1009069_1009363_+	hypothetical protein	NA	A0A0S2SXS0	Bacillus_phage	57.3	1.5e-23
AWC60142.1|1009349_1009694_+	hypothetical protein	NA	NA	NA	NA	NA
AWC60143.1|1009686_1010043_+	hypothetical protein	NA	D2XR21	Bacillus_phage	59.0	7.5e-33
AWC60144.1|1010039_1010369_+	hypothetical protein	NA	D2XR22	Bacillus_phage	96.3	1.4e-54
AWC60145.1|1010369_1010963_+|tail	phage tail protein	tail	D2XR23	Bacillus_phage	85.6	1.5e-94
AWC60146.1|1010969_1011326_+	hypothetical protein	NA	A0A2H4JAG8	uncultured_Caudovirales_phage	70.8	2.0e-41
AWC60147.1|1011556_1013020_+	hypothetical protein	NA	A0A2H4JAI2	uncultured_Caudovirales_phage	86.8	1.0e-189
AWC60148.1|1013238_1015419_+	hypothetical protein	NA	A0A2H4JC82	uncultured_Caudovirales_phage	70.4	2.1e-29
AWC60149.1|1015460_1016936_+|tail	phage tail protein	tail	D2XR27	Bacillus_phage	95.1	8.7e-285
AWC60150.1|1016932_1021627_+	peptidase S74	NA	D2XR28	Bacillus_phage	64.9	0.0e+00
AWC60151.1|1021649_1022099_+	hypothetical protein	NA	A0A2H4J6F8	uncultured_Caudovirales_phage	94.6	1.4e-76
AWC60152.1|1022268_1022505_+	hypothetical protein	NA	A0A2H4J382	uncultured_Caudovirales_phage	96.2	1.5e-18
AWC60153.1|1022504_1022744_+|holin	holin	holin	A0A2H4J378	uncultured_Caudovirales_phage	98.7	1.7e-33
AWC60154.1|1022740_1023805_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A1B1P878	Bacillus_phage	94.4	9.3e-196
AWC60155.1|1023843_1024386_-	hypothetical protein	NA	NA	NA	NA	NA
AWC60156.1|1024521_1024767_+	hypothetical protein	NA	NA	NA	NA	NA
AWC60157.1|1024768_1025617_+	AraC family transcriptional regulator	NA	A0A1B0RXG1	Streptococcus_phage	38.6	2.7e-20
AWC60158.1|1025921_1026284_-	hypothetical protein	NA	NA	NA	NA	NA
AWC60159.1|1026345_1026678_-	hypothetical protein	NA	A0A1B2AQ49	Phage_Wrath	49.1	4.1e-17
AWC60160.1|1026756_1027005_-	hypothetical protein	NA	A0A1B1P7Q5	Bacillus_phage	97.6	1.1e-38
AWC60161.1|1027001_1027226_-	transcriptional regulator	NA	A0A1B1P7Q3	Bacillus_phage	100.0	7.7e-36
AWC60162.1|1027319_1028150_-	cytosolic protein	NA	A0A2H4J9W9	uncultured_Caudovirales_phage	89.1	3.8e-120
>prophage 4
CP024120	Bacillus cytotoxicus strain CH_1 chromosome, complete genome	4147576	1098760	1164904	4147576	coat,integrase,bacteriocin	Escherichia_phage(18.18%)	59	1138513:1138540	1167526:1167553
AWC60230.1|1098760_1099336_-|coat	spore coat protein	coat	NA	NA	NA	NA
AWC60231.1|1099457_1099817_+	DUF1360 domain-containing protein	NA	NA	NA	NA	NA
AWC63060.1|1099941_1100100_+	cytochrome C oxidase subunit III	NA	NA	NA	NA	NA
AWC63061.1|1100166_1101102_-	glycosyl transferase family 2	NA	NA	NA	NA	NA
AWC60232.1|1101124_1101880_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AWC60233.1|1102069_1102915_-	macrocin O-methyltransferase	NA	A0A2R8FFV8	Cedratvirus	55.2	5.5e-58
AWC60234.1|1103040_1104063_-	collagen-like protein	NA	NA	NA	NA	NA
AWC63062.1|1104196_1105294_+	beta 1,4 glucosyltransferase	NA	A0A0N9QAD0	Chrysochromulina_ericina_virus	25.2	1.5e-10
AWC60235.1|1105378_1106065_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AWC60236.1|1106061_1106739_+	streptomycin biosynthesis protein StrF	NA	NA	NA	NA	NA
AWC60237.1|1106758_1107439_+	streptomycin biosynthesis protein StrF	NA	NA	NA	NA	NA
AWC60238.1|1107515_1108253_+|coat	spore coat protein	coat	I7I009	Enterobacteria_phage	44.7	2.8e-50
AWC60239.1|1108261_1108810_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A218MN57	uncultured_virus	43.2	1.7e-31
AWC60240.1|1108821_1109793_+	dTDP-glucose 4,6-dehydratase	NA	A0A1D7XFE8	Escherichia_phage	42.9	8.5e-71
AWC60241.1|1109804_1110656_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	40.2	9.5e-42
AWC60242.1|1110858_1111359_-	hypothetical protein	NA	NA	NA	NA	NA
AWC60243.1|1111794_1112268_-|coat	spore coat protein	coat	NA	NA	NA	NA
AWC60244.1|1112434_1114489_-	ATP-dependent helicase	NA	S5MMD7	Bacillus_phage	31.9	6.2e-79
AWC60245.1|1115014_1115533_-	hypothetical protein	NA	NA	NA	NA	NA
AWC60246.1|1115625_1116357_-	esterase family protein	NA	NA	NA	NA	NA
AWC60247.1|1116577_1117489_+	EamA/RhaT family transporter	NA	NA	NA	NA	NA
AWC60248.1|1117709_1118099_-	hypothetical protein	NA	A0A0E3TB73	Enterococcus_phage	36.6	6.3e-09
AWC60249.1|1118270_1119737_-	sodium/proline symporter PutP	NA	NA	NA	NA	NA
AWC60250.1|1121569_1123063_+	lactate permease	NA	NA	NA	NA	NA
AWC60251.1|1123167_1123851_+	DUF2278 domain-containing protein	NA	NA	NA	NA	NA
AWC60252.1|1123897_1124731_-	hypothetical protein	NA	NA	NA	NA	NA
AWC60253.1|1124859_1125606_+	zinc ribbon domain-containing protein	NA	NA	NA	NA	NA
AWC60254.1|1125780_1127115_+	CoA-disulfide reductase	NA	NA	NA	NA	NA
AWC60255.1|1127243_1127654_+	DUF3908 domain-containing protein	NA	NA	NA	NA	NA
AWC60256.1|1127867_1129412_-	NADH oxidase	NA	NA	NA	NA	NA
AWC60257.1|1129472_1131425_-|bacteriocin	bacteriocin biosynthesis protein SagD	bacteriocin	NA	NA	NA	NA
AWC60258.1|1131418_1133344_-|bacteriocin	putative thiazole-containing bacteriocin maturation protein	bacteriocin	NA	NA	NA	NA
AWC60259.1|1133502_1134747_-	dihydrolipoyllysine-residue succinyltransferase	NA	NA	NA	NA	NA
AWC60260.1|1134867_1137744_-	2-oxoglutarate dehydrogenase subunit E1	NA	NA	NA	NA	NA
1138513:1138540	attL	TCAAGATTCAGAGAGAAGCAAGGAAGAT	NA	NA	NA	NA
AWC60261.1|1138711_1138894_+	DUF3976 domain-containing protein	NA	NA	NA	NA	NA
AWC60262.1|1138955_1139840_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AWC60263.1|1140026_1140953_+	2,4-dihydroxyhept-2-ene-1,7-dioic acid aldolase	NA	NA	NA	NA	NA
AWC60264.1|1141022_1142546_+	5-carboxymethyl-2-hydroxymuconate semialdehyde dehydrogenase	NA	NA	NA	NA	NA
AWC60265.1|1142599_1144072_+	4-hydroxyphenylacetate 3-monooxygenase, oxygenase component	NA	NA	NA	NA	NA
AWC60266.1|1144091_1145075_+	3,4-dihydroxyphenylacetate 2,3-dioxygenase	NA	NA	NA	NA	NA
AWC60267.1|1145132_1145999_+	cytidyltransferase	NA	NA	NA	NA	NA
AWC60268.1|1146059_1146389_+	DUF485 domain-containing protein	NA	NA	NA	NA	NA
AWC60269.1|1146378_1147929_+	cation acetate symporter	NA	NA	NA	NA	NA
AWC60270.1|1147949_1148741_+	4-hydroxyphenylacetate isomerase	NA	NA	NA	NA	NA
AWC60271.1|1148737_1149496_+	2-hydroxyhepta-2,4-diene-1,7-dioate isomerase	NA	NA	NA	NA	NA
AWC60272.1|1149568_1149967_+	5-carboxymethyl-2-hydroxymuconate isomerase	NA	NA	NA	NA	NA
AWC60273.1|1150285_1151398_+	tetratricopeptide repeat-containing protein	NA	A0A2H4J8G3	uncultured_Caudovirales_phage	49.1	2.4e-93
AWC60274.1|1152048_1152417_+	NUDIX domain-containing protein	NA	NA	NA	NA	NA
AWC60275.1|1153241_1153448_+	hypothetical protein	NA	NA	NA	NA	NA
AWC60276.1|1154098_1154416_+	DUF3884 domain-containing protein	NA	NA	NA	NA	NA
AWC60277.1|1156473_1156881_+	hypothetical protein	NA	NA	NA	NA	NA
AWC60278.1|1159179_1160100_-	gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
AWC60279.1|1160181_1160559_-	hypothetical protein	NA	NA	NA	NA	NA
AWC60280.1|1160575_1160836_-	hypothetical protein	NA	NA	NA	NA	NA
AWC60281.1|1160971_1161226_+	hypothetical protein	NA	NA	NA	NA	NA
AWC60282.1|1161732_1162386_+	hypothetical protein	NA	NA	NA	NA	NA
AWC60283.1|1162583_1162859_+	hypothetical protein	NA	NA	NA	NA	NA
AWC60284.1|1163176_1164271_-	tetratricopeptide repeat-containing protein	NA	A0A2H4J8G3	uncultured_Caudovirales_phage	51.8	1.2e-100
AWC60285.1|1164532_1164904_+|integrase	site-specific integrase	integrase	A0A1B0T6A8	Bacillus_phage	54.4	2.1e-25
1167526:1167553	attR	TCAAGATTCAGAGAGAAGCAAGGAAGAT	NA	NA	NA	NA
>prophage 5
CP024120	Bacillus cytotoxicus strain CH_1 chromosome, complete genome	4147576	1978336	1986469	4147576		Bacillus_phage(50.0%)	9	NA	NA
AWC63098.1|1978336_1979254_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	43.3	7.6e-45
AWC61028.1|1979250_1980003_+	ABC transporter permease	NA	NA	NA	NA	NA
AWC61029.1|1980015_1980747_+	multidrug ABC transporter permease	NA	NA	NA	NA	NA
AWC61030.1|1981179_1981893_+	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	41.5	3.7e-39
AWC61031.1|1981893_1983300_+	two-component sensor histidine kinase	NA	A0A1V0SGX0	Hokovirus	24.4	3.2e-10
AWC61032.1|1983656_1983995_-	DUF4064 domain-containing protein	NA	A0A0S2MVJ2	Bacillus_phage	80.4	2.1e-40
AWC61033.1|1984011_1984515_-	DUF4352 domain-containing protein	NA	NA	NA	NA	NA
AWC61034.1|1985177_1985456_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	A0A2I7SC16	Paenibacillus_phage	61.9	5.1e-13
AWC61035.1|1985674_1986469_+	peptigoglycan-binding protein LysM	NA	A0A141HRV8	Bacillus_phage	40.7	6.3e-32
>prophage 6
CP024120	Bacillus cytotoxicus strain CH_1 chromosome, complete genome	4147576	2278338	2344503	4147576	transposase,bacteriocin,holin	Bacillus_phage(42.86%)	54	NA	NA
AWC61299.1|2278338_2278956_+|transposase	transposase	transposase	NA	NA	NA	NA
AWC63115.1|2279454_2280198_-	hypothetical protein	NA	A0A127AXI2	Bacillus_phage	44.5	1.7e-18
AWC61300.1|2280658_2281888_-	MFS transporter	NA	NA	NA	NA	NA
AWC61301.1|2282633_2282870_-	hypothetical protein	NA	NA	NA	NA	NA
AWC61302.1|2282900_2283842_-|transposase	transposase	transposase	NA	NA	NA	NA
AWC61303.1|2286007_2286433_+	hypothetical protein	NA	NA	NA	NA	NA
AWC61304.1|2286407_2286701_+	hypothetical protein	NA	NA	NA	NA	NA
AWC61305.1|2286982_2288124_-|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	66.4	5.1e-99
AWC61306.1|2288159_2288777_-|bacteriocin	bacteriocin ABC transporter ATP-binding protein	bacteriocin	G9BWD6	Planktothrix_phage	34.3	2.9e-16
AWC61307.1|2288781_2290950_-|bacteriocin	bacteriocin-associated protein	bacteriocin	NA	NA	NA	NA
AWC61308.1|2291073_2291262_-	hypothetical protein	NA	NA	NA	NA	NA
AWC61309.1|2291246_2291516_-	hypothetical protein	NA	NA	NA	NA	NA
AWC61310.1|2292612_2292861_-	DUF4176 domain-containing protein	NA	NA	NA	NA	NA
AWC63116.1|2292861_2293023_-	hypothetical protein	NA	NA	NA	NA	NA
AWC61311.1|2293061_2293253_-	hypothetical protein	NA	NA	NA	NA	NA
AWC61312.1|2294942_2295218_-	TIGR04197 family type VII secretion effector	NA	NA	NA	NA	NA
AWC61313.1|2298509_2299256_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.1	5.0e-31
AWC61314.1|2299625_2299949_-	hypothetical protein	NA	NA	NA	NA	NA
AWC61315.1|2299956_2300481_-	hypothetical protein	NA	NA	NA	NA	NA
AWC61316.1|2302613_2302997_-	hypothetical protein	NA	NA	NA	NA	NA
AWC61317.1|2303215_2303536_-	hypothetical protein	NA	NA	NA	NA	NA
AWC61318.1|2305385_2306366_+	ketoacyl-ACP synthase III	NA	NA	NA	NA	NA
AWC61319.1|2306428_2306677_-	hypothetical protein	NA	A0A288WFY7	Bacillus_phage	46.2	3.9e-12
AWC61320.1|2306949_2307999_-	oxidoreductase	NA	NA	NA	NA	NA
AWC61321.1|2308481_2308880_+	DUF2871 domain-containing protein	NA	NA	NA	NA	NA
AWC61322.1|2309778_2310039_-	DUF2642 domain-containing protein	NA	NA	NA	NA	NA
AWC61323.1|2310178_2310841_-	bacillithiol biosynthesis deacetylase BshB2	NA	NA	NA	NA	NA
AWC61324.1|2310856_2311207_-	DUF1806 domain-containing protein	NA	NA	NA	NA	NA
AWC61325.1|2311448_2312774_+	hypothetical protein	NA	NA	NA	NA	NA
AWC61326.1|2313113_2313641_-	N-acetyltransferase	NA	A0A1P8CWJ6	Bacillus_phage	66.3	4.8e-60
AWC61327.1|2313647_2315549_-	mannonate oxidoreductase	NA	F2Y0V3	Organic_Lake_phycodnavirus	25.4	2.0e-15
AWC61328.1|2317022_2318810_+	oligoendopeptidase F	NA	NA	NA	NA	NA
AWC61329.1|2318995_2320228_-	MFS transporter	NA	NA	NA	NA	NA
AWC61330.1|2320331_2321195_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AWC61331.1|2321362_2322421_+	acyltransferase	NA	NA	NA	NA	NA
AWC61332.1|2322465_2323410_-	glycerophosphodiester phosphodiesterase	NA	A0A076G4Q2	Staphylococcus_phage	35.0	2.4e-38
AWC61333.1|2323884_2324427_-	N-acetyltransferase	NA	NA	NA	NA	NA
AWC61334.1|2324677_2325091_-	hypothetical protein	NA	NA	NA	NA	NA
AWC61335.1|2325669_2326518_-	chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	47.9	1.4e-08
AWC61336.1|2326936_2327575_-	hypothetical protein	NA	NA	NA	NA	NA
AWC61337.1|2327601_2328414_-	hypothetical protein	NA	NA	NA	NA	NA
AWC61338.1|2328895_2330275_+	chitin-binding protein	NA	A0A0K1Y848	Apis_mellifera_filamentous_virus	35.7	1.4e-21
AWC61339.1|2330428_2332099_-	peptidase M4 family protein	NA	NA	NA	NA	NA
AWC61340.1|2332834_2334310_+	SELO family protein	NA	A0A075BSJ0	Microcystis_phage	30.9	1.2e-47
AWC61341.1|2334424_2335810_-	2-hydroxy-acid oxidase	NA	NA	NA	NA	NA
AWC61342.1|2336234_2336912_-	methyltransferase	NA	G3MA03	Bacillus_virus	43.3	8.1e-20
AWC61343.1|2337727_2338639_-	hypothetical protein	NA	NA	NA	NA	NA
AWC61344.1|2339044_2339392_+	hypothetical protein	NA	NA	NA	NA	NA
AWC61345.1|2339533_2340601_+	hypothetical protein	NA	NA	NA	NA	NA
AWC61346.1|2341850_2342183_-	hypothetical protein	NA	NA	NA	NA	NA
AWC61347.1|2342354_2342558_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AWC61348.1|2342637_2343222_+	hypothetical protein	NA	NA	NA	NA	NA
AWC61349.1|2343262_2344063_-	N-acetylmuramoyl-L-alanine amidase	NA	D2XR33	Bacillus_phage	74.9	3.0e-122
AWC61350.1|2344062_2344503_-|holin	holin	holin	A0A1B1P7S2	Bacillus_phage	86.3	8.3e-66
>prophage 7
CP024120	Bacillus cytotoxicus strain CH_1 chromosome, complete genome	4147576	2349031	2392738	4147576	integrase,capsid,tail,portal	Bacillus_phage(46.67%)	56	2340078:2340137	2392828:2393349
2340078:2340137	attL	TGCCTGAAGAAGGTATGGTCGAAGTCGGCGAATTAAAAATACACCAAGCATCGCATGCCC	NA	NA	NA	NA
AWC61352.1|2349031_2350534_-|tail	phage tail protein	tail	A0A1B1P7W7	Bacillus_phage	72.4	7.2e-202
AWC61353.1|2350548_2354202_-|tail	phage tail tape measure protein	tail	A6M961	Geobacillus_virus	46.6	2.4e-57
AWC61354.1|2354248_2354566_-	hypothetical protein	NA	NA	NA	NA	NA
AWC61355.1|2354607_2354982_-	hypothetical protein	NA	NA	NA	NA	NA
AWC61356.1|2355039_2355570_-|tail	phage major tail protein, TP901-1 family	tail	NA	NA	NA	NA
AWC61357.1|2355588_2355996_-	hypothetical protein	NA	NA	NA	NA	NA
AWC61358.1|2355998_2356358_-	hypothetical protein	NA	NA	NA	NA	NA
AWC61359.1|2356357_2356732_-	hypothetical protein	NA	NA	NA	NA	NA
AWC61360.1|2356735_2357542_-	hypothetical protein	NA	NA	NA	NA	NA
AWC61361.1|2357538_2357895_-	hypothetical protein	NA	A0A142F1M2	Bacillus_phage	34.5	2.0e-09
AWC61362.1|2357900_2358113_-	hypothetical protein	NA	NA	NA	NA	NA
AWC61363.1|2358112_2359138_-|capsid	minor capsid protein E	capsid	A0A142F1M0	Bacillus_phage	60.1	5.4e-108
AWC61364.1|2359201_2359588_-	hypothetical protein	NA	A0A142F1L9	Bacillus_phage	68.2	3.2e-45
AWC61365.1|2359610_2360162_-	hypothetical protein	NA	NA	NA	NA	NA
AWC61366.1|2360162_2361704_-|portal	phage portal protein	portal	A0A142F1L7	Bacillus_phage	48.4	8.3e-137
AWC61367.1|2361719_2363423_-	hypothetical protein	NA	A0A142F1L6	Bacillus_phage	50.3	2.5e-158
AWC61368.1|2363422_2363896_-	hypothetical protein	NA	NA	NA	NA	NA
AWC61369.1|2364964_2365789_-	hypothetical protein	NA	NA	NA	NA	NA
AWC61370.1|2366184_2366751_-	hypothetical protein	NA	A0A2H4J2L4	uncultured_Caudovirales_phage	45.8	9.7e-35
AWC61371.1|2366762_2367140_-	hypothetical protein	NA	A0A0N9RZI0	Paenibacillus_phage	43.1	2.0e-15
AWC61372.1|2367144_2368722_-	DNA cytosine methyltransferase	NA	Q02778	Bacillus_phage	42.4	8.3e-108
AWC61373.1|2368718_2368949_-	hypothetical protein	NA	NA	NA	NA	NA
AWC61374.1|2368950_2369589_-	hypothetical protein	NA	NA	NA	NA	NA
AWC61375.1|2369600_2369834_-	glutaredoxin family protein	NA	A0A1B1P8E0	Bacillus_phage	64.5	1.2e-23
AWC61376.1|2369830_2370436_-	hypothetical protein	NA	A0A2H4JAZ2	uncultured_Caudovirales_phage	41.2	7.7e-38
AWC61377.1|2370496_2371123_-	hypothetical protein	NA	J9Q953	Bacillus_phage	44.9	3.3e-36
AWC63117.1|2371124_2371496_-	hypothetical protein	NA	NA	NA	NA	NA
AWC61378.1|2371923_2372232_-	transglycosylase	NA	A0A0K2CZP5	Paenibacillus_phage	35.7	9.7e-05
AWC61379.1|2372231_2372627_-	alpha/beta hydrolase	NA	A0A2H4IZM2	uncultured_Caudovirales_phage	68.9	6.1e-44
AWC61380.1|2372912_2373440_-	hypothetical protein	NA	A0A0N9ST03	Paenibacillus_phage	44.6	3.2e-08
AWC61381.1|2373436_2373661_-	hypothetical protein	NA	U5Q038	Bacillus_phage	70.6	8.3e-22
AWC61382.1|2373660_2374707_-	hypothetical protein	NA	A0A0N9SHN6	Paenibacillus_phage	58.6	4.8e-88
AWC61383.1|2374720_2374876_-	hypothetical protein	NA	NA	NA	NA	NA
AWC63118.1|2374868_2377052_-	DNA-directed DNA polymerase	NA	A0A142F1Q9	Bacillus_phage	54.6	7.2e-219
AWC61384.1|2377231_2378407_-	hypothetical protein	NA	NA	NA	NA	NA
AWC61385.1|2378399_2378807_-	hypothetical protein	NA	NA	NA	NA	NA
AWC61386.1|2378833_2379595_-	single-stranded DNA-binding protein	NA	A0A0N9SJW5	Paenibacillus_phage	49.2	7.9e-56
AWC61387.1|2380101_2380749_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
AWC61388.1|2381046_2382270_-	hypothetical protein	NA	A0A288WGM1	Bacillus_phage	47.8	9.9e-101
AWC61389.1|2382384_2382588_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AWC63119.1|2382651_2382837_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AWC61390.1|2382844_2383861_-	hypothetical protein	NA	A0A2H4J6E6	uncultured_Caudovirales_phage	43.2	6.8e-71
AWC61391.1|2383887_2385231_-	DNA helicase	NA	A0A2H4IZL9	uncultured_Caudovirales_phage	55.8	2.6e-134
AWC61392.1|2385327_2385612_-	hypothetical protein	NA	A0A0H3V0M3	Geobacillus_virus	44.0	5.4e-10
AWC61393.1|2385859_2386276_-	hypothetical protein	NA	A0A0K2CNU6	Brevibacillus_phage	57.1	8.5e-12
AWC61394.1|2386313_2386853_-	hypothetical protein	NA	A0A1I9S5V4	Bacillus_phage	76.7	2.8e-71
AWC61395.1|2386898_2387084_-	hypothetical protein	NA	NA	NA	NA	NA
AWC61396.1|2387450_2388215_-	DNA replication protein	NA	A0A0N7GFF0	Paenibacillus_phage	56.5	3.7e-77
AWC61397.1|2388214_2388889_-	DUF723 domain-containing protein	NA	NA	NA	NA	NA
AWC63120.1|2388904_2389291_-	hypothetical protein	NA	A0A2H4J134	uncultured_Caudovirales_phage	36.2	3.2e-13
AWC61398.1|2389296_2389629_-	hypothetical protein	NA	NA	NA	NA	NA
AWC61399.1|2389615_2389774_-	Fur-regulated basic protein FbpA	NA	NA	NA	NA	NA
AWC61400.1|2389855_2390200_-	hypothetical protein	NA	NA	NA	NA	NA
AWC61401.1|2390629_2391001_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
AWC61402.1|2390997_2391399_-	helix-turn-helix domain-containing protein	NA	A0A142F1P0	Bacillus_phage	58.5	2.3e-30
AWC61403.1|2391607_2392738_+|integrase	site-specific integrase	integrase	A0A2H4JCB7	uncultured_Caudovirales_phage	36.5	3.1e-64
2392828:2393349	attR	TGCCTGAAGAAGGTATGGTCGAAGTCGGCGAATTAAAAATACACCAAGCATCGCATGCCCGCTACTTTGAAGACTTCTTAAAATTTGTCGAATATGAACGCTCCATGCCTGAAATTATGAAAACACAAGTAATGGACATGGTATACGACCAAATTGAAGATATATTTGAAGAAGGTACGGAAGAACGCGAACAATTCGACCAAGCGATGGAAGTATGGGCCGCTAGTCCGAAACGCGAAATTATGGAACAGTTTTCAACCGAAGAAATAATGGAAGCTACCGCTCAAATCGTCGAGCATGCTCCTGAAGTAGAATTAAAGGTTAAAGCCGATCACATTTCTGTGAAAGCTCTGCTTGCTGATTTCGGGGATCAAATACATATTGCAAAGGTAAATGACCGATACGTATTAATGATTGAGGCTGATACACTTACGTTTGAGAAAGGCTTCTCTCCGATTGAGTTTCTAAAGCCAGATGAATTGCAAGATGTGATTGAGCGGATTGAGAATAAGCAGCAATATT	NA	NA	NA	NA
>prophage 8
CP024120	Bacillus cytotoxicus strain CH_1 chromosome, complete genome	4147576	3038814	3074141	4147576	portal,holin,tail,head,terminase	Bacillus_phage(90.0%)	46	NA	NA
AWC62017.1|3038814_3039387_+	DUF4352 domain-containing protein	NA	A0A1B1P898	Bacillus_phage	84.9	1.5e-54
AWC62018.1|3039697_3040138_+	hypothetical protein	NA	NA	NA	NA	NA
AWC62019.1|3040212_3041034_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A0S2GLD4	Bacillus_phage	85.3	5.9e-142
AWC62020.1|3041033_3041474_-|holin	holin	holin	A0A1B1P7S2	Bacillus_phage	86.3	8.3e-66
AWC62021.1|3041508_3046002_-	hypothetical protein	NA	A0A0M4RER0	Bacillus_phage	45.7	9.5e-266
AWC62022.1|3046002_3047496_-|tail	phage tail protein	tail	A0A1B1P7W7	Bacillus_phage	76.3	2.4e-229
AWC62023.1|3047508_3050436_-|tail	phage tail tape measure protein	tail	A0A0A7AR36	Bacillus_phage	55.7	2.9e-183
AWC62024.1|3050441_3050708_-	hypothetical protein	NA	A0A0M4S6X7	Bacillus_phage	60.2	8.3e-21
AWC62025.1|3050743_3051181_-	hypothetical protein	NA	A0A0M4QX42	Bacillus_phage	32.7	3.6e-13
AWC62026.1|3051226_3051859_-	hypothetical protein	NA	A0A0M4R5F9	Bacillus_phage	79.1	5.7e-76
AWC62027.1|3051876_3052257_-	hypothetical protein	NA	A0A0M4RD75	Bacillus_phage	83.3	1.8e-56
AWC62028.1|3052253_3052670_-	hypothetical protein	NA	A0A0M4S6Z2	Bacillus_phage	76.8	2.7e-58
AWC62029.1|3052653_3053013_-	hypothetical protein	NA	A0A0M4S6Z9	Bacillus_phage	81.2	5.7e-49
AWC62030.1|3052994_3053333_-	hypothetical protein	NA	W8CYS9	Bacillus_phage	39.6	2.9e-10
AWC62031.1|3053369_3054212_-	hypothetical protein	NA	A0A0M5M1L4	Bacillus_phage	77.7	5.2e-117
AWC62032.1|3054886_3055912_-|head	phage head morphogenesis protein	head	A0A0M5M7Z2	Bacillus_phage	84.1	5.1e-159
AWC62033.1|3055898_3057254_-|portal	phage portal protein	portal	A0A0M4S669	Bacillus_phage	85.6	3.5e-200
AWC62034.1|3057265_3058570_-|terminase	PBSX family phage terminase large subunit	terminase	A0A0M4R5F3	Bacillus_phage	95.2	9.5e-251
AWC62035.1|3058556_3058988_-|terminase	terminase small subunit	terminase	A0A0M4RU19	Bacillus_phage	74.8	1.3e-55
AWC62036.1|3059752_3059998_-	DNA-binding protein	NA	A0A290FZJ4	Caldibacillus_phage	57.5	5.1e-17
AWC62037.1|3060403_3060784_-	ArpU family transcriptional regulator	NA	A0A0M4R397	Bacillus_phage	84.7	1.1e-53
AWC62038.1|3060788_3061076_-	hypothetical protein	NA	A6M999	Geobacillus_virus	73.4	2.9e-35
AWC63144.1|3061453_3061705_-	XRE family transcriptional regulator	NA	A0A0S2MV80	Bacillus_phage	92.7	1.3e-36
AWC62039.1|3061956_3062241_-	hypothetical protein	NA	I7J4K9	Bacillus_phage	48.9	4.3e-15
AWC62040.1|3062341_3062551_+	hypothetical protein	NA	NA	NA	NA	NA
AWC62041.1|3062611_3063043_-	hypothetical protein	NA	W8CYU3	Bacillus_phage	39.9	2.6e-19
AWC62042.1|3063072_3063276_-	hypothetical protein	NA	NA	NA	NA	NA
AWC62043.1|3063297_3063831_-	hypothetical protein	NA	U5PUK4	Bacillus_phage	60.0	8.8e-54
AWC62044.1|3063873_3064080_-	hypothetical protein	NA	NA	NA	NA	NA
AWC62045.1|3064158_3064359_-	hypothetical protein	NA	A0A1P8CWV4	Bacillus_phage	54.2	2.6e-06
AWC63145.1|3064395_3064968_-	dUTPase	NA	A0A0A7AQI4	Bacillus_phage	78.1	1.7e-82
AWC62046.1|3065121_3065913_-	hypothetical protein	NA	A0A0M4RU33	Bacillus_phage	42.1	3.8e-29
AWC62047.1|3065914_3066094_-	hypothetical protein	NA	NA	NA	NA	NA
AWC62048.1|3066303_3067176_-	DNA replication protein	NA	A0A0M4RD64	Bacillus_phage	72.0	1.5e-114
AWC62049.1|3067105_3067909_-	phage replication protein	NA	A0A0M4S6Y4	Bacillus_phage	75.4	5.9e-86
AWC62050.1|3067909_3068179_-	hypothetical protein	NA	A0A0M4S680	Bacillus_phage	83.1	5.3e-39
AWC62051.1|3068192_3068864_-	DUF1071 domain-containing protein	NA	A0A1B1P7F0	Bacillus_phage	44.2	8.0e-28
AWC62052.1|3068860_3069343_-	ATPase	NA	E5DV79	Deep-sea_thermophilic_phage	48.1	8.3e-35
AWC62053.1|3069406_3069775_-	XRE family transcriptional regulator	NA	A0A0M5M3T1	Bacillus_phage	81.0	2.9e-11
AWC62054.1|3069797_3070064_-	hypothetical protein	NA	A0A0M4S677	Bacillus_phage	80.9	2.3e-23
AWC62055.1|3070383_3070578_-	hypothetical protein	NA	NA	NA	NA	NA
AWC62056.1|3070606_3071383_-	hypothetical protein	NA	A0A288WFS9	Bacillus_phage	62.9	2.7e-59
AWC62057.1|3071379_3071568_-	XRE family transcriptional regulator	NA	A0A0M3ULF9	Bacillus_phage	91.4	1.1e-22
AWC62058.1|3071840_3072263_+	XRE family transcriptional regulator	NA	A0A0M4QX29	Bacillus_phage	97.1	2.0e-69
AWC63146.1|3072277_3072703_+	ImmA/IrrE family metallo-endopeptidase	NA	A0A0M4RD70	Bacillus_phage	92.2	7.5e-72
AWC62059.1|3072716_3074141_+	recombinase family protein	NA	A0A1L2JY12	Aeribacillus_phage	42.4	7.2e-103
>prophage 1
CP024121	Bacillus cytotoxicus strain CH_1 plasmid pCh1_53, complete sequence	53103	32758	39375	53103		Bacillus_phage(33.33%)	9	NA	NA
AWC63204.1|32758_33877_-	hypothetical protein	NA	A0A2H4J8G3	uncultured_Caudovirales_phage	51.3	3.6e-97
AWC63205.1|34263_34569_+	hypothetical protein	NA	NA	NA	NA	NA
AWC63206.1|34633_35134_-	hypothetical protein	NA	NA	NA	NA	NA
AWC63207.1|35525_35948_-	hypothetical protein	NA	NA	NA	NA	NA
AWC63208.1|35990_36560_-	resolvase	NA	A0A0A8WIK3	Clostridium_phage	49.7	4.8e-42
AWC63209.1|36780_37065_+	CRISPR-associated protein Cas2	NA	A0A0M3LS55	Mannheimia_phage	38.9	3.5e-09
AWC63210.1|37138_37489_-	YolD-like family protein	NA	A0A1Q1PW34	Staphylococcus_phage	39.7	3.0e-10
AWC63211.1|37485_38751_-	DNA repair protein	NA	O64031	Bacillus_phage	47.4	1.7e-103
AWC63212.1|38940_39375_-	sporulation protein	NA	F8WPS9	Bacillus_phage	50.7	4.1e-33
>prophage 1
CP024122	Bacillus cytotoxicus strain CH_1 plasmid pCh1_67, complete sequence	67308	0	18609	67308		Streptococcus_phage(100.0%)	18	NA	NA
AWC63235.1|665_1055_-	hypothetical protein	NA	NA	NA	NA	NA
AWC63236.1|4423_5314_-	hypothetical protein	NA	NA	NA	NA	NA
AWC63237.1|5685_6066_-	hypothetical protein	NA	NA	NA	NA	NA
AWC63238.1|6214_6787_-	type III toxin-antitoxin system ToxN/AbiQ family toxin	NA	NA	NA	NA	NA
AWC63239.1|7048_8071_-	hypothetical protein	NA	NA	NA	NA	NA
AWC63240.1|8198_8750_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
AWC63241.1|8774_9755_-	hypothetical protein	NA	NA	NA	NA	NA
AWC63242.1|9861_11637_-	hypothetical protein	NA	NA	NA	NA	NA
AWC63243.1|11627_11837_-	hypothetical protein	NA	NA	NA	NA	NA
AWC63244.1|11859_12288_-	hypothetical protein	NA	NA	NA	NA	NA
AWC63245.1|12307_12784_-	hypothetical protein	NA	NA	NA	NA	NA
AWC63246.1|12852_14418_-	hypothetical protein	NA	NA	NA	NA	NA
AWC63247.1|14437_15046_-	hypothetical protein	NA	NA	NA	NA	NA
AWC63248.1|15063_15351_-	hypothetical protein	NA	NA	NA	NA	NA
AWC63249.1|15614_16472_-	hypothetical protein	NA	NA	NA	NA	NA
AWC63250.1|16462_16741_-	hypothetical protein	NA	NA	NA	NA	NA
AWC63251.1|16848_17457_-	hypothetical protein	NA	NA	NA	NA	NA
AWC63252.1|17481_18609_-	lysozyme	NA	A0A1S5SEZ8	Streptococcus_phage	41.7	4.3e-58
>prophage 2
CP024122	Bacillus cytotoxicus strain CH_1 plasmid pCh1_67, complete sequence	67308	24142	27815	67308		Lactobacillus_phage(50.0%)	4	NA	NA
AWC63259.1|24142_25018_-	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	22.1	4.9e-09
AWC63260.1|25154_26174_+	putative sulfate exporter family transporter	NA	NA	NA	NA	NA
AWC63261.1|26199_26622_+	universal stress protein	NA	NA	NA	NA	NA
AWC63262.1|27080_27815_+	NAD(P)-dependent oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	31.5	7.4e-19
>prophage 3
CP024122	Bacillus cytotoxicus strain CH_1 plasmid pCh1_67, complete sequence	67308	43682	44906	67308		Bacillus_phage(100.0%)	1	NA	NA
AWC63275.1|43682_44906_-	hypothetical protein	NA	A0A1B1P895	Bacillus_phage	66.1	2.6e-149
>prophage 4
CP024122	Bacillus cytotoxicus strain CH_1 plasmid pCh1_67, complete sequence	67308	48244	65015	67308	integrase	Bacillus_phage(30.0%)	23	50095:50110	66303:66318
AWC63278.1|48244_49060_+	ATPase	NA	F0PIG8	Enterococcus_phage	40.8	2.8e-51
AWC63279.1|49064_49427_+	hypothetical protein	NA	NA	NA	NA	NA
AWC63280.1|49515_49737_+	hypothetical protein	NA	NA	NA	NA	NA
AWC63281.1|49758_49986_+	hypothetical protein	NA	NA	NA	NA	NA
AWC63282.1|50016_50208_+	hypothetical protein	NA	NA	NA	NA	NA
50095:50110	attL	AAATGGATTAATGAAA	NA	NA	NA	NA
AWC63283.1|50220_50505_+	transcriptional regulator	NA	NA	NA	NA	NA
AWC63284.1|50531_50867_+	hypothetical protein	NA	NA	NA	NA	NA
AWC63285.1|50944_51127_+	hypothetical protein	NA	NA	NA	NA	NA
AWC63286.1|51299_52394_+	hypothetical protein	NA	A0A2H4J8G3	uncultured_Caudovirales_phage	55.5	5.6e-103
AWC63287.1|52393_52552_+	general stress protein	NA	NA	NA	NA	NA
AWC63288.1|52641_54285_-	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AWC63289.1|54659_55424_-	site-specific DNA-methyltransferase	NA	A0A0H3UZL7	Geobacillus_virus	59.8	1.2e-80
AWC63290.1|55987_56707_-	DNA (cytosine-5-)-methyltransferase	NA	A0A1I9KKE7	Lactobacillus_phage	52.0	7.4e-64
AWC63291.1|57260_57860_-	hypothetical protein	NA	A0A1Z1LZN4	Bacillus_phage	35.6	5.1e-10
AWC63292.1|58089_58296_-	hypothetical protein	NA	NA	NA	NA	NA
AWC63293.1|59498_60113_+	DNA recombinase	NA	A0A1V0E035	Clostridioides_phage	32.5	7.1e-15
AWC63294.1|60229_61186_+|integrase	integrase	integrase	A0A1B1P793	Bacillus_phage	34.3	1.2e-37
AWC63295.1|61629_61968_+	hypothetical protein	NA	NA	NA	NA	NA
AWC63296.1|62006_62192_+	DNA-binding protein	NA	A6M9A5	Geobacillus_virus	64.9	6.8e-14
AWC63297.1|62668_63241_-	hypothetical protein	NA	A0A0K2SUB9	Clostridium_phage	44.4	3.3e-14
AWC63298.1|63254_63722_-	hypothetical protein	NA	NA	NA	NA	NA
AWC63299.1|63971_64226_-	hypothetical protein	NA	NA	NA	NA	NA
AWC63300.1|64292_65015_-	hypothetical protein	NA	A0A218KBS8	Bacillus_phage	44.9	9.3e-06
66303:66318	attR	TTTCATTAATCCATTT	NA	NA	NA	NA
