The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP027205	Escherichia coli strain WCHEC025943 chromosome, complete genome	4817293	1083970	1097153	4817293		Escherichia_phage(50.0%)	12	NA	NA
AVN00123.1|1083970_1084732_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	48.0	2.0e-59
AVN00124.1|1084725_1085352_+	protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	49.7	5.7e-36
AVN00125.1|1085491_1086631_+	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	35.6	1.7e-06
AVN00126.1|1086693_1087686_+	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	6.1e-32
AVN00127.1|1087779_1089144_-	GntP family transporter	NA	NA	NA	NA	NA
AVN00128.1|1089232_1090009_-	HPr family phosphocarrier protein	NA	NA	NA	NA	NA
AVN00129.1|1090013_1090652_-	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
AVN00130.1|1090648_1091911_-	3-oxo-tetronate kinase	NA	A0A077SLJ7	Escherichia_phage	61.4	1.3e-135
AVN00131.1|1091907_1092816_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
AVN00132.1|1093011_1093779_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.7	3.3e-70
AVN00133.1|1093829_1094486_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	46.3	8.0e-49
AVN00134.1|1094591_1097153_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	1.7e-30
>prophage 2
CP027205	Escherichia coli strain WCHEC025943 chromosome, complete genome	4817293	1458101	1503041	4817293	lysis,tail,head,portal,coat,protease,holin,terminase	Enterobacteria_phage(48.28%)	64	NA	NA
AVN00454.1|1458101_1459535_-	glycoside hydrolase family 32 protein	NA	F8WPR5	Bacillus_phage	25.4	7.0e-29
AVN00455.1|1459750_1460665_+	aminoimidazole riboside kinase	NA	NA	NA	NA	NA
AVN00456.1|1462513_1462714_-	excisionase	NA	K7P7V0	Enterobacteria_phage	98.5	2.7e-32
AVN00457.1|1463099_1463267_-	hypothetical protein	NA	A5VWB7	Enterobacteria_phage	98.2	2.9e-27
AVN00458.1|1463302_1463614_-	hypothetical protein	NA	A0A1I9LJL8	Stx_converting_phage	97.1	1.1e-53
AVN00459.1|1463788_1464406_-	DUF550 domain-containing protein	NA	S4TSR6	Salmonella_phage	56.2	9.2e-55
AVN00460.1|1464407_1464833_-	ead/Ea22-like family protein	NA	A0A077SLK5	Escherichia_phage	85.5	6.4e-31
AVN00461.1|1464819_1465053_-	hypothetical protein	NA	NA	NA	NA	NA
AVN00462.1|1465049_1465610_-	hypothetical protein	NA	Q76H44	Enterobacteria_phage	69.4	2.3e-60
AVN00463.1|1465606_1465771_-	DUF2737 family protein	NA	A0A2I6PID4	Escherichia_phage	96.3	2.3e-21
AVN00464.1|1465767_1466058_-	hypothetical protein	NA	K7P7M4	Enterobacteria_phage	100.0	3.7e-46
AVN00465.1|1466068_1466362_-	DUF2856 family protein	NA	G8C7L1	Escherichia_phage	99.0	2.5e-50
AVN00466.1|1466375_1466882_-	single-stranded DNA-binding protein	NA	K7PHK1	Enterobacteria_phage	98.8	6.8e-80
AVN00467.1|1466878_1467346_-	hypothetical protein	NA	A0A2I7QWC6	Vibrio_phage	62.0	1.2e-46
AVN00468.1|1467346_1468054_-	recombinase	NA	K7PKU3	Enterobacteria_phage	99.6	2.2e-137
AVN00469.1|1468554_1468866_-	superinfection exclusion protein	NA	A0A0N7BTN9	Escherichia_phage	98.1	4.6e-55
AVN00470.1|1469041_1469293_-	hypothetical protein	NA	A4KWV4	Enterobacteria_phage	100.0	5.6e-43
AVN00471.1|1469355_1469580_-	hypothetical protein	NA	K7PJZ1	Enterobacterial_phage	98.6	8.8e-32
AVN00472.1|1469583_1469847_-	hypothetical protein	NA	K7PKE4	Enterobacteria_phage	100.0	1.7e-29
AVN00473.1|1470214_1470583_-	hypothetical protein	NA	K7PJJ3	Enterobacteria_phage	100.0	1.3e-56
AVN00474.1|1470600_1471317_-	helix-turn-helix domain-containing protein	NA	K7PGR7	Enterobacteria_phage	100.0	9.2e-123
AVN00475.1|1471423_1471618_+	Cro/Cl family transcriptional regulator	NA	K7PLQ6	Enterobacteria_phage	100.0	1.8e-28
AVN03570.1|1471726_1472005_+	hypothetical protein	NA	K7P7A2	Enterobacteria_phage	97.8	8.1e-43
AVN00476.1|1472039_1472186_+	DUF2740 domain-containing protein	NA	Q687G5	Enterobacteria_phage	100.0	1.1e-19
AVN00477.1|1472178_1473039_+	replication protein	NA	K7PL20	Enterobacteria_phage	99.7	4.3e-159
AVN00478.1|1473146_1475027_+	bifunctional DNA primase/helicase	NA	K7PK08	Enterobacteria_phage	99.7	0.0e+00
AVN00479.1|1475086_1475545_+	recombination protein NinB	NA	A0A220NRM1	Escherichia_phage	100.0	7.3e-81
AVN00480.1|1475541_1476069_+	phage N-6-adenine-methyltransferase	NA	A0A1I9LJP9	Stx_converting_phage	100.0	9.5e-101
AVN00481.1|1476065_1476242_+	NinE family protein	NA	A5VW90	Enterobacteria_phage	100.0	4.6e-28
AVN00482.1|1476244_1476604_+	DUF2591 domain-containing protein	NA	K7PH48	Enterobacterial_phage	73.3	7.5e-41
AVN00483.1|1476596_1476773_+	protein ninF	NA	Q76H71	Enterobacteria_phage	98.3	1.5e-26
AVN00484.1|1476765_1477377_+	recombination protein NinG	NA	A0A2D1GLP2	Escherichia_phage	98.0	8.7e-98
AVN00485.1|1477373_1477580_+	protein ninH	NA	Q716C0	Shigella_phage	100.0	7.3e-33
AVN00486.1|1477557_1478229_+	serine/threonine protein phosphatase	NA	Q716B9	Shigella_phage	99.1	2.4e-133
AVN00487.1|1478219_1478738_+	DUF1133 family protein	NA	Q716B8	Shigella_phage	97.7	5.0e-94
AVN00488.1|1479334_1479658_+|holin	phage holin, lambda family	holin	G5DA93	Enterobacteria_phage	100.0	1.3e-52
AVN00489.1|1479641_1480118_+	lysozyme	NA	K7PKV2	Enterobacteria_phage	100.0	1.7e-88
AVN00490.1|1480114_1480552_+|lysis	lysis protein	lysis	Q716B4	Shigella_phage	97.2	2.5e-70
AVN00491.1|1480539_1480692_+	hypothetical protein	NA	C6ZR68	Salmonella_phage	100.0	1.2e-21
AVN00492.1|1480893_1481418_+	Rha family transcriptional regulator	NA	G8C7W4	Escherichia_phage	94.2	4.5e-87
AVN00493.1|1481718_1481961_+	DUF2560 family protein	NA	A5VW77	Enterobacteria_phage	98.8	1.4e-35
AVN03571.1|1481996_1482485_+	DNA-packaging protein	NA	A0A0M3ULC0	Salmonella_phage	100.0	5.0e-88
AVN00494.1|1482462_1483959_+|terminase	terminase	terminase	A0A2D1GLW6	Escherichia_phage	93.8	8.2e-283
AVN00495.1|1483958_1486160_+|portal	portal protein	portal	A0A088CQ69	Enterobacteria_phage	96.8	0.0e+00
AVN00496.1|1486250_1487144_+	scaffolding protein	NA	A0A088CPT0	Enterobacteria_phage	97.3	5.9e-127
AVN00497.1|1487162_1488416_+|coat	coat protein	coat	A0A088CQ56	Enterobacteria_phage	98.1	2.9e-233
AVN00498.1|1488457_1488646_+	hypothetical protein	NA	A0A088CPR7	Enterobacteria_phage	98.4	6.5e-28
AVN00499.1|1488626_1489088_+|head	head DNA stabilization protein	head	A5VW70	Enterobacteria_phage	100.0	7.1e-84
AVN00500.1|1489097_1490516_+	hypothetical protein	NA	A0A2D1GM00	Escherichia_phage	99.2	9.2e-276
AVN00501.1|1490518_1491013_+	HNH endonuclease	NA	A0A1U9HWQ1	Salmonella_phage	46.0	5.1e-32
AVN00502.1|1491012_1491714_+|tail	phage tail protein	tail	G5DA78	Enterobacteria_phage	98.3	2.5e-117
AVN00503.1|1491713_1492169_+	DUF2824 family protein	NA	A0A2D1GLX4	Escherichia_phage	99.3	8.8e-87
AVN00504.1|1492171_1492864_+	DNA transfer protein	NA	A5VW66	Enterobacteria_phage	97.8	4.4e-114
AVN00505.1|1492874_1494260_+	acyltransferase	NA	I6RSG0	Salmonella_phage	95.4	6.3e-245
AVN00506.1|1494259_1496077_+	DNA transfer protein	NA	A0A2H4FNB8	Salmonella_phage	97.5	3.2e-289
AVN00507.1|1496094_1496283_-	hypothetical protein	NA	NA	NA	NA	NA
AVN00508.1|1496313_1496679_+	hypothetical protein	NA	A0A192Y6W5	Salmonella_phage	100.0	2.1e-67
AVN00509.1|1496692_1496917_-	hypothetical protein	NA	NA	NA	NA	NA
AVN00510.1|1496942_1497128_+	hypothetical protein	NA	I6RSG3	Salmonella_phage	65.6	1.8e-06
AVN00511.1|1497205_1497742_-|protease	Clp protease	protease	NA	NA	NA	NA
AVN00512.1|1497741_1497978_-	Arc family DNA-binding protein	NA	G0ZNE9	Cronobacter_phage	61.0	4.5e-18
AVN00513.1|1498066_1498240_+	Arc family DNA-binding protein	NA	NA	NA	NA	NA
AVN00514.1|1498302_1499205_+	phage antirepressor Ant	NA	Q0H8C7	Salmonella_phage	97.3	4.3e-170
AVN00515.1|1501883_1503041_-	DUF4102 domain-containing protein	NA	A5VW56	Enterobacteria_phage	99.5	4.8e-222
>prophage 3
CP027205	Escherichia coli strain WCHEC025943 chromosome, complete genome	4817293	1750688	1760130	4817293		Enterobacteria_phage(85.71%)	10	NA	NA
AVN00736.1|1750688_1751615_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.8	1.7e-23
AVN00737.1|1751619_1752351_+	ABC transporter permease	NA	NA	NA	NA	NA
AVN00738.1|1752331_1752439_-	protein YohO	NA	NA	NA	NA	NA
AVN00739.1|1752498_1753230_-	transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
AVN00740.1|1753451_1755137_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
AVN00741.1|1755133_1755853_+	DNA-binding response regulator	NA	NA	NA	NA	NA
AVN00742.1|1755899_1756370_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
AVN00743.1|1756410_1756872_-	DUF1307 domain-containing protein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
AVN00744.1|1756996_1758997_-	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	96.3	0.0e+00
AVN00745.1|1758993_1760130_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.4	3.2e-162
>prophage 4
CP027205	Escherichia coli strain WCHEC025943 chromosome, complete genome	4817293	2314426	2328529	4817293		Escherichia_phage(22.22%)	17	NA	NA
AVN01257.1|2314426_2316853_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.0	7.7e-214
AVN01258.1|2317051_2317357_-	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
AVN01259.1|2317464_2318175_+	YnfC family lipoprotein	NA	NA	NA	NA	NA
AVN01260.1|2318177_2318738_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
AVN01261.1|2318772_2319114_-	DUF1283 family protein	NA	NA	NA	NA	NA
AVN01262.1|2319248_2319575_+	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
AVN01264.1|2319780_2320995_+	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
AVN01265.1|2321006_2322026_+	starvation-sensing protein RspB	NA	E3SJ82	Synechococcus_phage	26.2	4.3e-17
AVN01266.1|2322083_2322194_+	transporter	NA	NA	NA	NA	NA
AVN01267.1|2322213_2323509_-	DUF3596 domain-containing protein	NA	B6DZ48	Enterobacteria_phage	62.3	6.7e-156
AVN01268.1|2323528_2323780_-	DNA-binding protein	NA	S4TND0	Salmonella_phage	50.0	2.2e-15
AVN01269.1|2323852_2326324_-	exonuclease	NA	K7PLW7	Enterobacteria_phage	59.8	6.1e-57
AVN01270.1|2326417_2326609_-	DUF1482 family protein	NA	NA	NA	NA	NA
AVN01271.1|2326605_2326794_-	division inhibition protein DicB	NA	NA	NA	NA	NA
AVN01272.1|2326877_2327120_+	hypothetical protein	NA	NA	NA	NA	NA
AVN01273.1|2327046_2328066_+	hypothetical protein	NA	U5P0A0	Shigella_phage	63.9	1.0e-58
AVN01274.1|2328106_2328529_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	85.6	2.0e-61
>prophage 5
CP027205	Escherichia coli strain WCHEC025943 chromosome, complete genome	4817293	2739435	2750213	4817293	integrase	Enterobacteria_phage(40.0%)	11	2737408:2737431	2748916:2748939
2737408:2737431	attL	AACGGGCGTGTTATACGCCCGTTG	NA	NA	NA	NA
AVN01636.1|2739435_2741391_-	AAA family ATPase	NA	K4I1H4	Acidithiobacillus_phage	28.6	7.5e-26
AVN01637.1|2743755_2744295_-	regulator	NA	M9NZI6	Enterobacteria_phage	65.6	7.5e-61
AVN01638.1|2744477_2744789_+	recombinase	NA	A0A0N7KZJ3	Stx2-converting_phage	100.0	2.4e-43
AVN01639.1|2744785_2745466_+	exonuclease	NA	A0A0P0ZCD4	Stx2-converting_phage	98.7	5.1e-131
AVN03625.1|2745462_2745621_+	DUF1317 family protein	NA	M1FJ61	Enterobacteria_phage	88.5	6.4e-21
AVN01640.1|2745617_2746682_+	DGQHR domain-containing protein	NA	T1SBJ4	Salmonella_phage	64.8	1.7e-133
AVN01641.1|2746835_2747054_+	TraR/DksA family transcriptional regulator	NA	M1FQT7	Enterobacteria_phage	94.4	3.2e-34
AVN01642.1|2747101_2747341_+	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	94.9	3.9e-38
AVN01643.1|2747480_2747717_+	excisionase	NA	NA	NA	NA	NA
AVN01644.1|2747706_2748849_+|integrase	integrase	integrase	O21929	Phage_21	99.7	8.1e-206
AVN01645.1|2748962_2750213_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	3.8e-23
2748916:2748939	attR	CAACGGGCGTATAACACGCCCGTT	NA	NA	NA	NA
>prophage 6
CP027205	Escherichia coli strain WCHEC025943 chromosome, complete genome	4817293	2879020	2923673	4817293	transposase	Stx2-converting_phage(33.33%)	38	NA	NA
AVN01773.1|2879020_2879479_-|transposase	IS200/IS605 family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.5	5.5e-12
AVN01774.1|2880207_2881353_-	class C beta-lactamase CMY-2	NA	NA	NA	NA	NA
AVN01775.1|2881676_2882939_-|transposase	IS1380 family transposase ISEc9	transposase	A0A1B0VDR3	Salmonella_phage	100.0	1.3e-39
AVN01776.1|2883204_2884533_-|transposase	IS4-like element IS4 family transposase	transposase	NA	NA	NA	NA
AVN01777.1|2884764_2884944_-	hypothetical protein	NA	NA	NA	NA	NA
AVN01778.1|2884906_2885083_-	DUF3927 domain-containing protein	NA	NA	NA	NA	NA
AVN01779.1|2885326_2886109_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.2	1.7e-138
AVN01780.1|2887141_2887285_-	chemotaxis protein	NA	NA	NA	NA	NA
AVN01781.2|2887838_2889377_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	99.2	7.1e-298
AVN01782.2|2889426_2889774_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBY2	Stx2-converting_phage	99.1	1.1e-60
AVN03635.1|2889770_2890151_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	99.2	1.2e-65
AVN01783.1|2890605_2891619_-	DUF4432 domain-containing protein	NA	NA	NA	NA	NA
AVN01784.1|2891630_2892947_-	L-fucose:H+ symporter permease	NA	NA	NA	NA	NA
AVN01785.1|2892974_2893895_-	ribokinase	NA	NA	NA	NA	NA
AVN01786.1|2894200_2894983_+	DeoR family transcriptional regulator	NA	NA	NA	NA	NA
AVN01787.1|2894984_2895083_-	acetolactate synthase	NA	NA	NA	NA	NA
AVN03636.1|2895210_2895411_-	hypothetical protein	NA	NA	NA	NA	NA
AVN01788.1|2895695_2896924_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	96.0	2.7e-170
AVN01789.1|2897100_2897340_+	hypothetical protein	NA	NA	NA	NA	NA
AVN01790.1|2897526_2898162_+	galactonate dehydratase	NA	NA	NA	NA	NA
AVN01791.1|2898243_2898681_+	hypothetical protein	NA	NA	NA	NA	NA
AVN01792.1|2898743_2899568_-	DeoR family transcriptional regulator	NA	NA	NA	NA	NA
AVN01794.1|2899816_2900155_+	aldolase	NA	NA	NA	NA	NA
AVN01795.1|2900268_2901840_+	PTS maltose transporter subunit IICB	NA	NA	NA	NA	NA
AVN01796.1|2901851_2903027_+	putative C-S lyase	NA	NA	NA	NA	NA
AVN01797.1|2903040_2904930_+	enterotoxin	NA	NA	NA	NA	NA
AVN03637.1|2905098_2905305_-	methyltransferase	NA	NA	NA	NA	NA
AVN01798.1|2905409_2906846_-	hypothetical protein	NA	NA	NA	NA	NA
AVN03638.1|2906842_2911801_-	nuclease	NA	NA	NA	NA	NA
AVN01799.1|2912475_2913039_-	inovirus Gp2 family protein	NA	NA	NA	NA	NA
AVN01800.1|2913859_2915293_-	DUF3987 domain-containing protein	NA	NA	NA	NA	NA
AVN01801.1|2915511_2915709_-	DUF3987 domain-containing protein	NA	NA	NA	NA	NA
AVN01802.1|2915953_2916250_-	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
AVN01803.1|2917361_2919179_+	hypothetical protein	NA	NA	NA	NA	NA
AVN01804.1|2919365_2920568_-	DUF4102 domain-containing protein	NA	A0A1B0VMI6	Pseudomonas_phage	34.4	2.9e-44
AVN01805.1|2920934_2921921_-	hypothetical protein	NA	NA	NA	NA	NA
AVN03639.1|2921917_2922241_-	ACP S-malonyltransferase	NA	NA	NA	NA	NA
AVN01806.1|2922511_2923673_+|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.1e-51
>prophage 7
CP027205	Escherichia coli strain WCHEC025943 chromosome, complete genome	4817293	3137341	3147435	4817293	transposase,integrase	Salmonella_phage(90.0%)	13	3137011:3137024	3147477:3147490
3137011:3137024	attL	AAAACAATAAGTTA	NA	NA	NA	NA
AVN03647.1|3137341_3137530_-	hypothetical protein	NA	A0A1S6L006	Salmonella_phage	95.2	2.0e-24
AVN01986.1|3137688_3140082_-	replication endonuclease	NA	E5G6L9	Salmonella_phage	93.7	0.0e+00
AVN01987.1|3140078_3140936_-	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	95.8	9.5e-159
AVN01988.1|3140932_3141160_-	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	98.7	7.8e-36
AVN01989.1|3141159_3141393_-	DUF2732 family protein	NA	E5G6L6	Salmonella_phage	97.4	1.9e-32
AVN01990.1|3141460_3141802_-	hypothetical protein	NA	E5G6L5	Salmonella_phage	98.2	1.7e-55
AVN01991.1|3141919_3142216_-	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	88.5	1.9e-21
AVN01992.1|3142223_3142733_-	phage regulatory CII family protein	NA	E5G6L3	Salmonella_phage	98.2	1.3e-86
AVN01993.1|3142765_3142987_-	regulator	NA	NA	NA	NA	NA
AVN01994.1|3143132_3144011_+	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	39.4	1.7e-30
AVN01995.1|3144022_3144967_+	hypothetical protein	NA	NA	NA	NA	NA
AVN01996.1|3145087_3146308_+|transposase	ISL3-like element ISKox3 family transposase	transposase	NA	NA	NA	NA
AVN01997.1|3146382_3147435_+|integrase	site-specific integrase	integrase	A0A218M4I3	Erwinia_phage	57.0	1.4e-106
3147477:3147490	attR	TAACTTATTGTTTT	NA	NA	NA	NA
>prophage 8
CP027205	Escherichia coli strain WCHEC025943 chromosome, complete genome	4817293	3227018	3254222	4817293	lysis,tail,integrase,capsid,terminase	Enterobacteria_phage(47.06%)	50	3228934:3228948	3254296:3254310
AVN02067.1|3227018_3228308_+	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	27.1	3.4e-19
AVN02068.1|3228366_3228843_+	kinase inhibitor	NA	NA	NA	NA	NA
3228934:3228948	attL	TTAGTATAAAAAAGC	NA	NA	NA	NA
AVN02070.1|3229588_3230920_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	37.1	1.4e-20
AVN02071.1|3230993_3231170_-|tail	phage tail protein	tail	K7PMH7	Enterobacteria_phage	84.5	9.4e-21
AVN03651.1|3231361_3231988_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AVN02072.1|3231932_3232070_-|capsid	nucleocapsid protein	capsid	NA	NA	NA	NA
AVN02073.1|3232878_3233439_-|terminase	terminase small subunit	terminase	A0A0K2FIG2	Enterobacteria_phage	98.8	4.9e-87
AVN02075.1|3233827_3234061_+	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	94.4	7.3e-21
AVN02076.1|3234117_3234528_+	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	76.3	1.3e-52
AVN02077.1|3234573_3234738_+	hypothetical protein	NA	NA	NA	NA	NA
AVN02078.1|3234879_3235032_-	hypothetical protein	NA	K7PKL2	Enterobacteria_phage	96.0	3.1e-20
AVN02079.1|3235019_3235487_-|lysis	lysis protein	lysis	A0A2D1GLQ7	Escherichia_phage	96.8	1.6e-75
AVN02080.1|3235483_3235981_-	lysozyme	NA	A0A1B5FP97	Escherichia_phage	97.0	1.6e-89
AVN02081.1|3235980_3236196_-|lysis	lysis protein S	lysis	A5LH82	Enterobacteria_phage	98.6	1.2e-33
AVN02082.1|3236383_3236971_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
AVN02083.1|3236979_3237114_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AVN02084.1|3237465_3238425_-	DUF523 and DUF1722 domain-containing protein	NA	NA	NA	NA	NA
AVN02085.1|3238617_3239142_+	hypothetical protein	NA	A0A1W6JNX6	Morganella_phage	54.1	1.1e-48
AVN02086.1|3239297_3239675_-	antitermination protein	NA	Q777W5	Enterobacteria_phage	84.2	7.3e-55
AVN02087.1|3239760_3239901_-	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	67.4	5.5e-08
AVN02088.1|3239897_3240260_-	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	97.4	1.5e-60
AVN02089.1|3240256_3240547_-	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	91.7	4.8e-46
AVN02090.1|3240539_3240710_-	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	69.8	2.4e-13
AVN02091.1|3240709_3241165_-	hypothetical protein	NA	I6PD71	Cronobacter_phage	66.2	5.9e-59
AVN02092.1|3241161_3241263_-	hypothetical protein	NA	NA	NA	NA	NA
AVN02093.1|3241355_3241808_-	hypothetical protein	NA	NA	NA	NA	NA
AVN02094.1|3241804_3242365_-	UDP-N-acetylglucosamine acyltransferase	NA	NA	NA	NA	NA
AVN02095.1|3242621_3242813_+	hypothetical protein	NA	NA	NA	NA	NA
AVN02096.1|3242849_3243143_-	protein ren	NA	A0A0N6WES4	Escherichia_phage	95.7	1.1e-42
AVN02097.1|3243139_3243841_-	Replication protein P	NA	K7P6G2	Enterobacteria_phage	99.6	3.8e-129
AVN02098.1|3243837_3244857_-	Replication protein O	NA	A0A0M5M7Y1	Salmonella_phage	63.4	1.7e-109
AVN02099.1|3244853_3245393_-	regulator	NA	M9NZI6	Enterobacteria_phage	66.1	2.0e-61
AVN02100.1|3245462_3245693_-	transcriptional regulator	NA	A0A2H4FNF3	Salmonella_phage	68.0	1.5e-21
AVN02101.1|3245731_3246487_+	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	75.0	1.4e-92
AVN02102.1|3246609_3247359_+	hypothetical protein	NA	NA	NA	NA	NA
AVN02103.1|3247355_3248183_+	DUF3037 domain-containing protein	NA	NA	NA	NA	NA
AVN02104.1|3248691_3248898_+	cell division inhibitor protein	NA	K7P6H3	Enterobacteria_phage	85.3	3.2e-28
AVN02105.1|3248973_3249270_+	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	100.0	1.6e-49
AVN02106.1|3249275_3250061_+	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
AVN02107.1|3250057_3250738_+	exonuclease	NA	A0A0P0ZCD4	Stx2-converting_phage	98.7	3.0e-131
AVN03652.1|3250734_3250917_+	DUF1317 family protein	NA	A0A0N7CHV0	Escherichia_phage	98.3	2.2e-28
AVN02108.1|3250889_3251081_+	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	98.4	2.8e-26
AVN02109.1|3251091_3251373_+	cell division protein ZapA	NA	A0A0P0ZE02	Stx2-converting_phage	100.0	2.5e-47
AVN02110.1|3251471_3251693_+	TraR/DksA family transcriptional regulator	NA	A0A0N7C211	Escherichia_phage	97.3	1.4e-34
AVN02111.1|3251903_3252434_-	hypothetical protein	NA	NA	NA	NA	NA
AVN02112.1|3252324_3252576_-	hypothetical protein	NA	NA	NA	NA	NA
AVN02113.1|3252630_3252816_-	hypothetical protein	NA	NA	NA	NA	NA
AVN02114.1|3252748_3252916_+	hypothetical protein	NA	A5VWB7	Enterobacteria_phage	98.2	2.9e-27
AVN02115.1|3252955_3253174_+	excisionase	NA	Q77WA4	Escherichia_phage	100.0	3.7e-35
AVN02116.1|3253151_3254222_+|integrase	integrase	integrase	Q9MCR4	Enterobacteria_phage	99.7	1.9e-201
3254296:3254310	attR	TTAGTATAAAAAAGC	NA	NA	NA	NA
>prophage 9
CP027205	Escherichia coli strain WCHEC025943 chromosome, complete genome	4817293	3741713	3757401	4817293	integrase,tail	Shigella_phage(35.29%)	19	3738817:3738876	3753486:3753545
3738817:3738876	attL	CTTATTGATTTAAATGGTGCCGATAATAGGAGTCGAACCTACGACCTTCGCATTACGAAT	NA	NA	NA	NA
AVN02563.1|3741713_3742487_+	hypothetical protein	NA	G9IA57	Pseudomonas_phage	37.7	4.1e-36
AVN03666.1|3742556_3742685_-|tail	phage tail protein	tail	K7PMH7	Enterobacteria_phage	84.6	1.7e-11
AVN02564.1|3742739_3745883_-	GntR family transcriptional regulator	NA	K7PGT9	Enterobacteria_phage	57.4	9.3e-260
AVN02565.1|3745872_3746052_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	7.8e-15
AVN03667.1|3746227_3746785_-	protein YmfL	NA	S5FXP0	Shigella_phage	96.2	1.5e-96
AVN02566.1|3746822_3747023_-	cell division protein	NA	NA	NA	NA	NA
AVN02567.1|3747120_3747747_+	LexA family transcriptional regulator	NA	K7PM82	Enterobacteria_phage	48.8	2.5e-47
AVN03668.1|3747977_3748475_-	hypothetical protein	NA	NA	NA	NA	NA
AVN02569.1|3748671_3748896_-	hypothetical protein	NA	A0A291AWX8	Escherichia_phage	66.2	1.2e-15
AVN02570.1|3748968_3749331_+	hypothetical protein	NA	Q8SBF8	Shigella_phage	100.0	8.6e-61
AVN02571.1|3749396_3750221_+	DUF2303 family protein	NA	U5P439	Shigella_phage	99.6	6.0e-150
AVN02572.1|3750348_3750885_+	HD family hydrolase	NA	S5MW55	Escherichia_phage	98.3	2.0e-98
AVN02573.1|3750875_3751754_+	hypothetical protein	NA	A0A2R2Z314	Escherichia_phage	92.4	5.3e-165
AVN02574.1|3751750_3752095_+	DNA-binding protein	NA	U5P0J0	Shigella_phage	80.7	2.0e-30
AVN02575.1|3752094_3752445_+	DNA-binding protein	NA	U5P4J3	Shigella_phage	100.0	4.9e-61
AVN03669.1|3752546_3753485_+|integrase	site-specific integrase	integrase	U5P434	Shigella_phage	99.7	4.7e-183
AVN02576.1|3753689_3754943_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.0	1.7e-95
3753486:3753545	attR	CTTATTGATTTAAATGGTGCCGATAATAGGAGTCGAACCTACGACCTTCGCATTACGAAT	NA	NA	NA	NA
AVN02577.1|3754954_3756058_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
AVN02578.1|3756345_3757401_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.9	7.7e-118
>prophage 10
CP027205	Escherichia coli strain WCHEC025943 chromosome, complete genome	4817293	4143280	4149839	4817293	transposase	uncultured_Caudovirales_phage(16.67%)	7	NA	NA
AVN02922.1|4143280_4144237_+	iron-dicitrate ABC transporter permease FecD	NA	A0A2H4IY97	uncultured_Caudovirales_phage	26.1	1.1e-17
AVN02923.1|4144237_4145005_+	Fe(3+) dicitrate transport ATP-binding protein FecE	NA	G3M9Y6	Bacillus_virus	24.8	6.4e-13
AVN02924.1|4145562_4145976_-	hypothetical protein	NA	NA	NA	NA	NA
AVN02925.1|4146871_4148023_+|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	36.0	2.6e-42
AVN02926.1|4147942_4148293_-|transposase	transposase	transposase	Q716C1	Shigella_phage	97.7	8.9e-39
AVN02927.1|4148393_4148966_+	hypothetical protein	NA	Q858R9	Enterobacteria_phage	69.0	2.2e-71
AVN02928.1|4149014_4149839_-	hypothetical protein	NA	L7TR00	Rhizobium_phage	35.5	3.0e-16
>prophage 1
CP027199	Escherichia coli strain WCHEC025943 plasmid p1_025943, complete sequence	95895	0	95578	95895	plate,holin,terminase,transposase,portal,head,lysis,tail	Escherichia_phage(64.36%)	105	NA	NA
AVM98528.1|0_861_+	replication protein RepA	NA	Q71TL8	Escherichia_phage	100.0	4.7e-158
AVM98529.1|1418_2615_+	ParA family protein	NA	A0A077SL49	Escherichia_phage	100.0	1.6e-225
AVM98530.1|2631_3633_+	ParB/RepB/Spo0J family partition protein	NA	Q38420	Escherichia_phage	100.0	1.7e-178
AVM98531.1|3858_5565_+	hypothetical protein	NA	Q71TM1	Escherichia_phage	99.8	0.0e+00
AVM98532.1|5625_7215_+	hypothetical protein	NA	Q71TB2	Escherichia_phage	98.9	2.9e-302
AVM98533.1|7224_8040_+	hypothetical protein	NA	A0A1B0V835	Salmonella_phage	98.2	2.4e-111
AVM98534.1|8075_8657_+	hypothetical protein	NA	Q1MVJ8	Enterobacteria_phage	97.4	7.3e-102
AVM98535.1|8668_9178_+|plate	baseplate protein	plate	Q1MVJ9	Enterobacteria_phage	100.0	1.3e-91
AVM98536.1|9293_9449_-	type I toxin-antitoxin system Hok family toxin	NA	A0A1I9LJU7	Stx_converting_phage	90.2	4.0e-15
AVM98628.1|9630_9876_-	hypothetical protein	NA	A0A1B0VDM5	Salmonella_phage	45.0	3.5e-13
AVM98537.1|9926_10772_-	Replication protein repL	NA	Q1MVK3	Enterobacteria_phage	98.9	1.5e-151
AVM98538.1|10801_11602_-	DNA-binding protein	NA	Q1MVK4	Enterobacteria_phage	99.6	1.6e-147
AVM98539.1|11766_12810_-	phage antirepressor Ant	NA	Q71TN2	Escherichia_phage	92.5	2.7e-171
AVM98629.1|12806_13028_-	host cell division inhibitor Icd-like protein	NA	Q38557	Escherichia_phage	97.3	3.6e-38
AVM98540.1|13428_14103_+	hypothetical protein	NA	Q71TC4	Escherichia_phage	92.0	2.0e-18
AVM98541.1|14361_14631_+	hypothetical protein	NA	NA	NA	NA	NA
AVM98542.1|14689_15256_+	hypothetical protein	NA	Q71TN7	Escherichia_phage	98.9	3.3e-99
AVM98543.1|15266_15878_+|tail	phage tail protein	tail	Q71TN8	Escherichia_phage	99.5	2.9e-109
AVM98544.1|15892_16774_+	morphogenetic protein	NA	Q71TC9	Escherichia_phage	100.0	2.2e-174
AVM98545.1|16855_20596_+	lytic transglycosylase domain-containing protein	NA	Q1MVL3	Enterobacteria_phage	86.8	0.0e+00
AVM98546.1|20595_20952_+	hypothetical protein	NA	Q71TP1	Escherichia_phage	100.0	1.0e-61
AVM98547.1|20948_22382_+	bleomycin hydrolase	NA	Q71TP2	Escherichia_phage	99.4	3.4e-270
AVM98548.1|22381_23218_+|tail	phage tail protein	tail	A0A077SLH5	Escherichia_phage	99.6	1.5e-153
AVM98549.1|23296_23731_+|tail	phage tail protein	tail	Q71TD4	Escherichia_phage	98.6	3.7e-74
AVM98550.1|27782_28016_+	hypothetical protein	NA	NA	NA	NA	NA
AVM98551.1|28467_28749_+	hypothetical protein	NA	Q71TD9	Escherichia_phage	97.8	8.7e-45
AVM98552.1|28816_29146_+|holin	holin	holin	Q37876	Escherichia_phage	100.0	1.3e-52
AVM98553.1|29142_29586_+|lysis	lysis protein	lysis	A0A077SK09	Escherichia_phage	100.0	1.3e-82
AVM98554.1|29572_30175_+	odaE	NA	Q1MVM6	Enterobacteria_phage	99.5	1.6e-99
AVM98555.1|30176_32096_+	hypothetical protein	NA	A0A1B0V7H1	Salmonella_phage	98.6	0.0e+00
AVM98556.1|32092_32458_+	ddrA	NA	Q1MVM8	Enterobacteria_phage	96.7	1.5e-44
AVM98557.1|32470_35458_+	hypothetical protein	NA	A0A1B0VFX4	Salmonella_phage	99.0	0.0e+00
AVM98558.1|35447_35756_+	hypothetical protein	NA	O21974	Escherichia_phage	97.1	5.4e-48
AVM98559.1|35786_36581_-	hypothetical protein	NA	Q71TF1	Escherichia_phage	95.8	1.5e-142
AVM98560.1|36783_37272_-	single-stranded DNA-binding protein	NA	A0A1B0VAF5	Salmonella_phage	99.4	1.9e-87
AVM98561.1|37441_37999_+	lysozyme	NA	Q71TF3	Escherichia_phage	98.4	6.7e-105
AVM98562.1|38134_38311_+|holin	antiholin	holin	Q71TR5	Escherichia_phage	94.8	2.3e-27
AVM98563.1|38290_39310_-|head	head processing protein	head	Q71TR6	Escherichia_phage	96.5	2.2e-178
AVM98564.1|39302_41012_-|portal	phage portal protein	portal	Q71TR7	Escherichia_phage	99.5	0.0e+00
AVM98565.1|41783_44801_-|transposase	Tn3-like element IS3000 family transposase	transposase	A0A125RQ78	Bacillus_phage	24.7	5.5e-52
AVM98630.1|45603_51096_+	helicase	NA	A0A077SK04	Escherichia_phage	98.7	0.0e+00
AVM98566.1|51129_51570_+	peptide-binding protein	NA	A0A077SLF0	Escherichia_phage	100.0	1.7e-79
AVM98567.1|51566_51815_+	modulator protein	NA	Q71TG0	Escherichia_phage	100.0	1.8e-41
AVM98568.1|51861_53169_-	SIR2 family protein	NA	NA	NA	NA	NA
AVM98569.1|53225_53867_-	maturation control protein	NA	A0A077SK30	Escherichia_phage	98.1	1.6e-113
AVM98570.1|54055_54616_-	recombinase	NA	Q5QBN4	Enterobacteria_phage	99.5	2.9e-100
AVM98571.1|54865_55177_-	lysogeny establishment protein	NA	Q5QBN5	Enterobacteria_phage	99.0	3.0e-46
AVM98572.1|55227_56259_-	recombinase	NA	Q71TG5	Escherichia_phage	98.8	4.6e-192
AVM98573.1|56266_56488_-	creatininase	NA	Q5QBN7	Enterobacteria_phage	98.6	1.3e-35
AVM98574.1|56899_57013_+	peptidase	NA	Q5XLQ7	Enterobacteria_phage	100.0	3.2e-14
AVM98575.1|57031_57127_+	peptidase	NA	Q38402	Escherichia_phage	100.0	2.8e-11
AVM98576.1|57092_57302_+	c1 repressor inactivator	NA	A0A077SK26	Escherichia_phage	100.0	1.8e-31
AVM98577.1|57412_58264_+	hypothetical protein	NA	A0A077SLM8	Escherichia_phage	99.6	2.8e-158
AVM98578.1|58296_59319_-	phage antirepressor Ant	NA	A0A077SLR9	Escherichia_phage	86.3	3.2e-161
AVM98579.1|59343_60552_-|transposase	IS4-like element ISVsa5 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	100.0	1.8e-235
AVM98580.1|60743_61307_-	host cell division inhibitor Icd-like protein	NA	Q38557	Escherichia_phage	80.3	4.1e-25
AVM98581.1|61303_62788_-|terminase	terminase	terminase	Q5QBP2	Enterobacteria_phage	99.6	2.1e-291
AVM98582.1|62787_63981_-|terminase	terminase	terminase	Q5QBP3	Enterobacteria_phage	99.0	4.1e-208
AVM98583.1|64067_64520_-	Late promoter-activating protein	NA	Q71T63	Escherichia_phage	99.3	6.7e-79
AVM98584.1|64608_65652_-	DUF968 domain-containing protein	NA	A0A1B0VBU2	Salmonella_phage	99.7	3.0e-207
AVM98585.1|65679_65859_-	PdcA protein	NA	Q71TH5	Escherichia_phage	98.3	1.2e-23
AVM98586.1|65863_66244_-	type II toxin-antitoxin system death-on-curing family toxin	NA	A0A077SK56	Escherichia_phage	100.0	1.1e-63
AVM98587.1|66243_66465_-	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	A0A222YXU1	Escherichia_phage	100.0	6.7e-32
AVM98588.1|66537_66927_-	DNA repair protein	NA	Q1MVE7	Enterobacteria_phage	99.2	1.4e-69
AVM98589.1|67050_67302_-	DNA polymerase III subunit theta	NA	A0A077SLL5	Escherichia_phage	100.0	1.4e-38
AVM98631.1|67475_67685_+	hypothetical protein	NA	A0A222YY00	Escherichia_phage	98.6	1.1e-31
AVM98590.1|68508_68883_-	hypothetical protein	NA	A0A1B0VBU7	Salmonella_phage	96.8	9.2e-66
AVM98591.1|68889_69183_-	hypothetical protein	NA	A0A077SK23	Escherichia_phage	92.8	1.2e-44
AVM98592.1|69361_69595_-	hypothetical protein	NA	A0A1B0V7L5	Salmonella_phage	100.0	2.5e-37
AVM98593.1|69671_69932_-	eaa protein	NA	A0A077SLR0	Escherichia_phage	96.5	9.3e-41
AVM98594.1|69928_70726_-	DUF551 domain-containing protein	NA	A0A192Y7X3	Salmonella_phage	46.1	8.8e-50
AVM98595.1|70727_71372_-	ead/Ea22-like family protein	NA	K7P6J7	Enterobacteria_phage	56.0	1.1e-53
AVM98596.1|71368_72019_-	ead/Ea22-like family protein	NA	A0A0F6TJR7	Escherichia_coli_O157_typing_phage	82.1	1.1e-26
AVM98597.1|72015_72255_-	hypothetical protein	NA	S5MQM0	Escherichia_phage	97.5	1.3e-36
AVM98598.1|72247_72451_-	hypothetical protein	NA	A0A2R2Z313	Escherichia_phage	95.5	5.2e-31
AVM98599.1|72534_73263_-	hypothetical protein	NA	Q71T76	Escherichia_phage	99.1	1.7e-140
AVM98600.1|73457_73964_-	3'-phosphatase	NA	A0A1B0VAK0	Salmonella_phage	99.4	1.8e-93
AVM98601.1|74036_75299_-	hypothetical protein	NA	A0A1B0V7L1	Salmonella_phage	99.8	1.6e-234
AVM98602.1|75300_75519_-	hypothetical protein	NA	Q71TI9	Escherichia_phage	100.0	3.4e-36
AVM98603.1|75600_76302_-	hypothetical protein	NA	Q1MVG6	Enterobacteria_phage	100.0	4.2e-144
AVM98604.1|76298_76976_-	serine/threonine protein phosphatase	NA	A0A077SLQ6	Escherichia_phage	100.0	7.6e-135
AVM98605.1|76972_77599_-	norphogenetic protein	NA	A0A077SK52	Escherichia_phage	99.0	4.0e-122
AVM98606.1|77496_78159_-	norphogenetic protein	NA	Q71T83	Escherichia_phage	98.6	9.4e-122
AVM98607.1|78100_78256_-	norphogenetic protein	NA	Q71TJ4	Escherichia_phage	96.1	2.7e-19
AVM98608.1|78322_78901_-	VRR-NUC domain-containing protein	NA	Q71T85	Escherichia_phage	99.5	1.5e-107
AVM98609.1|78903_79149_-	hypothetical protein	NA	Q71T86	Escherichia_phage	98.8	2.1e-39
AVM98610.1|79295_79673_+	hypothetical protein	NA	Q38620	Escherichia_phage	100.0	2.2e-67
AVM98611.1|79682_80900_+|tail	phage tail protein	tail	A0A077SL53	Escherichia_phage	99.8	4.1e-224
AVM98612.1|80903_81632_+|tail	phage tail protein	tail	Q71TJ9	Escherichia_phage	100.0	4.2e-139
AVM98613.1|81618_82404_+|plate	baseplate	plate	A0A1B0V7N6	Salmonella_phage	99.6	2.7e-144
AVM98614.1|82405_83422_+|tail	phage tail tape measure protein	tail	A0A077SLQ1	Escherichia_phage	100.0	3.5e-192
AVM98615.1|83414_84047_+|plate	baseplate protein	plate	Q1MVH8	Enterobacteria_phage	100.0	9.0e-90
AVM98616.1|84093_85092_-	hypothetical protein	NA	Q71TK3	Escherichia_phage	99.1	1.4e-193
AVM98617.1|85091_86456_-	replicative DNA helicase	NA	O80281	Escherichia_phage	99.8	1.6e-253
AVM98618.1|86446_86662_+	hypothetical protein	NA	NA	NA	NA	NA
AYC76614.1|86928_87093_-	DUF3927 domain-containing protein	NA	Q71T96	Escherichia_phage	98.1	2.9e-16
AVM98619.1|87092_87518_-	tellurite/colicin resistance protein	NA	Q71TK7	Escherichia_phage	99.3	1.8e-70
AVM98620.1|87709_87901_+	hypothetical protein	NA	Q71T98	Escherichia_phage	100.0	6.0e-29
AVM98621.1|89075_92117_-	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A077SL51	Escherichia_phage	86.8	0.0e+00
AVM98622.1|92113_93019_-	recombination-associated protein RdgC	NA	A0A077SK17	Escherichia_phage	96.0	5.0e-158
AVM98623.1|93011_93296_-	hypothetical protein	NA	Q71TA2	Escherichia_phage	98.9	7.7e-49
AVM98624.1|93569_93749_+	hypothetical protein	NA	A0A1B0V758	Salmonella_phage	98.3	6.8e-27
AVM98625.1|93757_94546_+	hypothetical protein	NA	A0A1B0V830	Salmonella_phage	92.3	8.6e-114
AVM98626.1|94585_95008_+	ppfA	NA	Q71TL5	Escherichia_phage	85.7	7.4e-56
AVM98627.1|95185_95578_+	hypothetical protein	NA	A0A1B0VBK3	Salmonella_phage	100.0	2.4e-72
>prophage 1
CP027200	Escherichia coli strain WCHEC025943 plasmid p2_025943, complete sequence	75779	1262	42244	75779	transposase,integrase,protease	Salmonella_phage(23.53%)	42	NA	NA
AVM98633.1|1262_1994_-|integrase	site-specific integrase	integrase	I3WFA4	Macacine_betaherpesvirus	52.5	1.5e-19
AVM98634.1|2223_2928_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AVM98635.1|3148_3463_-|transposase	transposase	transposase	NA	NA	NA	NA
AVM98636.1|3401_4415_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
AVM98709.1|4706_5261_+	fluoroquinolone-acetylating aminoglycoside 6'-N-acetyltransferase AAC(6')-Ib-cr5	NA	NA	NA	NA	NA
AVM98637.1|5357_5810_+	NAD(+)--rifampin ADP-ribosyltransferase Arr-3	NA	NA	NA	NA	NA
AVM98638.1|5942_6416_+	trimethoprim-resistant dihydrofolate reductase DfrA27	NA	G3MBI7	Bacillus_virus	29.1	1.4e-15
AVM98639.1|6596_7442_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA16	NA	NA	NA	NA	NA
AVM98640.1|7558_7906_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
AVM98641.1|7899_8739_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
AVM98642.1|9143_10685_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
AVM98643.1|11277_12033_-	16S rRNA (guanine(1405)-N(7))-methyltransferase RmtB1	NA	NA	NA	NA	NA
AVM98644.1|12202_13063_-	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
AVM98645.1|13245_13653_-	resolvase	NA	Q1MVP4	Enterobacteria_phage	100.0	1.0e-57
AVM98646.1|13658_14363_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AVM98647.1|14595_15456_+	aminoglycoside N-acetyltransferase AAC(3)-IId	NA	NA	NA	NA	NA
AVM98648.1|15468_16011_+	tunicamycin resistance protein	NA	NA	NA	NA	NA
AVM98649.1|16492_16684_-	hypothetical protein	NA	NA	NA	NA	NA
AVM98650.1|16689_16935_+	hypothetical protein	NA	NA	NA	NA	NA
AVM98651.1|16985_18122_+	DUF3883 domain-containing protein	NA	NA	NA	NA	NA
AVM98652.1|18236_19607_+|transposase	IS1182-like element ISCfr1 family transposase	transposase	NA	NA	NA	NA
AVM98653.1|20427_21288_+	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
AVM98654.1|21518_22355_-	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
AVM98655.1|22354_23158_-	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	NA	NA	NA	NA
AVM98656.1|23218_24034_-	sulfonamide-resistant dihydropteroate synthase Sul2	NA	A0A0B5J4J5	Pandoravirus	27.6	5.9e-09
AVM98657.1|24363_24540_+	DUF4102 domain-containing protein	NA	T1S9J3	Salmonella_phage	68.6	1.0e-06
AVM98658.1|24721_25726_-|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
AVM98659.1|25804_28771_-|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	72.9	0.0e+00
AVM98660.1|29141_29846_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AVM98661.2|29915_30389_-	trimethoprim-resistant dihydrofolate reductase DfrA14	NA	G3MBI7	Bacillus_virus	28.9	8.4e-16
AVM98662.1|30544_31558_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
AVM98663.1|31496_32111_+	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
AVM98664.1|32286_32847_+	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	100.0	1.1e-59
AVM98665.1|32850_33447_+|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	85.1	4.7e-64
AVM98666.1|33478_34156_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
AVM98667.1|34234_35434_+	tetracycline efflux MFS transporter Tet(A)	NA	NA	NA	NA	NA
AVM98668.1|35465_36350_-	EamA family transporter	NA	NA	NA	NA	NA
AVM98710.1|36487_36880_-	cysteine hydrolase	NA	NA	NA	NA	NA
AVM98669.1|38849_40622_-	DUF262 domain-containing protein	NA	NA	NA	NA	NA
AVM98670.1|40805_40910_-	hypothetical protein	NA	NA	NA	NA	NA
AVM98671.1|40906_41371_-	mRNA interferase PemK	NA	NA	NA	NA	NA
AVM98672.1|41590_42244_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
>prophage 2
CP027200	Escherichia coli strain WCHEC025943 plasmid p2_025943, complete sequence	75779	55543	62131	75779		Escherichia_phage(33.33%)	10	NA	NA
AVM98689.1|55543_56227_-	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	36.9	5.1e-30
AVM98690.1|56302_56608_-	hypothetical protein	NA	NA	NA	NA	NA
AVM98691.1|56611_57583_-	DUF1281 domain-containing protein	NA	NA	NA	NA	NA
AVM98692.1|57551_57821_-	hypothetical protein	NA	NA	NA	NA	NA
AVM98693.1|57931_58180_+	protein ImpC	NA	Q2A098	Sodalis_phage	48.0	1.9e-14
AVM98694.1|58176_58614_+	peptidase	NA	A0A1W6JNS2	Morganella_phage	48.4	8.3e-26
AVM98695.1|58613_59885_+	translesion error-prone DNA polymerase V subunit UmuC	NA	F1C5A5	Cronobacter_phage	60.2	3.2e-142
AVM98696.1|59889_60318_-	plasmid stability protein	NA	NA	NA	NA	NA
AVM98697.1|60286_61258_-	plasmid segregation protein parM	NA	A0A222YXF2	Escherichia_phage	42.9	1.3e-66
AVM98698.1|61486_62131_+	chromosome partitioning protein ParA	NA	A0A222YXS3	Escherichia_phage	43.0	1.9e-39
>prophage 1
CP027202	Escherichia coli strain WCHEC025943 plasmid pMCR1_025943, complete sequence	265538	96406	177677	265538	integrase,transposase	Escherichia_phage(48.28%)	84	100030:100089	150266:151086
AVM98812.1|96406_97111_+|transposase	IS6 family transposase IS15DI	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
AVM98813.1|97236_97821_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
AVM98814.1|97820_99059_-	MFS transporter	NA	NA	NA	NA	NA
AVM98815.1|99055_99961_-	Mph(A) family macrolide 2'-phosphotransferase	NA	NA	NA	NA	NA
100030:100089	attL	CGGCACTGTTGCAAAGTTAGCGATGAGGCAGCCTTTTGTCTTATTCAAAGGCCTTACATT	NA	NA	NA	NA
AVM98816.1|100082_100787_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AVM98817.1|100777_100966_+	hypothetical protein	NA	NA	NA	NA	NA
AVM98818.1|101053_102490_+	glutathione synthase	NA	NA	NA	NA	NA
AVM98819.1|102803_103070_-	hypothetical protein	NA	NA	NA	NA	NA
AVM98820.1|103157_103829_-	RepB family plasmid replication initiator protein	NA	NA	NA	NA	NA
AVM98821.1|103838_104543_-|transposase	IS6 family transposase IS15DI	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
AVM98822.1|104725_105031_-	PadR family transcriptional regulator	NA	NA	NA	NA	NA
AVM98823.1|105041_106247_-	chromate efflux transporter	NA	NA	NA	NA	NA
AVM98824.1|107462_107549_+	tetracycline resistance determinant leader peptide	NA	NA	NA	NA	NA
AVM98825.1|107564_109484_+	tetracycline resistance ribosomal protection protein Tet(M)	NA	A0A1S5SF82	Streptococcus_phage	98.0	0.0e+00
AVM98826.1|109559_110165_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	99.5	7.0e-116
AVM98827.1|110939_111605_-	hypothetical protein	NA	NA	NA	NA	NA
AVM98828.1|111662_112043_-	hypothetical protein	NA	NA	NA	NA	NA
AVM98829.1|112685_113504_+	DUF4942 domain-containing protein	NA	NA	NA	NA	NA
AVM98830.1|113500_114706_+	ATP/GTP-binding protein	NA	NA	NA	NA	NA
AVM98831.1|114769_114973_-	hypothetical protein	NA	NA	NA	NA	NA
AVM98832.1|114985_116305_-	DUF1173 family protein	NA	NA	NA	NA	NA
AVM98833.1|116555_117983_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	52.3	3.4e-100
AVM98834.1|118197_118713_+	thermonuclease family protein	NA	A0A1X6WF84	Pacmanvirus	38.6	2.1e-07
AVM98835.1|118715_119612_+	hypothetical protein	NA	NA	NA	NA	NA
AVM98982.1|119833_120067_+	hypothetical protein	NA	NA	NA	NA	NA
AVM98836.1|120112_120367_+	hypothetical protein	NA	NA	NA	NA	NA
AVM98837.1|120404_120692_+	hypothetical protein	NA	NA	NA	NA	NA
AVM98838.1|120728_120959_+	hypothetical protein	NA	NA	NA	NA	NA
AVM98839.1|121295_121757_+	hypothetical protein	NA	NA	NA	NA	NA
AVM98840.1|121786_122194_+	hypothetical protein	NA	NA	NA	NA	NA
AVM98983.1|122244_122562_-	hypothetical protein	NA	NA	NA	NA	NA
AVM98984.1|122938_123289_-	hypothetical protein	NA	NA	NA	NA	NA
AVM98985.1|125153_125546_+	cysteine hydrolase	NA	NA	NA	NA	NA
AVM98841.1|125683_126568_+	EamA family transporter	NA	NA	NA	NA	NA
AVM98842.1|126599_127799_-	tetracycline efflux MFS transporter Tet(A)	NA	NA	NA	NA	NA
AVM98843.1|127877_128555_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
AVM98844.1|128586_128829_-	relaxase	NA	NA	NA	NA	NA
AVM98845.1|129134_129971_-	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
AVM98846.1|129970_130774_-	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	NA	NA	NA	NA
AVM98847.1|130834_131650_-	sulfonamide-resistant dihydropteroate synthase Sul2	NA	A0A0B5J4J5	Pandoravirus	27.6	5.9e-09
AVM98848.1|131811_132672_-	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
AVM98986.1|132854_133331_-	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	100.0	2.5e-76
AVM98849.1|133379_134084_+|transposase	IS6 family transposase IS15DI	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
AVM98850.1|133974_134283_-	hypothetical protein	NA	NA	NA	NA	NA
AVM98851.1|134635_135340_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AVM98852.1|135230_136190_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	40.5	1.7e-47
AVM98987.1|136338_137130_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA22	NA	NA	NA	NA	NA
AVM98853.1|137261_138083_+	lincosamide nucleotidyltransferase Lnu(F)	NA	NA	NA	NA	NA
AVM98854.1|138235_138940_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AVM98855.1|139560_139752_+	hypothetical protein	NA	NA	NA	NA	NA
AVM98856.1|140775_141579_+	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	NA	NA	NA	NA
AVM98857.1|141578_142415_+	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
AVM98858.1|142750_143566_+	aminoglycoside O-phosphotransferase APH(3')-Ia	NA	A0A193DTG4	Autographa_californica_nuclear_polyhedrosis_virus	98.2	4.8e-160
AVM98859.1|143719_144595_-	acyl-CoA--6-aminopenicillanic acid acyl-transferase	NA	NA	NA	NA	NA
AVM98860.1|146249_147002_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	44.7	2.4e-41
AVM98861.1|147423_148449_-	aminoglycoside O-phosphotransferase APH(4)-Ia	NA	NA	NA	NA	NA
AVM98862.1|148435_148657_-	hypothetical protein	NA	NA	NA	NA	NA
AVM98863.1|148677_149454_-	aminoglycoside N-acetyltransferase AAC(3)-IV	NA	NA	NA	NA	NA
AVM98864.1|149567_150272_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AVM98865.1|150351_150603_+	tetracycline resistance protein	NA	NA	NA	NA	NA
AVM98866.1|150869_151175_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
150266:151086	attR	AATGTAAGGCCTTTGAATAAGACAAAAGGCTGCCTCATCGCTAACTTTGCAACAGTGCCGTCCTGCTTGCTTCGGGTGGCATCGGAATGCCGGCGCTGCAAGCAATGTTGTCCAGGCAGGTGGATGAGGAACGTCAGGGGCAGCTGCAAGGCTCACTGGCGGCGCTCACCAGCCTGACCTCGATCGTCGGACCCCTCCTCTTCACGGCGATCTATGCGGCTTCTATAACAACGTGGAACGGGTGGGCATGGATTGCAGGCGCTGCCCTCTACTTGCTCTGCCTGCCGGCGCTGCGTCGCGGGCTTTGGAGAAATTCTTCAAATTCCCGTTGCACATAGCCCGGCAATTCCTTTCCCTGCTCTGCCATAAGCGCAGCGAATGCCGGGTAATACTCGTCAACGATCTGATAGAGAAGGGTTTGCTCGGGTCGGTGGCTCTGGTAACGACCAGTATCCCGATCCCGGCTGGCCGTCCTGGCCGCCACATGAGGCATGTTCCGCGTCCTTGCAATACTGTGTTTACATACAGTCTATCGCTTAGCGGAAAGTTCTTTTACCCTCAGCCGAAATGCCTGCCGTTGCTAGACATTGCCAGCCAGTGCCCGTCACTCCGCGGTCTTCACTGCGTGATCGAGTTGATCGACACCCGCCGTGACACGCTCCATGAAGTGCCTGCCTGCGTCTGTTAGCCGAACGCCCCGCGCATGGCGCTCAAATAGCAGGACACCAAGGTTATCCTCCAGCGCTTTCACACGCGCGCTGACGCTCGACTGGCTGATACCAAGTGCCTTGGCCGCATGCCGAAAATTCAGATGCTCGGCG	NA	NA	NA	NA
AVM98867.1|151202_152417_-	chloramphenicol/florfenicol efflux MFS transporter FloR	NA	S4TR35	Salmonella_phage	25.4	1.5e-16
AVM98868.1|152633_153518_-	DUF3363 domain-containing protein	NA	NA	NA	NA	NA
AVM98869.1|154442_155147_+|transposase	IS6 family transposase IS1006	transposase	A0A077SL39	Escherichia_phage	85.8	1.9e-120
AVM98988.1|155231_155651_-	hypothetical protein	NA	NA	NA	NA	NA
AVM98870.1|155641_158593_-|transposase	Tn3-like element TnAs3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.5	0.0e+00
AVM98871.1|158595_159156_-	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	86.2	4.0e-49
AVM98872.1|161173_162142_-|transposase	IS5-like element IS903B family transposase	transposase	A0A1B0VFY5	Salmonella_phage	100.0	1.6e-186
AVM98873.1|162176_163052_-	class A extended-spectrum beta-lactamase CTX-M-65	NA	A0A1B0VBP7	Salmonella_phage	98.9	6.8e-152
AVM98874.1|163556_164183_-	hypothetical protein	NA	NA	NA	NA	NA
AVM98875.1|164780_165485_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AVM98876.1|165709_165913_-	hypothetical protein	NA	NA	NA	NA	NA
AVM98877.1|165931_166111_+	hypothetical protein	NA	NA	NA	NA	NA
AVM98878.1|166040_166880_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
AVM98879.1|167060_167225_+	cupin domain-containing protein	NA	NA	NA	NA	NA
AVM98880.1|168615_169320_+|transposase	IS6 family transposase IS15DI	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
AVM98881.1|169265_169445_-	hypothetical protein	NA	Q1MVP5	Enterobacteria_phage	85.7	7.3e-05
AVM98882.1|169513_169900_+	bleomycin binding protein	NA	NA	NA	NA	NA
AVM98883.1|170219_170612_-	NimC/NimA family protein	NA	NA	NA	NA	NA
AVM98884.1|170946_171651_-|transposase	IS6 family transposase IS15DI	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
AVM98885.1|171970_173146_+	multidrug efflux RND transporter periplasmic adaptor subunit OqxA	NA	NA	NA	NA	NA
AVM98886.1|173169_176322_+	multidrug efflux RND transporter permease subunit OqxB	NA	NA	NA	NA	NA
AVM98887.1|176391_176871_-	transcriptional regulator	NA	NA	NA	NA	NA
AVM98888.1|176972_177677_-|transposase	IS6 family transposase IS15DI	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
>prophage 1
CP027203	Escherichia coli strain WCHEC025943 plasmid pMCR3_025943, complete sequence	50520	0	13230	50520		Leptospira_phage(50.0%)	17	NA	NA
AVM98997.1|271_598_-	hypothetical protein	NA	NA	NA	NA	NA
AVM99045.1|594_924_-	hypothetical protein	NA	NA	NA	NA	NA
AVM98996.1|944_1478_-	conjugative transfer signal peptidase TraF	NA	NA	NA	NA	NA
AVM98995.1|1474_3421_-	conjugal transfer protein TraG	NA	NA	NA	NA	NA
AYC76615.1|3407_3563_-	hypothetical protein	NA	NA	NA	NA	NA
AVM98994.1|3559_6169_-	conjugal transfer protein TraI	NA	NA	NA	NA	NA
AVM98993.1|6217_6574_-	conjugal transfer protein TraJ	NA	NA	NA	NA	NA
AVM98992.1|6921_7356_+	DNA-processing protein	NA	NA	NA	NA	NA
AVM99044.1|7355_8141_+	conjugal transfer protein TraL	NA	NA	NA	NA	NA
AVM99043.1|8140_8581_+	conjugal transfer protein TraM	NA	NA	NA	NA	NA
AVM99042.1|8631_8865_+	hypothetical protein	NA	NA	NA	NA	NA
AVM99050.1|8963_9446_-	hypothetical protein	NA	NA	NA	NA	NA
AVM99041.1|9825_10506_-	traN-like protein	NA	NA	NA	NA	NA
AVM99049.1|10527_10857_-	conjugal transfer protein TraO	NA	NA	NA	NA	NA
AVM99040.1|11127_11334_-	hypothetical protein	NA	NA	NA	NA	NA
AVM99039.1|11458_12472_-	ParB/RepB/Spo0J family partition protein	NA	S5VSZ7	Leptospira_phage	29.4	6.7e-10
AVM99048.1|12471_13230_-	ParA family protein	NA	E9LUK9	Lactobacillus_phage	22.7	2.6e-06
>prophage 2
CP027203	Escherichia coli strain WCHEC025943 plasmid pMCR3_025943, complete sequence	50520	16539	18920	50520		Escherichia_phage(66.67%)	5	NA	NA
AVM99032.1|16539_17007_-	antirestriction protein	NA	A0A2D0W9W4	Bordetella_phage	32.0	6.2e-11
AVM99031.1|17188_17386_-	DUF905 domain-containing protein	NA	NA	NA	NA	NA
AVM99030.1|18055_18304_-	antirestriction protein ArdR	NA	NA	NA	NA	NA
AVM99029.1|18303_18612_-	addiction module antidote protein, HigA family	NA	A0A222YWD7	Escherichia_phage	44.0	1.3e-12
AVM99028.1|18620_18920_-	toxin	NA	A0A222YWE2	Escherichia_phage	49.5	1.5e-18
>prophage 3
CP027203	Escherichia coli strain WCHEC025943 plasmid pMCR3_025943, complete sequence	50520	33227	33914	50520		Xanthomonas_phage(100.0%)	1	NA	NA
AVM99013.1|33227_33914_+	conjugal transfer protein TraX	NA	A0A1W6DY89	Xanthomonas_phage	34.0	2.5e-24
>prophage 4
CP027203	Escherichia coli strain WCHEC025943 plasmid pMCR3_025943, complete sequence	50520	37494	38199	50520	transposase	Escherichia_phage(100.0%)	1	NA	NA
AVM99010.1|37494_38199_-|transposase	IS6 family transposase IS15DI	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
>prophage 5
CP027203	Escherichia coli strain WCHEC025943 plasmid pMCR3_025943, complete sequence	50520	44601	48561	50520		Caulobacter_phage(100.0%)	1	NA	NA
AVM99000.1|44601_48561_-	DUF1738 domain-containing protein	NA	A0A1V0EBY3	Caulobacter_phage	38.8	1.7e-32
