The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP024650	Escherichia coli strain BH100 substr. MG2014 chromosome, complete genome	5072943	127927	190399	5072943	tRNA,transposase,protease,bacteriocin	Erysipelothrix_phage(11.11%)	58	NA	NA
ATV07321.1|127927_128212_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
ATV07322.1|128379_128619_+	hypothetical protein	NA	NA	NA	NA	NA
ATV07323.1|128619_128910_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
ATV07324.1|129076_129265_+	HNH endonuclease	NA	NA	NA	NA	NA
ATV07325.1|129318_129609_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
ATV07326.1|130064_130829_+	pyruvate dehydrogenase complex repressor	NA	NA	NA	NA	NA
ATV07327.1|130825_131008_-	hypothetical protein	NA	NA	NA	NA	NA
ATV07328.1|130989_133653_+	pyruvate dehydrogenase (acetyl-transferring), homodimeric type	NA	NA	NA	NA	NA
ATV07329.1|133667_135560_+	pyruvate dehydrogenase complex dihydrolipoyllysine-residue acetyltransferase	NA	NA	NA	NA	NA
ATV12013.1|135767_137192_+	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.8	4.2e-42
ATV07330.1|137433_139191_-	translation initiation factor IF-2	NA	NA	NA	NA	NA
ATV07331.1|139447_139564_+	aconitate hydratase	NA	NA	NA	NA	NA
ATV07332.1|139544_142142_+	aconitate hydratase B	NA	NA	NA	NA	NA
ATV07333.1|142316_142679_+	UPF0231 family protein	NA	NA	NA	NA	NA
ATV07334.1|142716_143511_-	S-adenosylmethionine decarboxylase proenzyme	NA	NA	NA	NA	NA
ATV07335.1|143526_144393_-	polyamine aminopropyltransferase	NA	NA	NA	NA	NA
ATV07336.1|144498_144846_-	hypothetical protein	NA	NA	NA	NA	NA
ATV07337.1|145011_146562_+	multicopper oxidase CueO	NA	NA	NA	NA	NA
ATV07342.1|146818_149209_-	glucose/quinate/shikimate family membrane-bound PQQ-dependent dehydrogenase	NA	NA	NA	NA	NA
ATV07343.1|149414_149951_+	hypoxanthine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	33.1	5.1e-17
ATV07344.1|149991_150654_-	carbonate dehydratase	NA	NA	NA	NA	NA
ATV07345.1|150762_151689_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	34.0	1.2e-21
ATV07346.1|151685_152456_+	inner membrane transport permease YadH	NA	NA	NA	NA	NA
ATV07347.1|152560_153001_+	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
ATV07348.1|153064_154294_+	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
ATV07349.1|154297_154678_-	aspartate 1-decarboxylase	NA	NA	NA	NA	NA
ATV07350.1|154627_154831_+	hypothetical protein	NA	NA	NA	NA	NA
ATV07351.1|154951_155884_+|transposase	ISNCY family transposase	transposase	Q2A0A7	Sodalis_phage	48.4	6.5e-60
ATV07352.1|155952_156156_+|transposase	transposase	transposase	NA	NA	NA	NA
ATV07353.1|156237_157089_-	pantoate--beta-alanine ligase	NA	NA	NA	NA	NA
ATV07354.1|157100_157895_-	3-methyl-2-oxobutanoate hydroxymethyltransferase	NA	NA	NA	NA	NA
ATV07355.1|158006_159293_-	adhesin	NA	NA	NA	NA	NA
ATV07356.1|159318_159915_-	fimbrial protein StaF	NA	NA	NA	NA	NA
ATV07357.1|159941_160550_-	fimbrial protein StaE	NA	NA	NA	NA	NA
ATV07358.1|160561_161128_-	Na+/H+ antiporter subunit E	NA	NA	NA	NA	NA
ATV07359.1|161144_163733_-	outer membrane usher protein	NA	NA	NA	NA	NA
ATV07360.1|163767_164508_-	fimbrial chaperone	NA	NA	NA	NA	NA
ATV07361.1|164616_165207_-	fimbrial protein	NA	NA	NA	NA	NA
ATV07362.1|165568_166048_-	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
ATV07363.1|166044_167463_-	polynucleotide adenylyltransferase PcnB	NA	H7BUW3	unidentified_phage	37.9	3.2e-26
ATV07364.1|167501_168428_-|tRNA	glutamyl-Q tRNA(Asp) synthetase	tRNA	NA	NA	NA	NA
ATV07365.1|168464_168920_-	RNA polymerase-binding transcription factor DksA	NA	NA	NA	NA	NA
ATV07366.1|169097_169802_-	DNA/RNA nuclease SfsA	NA	NA	NA	NA	NA
ATV07367.1|169816_170347_-	RNA 2',3'-cyclic phosphodiesterase	NA	NA	NA	NA	NA
ATV07368.1|170420_172850_+	ATP-dependent helicase HrpB	NA	A0A0G2Y9F4	Acanthamoeba_polyphaga_mimivirus	28.8	2.1e-41
ATV07369.1|172943_175478_+	penicillin-binding protein 1B	NA	NA	NA	NA	NA
ATV07370.1|175697_177941_+	ferrichrome porin FhuA	NA	NA	NA	NA	NA
ATV07371.1|177991_178789_+	iron(3+)-hydroxamate import ATP-binding protein FhuC	NA	G9BWD6	Planktothrix_phage	26.9	6.0e-14
ATV07372.1|178788_179679_+	iron-hydroxamate transporter substrate-binding subunit	NA	NA	NA	NA	NA
ATV07373.1|179675_181658_+	Fe(3+)-hydroxamate ABC transporter permease FhuB	NA	NA	NA	NA	NA
ATV07374.1|181692_182973_-	glutamate-1-semialdehyde 2,1-aminomutase	NA	NA	NA	NA	NA
ATV07375.1|183197_184619_+	ClC family H(+)/Cl(-) exchange transporter	NA	NA	NA	NA	NA
ATV07376.1|184700_185045_+	iron-sulfur cluster insertion protein ErpA	NA	A0A2H4N7M3	Lake_Baikal_phage	51.4	4.5e-27
ATV07377.1|185091_185715_-	hypothetical protein	NA	NA	NA	NA	NA
ATV07378.1|185752_186553_-	vitamin B12 ABC transporter substrate-binding protein BtuF	NA	NA	NA	NA	NA
ATV07379.1|186545_187244_-	5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase	NA	NA	NA	NA	NA
ATV07380.1|187327_188845_+	deoxyguanosinetriphosphate triphosphohydrolase	NA	NA	NA	NA	NA
ATV07381.1|188974_190399_+|protease	serine endoprotease DegQ	protease	A0A1B1IT49	uncultured_Mediterranean_phage	28.8	2.5e-26
>prophage 2
CP024650	Escherichia coli strain BH100 substr. MG2014 chromosome, complete genome	5072943	256757	307032	5072943	plate,transposase	Streptococcus_phage(22.22%)	45	NA	NA
ATV07438.1|256757_258104_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
ATV07439.1|258106_258631_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
ATV12018.1|258627_259908_-	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
ATV07440.1|259924_260974_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
ATV07441.1|260937_262797_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
ATV07442.1|262784_263210_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
ATV07443.1|263214_264699_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
ATV07444.1|264721_265225_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
ATV07445.1|265930_266449_+	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
ATV07446.1|266669_268652_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.3	1.6e-23
ATV07447.1|268758_269805_+	DUF2169 domain-containing protein	NA	NA	NA	NA	NA
ATV07448.1|269797_271237_+	DUF4150 domain-containing protein	NA	NA	NA	NA	NA
ATV07449.1|271211_271502_+	hypothetical protein	NA	NA	NA	NA	NA
ATV07450.1|272752_273256_+	hypothetical protein	NA	NA	NA	NA	NA
ATV07451.1|273325_273838_+	integrating conjugative element protein	NA	NA	NA	NA	NA
ATV07452.1|274108_274879_-	amidohydrolase	NA	NA	NA	NA	NA
ATV07453.1|275032_275506_+	C-lysozyme inhibitor	NA	NA	NA	NA	NA
ATV07454.1|275548_277993_-	crotonobetainyl-CoA dehydrogenase	NA	NA	NA	NA	NA
ATV07455.1|278232_278811_+	phosphoheptose isomerase	NA	A0A067XQR2	Caulobacter_phage	32.0	1.1e-14
ATV07456.1|279015_279783_+	class II glutamine amidotransferase	NA	NA	NA	NA	NA
ATV07457.1|279753_280494_-	transpeptidase	NA	NA	NA	NA	NA
ATV07458.1|281514_283254_-	flagellar type III secretion system protein FlhA	NA	NA	NA	NA	NA
ATV12019.1|283213_283984_+	putative lateral flagellar export/assembly protein LafU	NA	NA	NA	NA	NA
ATV07459.1|284054_285110_+	DNA polymerase IV	NA	NA	NA	NA	NA
ATV07460.1|285161_285455_+	antitoxin YafN	NA	NA	NA	NA	NA
ATV07461.1|285457_285856_+	type II toxin-antitoxin system YafO family toxin	NA	NA	NA	NA	NA
ATV07462.1|285865_286318_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
ATV07463.1|286495_287647_+	RNA ligase RtcB family protein	NA	A0A222ZMP7	Mycobacterium_phage	31.8	7.8e-31
ATV07464.1|287643_288258_+	peptide chain release factor H	NA	NA	NA	NA	NA
ATV07465.1|288314_289772_-	cytosol nonspecific dipeptidase	NA	NA	NA	NA	NA
ATV07466.1|290032_290491_+	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
ATV07467.1|290582_291827_+	esterase	NA	NA	NA	NA	NA
ATV07468.1|291884_292286_+	sigma factor-binding protein Crl	NA	NA	NA	NA	NA
ATV07469.1|292324_293380_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.6	1.0e-117
ATV07470.1|293668_294772_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
ATV07471.1|294783_296037_+	gamma-glutamyl-phosphate reductase	NA	A0A1X9I5D4	Streptococcus_phage	47.5	5.8e-96
ATV07472.1|296537_297134_+	hypothetical protein	NA	A0A1B0VBK8	Salmonella_phage	88.4	1.7e-98
ATV12020.2|297220_298858_-	hypothetical protein	NA	NA	NA	NA	NA
ATV07473.1|299549_299777_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
ATV07474.1|299882_300110_+	DUF3987 domain-containing protein	NA	NA	NA	NA	NA
ATV07475.1|300358_301792_+	DUF3987 domain-containing protein	NA	NA	NA	NA	NA
ATV07476.1|302761_303325_+	inovirus Gp2 family protein	NA	NA	NA	NA	NA
AUM61469.1|303532_305064_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	35.0	2.8e-44
ATV12021.1|305858_305996_+	chemotaxis protein	NA	NA	NA	NA	NA
AUM61470.1|306009_307032_+|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	99.4	6.0e-200
>prophage 3
CP024650	Escherichia coli strain BH100 substr. MG2014 chromosome, complete genome	5072943	922245	929968	5072943		uncultured_Caudovirales_phage(50.0%)	10	NA	NA
ATV08051.1|922245_924192_+	macrolide ABC transporter permease/ATP-binding protein MacB	NA	G9BWD6	Planktothrix_phage	40.1	1.1e-37
ATV08052.1|924264_924489_-	cold-shock protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	2.3e-16
ATV08053.1|924893_926132_+	DUF4102 domain-containing protein	NA	A0A2H4JB45	uncultured_Caudovirales_phage	52.2	2.0e-125
ATV08054.1|926541_926751_+	AlpA family phage regulatory protein	NA	A0A2H4JB58	uncultured_Caudovirales_phage	67.9	2.2e-16
ATV08055.1|926889_927069_-	hypothetical protein	NA	A0A2H4JB52	uncultured_Caudovirales_phage	58.6	1.2e-10
ATV08056.1|927202_927400_+	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
ATV08057.1|927392_927704_+	hypothetical protein	NA	NA	NA	NA	NA
ATV08058.1|927696_927924_+	hypothetical protein	NA	NA	NA	NA	NA
ATV08059.1|927929_928217_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
ATV08060.1|928213_929968_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	40.8	2.2e-93
>prophage 4
CP024650	Escherichia coli strain BH100 substr. MG2014 chromosome, complete genome	5072943	1183894	1249490	5072943	terminase,capsid,integrase,tRNA,portal,lysis,head,tail	Enterobacteria_phage(53.57%)	92	1176529:1176544	1236174:1236189
1176529:1176544	attL	TAGCTTTGGAAAACAG	NA	NA	NA	NA
ATV08300.1|1183894_1185001_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
ATV08301.1|1185054_1185516_-	NUDIX hydrolase	NA	NA	NA	NA	NA
ATV08302.1|1185525_1186179_-	23S rRNA pseudouridine synthase E	NA	NA	NA	NA	NA
ATV08303.1|1186350_1187601_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	3.8e-23
ATV08304.1|1187714_1188857_-|integrase	integrase	integrase	Q77Z02	Phage_21	99.4	3.1e-205
ATV08305.1|1188846_1189083_-	excisionase	NA	NA	NA	NA	NA
ATV08306.1|1189222_1189462_-	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	94.9	3.9e-38
ATV08307.1|1189509_1189728_-	conjugal transfer protein TraR	NA	M1FQT7	Enterobacteria_phage	95.8	1.8e-34
ATV08308.1|1189826_1190108_-	hypothetical protein	NA	A0A0P0ZE02	Stx2-converting_phage	97.8	1.2e-46
ATV08309.1|1190118_1190310_-	hypothetical protein	NA	A0A0P0ZC67	Stx2-converting_phage	98.4	2.1e-26
ATV08310.1|1190282_1190465_-	DUF1317 domain-containing protein	NA	A0A0N7CHV0	Escherichia_phage	98.3	1.3e-28
ATV08311.1|1190461_1191142_-	exonuclease	NA	B6DZ61	Enterobacteria_phage	98.2	5.1e-131
ATV08312.1|1191138_1191924_-	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
ATV08313.1|1191929_1192226_-	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	99.0	3.6e-49
ATV08314.1|1192300_1192507_-	cell division inhibitor protein	NA	K7P6H3	Enterobacteria_phage	85.3	3.2e-28
ATV08315.1|1192982_1193360_-	hypothetical protein	NA	Q6SE87	Lactobacillus_prophage	49.2	1.3e-30
ATV08316.1|1193337_1194399_-	N-acetyltransferase	NA	Q6SE88	Lactobacillus_prophage	42.0	2.9e-64
ATV12054.1|1194479_1195172_-	transcriptional repressor LexA	NA	Q76H56	Enterobacteria_phage	86.1	1.5e-109
ATV08317.1|1195282_1195510_+	transcriptional regulator	NA	Q76H55	Enterobacteria_phage	69.0	3.8e-22
ATV08318.1|1195540_1196080_+	regulator	NA	M9NZI6	Enterobacteria_phage	66.7	8.9e-62
ATV08319.1|1196076_1197096_+	Replication protein O	NA	A0A0M5M7Y1	Salmonella_phage	64.7	6.1e-112
ATV08320.1|1197092_1197806_+	phage replication protein	NA	G8C7U6	Escherichia_phage	83.4	9.8e-109
ATV08321.1|1197884_1198313_-	hypothetical protein	NA	NA	NA	NA	NA
ATV08322.1|1198309_1198687_-	hypothetical protein	NA	NA	NA	NA	NA
ATV08323.1|1198954_1199410_+	hypothetical protein	NA	I6PD71	Cronobacter_phage	66.2	7.0e-60
ATV08324.1|1199409_1199580_+	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	67.9	2.0e-12
ATV08325.1|1199572_1199863_+	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	92.7	9.6e-47
ATV08326.1|1199859_1200222_+	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	96.5	4.3e-60
ATV08327.1|1200218_1200359_+	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	69.8	1.1e-08
ATV08328.1|1200444_1200828_+	antitermination protein	NA	A0A088CD47	Shigella_phage	83.3	1.5e-55
ATV08329.1|1201016_1202099_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	80.1	1.6e-166
ATV08330.1|1202687_1202903_+|lysis	lysis protein S	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
ATV08331.1|1202902_1203400_+	lysozyme	NA	M1FJA0	Enterobacteria_phage	96.4	2.1e-89
ATV08332.1|1203396_1203858_+|lysis	lysis protein	lysis	A0A0K2FJD0	Enterobacteria_phage	98.7	1.2e-75
ATV08333.1|1203889_1204183_-	lipoprotein bor	NA	K7PL54	Enterobacteria_phage	92.8	7.0e-45
ATV08334.1|1204609_1204990_+	hypothetical protein	NA	H6WZK5	Escherichia_phage	72.2	2.6e-39
ATV08335.1|1205112_1205466_-	hypothetical protein	NA	NA	NA	NA	NA
ATV12055.1|1205353_1205674_-	hypothetical protein	NA	NA	NA	NA	NA
ATV08337.1|1205942_1206491_+|terminase	phage terminase small subunit	terminase	A0A0U2S671	Escherichia_phage	84.2	1.0e-57
ATV08338.1|1206462_1208391_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	66.7	3.3e-260
ATV08339.1|1208374_1208581_+|head	phage head-stabilizing protein	head	K7PM10	Enterobacteria_phage	55.4	3.0e-10
ATV08340.1|1208577_1210170_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	61.1	6.5e-185
ATV08341.1|1210159_1211665_+	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	53.2	1.3e-99
ATV08342.1|1211701_1212049_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	58.1	2.6e-22
ATV08343.1|1212106_1213135_+|capsid	minor capsid protein E	capsid	C6ZCY2	Enterobacteria_phage	61.6	2.7e-115
ATV08344.1|1213138_1213561_+	hypothetical protein	NA	NA	NA	NA	NA
ATV08345.1|1213553_1213907_+|tail	phage tail protein	tail	A0A0K2FJB7	Enterobacteria_phage	65.0	3.4e-38
ATV08346.1|1213918_1214497_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	92.2	1.7e-79
ATV08347.1|1214493_1214889_+|tail	phage tail protein	tail	A0A2R9YJI2	Escherichia_phage	98.5	5.0e-70
ATV12056.1|1214896_1215637_+|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	98.0	6.1e-130
ATV08348.1|1215652_1216075_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	95.7	2.4e-70
ATV08349.1|1216056_1216491_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	97.5	6.5e-63
ATV08350.1|1216483_1219045_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	90.0	0.0e+00
ATV08351.1|1219041_1219371_+|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	98.2	2.8e-58
ATV08352.1|1219370_1220069_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	98.7	6.2e-132
ATV08353.1|1220073_1220817_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.2	7.7e-149
ATV08354.1|1220714_1221386_+|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	100.0	8.1e-105
ATV08355.1|1221446_1224845_+	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	90.8	0.0e+00
ATV08356.1|1224911_1225511_+	Ail/Lom family protein	NA	A0A0P0ZCF6	Stx2-converting_phage	99.5	2.3e-111
ATV08357.1|1225575_1228416_+	hypothetical protein	NA	A0A0K2FIZ6	Escherichia_phage	92.3	2.5e-54
ATV08358.1|1228415_1228997_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	93.8	1.6e-101
ATV08359.1|1229777_1230635_-	metal ABC transporter permease	NA	NA	NA	NA	NA
ATV08360.1|1230631_1231489_-	metal ABC transporter permease	NA	NA	NA	NA	NA
ATV08361.1|1231485_1232313_-	manganese/iron transporter ATP-binding protein	NA	M1HV27	Acanthocystis_turfacea_Chlorella_virus	28.0	1.5e-07
ATV08362.1|1232312_1233227_-	metal ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
ATV08363.1|1234154_1234307_+	isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	1.6e-21
ATV08364.1|1234568_1234973_-	DUF1398 domain-containing protein	NA	NA	NA	NA	NA
ATV08365.1|1235193_1235925_-	helix-turn-helix-type transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	51.0	1.6e-53
ATV08366.1|1236129_1237341_-	diguanylate phosphodiesterase	NA	NA	NA	NA	NA
1236174:1236189	attR	TAGCTTTGGAAAACAG	NA	NA	NA	NA
ATV08367.1|1237654_1237891_+	two-component-system connector protein YcgZ	NA	NA	NA	NA	NA
ATV08368.1|1237933_1238206_+	two-component-system connector protein YmgA	NA	NA	NA	NA	NA
ATV08369.1|1238234_1238501_+	regulatory protein AriR	NA	NA	NA	NA	NA
ATV08370.1|1238613_1238862_+	hypothetical protein	NA	NA	NA	NA	NA
ATV08371.1|1240184_1240403_+	hypothetical protein	NA	NA	NA	NA	NA
ATV08372.1|1240800_1240980_+	ATPase	NA	NA	NA	NA	NA
AUD55437.1|1241269_1241647_+	porin	NA	NA	NA	NA	NA
ATV08373.1|1241663_1242320_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	A0A2L1IV18	Escherichia_phage	29.1	3.0e-35
ATV08374.1|1242377_1242707_-	hypothetical protein	NA	NA	NA	NA	NA
ATV08375.1|1242716_1243061_-	glycine zipper family protein	NA	NA	NA	NA	NA
ATV08376.1|1243062_1243236_-	hypothetical protein	NA	NA	NA	NA	NA
ATV08377.1|1243336_1243522_+	hypothetical protein	NA	NA	NA	NA	NA
ATV08378.1|1244025_1244211_+	hypothetical protein	NA	NA	NA	NA	NA
ATV08379.1|1244352_1244619_-	cell division topological specificity factor	NA	NA	NA	NA	NA
ATV08380.1|1244622_1245435_-	septum site-determining protein MinD	NA	NA	NA	NA	NA
ATV08381.1|1245458_1246154_-	septum site-determining protein MinC	NA	NA	NA	NA	NA
ATV08382.1|1246293_1246521_+	hypothetical protein	NA	NA	NA	NA	NA
ATV08383.1|1246673_1247042_+	hypothetical protein	NA	NA	NA	NA	NA
ATV08384.1|1247144_1247546_-	inhibitor of g-type lysozyme	NA	NA	NA	NA	NA
ATV08385.1|1247787_1248081_+	hypothetical protein	NA	NA	NA	NA	NA
ATV08386.1|1248152_1248812_+	isomerase/hydrolase	NA	NA	NA	NA	NA
ATV08387.1|1248888_1249350_+	YcgN family cysteine cluster protein	NA	NA	NA	NA	NA
AUM61477.1|1249346_1249490_+|tRNA	arginine--tRNA ligase	tRNA	NA	NA	NA	NA
>prophage 5
CP024650	Escherichia coli strain BH100 substr. MG2014 chromosome, complete genome	5072943	2698142	2774295	5072943	terminase,holin,tRNA,head,tail,transposase	Salmonella_phage(47.27%)	84	NA	NA
ATV09695.1|2698142_2698883_-|tRNA	tRNA (cytidine/uridine-2'-O-)-methyltransferase TrmJ	tRNA	NA	NA	NA	NA
ATV09696.1|2699001_2699805_+	inositol monophosphatase	NA	NA	NA	NA	NA
ATV09697.1|2699949_2700804_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
ATV09698.1|2700994_2702275_+	PRD domain-containing protein	NA	NA	NA	NA	NA
ATV09699.1|2702266_2703406_-	3-phenylpropionate MFS transporter	NA	NA	NA	NA	NA
ATV09700.1|2703774_2704197_+	hypothetical protein	NA	NA	NA	NA	NA
AUM61484.1|2704271_2705619_+|transposase	IS3-like element IS1397 family transposase	transposase	A0A1B1P773	Bacillus_phage	52.4	1.3e-74
ATV09703.1|2705792_2706665_-	aldose 1-epimerase	NA	NA	NA	NA	NA
ATV12110.1|2706676_2707738_-	alcohol dehydrogenase	NA	NA	NA	NA	NA
ATV09704.1|2707803_2708802_-	ABC transporter permease	NA	NA	NA	NA	NA
ATV09705.1|2708826_2710338_-	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.3	3.3e-13
ATV09706.1|2710360_2711344_-	sugar ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
ATV09707.1|2711440_2714722_-	DUF5107 domain-containing protein	NA	NA	NA	NA	NA
ATV09708.1|2714839_2716033_+	ROK family protein	NA	NA	NA	NA	NA
ATV09709.1|2716096_2717350_-	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	52.7	7.8e-101
ATV09710.1|2717678_2718869_+	NO-inducible flavohemoprotein	NA	NA	NA	NA	NA
ATV09711.1|2718913_2719252_-	nitrogen regulatory protein P-II 1	NA	NA	NA	NA	NA
ATV09712.1|2719312_2720647_-	two-component system response regulator GlrR	NA	W8CYM9	Bacillus_phage	37.3	3.9e-10
ATV09713.1|2720636_2721350_-	two-component system QseEF-associated lipoprotein QseG	NA	NA	NA	NA	NA
ATV09714.1|2721514_2722942_-	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	24.9	3.0e-16
ATV09715.1|2723517_2727405_-	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	59.4	2.2e-130
ATV09716.1|2727419_2727569_-	phosphoribosylglycinamide synthetase	NA	NA	NA	NA	NA
ATV09717.1|2727662_2729219_+	lytic transglycosylase F	NA	NA	NA	NA	NA
ATV09718.1|2729215_2729752_-|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	NA	NA	NA	NA
ATV09719.1|2729776_2730412_-	phosphatidylglycerophosphatase C	NA	NA	NA	NA	NA
ATV09720.1|2730620_2731469_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
ATV09721.1|2731781_2732048_+	hypothetical protein	NA	A0A0M3ULK3	Salmonella_phage	80.7	1.7e-34
ATV09722.1|2732106_2732754_+	hypothetical protein	NA	NA	NA	NA	NA
ATV09723.1|2732834_2733389_-	recombinase family protein	NA	A0A1S6L009	Salmonella_phage	87.3	3.7e-87
ATV09724.1|2733418_2733913_+|tail	phage tail protein	tail	K7PH60	Enterobacterial_phage	92.8	1.1e-79
ATV09725.1|2733912_2734506_+|tail	phage tail protein	tail	Q9MCR5	Enterobacteria_phage	64.9	4.5e-59
ATV09726.1|2734477_2734918_-|tail	tail assembly chaperone	tail	A0A0F7LDZ0	Escherichia_phage	69.7	5.6e-54
ATV09727.1|2734944_2735634_-	hypothetical protein	NA	A0A0M3ULD8	Salmonella_phage	70.0	3.7e-28
ATV09728.1|2735633_2736314_-	DUF2612 domain-containing protein	NA	A0A0M5M1K4	Salmonella_phage	78.8	3.4e-103
ATV09729.1|2736310_2737510_-	hypothetical protein	NA	A0A0M4RD32	Salmonella_phage	83.9	1.7e-185
ATV09730.1|2737509_2737863_-	hypothetical protein	NA	A0A0M4R339	Salmonella_phage	88.9	1.5e-54
ATV09731.1|2737862_2738615_-	translation initiation factor IF-2	NA	A0A0M5M1K7	Salmonella_phage	65.9	2.5e-86
ATV09732.1|2738674_2739070_-	hypothetical protein	NA	NA	NA	NA	NA
ATV09733.1|2739056_2739830_-	hypothetical protein	NA	NA	NA	NA	NA
ATV09734.1|2739925_2740258_-	hypothetical protein	NA	A0A0M4RTY3	Salmonella_phage	70.5	1.1e-22
ATV09735.1|2740257_2741322_-	hypothetical protein	NA	A0A0M4QX01	Salmonella_phage	81.1	3.2e-156
ATV09736.1|2741324_2741627_-	hypothetical protein	NA	A0A0M4R5B7	Salmonella_phage	91.0	6.3e-49
ATV09737.1|2741626_2742214_-	hypothetical protein	NA	A0A0M3ULD5	Salmonella_phage	88.0	3.4e-83
ATV09738.1|2742213_2744199_-	lytic transglycosylase catalytic	NA	A0A0M4REK7	Salmonella_phage	53.3	3.8e-174
ATV09739.1|2744188_2744365_-	NTP pyrophosphohydrolase	NA	A0A2H4J1A2	uncultured_Caudovirales_phage	70.0	1.6e-12
ATV09740.1|2744376_2744829_-	hypothetical protein	NA	A0A0M4S6U8	Salmonella_phage	72.7	6.1e-56
ATV09741.1|2744832_2745273_-	DUF3277 domain-containing protein	NA	A0A2H4J619	uncultured_Caudovirales_phage	75.3	7.0e-57
ATV09742.1|2745283_2746429_-	DUF3383 domain-containing protein	NA	A0A2H4J8G4	uncultured_Caudovirales_phage	73.2	5.2e-160
ATV09743.1|2746432_2746996_-	hypothetical protein	NA	A0A0M4R331	Salmonella_phage	75.7	1.3e-79
ATV09744.1|2746970_2747360_-|head,tail	head-tail adaptor	head,tail	A0A0M3ULK0	Salmonella_phage	95.3	5.6e-66
ATV09745.1|2747346_2747901_-	hypothetical protein	NA	A0A0M4S631	Salmonella_phage	83.2	1.7e-79
ATV09746.1|2747897_2748305_-	DUF4054 domain-containing protein	NA	A0A0M5M3S2	Salmonella_phage	94.8	4.3e-69
ATV09747.1|2748270_2748492_-	hypothetical protein	NA	A0A0M4RTX5	Salmonella_phage	68.6	7.7e-12
ATV09748.1|2748533_2749475_-	DUF2184 domain-containing protein	NA	A0A0M3ULD3	Salmonella_phage	86.3	3.2e-155
ATV09749.1|2749486_2749993_-	hypothetical protein	NA	A0A0M4QWZ6	Salmonella_phage	79.3	1.1e-69
ATV09750.1|2749996_2751217_-	DUF2213 domain-containing protein	NA	A0A0M4R5A6	Salmonella_phage	88.0	3.2e-200
ATV09751.1|2751231_2751669_-|head	phage head morphogenesis protein	head	A0A0M4REK0	Salmonella_phage	89.7	5.0e-71
ATV09752.1|2751855_2753322_-	DUF1073 domain-containing protein	NA	A0A0M4S6U1	Salmonella_phage	91.8	6.7e-261
ATV09753.1|2753321_2754944_-	TerL protein	NA	A0A0M5M1R6	Salmonella_phage	95.4	0.0e+00
ATV09754.1|2754946_2755519_-|terminase	terminase small subunit	terminase	A0A2H4J480	uncultured_Caudovirales_phage	69.6	6.1e-61
ATV09755.1|2755580_2756105_-	hypothetical protein	NA	K7P6W1	Enterobacteria_phage	66.9	4.5e-42
ATV09756.1|2756088_2756565_-	lysozyme	NA	Q8SBE0	Shigella_phage	96.2	2.1e-86
ATV09757.1|2756568_2756910_-|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	91.9	2.8e-53
ATV09758.1|2757355_2757697_-	hypothetical protein	NA	NA	NA	NA	NA
ATV09759.1|2757728_2758151_-	antitermination protein	NA	Q8W638	Enterobacteria_phage	63.3	8.8e-41
ATV09760.1|2758432_2760625_-	replication protein	NA	B6SCY1	Bacteriophage	71.3	1.2e-173
ATV09761.1|2760628_2760841_-	XRE family transcriptional regulator	NA	A0A0R6PHL1	Moraxella_phage	42.9	7.9e-06
ATV09762.1|2760961_2761585_+	helix-turn-helix domain-containing protein	NA	A0A1I9KG86	Aeromonas_phage	44.8	3.3e-36
ATV09763.1|2762364_2763267_+	hypothetical protein	NA	Q3LZP9	Bacteriophage	54.4	6.1e-07
ATV09764.1|2763269_2764571_+	DUF2800 domain-containing protein	NA	B6SCX9	Bacteriophage	56.4	7.2e-134
ATV09765.1|2764586_2765135_+	DUF2815 domain-containing protein	NA	Q775A5	Bordetella_phage	65.9	1.6e-66
ATV12111.1|2765186_2765825_+	hypothetical protein	NA	H6WRY3	Salmonella_phage	68.8	3.9e-72
ATV09766.1|2765924_2766161_-	hypothetical protein	NA	NA	NA	NA	NA
ATV09767.1|2766217_2768281_+	DNA polymerase	NA	Q775A3	Bordetella_phage	67.8	8.7e-275
ATV09768.1|2768286_2768490_+	hypothetical protein	NA	K7PLX1	Enterobacteria_phage	55.4	3.2e-12
ATV09769.1|2768495_2768717_+	hypothetical protein	NA	NA	NA	NA	NA
ATV09770.1|2768706_2769189_+	malonyl-ACP O-methyltransferase BioC	NA	H9C170	Pectobacterium_phage	79.6	3.6e-70
ATV09771.1|2769188_2769482_+	VRR-NUC domain-containing protein	NA	B6SD64	Bacteriophage	68.2	5.0e-27
ATV09772.1|2769451_2770483_+	DNA cytosine methyltransferase	NA	Q858D4	Salmonella_phage	53.0	1.1e-100
ATV09773.1|2770479_2770800_-	hypothetical protein	NA	NA	NA	NA	NA
ATV09774.1|2770834_2772229_+	ATP-dependent helicase	NA	Q3LZN8	Bacteriophage	74.7	7.3e-217
ATV09775.1|2772225_2772426_+	DNA-binding protein	NA	NA	NA	NA	NA
ATV09776.1|2772422_2773820_-	recombinase	NA	NA	NA	NA	NA
ATV09777.1|2774034_2774295_+	ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	54.7	1.7e-18
>prophage 6
CP024650	Escherichia coli strain BH100 substr. MG2014 chromosome, complete genome	5072943	4077774	4089335	5072943		Enterobacteria_phage(88.89%)	13	NA	NA
ATV11023.1|4077774_4078962_+	DUF4102 domain-containing protein	NA	Q7M297	Enterobacteria_phage	91.2	1.5e-207
ATV12162.1|4079008_4079536_-	hypothetical protein	NA	NA	NA	NA	NA
ATV12163.1|4079542_4080628_-	hypothetical protein	NA	NA	NA	NA	NA
ATV11024.1|4080924_4081497_-	Polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	96.8	5.0e-95
ATV11025.1|4081570_4082071_-	transactivation protein	NA	NA	NA	NA	NA
ATV11026.1|4082067_4082802_-	glycoprotein 3	NA	Q7M2A2	Enterobacteria_phage	96.3	1.1e-126
ATV11027.1|4083354_4083621_+	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	100.0	4.9e-45
ATV11028.1|4083617_4084208_+	Ash-like/host cell division inhibitor Icd-like protein	NA	Q7M2A7	Enterobacteria_phage	89.6	2.0e-59
ATV11029.1|4084200_4084488_+	Derepression protein	NA	Q7M2A0	Enterobacteria_phage	97.9	8.6e-48
ATV11030.1|4084480_4084936_+	hypothetical protein	NA	Q7M298	Enterobacteria_phage	99.1	1.6e-64
ATV11031.1|4085071_4085392_+	hypothetical protein	NA	NA	NA	NA	NA
ATV11032.1|4085406_4087740_+	50S ribosomal protein L37ae	NA	Q7M2A8	Enterobacteria_phage	99.0	0.0e+00
ATV11033.1|4088297_4089335_+	hydroxyacid dehydrogenase	NA	Q9JMN3	Wolbachia_phage	43.6	7.4e-73
>prophage 7
CP024650	Escherichia coli strain BH100 substr. MG2014 chromosome, complete genome	5072943	4995318	5036262	5072943	terminase,holin,integrase,portal,lysis,tail	Enterobacteria_phage(48.94%)	53	4995069:4995088	5040214:5040233
4995069:4995088	attL	TTTGCCATTATTTCTCACCC	NA	NA	NA	NA
ATV11922.1|4995318_4996533_+|integrase	site-specific integrase	integrase	A0A291AWU1	Escherichia_phage	99.3	1.6e-236
ATV11923.1|4996908_4997904_-	hypothetical protein	NA	NA	NA	NA	NA
ATV11924.1|4998277_4998472_-	DNA-binding protein	NA	A5LH59	Enterobacteria_phage	93.8	2.5e-30
ATV11925.1|4998471_4999092_-	DUF551 domain-containing protein	NA	A5LH60	Enterobacteria_phage	95.6	1.2e-118
ATV11926.1|4999091_4999454_-	hypothetical protein	NA	U5P092	Shigella_phage	95.8	1.3e-64
ATV11927.1|4999444_4999981_-	HD family hydrolase	NA	S5MW55	Escherichia_phage	100.0	7.4e-101
ATV11928.1|5000108_5000933_-	DUF2303 domain-containing protein	NA	U5P439	Shigella_phage	99.3	6.6e-149
ATV11929.1|5000998_5001361_-	hypothetical protein	NA	Q8SBF8	Shigella_phage	100.0	8.6e-61
ATV11930.1|5001433_5001658_+	hypothetical protein	NA	A0A291AWX8	Escherichia_phage	66.2	4.9e-14
ATV11931.1|5001566_5001857_+	hypothetical protein	NA	U5P0J5	Shigella_phage	96.2	1.2e-41
ATV11932.1|5001829_5002342_+	hypothetical protein	NA	NA	NA	NA	NA
ATV11933.1|5002657_5003350_-	helix-turn-helix transcriptional regulator	NA	S5FUZ3	Shigella_phage	99.1	7.3e-125
ATV11934.1|5003323_5003476_+	amino acid permease	NA	NA	NA	NA	NA
ATV11935.1|5003447_5003708_+	XRE family transcriptional regulator	NA	S5FKP1	Shigella_phage	98.8	9.3e-41
ATV11936.1|5003700_5004252_+	hypothetical protein	NA	K7PGU3	Enterobacteria_phage	97.8	1.1e-99
ATV11937.1|5004248_5005085_+	ash family protein	NA	Q8SBF3	Shigella_phage	92.4	1.1e-138
ATV12209.1|5005089_5005314_+	hypothetical protein	NA	A0A291AX25	Escherichia_phage	97.3	9.1e-37
ATV11938.1|5005310_5006129_+	helix-turn-helix domain-containing protein	NA	A0A291AWW0	Escherichia_phage	99.6	4.7e-123
ATV11939.1|5006125_5006620_+	PerC family transcriptional regulator	NA	A0A291AWV6	Escherichia_phage	97.5	8.1e-86
ATV11940.1|5006619_5007273_+	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	99.5	1.9e-127
ATV11941.1|5007269_5007596_+	LexA family transcriptional regulator	NA	K7PLX6	Enterobacteria_phage	99.1	2.0e-53
ATV11942.1|5007592_5007982_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A0P0ZD39	Stx2-converting_phage	100.0	7.1e-69
ATV11943.1|5008001_5008844_+	DNA-binding protein	NA	S5MC03	Escherichia_phage	91.8	5.7e-140
ATV11944.1|5008851_5009841_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	99.1	8.1e-194
ATV11945.1|5009858_5010200_+	antitermination protein	NA	A0A0P0ZCW0	Stx2-converting_phage	90.3	4.2e-57
ATV11946.1|5010212_5010761_-	hypothetical protein	NA	NA	NA	NA	NA
ATV11947.1|5010747_5011674_-	hypothetical protein	NA	NA	NA	NA	NA
ATV11948.1|5011938_5012142_+	hypothetical protein	NA	A0A291AWX6	Escherichia_phage	98.5	3.0e-31
ATV11949.1|5012292_5013345_+	site-specific DNA-methyltransferase	NA	A5LH81	Enterobacteria_phage	98.9	2.6e-206
ATV12210.1|5013421_5013748_+|holin	phage holin, lambda family	holin	U5P0K7	Shigella_phage	98.1	2.6e-56
ATV11950.1|5013751_5014228_+	lysozyme	NA	K7PKV2	Enterobacteria_phage	95.6	2.5e-84
ATV11951.1|5014224_5014668_+|lysis	lysis protein	lysis	M1FJ79	Enterobacteria_phage	93.9	1.5e-70
ATV11952.1|5014706_5015081_+	hypothetical protein	NA	M1FPD9	Enterobacteria_phage	87.9	2.5e-55
ATV11953.1|5015179_5015362_-	hypothetical protein	NA	NA	NA	NA	NA
ATV11954.1|5015360_5015561_+	hypothetical protein	NA	K7PJR7	Enterobacteria_phage	93.9	2.3e-31
ATV11955.1|5015719_5016214_+	DUF1441 domain-containing protein	NA	A0A291AWV8	Escherichia_phage	99.4	3.8e-83
ATV11956.1|5016213_5018316_+|terminase	phage terminase large subunit family protein	terminase	K7PH40	Enterobacteria_phage	99.6	0.0e+00
ATV11957.1|5018312_5018525_+	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
ATV11958.1|5018524_5020033_+|portal	phage portal protein	portal	K7PJP3	Enterobacteria_phage	99.8	1.6e-289
ATV11959.1|5019977_5022005_+	peptidase S14	NA	A5LH30	Enterobacteria_phage	99.5	0.0e+00
ATV11960.1|5022046_5022415_+	DUF2190 domain-containing protein	NA	A0A291AWX2	Escherichia_phage	100.0	9.7e-52
ATV11961.1|5022407_5022683_+	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	100.0	2.3e-45
ATV11962.1|5022694_5023273_+|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	99.5	2.1e-101
ATV12212.1|5023269_5023671_+|tail	phage tail protein	tail	A5LH34	Enterobacteria_phage	98.5	1.6e-71
ATV11963.1|5023681_5024425_+|tail	phage tail protein	tail	A0A291AWU6	Escherichia_phage	98.0	1.6e-130
ATV12211.1|5024485_5024872_+|tail	phage minor tail protein G	tail	K7PLV8	Enterobacteria_phage	100.0	3.3e-66
ATV11964.1|5024880_5025210_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
ATV11965.1|5025181_5028247_+|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	98.8	0.0e+00
ATV11966.1|5028246_5028576_+|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	99.1	5.1e-60
ATV11967.1|5028585_5029284_+|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	97.0	8.9e-131
ATV11968.1|5029288_5030032_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.2	7.7e-149
ATV11969.1|5030660_5034143_+	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	90.1	0.0e+00
ATV11970.1|5034201_5036262_+|tail	phage tail protein	tail	A0A0E3M194	Enterobacteria_phage	54.9	5.7e-125
5040214:5040233	attR	TTTGCCATTATTTCTCACCC	NA	NA	NA	NA
>prophage 1
CP024652	Escherichia coli strain BH100 substr. MG2014 plasmid pBH100-1, complete sequence	107274	0	48415	107274	integrase,transposase	Escherichia_phage(29.41%)	55	3416:3430	38145:38159
ATV12228.1|1715_2576_+|transposase	transposase	transposase	NA	NA	NA	NA
ATV12229.1|2626_4171_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	34.6	1.0e-38
3416:3430	attL	GCGCGCCAGCTTCAG	NA	NA	NA	NA
ATV12230.1|4293_5817_+|transposase	IS21 family transposase IS1326	transposase	A0A2L1IVA1	Escherichia_phage	24.2	1.2e-15
ATV12340.1|5806_6589_+	ATP-binding protein	NA	A0A2L1IVB6	Escherichia_phage	35.0	2.5e-33
ATV12231.1|6764_7265_-	N-acetyltransferase	NA	NA	NA	NA	NA
ATV12232.1|7283_7463_+	hypothetical protein	NA	NA	NA	NA	NA
ATV12233.1|7392_8232_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
ATV12234.1|8225_8573_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
ATV12341.1|8736_9528_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA1	NA	NA	NA	NA	NA
ATV12235.1|9676_10690_+|integrase	integron integrase	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
ATV12236.1|10628_11243_+	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
ATV12237.1|11368_11929_+	DNA resolvase	NA	A0A1B0V7I5	Salmonella_phage	86.2	4.0e-49
ATV12238.1|11931_14898_+|transposase	Tn3 family transposase TnAs3	transposase	A0A1B0V7H9	Salmonella_phage	73.6	0.0e+00
ATV12239.1|14964_15342_+	N-acetyltransferase	NA	NA	NA	NA	NA
ATV12240.1|15542_16202_-	type A-1 chloramphenicol O-acetyltransferase	NA	G3CFL0	Escherichia_phage	100.0	8.4e-131
ATV12241.1|16255_16447_+	hypothetical protein	NA	NA	NA	NA	NA
ATV12342.1|18987_19269_+	hypothetical protein	NA	NA	NA	NA	NA
ATV12343.1|19391_19742_-	protein stbB	NA	NA	NA	NA	NA
ATV12243.1|19744_20707_-	plasmid segregation protein ParM	NA	A0A222YXF2	Escherichia_phage	53.9	4.1e-94
ATV12344.1|20853_21147_+	hypothetical protein	NA	NA	NA	NA	NA
ATV12244.1|21087_21267_-	hypothetical protein	NA	NA	NA	NA	NA
ATV12245.1|21223_21907_+	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	37.4	5.6e-29
ATV12246.1|21907_22129_+	hypothetical protein	NA	NA	NA	NA	NA
ATV12247.1|22142_22577_+	DUF1380 domain-containing protein	NA	NA	NA	NA	NA
ATV12248.1|23276_23849_+	DUF1472 domain-containing protein	NA	NA	NA	NA	NA
ATV12345.1|23944_24247_+	antirestriction protein	NA	NA	NA	NA	NA
ATV12249.1|24293_24716_+	DUF1380 domain-containing protein	NA	NA	NA	NA	NA
ATV12250.1|24712_24904_+	hypothetical protein	NA	NA	NA	NA	NA
ATV12251.1|25176_25425_-	hypothetical protein	NA	NA	NA	NA	NA
ATV12252.1|25939_26170_+	hypothetical protein	NA	NA	NA	NA	NA
ATV12253.1|26221_27583_+	DUF3560 domain-containing protein	NA	NA	NA	NA	NA
ATV12254.1|27629_28193_+	class I SAM-dependent methyltransferase	NA	A8HNV9	Thalassomonas_phage	37.3	4.7e-21
ATV12255.1|28192_28453_+	hypothetical protein	NA	NA	NA	NA	NA
ATV12346.1|28344_28572_+	transporter	NA	NA	NA	NA	NA
AUD55465.1|28754_28982_-	hypothetical protein	NA	NA	NA	NA	NA
ATV12256.1|29007_29574_+	single-stranded DNA-binding protein	NA	I3PGW4	Xanthomonas_phage	74.4	8.5e-47
ATV12257.1|29631_29865_+	DUF905 domain-containing protein	NA	NA	NA	NA	NA
ATV12258.1|29925_31347_+	chromosome partitioning protein ParB	NA	G8DH78	Emiliania_huxleyi_virus	29.2	1.2e-20
ATV12259.1|31416_32625_+|transposase	IS4 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	100.0	1.8e-235
ATV12260.1|32990_34196_-	sodium/glutamate symporter	NA	NA	NA	NA	NA
ATV12261.1|34639_34960_+	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
ATV12347.1|34993_35107_+	ABC transporter	NA	NA	NA	NA	NA
ATV12262.1|35145_36126_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	98.8	1.7e-183
ATV12263.1|36585_37137_-	carboxymuconolactone decarboxylase	NA	NA	NA	NA	NA
ATV12264.1|37133_38477_-	aspartate aminotransferase family protein	NA	NA	NA	NA	NA
38145:38159	attR	GCGCGCCAGCTTCAG	NA	NA	NA	NA
ATV12265.1|38609_39467_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
ATV12266.1|39796_40237_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
ATV12267.1|40867_41683_+	aminoglycoside O-phosphotransferase APH(3')-Ia	NA	A0A193DTG4	Autographa_californica_nuclear_polyhedrosis_virus	98.5	4.3e-161
ATV12348.1|41833_41974_+	ABC transporter	NA	NA	NA	NA	NA
ATV12268.1|43036_43405_+	amino acid-binding protein	NA	NA	NA	NA	NA
ATV12269.1|43412_44099_+	ArsR family transcriptional regulator	NA	NA	NA	NA	NA
ATV12270.1|44076_44703_-	transcriptional regulator	NA	NA	NA	NA	NA
ATV12271.1|44781_45987_+	tetracycline efflux MFS transporter Tet(B)	NA	NA	NA	NA	NA
ATV12272.1|46099_46768_-	putative tetracyline resistance transcriptional regulator TetC	NA	NA	NA	NA	NA
AUD55466.1|47206_48415_-|transposase	IS4 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	100.0	1.8e-235
