The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP023863	Prevotella jejuni strain CD3:33 chromosome I, complete sequence	2204592	0	2063	2204592	transposase	Burkholderia_phage(100.0%)	2	NA	NA
AUI53873.1|427_904_+	hypothetical protein	NA	NA	NA	NA	NA
AUI53874.1|857_2063_-|transposase	ISL3 family transposase	transposase	A9YX10	Burkholderia_phage	32.2	2.4e-51
>prophage 2
CP023863	Prevotella jejuni strain CD3:33 chromosome I, complete sequence	2204592	15643	16840	2204592		Hokovirus(100.0%)	1	NA	NA
AUI53884.1|15643_16840_+	serine/threonine protein kinase	NA	A0A1V0SGY7	Hokovirus	33.6	3.5e-10
>prophage 3
CP023863	Prevotella jejuni strain CD3:33 chromosome I, complete sequence	2204592	22014	23916	2204592		Bacillus_phage(100.0%)	1	NA	NA
AUI55378.1|22014_23916_+	type IIA DNA topoisomerase subunit B	NA	A0A172JHT4	Bacillus_phage	32.6	1.8e-61
>prophage 4
CP023863	Prevotella jejuni strain CD3:33 chromosome I, complete sequence	2204592	53099	56958	2204592		Bacillus_phage(50.0%)	4	NA	NA
AUI53915.1|53099_54134_-	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	26.2	8.3e-08
AUI53916.1|54395_55331_+	YitT family protein	NA	NA	NA	NA	NA
AUI53917.1|55492_56107_-	glutathione peroxidase	NA	NA	NA	NA	NA
AUI53918.1|56265_56958_-	NAD-dependent protein deacylase	NA	A0A2C9CZC8	Yersinia_phage	36.7	1.2e-21
>prophage 5
CP023863	Prevotella jejuni strain CD3:33 chromosome I, complete sequence	2204592	70903	72826	2204592		Diachasmimorpha_longicaudata_entomopoxvirus(100.0%)	1	NA	NA
AUI53928.1|70903_72826_-	ATP-dependent RNA helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	35.6	5.8e-55
>prophage 6
CP023863	Prevotella jejuni strain CD3:33 chromosome I, complete sequence	2204592	99030	99549	2204592		Catovirus(100.0%)	1	NA	NA
AUI53941.1|99030_99549_-	TIGR00730 family Rossman fold protein	NA	A0A1V0S9E9	Catovirus	28.3	3.8e-09
>prophage 7
CP023863	Prevotella jejuni strain CD3:33 chromosome I, complete sequence	2204592	103465	104707	2204592		Tupanvirus(100.0%)	1	NA	NA
AUI55381.1|103465_104707_+	insulinase family protein	NA	A0A2K9L1M6	Tupanvirus	28.2	1.2e-42
>prophage 8
CP023863	Prevotella jejuni strain CD3:33 chromosome I, complete sequence	2204592	107782	108868	2204592		Lake_Baikal_phage(100.0%)	1	NA	NA
AUI53947.1|107782_108868_-	DNA/RNA non-specific endonuclease	NA	A0A2H4N7Z3	Lake_Baikal_phage	28.9	7.1e-18
>prophage 9
CP023863	Prevotella jejuni strain CD3:33 chromosome I, complete sequence	2204592	126996	128901	2204592		Bacillus_phage(100.0%)	1	NA	NA
AUI53959.1|126996_128901_+	2,6-beta-D-fructofuranosidase	NA	F8WPR5	Bacillus_phage	32.0	1.3e-59
>prophage 10
CP023863	Prevotella jejuni strain CD3:33 chromosome I, complete sequence	2204592	141059	147084	2204592		Bacillus_phage(50.0%)	4	NA	NA
AUI53965.1|141059_142754_+	2,6-beta-D-fructofuranosidase	NA	F8WPR5	Bacillus_phage	34.6	6.7e-55
AUI53966.1|142919_144083_+	MFS transporter	NA	NA	NA	NA	NA
AUI53967.1|144090_144972_+	carbohydrate kinase	NA	NA	NA	NA	NA
AUI53968.1|145539_147084_+	arylsulfatase	NA	A0A2P0VMN7	Tetraselmis_virus	27.3	9.5e-32
>prophage 11
CP023863	Prevotella jejuni strain CD3:33 chromosome I, complete sequence	2204592	150201	153153	2204592		Ralstonia_phage(50.0%)	2	NA	NA
AUI53970.1|150201_150738_+	DNA mismatch repair protein MutT	NA	B2ZXX2	Ralstonia_phage	30.9	2.1e-07
AUI53971.1|150816_153153_+	DNA topoisomerase I	NA	A0A0G2Y787	Acanthamoeba_polyphaga_mimivirus	40.0	9.9e-142
>prophage 12
CP023863	Prevotella jejuni strain CD3:33 chromosome I, complete sequence	2204592	162387	163392	2204592		Microcystis_virus(100.0%)	1	NA	NA
AUI53979.1|162387_163392_-	sugar tyrosine-protein kinase	NA	A0A7K9	Microcystis_virus	49.0	7.8e-19
>prophage 13
CP023863	Prevotella jejuni strain CD3:33 chromosome I, complete sequence	2204592	168664	170344	2204592		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
AUI53984.1|168664_170344_+	ABC transporter ATP-binding protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	33.5	4.5e-27
>prophage 14
CP023863	Prevotella jejuni strain CD3:33 chromosome I, complete sequence	2204592	208291	218218	2204592		Cafeteria_roenbergensis_virus(50.0%)	8	NA	NA
AUI54006.1|208291_211153_+	translation initiation factor IF-2	NA	E3T4N3	Cafeteria_roenbergensis_virus	23.5	4.8e-21
AUI54007.1|211509_212955_+	Fe-S cluster assembly protein SufB	NA	NA	NA	NA	NA
AUI54008.1|212969_213374_+	hypothetical protein	NA	NA	NA	NA	NA
AUI54009.1|213386_214142_+	Fe-S cluster assembly ATPase SufC	NA	A0A285PWH2	Cedratvirus	31.1	3.9e-07
AUI54010.1|214394_215738_+	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
AUI54011.1|215840_217058_+	cysteine desulfurase	NA	Q2XUY6	environmental_halophage	43.6	3.6e-103
AUI55387.1|217153_217447_-	hypothetical protein	NA	NA	NA	NA	NA
AUI54012.1|217615_218218_+	ribonuclease HII	NA	E3T5H8	Cafeteria_roenbergensis_virus	44.1	5.9e-30
>prophage 15
CP023863	Prevotella jejuni strain CD3:33 chromosome I, complete sequence	2204592	227008	232166	2204592		Bacillus_virus(50.0%)	4	NA	NA
AUI54020.1|227008_228982_+	DNA gyrase subunit B	NA	G3M9Z3	Bacillus_virus	45.7	1.4e-141
AUI55388.1|229531_230416_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AUI54021.1|230600_231191_-	DUF3109 domain-containing protein	NA	NA	NA	NA	NA
AUI54022.1|231500_232166_-	uracil-DNA glycosylase	NA	V5NWU7	Chelonid_alphaherpesvirus	42.7	3.5e-44
>prophage 16
CP023863	Prevotella jejuni strain CD3:33 chromosome I, complete sequence	2204592	248002	248950	2204592	transposase	unidentified_phage(100.0%)	1	NA	NA
AUI54035.1|248002_248950_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	27.0	1.6e-18
>prophage 17
CP023863	Prevotella jejuni strain CD3:33 chromosome I, complete sequence	2204592	284323	286480	2204592		unidentified_phage(100.0%)	1	NA	NA
AUI54058.1|284323_286480_-	hypothetical protein	NA	H7BUJ6	unidentified_phage	42.1	4.2e-86
>prophage 18
CP023863	Prevotella jejuni strain CD3:33 chromosome I, complete sequence	2204592	295642	297670	2204592		Cafeteria_roenbergensis_virus(100.0%)	1	NA	NA
AUI54065.1|295642_297670_-	peptidase M13	NA	E3T4I7	Cafeteria_roenbergensis_virus	30.4	1.8e-75
>prophage 19
CP023863	Prevotella jejuni strain CD3:33 chromosome I, complete sequence	2204592	316899	317730	2204592	holin	Catovirus(100.0%)	1	NA	NA
AUI54080.1|316899_317730_+|holin	lipopolysaccharide cholinephosphotransferase	holin	A0A1V0SAS8	Catovirus	39.2	6.9e-05
>prophage 20
CP023863	Prevotella jejuni strain CD3:33 chromosome I, complete sequence	2204592	327401	328505	2204592		NY_014_poxvirus(100.0%)	1	NA	NA
AUI54087.1|327401_328505_-	guanylate kinase	NA	A0A223FNL1	NY_014_poxvirus	34.7	2.7e-20
>prophage 21
CP023863	Prevotella jejuni strain CD3:33 chromosome I, complete sequence	2204592	337723	341470	2204592		Equid_gammaherpesvirus(100.0%)	1	NA	NA
AUI54097.1|337723_341470_-	phosphoribosylformylglycinamidine synthase	NA	A0A0B4Q6P6	Equid_gammaherpesvirus	24.6	4.0e-36
>prophage 22
CP023863	Prevotella jejuni strain CD3:33 chromosome I, complete sequence	2204592	359402	360884	2204592		Microcystis_phage(100.0%)	1	NA	NA
AUI54107.1|359402_360884_-	gliding motility-associated lipoprotein GldK	NA	A0A075BSL8	Microcystis_phage	31.9	2.6e-10
>prophage 23
CP023863	Prevotella jejuni strain CD3:33 chromosome I, complete sequence	2204592	386014	392009	2204592		Acinetobacter_phage(33.33%)	5	NA	NA
AUI55394.1|386014_387802_+	aminopeptidase P family protein	NA	A0A0P0I8D7	Acinetobacter_phage	38.7	3.4e-118
AUI54123.1|388828_389020_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
AUI54124.1|389091_389976_+	tyrosine recombinase XerC	NA	T2KT84	uncultured_phage	30.6	1.3e-06
AUI54125.1|389998_390298_+	ribosomal subunit interface protein	NA	NA	NA	NA	NA
AUI54126.1|390812_392009_+	elongation factor Tu	NA	A0A2H4UVR3	Bodo_saltans_virus	26.0	7.6e-13
>prophage 24
CP023863	Prevotella jejuni strain CD3:33 chromosome I, complete sequence	2204592	395247	403456	2204592		Chrysochromulina_ericina_virus(50.0%)	2	NA	NA
AUI54133.1|395247_399057_+	DNA-directed RNA polymerase subunit beta	NA	A0A0N9R0J7	Chrysochromulina_ericina_virus	33.0	3.8e-34
AUI54134.1|399085_403456_+	DNA-directed RNA polymerase subunit beta'	NA	A0A2I7QNZ7	Vibrio_phage	25.7	4.7e-68
>prophage 25
CP023863	Prevotella jejuni strain CD3:33 chromosome I, complete sequence	2204592	429856	431974	2204592		Streptococcus_phage(100.0%)	1	NA	NA
AUI54153.1|429856_431974_+	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	25.9	1.6e-53
>prophage 26
CP023863	Prevotella jejuni strain CD3:33 chromosome I, complete sequence	2204592	479806	480601	2204592		Sinorhizobium_phage(100.0%)	1	NA	NA
AUI54201.1|479806_480601_-	septal ring lytic transglycosylase RlpA family protein	NA	S5MVR9	Sinorhizobium_phage	45.9	1.2e-19
>prophage 27
CP023863	Prevotella jejuni strain CD3:33 chromosome I, complete sequence	2204592	505618	507589	2204592		Acinetobacter_phage(100.0%)	1	NA	NA
AUI54222.1|505618_507589_+	TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	32.0	1.7e-09
>prophage 28
CP023863	Prevotella jejuni strain CD3:33 chromosome I, complete sequence	2204592	514966	522314	2204592		Phaeocystis_pouchetii_virus(33.33%)	6	NA	NA
AUI54228.1|514966_516784_+	DNA mismatch repair protein MutS	NA	F2QAF8	Phaeocystis_pouchetii_virus	29.3	3.7e-11
AUI54229.1|517034_517850_-	HAD family phosphatase	NA	NA	NA	NA	NA
AUI54230.1|518106_518814_+	MIP family channel protein	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	23.0	5.9e-05
AUI54231.1|519017_520031_+	fructose-1,6-bisphosphate aldolase, class II	NA	NA	NA	NA	NA
AUI54232.1|520175_521693_-	bifunctional ADP-dependent (S)-NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase	NA	NA	NA	NA	NA
AUI54233.1|521774_522314_+	hypoxanthine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	33.9	6.2e-15
>prophage 29
CP023863	Prevotella jejuni strain CD3:33 chromosome I, complete sequence	2204592	542895	544101	2204592		Staphylococcus_phage(100.0%)	1	NA	NA
AUI54253.1|542895_544101_+	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	47.7	5.2e-102
>prophage 30
CP023863	Prevotella jejuni strain CD3:33 chromosome I, complete sequence	2204592	557384	557981	2204592		Prochlorococcus_phage(100.0%)	1	NA	NA
AUI54265.1|557384_557981_+	IMP cyclohydrolase	NA	Q58MG3	Prochlorococcus_phage	41.9	1.5e-33
>prophage 31
CP023863	Prevotella jejuni strain CD3:33 chromosome I, complete sequence	2204592	567471	568611	2204592		Streptococcus_virus(100.0%)	1	NA	NA
AUI54273.1|567471_568611_-	DNA polymerase III subunit delta	NA	A0A1U9WR94	Streptococcus_virus	28.1	1.8e-11
>prophage 32
CP023863	Prevotella jejuni strain CD3:33 chromosome I, complete sequence	2204592	573894	575743	2204592		Mycoplasma_phage(50.0%)	2	NA	NA
AUI55405.1|573894_574494_-	thymidine kinase	NA	Q6GYZ9	Mycoplasma_phage	42.8	5.8e-30
AUI54278.1|575020_575743_+	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	46.6	8.6e-52
>prophage 33
CP023863	Prevotella jejuni strain CD3:33 chromosome I, complete sequence	2204592	597131	598106	2204592		Geobacillus_virus(100.0%)	1	NA	NA
AUI54294.1|597131_598106_-	site-specific DNA-methyltransferase	NA	A0A0H3UZ66	Geobacillus_virus	28.6	1.4e-17
>prophage 34
CP023863	Prevotella jejuni strain CD3:33 chromosome I, complete sequence	2204592	601320	605432	2204592		Staphylococcus_phage(50.0%)	2	NA	NA
AUI54296.1|601320_601635_-	thioredoxin	NA	A0A1X9I9P5	Staphylococcus_phage	38.3	3.6e-15
AUI54297.1|601712_605432_-	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	32.3	1.3e-172
>prophage 35
CP023863	Prevotella jejuni strain CD3:33 chromosome I, complete sequence	2204592	623259	625884	2204592	transposase	environmental_Halophage(50.0%)	2	NA	NA
AUI54309.1|623259_624603_+	purine permease	NA	H9YQ34	environmental_Halophage	48.8	7.5e-25
AUI55407.1|624945_625884_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	29.2	2.5e-19
>prophage 36
CP023863	Prevotella jejuni strain CD3:33 chromosome I, complete sequence	2204592	629043	633371	2204592		Pseudomonas_phage(33.33%)	5	NA	NA
AUI54314.1|629043_630525_-	MBOAT family protein	NA	A0A125RNP0	Pseudomonas_phage	37.8	2.4e-69
AUI54315.1|630558_631311_-	SGNH/GDSL hydrolase family protein	NA	NA	NA	NA	NA
AUI54316.1|631320_632070_-	exodeoxyribonuclease III	NA	E3T4M6	Cafeteria_roenbergensis_virus	47.7	2.8e-61
AUI54317.1|632126_632744_-	DUF4840 domain-containing protein	NA	NA	NA	NA	NA
AUI54318.1|632777_633371_-	GTP cyclohydrolase I FolE	NA	S4VV34	Pandoravirus	51.3	6.4e-45
>prophage 37
CP023863	Prevotella jejuni strain CD3:33 chromosome I, complete sequence	2204592	640532	655649	2204592	integrase,tRNA	Mycobacterium_phage(25.0%)	10	632096:632111	666381:666396
632096:632111	attL	TTAATTAAACCTTAAT	NA	NA	NA	NA
AUI54324.1|640532_641957_+|tRNA	tRNA nucleotidyltransferase	tRNA	A0A2I2MPB1	Mycobacterium_phage	36.9	1.7e-27
AUI54325.1|642155_643490_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
AUI54326.1|643572_646836_+	AcrB/AcrD/AcrF family protein	NA	S5VTK5	Leptospira_phage	21.8	2.8e-57
AUI54327.1|646857_648237_+	multidrug transporter	NA	NA	NA	NA	NA
AUI54328.1|648268_649051_+	acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase	NA	NA	NA	NA	NA
AUI54329.1|649785_651015_+|integrase	integrase	integrase	H7BUI8	unidentified_phage	34.0	1.1e-27
AUI54330.1|651079_652375_+|integrase	integrase	integrase	NA	NA	NA	NA
AUI54331.1|652371_652788_+	hypothetical protein	NA	NA	NA	NA	NA
AUI54332.1|652962_653442_-	HlyD family secretion protein	NA	NA	NA	NA	NA
AUI54333.1|653459_655649_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	28.5	6.6e-39
666381:666396	attR	TTAATTAAACCTTAAT	NA	NA	NA	NA
>prophage 38
CP023863	Prevotella jejuni strain CD3:33 chromosome I, complete sequence	2204592	661215	662088	2204592		Cedratvirus(100.0%)	1	NA	NA
AUI54338.1|661215_662088_-	ABC transporter ATP-binding protein	NA	A0A2R8FFL6	Cedratvirus	28.8	1.0e-14
>prophage 39
CP023863	Prevotella jejuni strain CD3:33 chromosome I, complete sequence	2204592	669681	671046	2204592		Lactococcus_phage(100.0%)	1	NA	NA
AUI54344.1|669681_671046_+	virulence protein	NA	D3W0G0	Lactococcus_phage	31.3	7.1e-15
>prophage 40
CP023863	Prevotella jejuni strain CD3:33 chromosome I, complete sequence	2204592	678326	679568	2204592		Bodo_saltans_virus(100.0%)	1	NA	NA
AUI54352.1|678326_679568_-	DUF1810 domain-containing protein	NA	A0A2H4UVK5	Bodo_saltans_virus	42.6	1.8e-12
>prophage 41
CP023863	Prevotella jejuni strain CD3:33 chromosome I, complete sequence	2204592	713533	715724	2204592		Catovirus(50.0%)	2	NA	NA
AUI54375.1|713533_714490_+	SPFH/Band 7/PHB domain protein	NA	A0A1V0SB59	Catovirus	28.9	6.3e-18
AUI54376.1|714599_715724_+	UDP-N-acetyl glucosamine 2-epimerase	NA	A0A1V0SJE0	Klosneuvirus	28.0	9.9e-31
>prophage 42
CP023863	Prevotella jejuni strain CD3:33 chromosome I, complete sequence	2204592	719195	721115	2204592		uncultured_virus(100.0%)	1	NA	NA
AUI54380.1|719195_721115_+	ATPase P	NA	A0A218MNH6	uncultured_virus	31.9	1.6e-81
>prophage 43
CP023863	Prevotella jejuni strain CD3:33 chromosome I, complete sequence	2204592	731667	732927	2204592		Acanthocystis_turfacea_Chlorella_virus(100.0%)	1	NA	NA
AUI54389.1|731667_732927_+	nucleotide sugar dehydrogenase	NA	M1IB49	Acanthocystis_turfacea_Chlorella_virus	48.8	9.2e-102
>prophage 44
CP023863	Prevotella jejuni strain CD3:33 chromosome I, complete sequence	2204592	773298	774561	2204592	integrase	unidentified_phage(100.0%)	1	760653:760668	783957:783972
760653:760668	attL	CGTCAATGGAACGAAG	NA	NA	NA	NA
AUI54404.1|773298_774561_-|integrase	integrase	integrase	H7BUI8	unidentified_phage	34.6	1.2e-24
AUI54404.1|773298_774561_-|integrase	integrase	integrase	H7BUI8	unidentified_phage	34.6	1.2e-24
783957:783972	attR	CGTCAATGGAACGAAG	NA	NA	NA	NA
>prophage 45
CP023863	Prevotella jejuni strain CD3:33 chromosome I, complete sequence	2204592	780853	782329	2204592		Anomala_cuprea_entomopoxvirus(100.0%)	1	NA	NA
AUI55417.1|780853_782329_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	28.3	1.1e-26
>prophage 46
CP023863	Prevotella jejuni strain CD3:33 chromosome I, complete sequence	2204592	786486	787575	2204592		Pandoravirus(100.0%)	1	NA	NA
AUI54410.1|786486_787575_+	chorismate synthase	NA	A0A291AU41	Pandoravirus	51.0	4.8e-91
>prophage 47
CP023863	Prevotella jejuni strain CD3:33 chromosome I, complete sequence	2204592	792322	792997	2204592		Bacillus_virus(100.0%)	1	NA	NA
AUI54416.1|792322_792997_-	methyltransferase	NA	G3MA03	Bacillus_virus	46.5	1.1e-19
>prophage 48
CP023863	Prevotella jejuni strain CD3:33 chromosome I, complete sequence	2204592	813542	815564	2204592		Clostridium_botulinum_C_phage(100.0%)	1	NA	NA
AUI54430.1|813542_815564_-	NAD-dependent DNA ligase LigA	NA	Q332J4	Clostridium_botulinum_C_phage	38.6	8.1e-116
>prophage 49
CP023863	Prevotella jejuni strain CD3:33 chromosome I, complete sequence	2204592	827535	838959	2204592		Noumeavirus(20.0%)	9	NA	NA
AUI54438.1|827535_829068_-	ATP-dependent endonuclease	NA	A0A1Q1PMX7	Noumeavirus	20.1	5.5e-08
AUI54439.1|829090_829975_-	DNA/RNA non-specific endonuclease	NA	A0A2H4N7Z3	Lake_Baikal_phage	35.4	1.9e-29
AUI54440.1|830289_830499_+	hypothetical protein	NA	NA	NA	NA	NA
AUI54441.1|830654_831476_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.8	1.2e-14
AUI54442.1|831495_832224_+	hypothetical protein	NA	NA	NA	NA	NA
AUI54443.1|832244_833033_+	hypothetical protein	NA	NA	NA	NA	NA
AUI54444.1|833060_833420_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AUI54445.1|833597_837623_-	ATP-dependent helicase	NA	A0A160DHD3	Gordonia_phage	29.1	1.5e-44
AUI54446.1|837939_838959_-	recombinase RecA	NA	A0A2D1GPX2	Mycobacterium_phage	65.5	3.1e-116
>prophage 50
CP023863	Prevotella jejuni strain CD3:33 chromosome I, complete sequence	2204592	851169	860757	2204592	transposase	Streptococcus_phage(25.0%)	4	NA	NA
AUI54455.1|851169_852594_-	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	E4ZFI6	Streptococcus_phage	31.2	8.1e-54
AUI54456.1|852797_855524_+	pyruvate, phosphate dikinase	NA	H8YJB7	Vibrio_phage	39.3	6.2e-87
AUI54457.1|856755_859344_-	ATP-dependent chaperone ClpB	NA	A0A223W0B1	Agrobacterium_phage	34.1	4.2e-125
AUI54458.1|859809_860757_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	27.0	1.6e-18
>prophage 51
CP023863	Prevotella jejuni strain CD3:33 chromosome I, complete sequence	2204592	878625	879579	2204592		Enterobacteria_phage(100.0%)	1	NA	NA
AUI54472.1|878625_879579_+	glycosyltransferase	NA	M1FQW5	Enterobacteria_phage	28.8	2.0e-24
>prophage 52
CP023863	Prevotella jejuni strain CD3:33 chromosome I, complete sequence	2204592	883546	886266	2204592		Indivirus(50.0%)	2	NA	NA
AUI54476.1|883546_885631_+	peptidase M3	NA	A0A1V0SD92	Indivirus	22.9	3.7e-39
AUI54477.1|885762_886266_+	cytidine deaminase	NA	H6WFU3	Cyanophage	50.8	1.6e-33
>prophage 53
CP023863	Prevotella jejuni strain CD3:33 chromosome I, complete sequence	2204592	895386	897113	2204592		Tetraselmis_virus(50.0%)	2	NA	NA
AUI54486.1|895386_896358_-	KpsF/GutQ family sugar-phosphate isomerase	NA	A0A2P0VNK5	Tetraselmis_virus	35.7	2.3e-39
AUI54487.1|896354_897113_-	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	49.4	6.4e-58
>prophage 54
CP023863	Prevotella jejuni strain CD3:33 chromosome I, complete sequence	2204592	922944	926235	2204592		Rhizobium_phage(33.33%)	3	NA	NA
AUI54507.1|922944_924069_+	DNA polymerase III subunit beta	NA	B4UTW9	Rhizobium_phage	26.7	3.2e-29
AUI54508.1|924164_925019_+	3'-5' exonuclease	NA	A0A1P8VWC8	Flavobacterium_phage	39.5	2.2e-38
AUI54509.1|925023_926235_+	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	31.6	1.7e-36
>prophage 55
CP023863	Prevotella jejuni strain CD3:33 chromosome I, complete sequence	2204592	954265	961582	2204592	protease	Brevibacillus_phage(33.33%)	7	NA	NA
AUI54525.1|954265_955690_+|protease	serine protease	protease	A0A0K2CNJ2	Brevibacillus_phage	34.6	4.4e-07
AUI54526.1|955714_957019_+	exodeoxyribonuclease VII large subunit	NA	A0A2P1EMK6	Moumouvirus	38.7	4.7e-16
AUI54527.1|957060_957249_+	exodeoxyribonuclease VII small subunit	NA	NA	NA	NA	NA
AUI54528.1|957346_958390_+	branched-chain amino acid aminotransferase	NA	NA	NA	NA	NA
AUI54529.1|958670_959156_+	ferritin	NA	NA	NA	NA	NA
AUI54530.1|959268_959808_-	hypothetical protein	NA	NA	NA	NA	NA
AUI54531.1|959812_961582_-	hypothetical protein	NA	H7BUJ6	unidentified_phage	41.3	1.2e-83
>prophage 56
CP023863	Prevotella jejuni strain CD3:33 chromosome I, complete sequence	2204592	968637	973248	2204592		uncultured_Mediterranean_phage(50.0%)	5	NA	NA
AUI55426.1|968637_969858_-	HD domain-containing protein	NA	A0A1B1ISR1	uncultured_Mediterranean_phage	31.4	4.4e-24
AUI55427.1|970341_970551_+	hypothetical protein	NA	NA	NA	NA	NA
AUI54537.1|970674_972216_+	phosphotransferase	NA	NA	NA	NA	NA
AUI54538.1|972372_972729_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
AUI54539.1|972738_973248_-	thioredoxin	NA	A0A1X9I9P5	Staphylococcus_phage	32.2	8.8e-11
>prophage 57
CP023863	Prevotella jejuni strain CD3:33 chromosome I, complete sequence	2204592	982818	984738	2204592		Megavirus(100.0%)	1	NA	NA
AUI54548.1|982818_984738_+	polysaccharide biosynthesis protein	NA	K7Y9E1	Megavirus	30.7	6.0e-28
>prophage 58
CP023863	Prevotella jejuni strain CD3:33 chromosome I, complete sequence	2204592	1005927	1008662	2204592	tRNA	Tupanvirus(50.0%)	2	NA	NA
AUI54567.1|1005927_1007286_-|tRNA	histidine--tRNA ligase	tRNA	A0A2K9L0H9	Tupanvirus	32.7	4.5e-46
AUI54568.1|1007387_1008662_-	adenylosuccinate synthase	NA	A0A0B5J049	Pandoravirus	31.0	6.6e-55
>prophage 59
CP023863	Prevotella jejuni strain CD3:33 chromosome I, complete sequence	2204592	1019036	1020038	2204592		Acanthocystis_turfacea_Chlorella_virus(100.0%)	1	NA	NA
AUI54578.1|1019036_1020038_-	2-hydroxyacid dehydrogenase	NA	M1HUW8	Acanthocystis_turfacea_Chlorella_virus	42.8	3.8e-58
>prophage 60
CP023863	Prevotella jejuni strain CD3:33 chromosome I, complete sequence	2204592	1035500	1037369	2204592		Aureococcus_anophage(100.0%)	1	NA	NA
AUI54592.1|1035500_1037369_-	DNA topoisomerase III	NA	A0A076FM50	Aureococcus_anophage	24.9	5.2e-16
>prophage 61
CP023863	Prevotella jejuni strain CD3:33 chromosome I, complete sequence	2204592	1040401	1048961	2204592		Streptococcus_phage(66.67%)	6	NA	NA
AUI54596.1|1040401_1041709_+	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	67.1	5.7e-155
AUI54597.1|1042578_1043997_-	hypothetical protein	NA	NA	NA	NA	NA
AUI54598.1|1044158_1045208_-	glycerate kinase	NA	W6LM47	Streptococcus_phage	35.7	6.2e-27
AUI54599.1|1045303_1047082_+	signal peptide peptidase SppA	NA	NA	NA	NA	NA
AUI54600.1|1047088_1048267_+	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
AUI54601.1|1048151_1048961_+	purine-nucleoside phosphorylase	NA	Q5YBA4	Grouper_iridovirus	41.8	3.1e-58
>prophage 62
CP023863	Prevotella jejuni strain CD3:33 chromosome I, complete sequence	2204592	1053393	1055553	2204592		Cronobacter_phage(100.0%)	1	NA	NA
AUI54605.1|1053393_1055553_+	anaerobic ribonucleoside-triphosphate reductase	NA	A0A060AN10	Cronobacter_phage	52.0	9.1e-182
>prophage 63
CP023863	Prevotella jejuni strain CD3:33 chromosome I, complete sequence	2204592	1067592	1072873	2204592	transposase	Aeromonas_phage(50.0%)	3	NA	NA
AUI54616.1|1067592_1068873_+	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	48.4	1.1e-91
AUI54617.1|1069312_1070614_-	peptidase M64	NA	NA	NA	NA	NA
AUI54618.1|1071211_1072873_-|transposase	IS5/IS1182 family transposase	transposase	A0A146ICT8	Staphylococcus_phage	32.5	8.8e-60
>prophage 64
CP023863	Prevotella jejuni strain CD3:33 chromosome I, complete sequence	2204592	1078560	1082457	2204592	capsid	Enterobacteria_phage(50.0%)	3	NA	NA
AUI54626.1|1078560_1079451_+	glucose-1-phosphate thymidylyltransferase	NA	I7I009	Enterobacteria_phage	64.6	6.1e-108
AUI54627.1|1079484_1081998_+|capsid	capsid assembly protein	capsid	NA	NA	NA	NA
AUI54628.1|1082031_1082457_+	hypothetical protein	NA	A0A1W6DYI0	Aeromonas_phage	44.4	3.4e-16
>prophage 65
CP023863	Prevotella jejuni strain CD3:33 chromosome I, complete sequence	2204592	1107161	1120215	2204592	tRNA	Pseudoalteromonas_phage(16.67%)	9	NA	NA
AUI54645.1|1107161_1107569_-	single-stranded DNA-binding protein	NA	S5M9Z7	Pseudoalteromonas_phage	42.6	8.6e-17
AUI54646.1|1107599_1108139_-	hypothetical protein	NA	NA	NA	NA	NA
AUI54647.1|1110189_1111380_-	8-amino-7-oxononanoate synthase	NA	V5LQ39	Emiliania_huxleyi_virus	33.4	4.7e-47
AUI54648.1|1111575_1112607_+	diacylglycerol kinase	NA	A0A1V0SBJ0	Catovirus	24.2	2.2e-08
AUI54649.1|1112626_1113337_+	methyltransferase	NA	NA	NA	NA	NA
AUI54650.1|1113611_1116077_+	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	40.3	7.2e-151
AUI54651.1|1116076_1117204_+|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	42.3	4.6e-76
AUI54652.1|1117215_1118433_+	YjgP/YjgQ family permease	NA	NA	NA	NA	NA
AUI54653.1|1118493_1120215_+	ATP-dependent helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	32.4	2.6e-54
>prophage 66
CP023863	Prevotella jejuni strain CD3:33 chromosome I, complete sequence	2204592	1131418	1138555	2204592		uncultured_virus(50.0%)	8	NA	NA
AUI54660.1|1131418_1132885_+	deoxyribonuclease HsdR	NA	A0A1B1IRD3	uncultured_Mediterranean_phage	31.1	5.1e-11
AUI54661.1|1133167_1134031_+	RNA polymerase subunit sigma	NA	G8CLC7	Synechococcus_phage	29.7	1.1e-29
AUI54662.1|1134061_1134562_+	hypothetical protein	NA	NA	NA	NA	NA
AUI54663.1|1134548_1135436_+	hypothetical protein	NA	NA	NA	NA	NA
AUI54664.1|1135511_1135997_+	peptidase S41	NA	NA	NA	NA	NA
AUI54665.1|1136039_1136444_+	pyrroloquinoline quinone biosynthesis protein PqqD	NA	NA	NA	NA	NA
AUI54666.1|1136556_1138182_-	chaperonin GroEL	NA	A0A219YK78	uncultured_virus	61.9	1.2e-183
AUI54667.1|1138285_1138555_-	co-chaperone GroES	NA	A0A221S4G8	uncultured_virus	48.4	2.9e-13
>prophage 67
CP023863	Prevotella jejuni strain CD3:33 chromosome I, complete sequence	2204592	1148686	1153608	2204592		uncultured_Mediterranean_phage(50.0%)	2	NA	NA
AUI54678.1|1148686_1151560_+	excinuclease ABC subunit A	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	43.2	4.9e-215
AUI54679.1|1152078_1153608_-	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	26.7	7.7e-34
>prophage 68
CP023863	Prevotella jejuni strain CD3:33 chromosome I, complete sequence	2204592	1157942	1160771	2204592		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
AUI54682.1|1157942_1160771_+	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	50.2	3.6e-271
>prophage 69
CP023863	Prevotella jejuni strain CD3:33 chromosome I, complete sequence	2204592	1168380	1173538	2204592		Halovirus(33.33%)	3	NA	NA
AUI54688.1|1168380_1169457_-	carbamoyl-phosphate synthase (glutamine-hydrolyzing) small subunit	NA	R4TGJ8	Halovirus	33.7	1.9e-47
AUI54689.1|1169607_1171509_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	22.6	7.1e-13
AUI54690.1|1171690_1173538_-	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	M1HVL7	Paramecium_bursaria_Chlorella_virus	39.1	2.3e-109
>prophage 70
CP023863	Prevotella jejuni strain CD3:33 chromosome I, complete sequence	2204592	1180432	1181386	2204592		Clostridium_phage(100.0%)	1	NA	NA
AUI54696.1|1180432_1181386_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A0A7RUS8	Clostridium_phage	40.3	1.7e-23
>prophage 71
CP023863	Prevotella jejuni strain CD3:33 chromosome I, complete sequence	2204592	1192141	1193682	2204592		Catovirus(50.0%)	2	NA	NA
AUI54706.1|1192141_1193089_-	glycosyltransferase family 2 protein	NA	A0A1V0SAH6	Catovirus	38.5	1.8e-09
AUI54707.1|1193085_1193682_-	serine acetyltransferase	NA	A0A1L2JYI5	Streptococcus_phage	30.4	1.4e-15
>prophage 72
CP023863	Prevotella jejuni strain CD3:33 chromosome I, complete sequence	2204592	1198007	1199279	2204592		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
AUI54712.1|1198007_1199279_-	nucleotide sugar dehydrogenase	NA	M1HWZ1	Paramecium_bursaria_Chlorella_virus	27.6	2.1e-24
>prophage 73
CP023863	Prevotella jejuni strain CD3:33 chromosome I, complete sequence	2204592	1215981	1222015	2204592		Pandoravirus(33.33%)	6	NA	NA
AUI54729.1|1215981_1216551_-	threonylcarbamoyl-AMP synthase	NA	S4VW33	Pandoravirus	26.9	6.0e-08
AUI54730.1|1216982_1217984_-	glucokinase	NA	NA	NA	NA	NA
AUI54731.1|1218114_1218807_+	lysine transporter LysE	NA	NA	NA	NA	NA
AUI54732.1|1218809_1219418_+	DUF4924 domain-containing protein	NA	NA	NA	NA	NA
AUI54733.1|1219430_1220318_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	37.3	1.2e-36
AUI54734.1|1220446_1222015_+	peptide chain release factor 3	NA	A0A2K5B2A5	Erysipelothrix_phage	26.7	1.0e-33
>prophage 74
CP023863	Prevotella jejuni strain CD3:33 chromosome I, complete sequence	2204592	1227309	1227879	2204592		Acinetobacter_phage(100.0%)	1	NA	NA
AUI54740.1|1227309_1227879_+	type 1 glutamine amidotransferase	NA	A0A0P0IKJ1	Acinetobacter_phage	44.5	5.4e-41
>prophage 75
CP023863	Prevotella jejuni strain CD3:33 chromosome I, complete sequence	2204592	1262123	1264945	2204592	transposase	unidentified_phage(50.0%)	3	NA	NA
AUI54764.1|1262123_1263071_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	27.0	1.6e-18
AUI54765.1|1263218_1264304_+	hypothetical protein	NA	NA	NA	NA	NA
AUI54766.1|1264348_1264945_+	hypothetical protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	46.8	1.5e-06
>prophage 76
CP023863	Prevotella jejuni strain CD3:33 chromosome I, complete sequence	2204592	1312661	1316382	2204592		Bacillus_phage(50.0%)	2	NA	NA
AUI54797.1|1312661_1314386_+	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	30.1	2.7e-75
AUI54798.1|1314489_1316382_+	RecQ family ATP-dependent DNA helicase	NA	A0A2K9L3P7	Tupanvirus	41.1	1.8e-64
>prophage 77
CP023863	Prevotella jejuni strain CD3:33 chromosome I, complete sequence	2204592	1322898	1323783	2204592		Enterococcus_phage(100.0%)	1	NA	NA
AUI54806.1|1322898_1323783_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase	NA	A0A249XZQ2	Enterococcus_phage	31.6	5.8e-26
>prophage 78
CP023863	Prevotella jejuni strain CD3:33 chromosome I, complete sequence	2204592	1357616	1359360	2204592		Cafeteria_roenbergensis_virus(50.0%)	2	NA	NA
AUI54828.1|1357616_1358435_+	molecular chaperone DjlA	NA	E3T4P7	Cafeteria_roenbergensis_virus	46.2	2.3e-05
AUI54829.1|1358613_1359360_+	peptidylprolyl isomerase	NA	A0A1V0S9I2	Catovirus	25.3	4.8e-05
>prophage 79
CP023863	Prevotella jejuni strain CD3:33 chromosome I, complete sequence	2204592	1364214	1366623	2204592		Paramecium_bursaria_Chlorella_virus(50.0%)	2	NA	NA
AUI54833.1|1364214_1365099_+	acyltransferase	NA	M1H5W0	Paramecium_bursaria_Chlorella_virus	39.1	1.6e-55
AUI54834.1|1365585_1366623_-	aspartate--ammonia ligase	NA	A0A1C9C5F0	Heterosigma_akashiwo_virus	38.5	1.5e-52
>prophage 80
CP023863	Prevotella jejuni strain CD3:33 chromosome I, complete sequence	2204592	1383610	1385422	2204592		Streptococcus_virus(100.0%)	1	NA	NA
AUI54846.1|1383610_1385422_-	DNA polymerase III, subunit gamma and tau	NA	A0A1U9WR94	Streptococcus_virus	34.3	7.9e-46
>prophage 81
CP023863	Prevotella jejuni strain CD3:33 chromosome I, complete sequence	2204592	1391894	1392641	2204592		Sulfolobus_monocaudavirus(100.0%)	1	NA	NA
AUI54852.1|1391894_1392641_+	polyprenol monophosphomannose synthase	NA	A0A0N7A8R9	Sulfolobus_monocaudavirus	37.7	3.3e-30
>prophage 82
CP023863	Prevotella jejuni strain CD3:33 chromosome I, complete sequence	2204592	1409315	1409771	2204592		Pneumococcus_phage(100.0%)	1	NA	NA
AUI54864.1|1409315_1409771_-	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	E7DN65	Pneumococcus_phage	71.4	1.2e-48
>prophage 83
CP023863	Prevotella jejuni strain CD3:33 chromosome I, complete sequence	2204592	1439668	1441405	2204592	tRNA	Klosneuvirus(100.0%)	1	NA	NA
AUI54893.1|1439668_1441405_-|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SIS0	Klosneuvirus	38.7	1.3e-90
>prophage 84
CP023863	Prevotella jejuni strain CD3:33 chromosome I, complete sequence	2204592	1454870	1461906	2204592		Ostreococcus_lucimarinus_virus(50.0%)	4	NA	NA
AUI54906.1|1454870_1456901_+	cell division protein FtsH	NA	M4QNJ1	Ostreococcus_lucimarinus_virus	45.6	2.0e-98
AUI54907.1|1456915_1457788_+	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
AUI54908.1|1457869_1458517_+	transcription elongation protein SprT	NA	NA	NA	NA	NA
AUI54909.1|1458738_1461906_-	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	32.6	8.7e-141
>prophage 85
CP023863	Prevotella jejuni strain CD3:33 chromosome I, complete sequence	2204592	1493290	1494553	2204592	integrase	unidentified_phage(100.0%)	1	1488195:1488208	1498675:1498688
1488195:1488208	attL	TCAAAGAATTGTTT	NA	NA	NA	NA
AUI54924.1|1493290_1494553_-|integrase	integrase	integrase	H7BUI8	unidentified_phage	34.1	5.9e-24
AUI54924.1|1493290_1494553_-|integrase	integrase	integrase	H7BUI8	unidentified_phage	34.1	5.9e-24
1498675:1498688	attR	AAACAATTCTTTGA	NA	NA	NA	NA
>prophage 86
CP023863	Prevotella jejuni strain CD3:33 chromosome I, complete sequence	2204592	1505533	1524793	2204592	tRNA,transposase	uncultured_Mediterranean_phage(22.22%)	15	NA	NA
AUI54932.1|1505533_1508200_+|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	36.5	6.3e-84
AUI54933.1|1508428_1509628_-	lipid-A-disaccharide synthase	NA	NA	NA	NA	NA
AUI54934.1|1509640_1510414_-	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	30.1	8.6e-26
AUI54935.1|1510528_1511296_+	ParA family protein	NA	Q8JL10	Natrialba_phage	29.6	6.8e-23
AUI54936.1|1511506_1512412_+	chromosome partitioning protein ParB	NA	S5VSZ7	Leptospira_phage	35.5	5.8e-13
AUI54937.1|1512582_1513362_+	hypothetical protein	NA	NA	NA	NA	NA
AUI54938.1|1513402_1514539_+	murein transglycosylase	NA	A0A218M4G6	Pasteurella_phage	46.6	3.1e-16
AUI54939.1|1514579_1516874_+	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	A0A1B1IUF0	uncultured_Mediterranean_phage	37.2	7.3e-12
AUI54940.1|1517147_1517732_+	hypothetical protein	NA	NA	NA	NA	NA
AUI54941.1|1517821_1518253_+	hypothetical protein	NA	NA	NA	NA	NA
AUI55451.1|1519739_1520678_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	29.2	2.5e-19
AUI54942.1|1520921_1521119_-	hypothetical protein	NA	NA	NA	NA	NA
AUI54943.1|1521426_1522095_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.4	1.0e-19
AUI54944.1|1522091_1523006_-	beta-carotene 15,15'-monooxygenase	NA	NA	NA	NA	NA
AUI55452.1|1523884_1524793_-	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	26.3	7.6e-05
>prophage 87
CP023863	Prevotella jejuni strain CD3:33 chromosome I, complete sequence	2204592	1532144	1534967	2204592		Bodo_saltans_virus(100.0%)	1	NA	NA
AUI54949.1|1532144_1534967_+	insulinase family protein	NA	A0A2H4UVM3	Bodo_saltans_virus	24.1	8.6e-07
>prophage 88
CP023863	Prevotella jejuni strain CD3:33 chromosome I, complete sequence	2204592	1543711	1544779	2204592		White_spot_syndrome_virus(100.0%)	1	NA	NA
AUI54955.1|1543711_1544779_+	Fic family protein	NA	K7WHW6	White_spot_syndrome_virus	32.6	1.1e-05
>prophage 89
CP023863	Prevotella jejuni strain CD3:33 chromosome I, complete sequence	2204592	1555716	1557672	2204592		uncultured_virus(100.0%)	1	NA	NA
AUI54964.1|1555716_1557672_-	DNA primase	NA	A0A218MKR7	uncultured_virus	32.0	1.4e-40
>prophage 90
CP023863	Prevotella jejuni strain CD3:33 chromosome I, complete sequence	2204592	1566963	1573178	2204592		Leptospira_phage(33.33%)	3	NA	NA
AUI54973.1|1566963_1570296_-	helicase	NA	Q6NDX2	Leptospira_phage	26.3	6.8e-11
AUI54974.1|1570382_1571555_-	restriction endonuclease subunit S	NA	A0A1V0SKS6	Klosneuvirus	32.7	4.7e-15
AUI54975.1|1571666_1573178_-	restriction endonuclease subunit M	NA	J7I0U9	Acinetobacter_phage	33.5	4.0e-35
>prophage 91
CP023863	Prevotella jejuni strain CD3:33 chromosome I, complete sequence	2204592	1591671	1592619	2204592		Streptococcus_phage(100.0%)	1	NA	NA
AUI54986.1|1591671_1592619_-	cysteine synthase A	NA	A0A1X9I5F1	Streptococcus_phage	55.0	3.5e-85
>prophage 92
CP023863	Prevotella jejuni strain CD3:33 chromosome I, complete sequence	2204592	1602966	1604205	2204592		Clostridium_phage(100.0%)	1	NA	NA
AUI54993.1|1602966_1604205_-	helicase	NA	F8UBM0	Clostridium_phage	27.1	3.4e-08
>prophage 93
CP023863	Prevotella jejuni strain CD3:33 chromosome I, complete sequence	2204592	1610412	1618954	2204592		uncultured_Mediterranean_phage(50.0%)	3	NA	NA
AUI54996.1|1610412_1616496_+	hypothetical protein	NA	A0A1B1IUF6	uncultured_Mediterranean_phage	22.2	5.7e-40
AUI54997.1|1617685_1617913_+	hypothetical protein	NA	NA	NA	NA	NA
AUI54998.1|1618051_1618954_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	40.5	2.6e-34
>prophage 94
CP023863	Prevotella jejuni strain CD3:33 chromosome I, complete sequence	2204592	1625376	1627599	2204592		Bacillus_phage(100.0%)	1	NA	NA
AUI55001.1|1625376_1627599_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	28.3	1.1e-33
>prophage 95
CP023863	Prevotella jejuni strain CD3:33 chromosome I, complete sequence	2204592	1636196	1696782	2204592	protease,tRNA,transposase	unidentified_phage(20.0%)	40	NA	NA
AUI55005.1|1636196_1638923_-	DNA topoisomerase IV	NA	A0A172JHV7	Bacillus_phage	28.9	8.3e-39
AUI55006.1|1639263_1640811_+|tRNA	glycine--tRNA ligase	tRNA	A0A2I2L3K8	Orpheovirus	30.5	1.8e-43
AUI55007.1|1640924_1641605_+	peptidylprolyl isomerase	NA	NA	NA	NA	NA
AUI55008.1|1641836_1643258_+	MATE family efflux transporter	NA	NA	NA	NA	NA
AUI55009.1|1643694_1644777_+	OmpA family protein	NA	NA	NA	NA	NA
AUI55010.1|1645316_1647239_+	1-deoxy-D-xylulose-5-phosphate synthase	NA	NA	NA	NA	NA
AUI55011.1|1647299_1648640_+	Trk system potassium transporter TrkA	NA	NA	NA	NA	NA
AUI55012.1|1648642_1650100_+	potassium transporter	NA	NA	NA	NA	NA
AUI55461.1|1650564_1651185_+	DUF4840 domain-containing protein	NA	NA	NA	NA	NA
AUI55013.1|1651468_1653373_+	molecular chaperone DnaK	NA	J3IZ77	Acanthamoeba_polyphaga_lentillevirus	48.4	5.8e-140
AUI55014.1|1654466_1655297_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
AUI55015.1|1655323_1655782_+	hypothetical protein	NA	NA	NA	NA	NA
AUI55462.1|1656007_1656277_+	hypothetical protein	NA	NA	NA	NA	NA
AUI55016.1|1656383_1657280_-	TIGR02391 family protein	NA	NA	NA	NA	NA
AUI55017.1|1657538_1657811_+	hypothetical protein	NA	NA	NA	NA	NA
AUI55463.1|1657909_1658140_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AUI55018.1|1658136_1662432_+	ATP-binding protein	NA	NA	NA	NA	NA
AUI55019.1|1667003_1667951_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	27.0	2.1e-18
AUI55020.1|1668098_1668338_+	hypothetical protein	NA	NA	NA	NA	NA
AUI55021.1|1668334_1668793_+	hypothetical protein	NA	NA	NA	NA	NA
AUI55022.1|1669006_1670779_-	hypothetical protein	NA	NA	NA	NA	NA
AUI55464.1|1671868_1672630_-|protease	serine protease	protease	A0A1B1IT49	uncultured_Mediterranean_phage	34.7	3.7e-05
AUI55023.1|1672638_1673259_-	hypothetical protein	NA	NA	NA	NA	NA
AUI55024.1|1673271_1674888_-	hypothetical protein	NA	NA	NA	NA	NA
AUI55025.1|1674901_1675669_-	hypothetical protein	NA	NA	NA	NA	NA
AUI55026.1|1675671_1679046_-	hypothetical protein	NA	NA	NA	NA	NA
AUI55027.1|1679058_1680486_-	hypothetical protein	NA	NA	NA	NA	NA
AUI55028.1|1680501_1680963_-	hypothetical protein	NA	NA	NA	NA	NA
AUI55029.1|1680967_1682020_-	hypothetical protein	NA	NA	NA	NA	NA
AUI55465.1|1682148_1683795_-|transposase	IS5/IS1182 family transposase	transposase	A0A146ICT8	Staphylococcus_phage	32.3	1.5e-59
AUI55030.1|1683922_1684861_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	29.2	2.5e-19
AUI55031.1|1685663_1686146_+	phosphohydrolase	NA	A0A141E1X8	Streptococcus_phage	38.1	4.1e-18
AUI55032.1|1686179_1687994_+	DUF262 domain-containing protein	NA	NA	NA	NA	NA
AUI55033.1|1688377_1689247_-|transposase	DDE transposase	transposase	NA	NA	NA	NA
AUI55034.1|1689362_1689707_-|transposase	transposase family protein	transposase	NA	NA	NA	NA
AUI55035.1|1690044_1690560_-	porin family protein	NA	NA	NA	NA	NA
AUI55036.1|1690976_1691411_-	DNA-binding protein	NA	NA	NA	NA	NA
AUI55037.1|1692216_1693563_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	57.2	7.2e-145
AUI55038.1|1693702_1695250_+	rRNA pseudouridine synthase	NA	NA	NA	NA	NA
AUI55039.1|1695390_1696782_+|tRNA	asparagine--tRNA ligase	tRNA	A0A2P1EMB4	Moumouvirus	38.3	4.6e-86
>prophage 96
CP023863	Prevotella jejuni strain CD3:33 chromosome I, complete sequence	2204592	1703100	1705917	2204592	tRNA	Pandoravirus(50.0%)	3	NA	NA
AUI55046.1|1703100_1703985_-|tRNA	tRNA threonylcarbamoyladenosine dehydratase	tRNA	S4VW33	Pandoravirus	35.5	3.2e-16
AUI55047.1|1704252_1705113_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AUI55048.1|1705209_1705917_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	40.6	1.2e-37
>prophage 97
CP023863	Prevotella jejuni strain CD3:33 chromosome I, complete sequence	2204592	1715620	1716568	2204592	transposase	unidentified_phage(100.0%)	1	NA	NA
AUI55055.1|1715620_1716568_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	27.0	2.1e-18
>prophage 98
CP023863	Prevotella jejuni strain CD3:33 chromosome I, complete sequence	2204592	1719796	1721686	2204592		Wolbachia_phage(100.0%)	1	NA	NA
AUI55059.1|1719796_1721686_-	DNA mismatch repair protein MutL	NA	A0A1B2LRQ5	Wolbachia_phage	28.7	2.7e-57
>prophage 99
CP023863	Prevotella jejuni strain CD3:33 chromosome I, complete sequence	2204592	1726903	1738238	2204592	protease	Klosneuvirus(20.0%)	10	NA	NA
AUI55064.1|1726903_1728388_-	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	43.8	8.6e-99
AUI55466.1|1728719_1729208_+	DNA starvation/stationary phase protection protein	NA	NA	NA	NA	NA
AUI55065.1|1729501_1729990_+	DNA starvation/stationary phase protection protein	NA	NA	NA	NA	NA
AUI55066.1|1730256_1730568_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AUI55067.1|1730571_1730922_-	addiction module toxin RelE	NA	NA	NA	NA	NA
AUI55068.1|1731203_1733387_-	DNA helicase RecQ	NA	L7RCS0	Acanthamoeba_polyphaga_moumouvirus	35.9	1.1e-86
AUI55069.1|1733487_1734726_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	53.1	3.8e-116
AUI55070.1|1734735_1735428_-|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	45.4	2.3e-38
AUI55071.1|1735606_1736971_-	trigger factor	NA	NA	NA	NA	NA
AUI55072.1|1737410_1738238_-	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.2	1.2e-17
>prophage 100
CP023863	Prevotella jejuni strain CD3:33 chromosome I, complete sequence	2204592	1755552	1762393	2204592		Staphylococcus_phage(50.0%)	5	NA	NA
AUI55083.1|1755552_1757226_-	acetyl-CoA synthetase	NA	A0A2H4PQU7	Staphylococcus_phage	31.2	1.3e-55
AUI55084.1|1757359_1757914_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AUI55085.1|1758557_1759034_-	arginine repressor	NA	NA	NA	NA	NA
AUI55468.1|1759377_1760115_-	pyruvate formate-lyase 1-activating enzyme	NA	NA	NA	NA	NA
AUI55086.1|1760146_1762393_-	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.3	7.3e-166
>prophage 101
CP023863	Prevotella jejuni strain CD3:33 chromosome I, complete sequence	2204592	1766582	1767683	2204592		Bodo_saltans_virus(100.0%)	1	NA	NA
AUI55090.1|1766582_1767683_-	RluA family pseudouridine synthase	NA	A0A2H4UV25	Bodo_saltans_virus	29.6	9.8e-07
>prophage 102
CP023863	Prevotella jejuni strain CD3:33 chromosome I, complete sequence	2204592	1780723	1782649	2204592		Clostridioides_phage(50.0%)	2	NA	NA
AUI55103.1|1780723_1780924_+	transcriptional regulator	NA	A0A1V0E021	Clostridioides_phage	40.0	1.3e-05
AUI55104.1|1781095_1782649_-	alkyl hydroperoxide reductase subunit F	NA	A0A249XZT7	Enterococcus_phage	31.2	3.5e-34
>prophage 103
CP023863	Prevotella jejuni strain CD3:33 chromosome I, complete sequence	2204592	1790306	1791494	2204592		Emiliania_huxleyi_virus(100.0%)	1	NA	NA
AUI55110.1|1790306_1791494_-	glycine C-acetyltransferase	NA	V5LQ39	Emiliania_huxleyi_virus	28.9	1.4e-35
>prophage 104
CP023863	Prevotella jejuni strain CD3:33 chromosome I, complete sequence	2204592	1797139	1799017	2204592		Streptococcus_phage(100.0%)	1	NA	NA
AUI55115.1|1797139_1799017_-	cadmium-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	36.9	4.1e-106
>prophage 105
CP023863	Prevotella jejuni strain CD3:33 chromosome I, complete sequence	2204592	1805224	1809135	2204592		Aeromonas_virus(50.0%)	3	NA	NA
AUI55120.1|1805224_1805722_-	CYTH domain-containing protein	NA	Q76Z87	Aeromonas_virus	33.8	9.8e-07
AUI55121.1|1805996_1807112_-	peptide chain release factor 2	NA	NA	NA	NA	NA
AUI55122.1|1807326_1809135_-	long-chain fatty acid--CoA ligase	NA	A0A1V0SBX8	Catovirus	22.2	1.6e-38
>prophage 106
CP023863	Prevotella jejuni strain CD3:33 chromosome I, complete sequence	2204592	1814617	1817848	2204592		Tunisvirus(50.0%)	3	NA	NA
AUI55126.1|1814617_1815055_-	dUTP diphosphatase	NA	V9SFR6	Tunisvirus	58.3	7.5e-43
AUI55127.1|1815303_1816641_+	dehydrogenase	NA	NA	NA	NA	NA
AUI55128.1|1816852_1817848_+	esterase	NA	A0A2C9CY00	Yersinia_phage	27.8	1.0e-07
>prophage 107
CP023863	Prevotella jejuni strain CD3:33 chromosome I, complete sequence	2204592	1821899	1823720	2204592	tRNA	Klosneuvirus(100.0%)	1	NA	NA
AUI55130.1|1821899_1823720_+|tRNA	arginine--tRNA ligase	tRNA	A0A1V0SIS8	Klosneuvirus	23.1	1.0e-29
>prophage 108
CP023863	Prevotella jejuni strain CD3:33 chromosome I, complete sequence	2204592	1828619	1831310	2204592		Streptococcus_phage(50.0%)	3	NA	NA
AUI55135.1|1828619_1829594_+	modification methylase	NA	A0A1S5PRR3	Streptococcus_phage	37.2	8.9e-44
AUI55472.1|1829610_1830435_+	restriction endonuclease	NA	NA	NA	NA	NA
AUI55136.1|1830431_1831310_+	site-specific DNA-methyltransferase	NA	H9C0B7	Vibrio_phage	30.8	8.3e-17
>prophage 109
CP023863	Prevotella jejuni strain CD3:33 chromosome I, complete sequence	2204592	1836129	1837695	2204592		Tetraselmis_virus(100.0%)	1	NA	NA
AUI55138.1|1836129_1837695_+	sulfatase	NA	A0A2P0VMN7	Tetraselmis_virus	24.1	1.3e-17
>prophage 110
CP023863	Prevotella jejuni strain CD3:33 chromosome I, complete sequence	2204592	1845858	1846491	2204592		Prochlorococcus_phage(100.0%)	1	NA	NA
AUI55146.1|1845858_1846491_-	orotate phosphoribosyltransferase	NA	Q58MW1	Prochlorococcus_phage	28.9	6.0e-09
>prophage 111
CP023863	Prevotella jejuni strain CD3:33 chromosome I, complete sequence	2204592	1859760	1864972	2204592		Indivirus(50.0%)	4	NA	NA
AUI55154.1|1859760_1860903_+	riboflavin biosynthesis protein RibD	NA	A0A1V0SE20	Indivirus	28.0	4.7e-28
AUI55155.1|1861068_1862358_-	serine dehydratase subunit alpha family protein	NA	NA	NA	NA	NA
AUI55156.1|1862432_1862846_-	hypothetical protein	NA	NA	NA	NA	NA
AUI55157.1|1863001_1864972_-	helicase	NA	A0A076FFX0	Aureococcus_anophage	23.6	1.9e-13
>prophage 112
CP023863	Prevotella jejuni strain CD3:33 chromosome I, complete sequence	2204592	1872128	1872932	2204592		Moumouvirus(100.0%)	1	NA	NA
AUI55164.1|1872128_1872932_+	ADP-ribosylglycohydrolase	NA	A0A2P1EM87	Moumouvirus	24.9	3.1e-10
>prophage 113
CP023863	Prevotella jejuni strain CD3:33 chromosome I, complete sequence	2204592	1877407	1879873	2204592		Acinetobacter_phage(100.0%)	1	NA	NA
AUI55168.1|1877407_1879873_+	TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	35.0	4.6e-12
>prophage 114
CP023863	Prevotella jejuni strain CD3:33 chromosome I, complete sequence	2204592	1891417	1895612	2204592	tRNA	Acanthocystis_turfacea_Chlorella_virus(50.0%)	2	NA	NA
AUI55176.1|1891417_1893406_-	potassium transporter Kup	NA	M1IAJ4	Acanthocystis_turfacea_Chlorella_virus	34.1	1.1e-64
AUI55177.1|1893548_1895612_+|tRNA	methionine--tRNA ligase	tRNA	K7Y9Y6	Megavirus	33.8	3.1e-78
>prophage 115
CP023863	Prevotella jejuni strain CD3:33 chromosome I, complete sequence	2204592	1904139	1904850	2204592		Streptococcus_phage(100.0%)	1	NA	NA
AUI55186.1|1904139_1904850_-	ABC transporter ATP-binding protein	NA	A0A1B0RXA0	Streptococcus_phage	31.7	4.1e-06
>prophage 116
CP023863	Prevotella jejuni strain CD3:33 chromosome I, complete sequence	2204592	1907962	1913842	2204592	protease	uncultured_Mediterranean_phage(50.0%)	4	NA	NA
AUI55189.1|1907962_1910983_-	protein translocase subunit SecDF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	42.8	4.7e-27
AUI55478.1|1911088_1912189_-	AP endonuclease	NA	NA	NA	NA	NA
AUI55190.1|1912394_1913351_-|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
AUI55191.1|1913566_1913842_+	HU family DNA-binding protein	NA	A7KV42	Bacillus_phage	57.3	9.9e-17
>prophage 117
CP023863	Prevotella jejuni strain CD3:33 chromosome I, complete sequence	2204592	1919633	1924927	2204592	tRNA	Staphylococcus_phage(66.67%)	6	NA	NA
AUI55195.1|1919633_1920926_+	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	48.7	4.3e-102
AUI55196.1|1920932_1921865_+	DUF4271 domain-containing protein	NA	NA	NA	NA	NA
AUI55197.1|1921871_1922627_+	uroporphyrinogen-III synthase	NA	NA	NA	NA	NA
AUI55198.1|1922710_1923166_+	ribonuclease P protein component	NA	NA	NA	NA	NA
AUI55479.1|1923277_1923523_+	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	60.6	6.7e-17
AUI55199.1|1923628_1924927_+|tRNA	tyrosine--tRNA ligase	tRNA	A0A1L2CUL7	Pectobacterium_phage	38.8	5.1e-71
>prophage 118
CP023863	Prevotella jejuni strain CD3:33 chromosome I, complete sequence	2204592	1929060	1932934	2204592		Tupanvirus(50.0%)	2	NA	NA
AUI55202.1|1929060_1931877_-	insulinase family protein	NA	A0A2K9L1M6	Tupanvirus	29.4	3.1e-12
AUI55203.1|1931989_1932934_-	tyrosine recombinase XerD	NA	A0A1I9SC88	Mycobacterium_phage	29.1	3.3e-19
>prophage 119
CP023863	Prevotella jejuni strain CD3:33 chromosome I, complete sequence	2204592	1936337	1937333	2204592		Wolbachia_phage(100.0%)	1	NA	NA
AUI55208.1|1936337_1937333_+	cytochrome C biogenesis protein CycH	NA	Q9JMN3	Wolbachia_phage	39.4	4.1e-20
>prophage 120
CP023863	Prevotella jejuni strain CD3:33 chromosome I, complete sequence	2204592	1972046	1979250	2204592		Staphylococcus_phage(33.33%)	5	NA	NA
AUI55231.1|1972046_1973660_+	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	46.5	1.1e-118
AUI55232.1|1975020_1975890_-	DNA-binding protein	NA	Q4ZC41	Staphylococcus_virus	53.8	1.0e-75
AUI55233.1|1976322_1977684_+	exo-alpha-sialidase	NA	NA	NA	NA	NA
AUI55234.1|1977706_1978399_+	porin family protein	NA	NA	NA	NA	NA
AUI55235.1|1978497_1979250_+	isoprenyl transferase	NA	R9W0U9	Flavobacterium_phage	41.9	4.8e-21
>prophage 121
CP023863	Prevotella jejuni strain CD3:33 chromosome I, complete sequence	2204592	1988025	1989513	2204592	tRNA	Catovirus(100.0%)	1	NA	NA
AUI55244.1|1988025_1989513_+|tRNA	cysteine--tRNA ligase	tRNA	A0A1V0SAQ2	Catovirus	28.6	2.6e-47
>prophage 122
CP023863	Prevotella jejuni strain CD3:33 chromosome I, complete sequence	2204592	2003572	2086479	2204592	protease,tRNA,transposase	Bacillus_phage(21.43%)	58	NA	NA
AUI55255.1|2003572_2004463_-|transposase	ISL3 family transposase	transposase	A9YX10	Burkholderia_phage	34.8	9.0e-43
AUI55256.1|2004481_2004712_+	hypothetical protein	NA	NA	NA	NA	NA
AUI55485.1|2004818_2005757_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	29.2	2.5e-19
AUI55257.1|2006093_2007557_+	hypothetical protein	NA	NA	NA	NA	NA
AUI55258.1|2007570_2008260_+	HEAT repeat domain-containing protein	NA	NA	NA	NA	NA
AUI55259.1|2008256_2008583_+	hypothetical protein	NA	NA	NA	NA	NA
AUI55260.1|2008899_2009289_+	DNA-entry nuclease	NA	F8WPS9	Bacillus_phage	52.2	2.0e-23
AUI55261.1|2009291_2009837_+	hypothetical protein	NA	NA	NA	NA	NA
AUI55262.1|2009969_2010788_+	hypothetical protein	NA	F8WPS9	Bacillus_phage	57.7	3.1e-26
AUI55263.1|2010793_2011360_+	hypothetical protein	NA	NA	NA	NA	NA
AUI55264.1|2011502_2011901_+	type VI secretion system needle protein Hcp	NA	NA	NA	NA	NA
AUI55265.1|2012083_2013934_+	type IV secretion protein Rhs	NA	NA	NA	NA	NA
AUI55266.1|2013937_2014729_+	hypothetical protein	NA	NA	NA	NA	NA
AUI55267.1|2014735_2017831_+	hypothetical protein	NA	A0A0X8WP64	Ralstonia_phage	30.0	1.1e-10
AUI55486.1|2017922_2019089_+	hypothetical protein	NA	NA	NA	NA	NA
AUI55268.1|2019343_2021323_+	hypothetical protein	NA	A0A0F6R8M1	Escherichia_coli_O157_typing_phage	36.0	6.1e-07
AUI55487.1|2021298_2021583_+	hypothetical protein	NA	NA	NA	NA	NA
AUI55269.1|2021584_2022814_+	hypothetical protein	NA	NA	NA	NA	NA
AUI55488.1|2023961_2024759_+	hypothetical protein	NA	NA	NA	NA	NA
AUI55270.1|2027609_2028449_+	hypothetical protein	NA	NA	NA	NA	NA
AUI55271.1|2029137_2030358_+	SH3 domain-containing protein	NA	NA	NA	NA	NA
AUI55489.1|2032060_2032453_+	hypothetical protein	NA	D6QWN7	uncultured_phage	33.3	1.3e-06
AUI55272.1|2032455_2033496_+	hypothetical protein	NA	NA	NA	NA	NA
AUI55273.1|2033704_2035000_-|transposase	transposase	transposase	NA	NA	NA	NA
AUI55274.1|2034943_2035174_+	hypothetical protein	NA	NA	NA	NA	NA
AUI55275.1|2035154_2036984_-	SAM-dependent methyltransferase	NA	A0A1C9C5K0	Heterosigma_akashiwo_virus	25.7	2.9e-19
AUI55276.1|2037059_2037602_-	HNH endonuclease	NA	NA	NA	NA	NA
AUI55277.1|2037603_2038254_-	hypothetical protein	NA	NA	NA	NA	NA
AUI55278.1|2038243_2040823_-	ATP-binding protein	NA	NA	NA	NA	NA
AUI55279.1|2040914_2041382_-	hypothetical protein	NA	NA	NA	NA	NA
AUI55280.1|2043532_2044114_+	hypothetical protein	NA	NA	NA	NA	NA
AUI55281.1|2044244_2045192_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	27.0	2.1e-18
AUI55282.1|2046016_2046253_+	acyl carrier protein	NA	NA	NA	NA	NA
AUI55490.1|2046341_2047604_+	beta-ketoacyl-[acyl-carrier-protein] synthase II	NA	NA	NA	NA	NA
AUI55283.1|2047593_2048658_+	ribonuclease III	NA	A0A1C9C5A7	Heterosigma_akashiwo_virus	33.7	3.0e-21
AUI55284.1|2048998_2050597_-	hypothetical protein	NA	NA	NA	NA	NA
AUI55285.1|2050771_2053675_-	sugar-binding protein	NA	NA	NA	NA	NA
AUI55286.1|2054865_2055372_+	DUF5004 domain-containing protein	NA	NA	NA	NA	NA
AUI55287.1|2055509_2056730_+	hypothetical protein	NA	NA	NA	NA	NA
AUI55288.1|2056789_2059726_+	TonB-dependent receptor	NA	NA	NA	NA	NA
AUI55289.1|2059766_2061329_+	RagB/SusD family nutrient uptake outer membrane protein	NA	NA	NA	NA	NA
AUI55491.1|2061823_2063056_+	hypothetical protein	NA	NA	NA	NA	NA
AUI55290.1|2063076_2065098_+	alpha-glucosidase	NA	NA	NA	NA	NA
AUI55291.1|2065620_2068098_+	TonB-dependent receptor	NA	NA	NA	NA	NA
AUI55292.1|2068466_2069600_+	ATP-binding protein	NA	NA	NA	NA	NA
AUI55293.1|2069740_2070709_-	hypothetical protein	NA	NA	NA	NA	NA
AUI55294.1|2070790_2071780_-	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
AUI55295.1|2072046_2074344_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	32.0	5.3e-63
AUI55296.1|2074352_2075009_+	hemolysin III	NA	NA	NA	NA	NA
AUI55297.1|2075036_2075852_+	hypothetical protein	NA	NA	NA	NA	NA
AUI55298.1|2076014_2077016_+|protease	cysteine protease	protease	NA	NA	NA	NA
AUI55492.1|2077120_2077951_-	hypothetical protein	NA	NA	NA	NA	NA
AUI55493.1|2078891_2079638_+	hypothetical protein	NA	A0A2K9L8X2	Tupanvirus	42.6	2.9e-34
AUI55494.1|2080272_2080974_-	TrmH family RNA methyltransferase	NA	NA	NA	NA	NA
AUI55299.1|2081175_2081592_-	Fe-S metabolism protein SufE	NA	NA	NA	NA	NA
AUI55300.1|2081654_2082899_-|protease	collagenase-like protease	protease	Q6DW11	Phage_TP	26.1	6.1e-21
AUI55301.1|2083190_2084519_+|tRNA	tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB	tRNA	NA	NA	NA	NA
AUI55302.1|2084619_2086479_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	31.0	3.5e-49
>prophage 123
CP023863	Prevotella jejuni strain CD3:33 chromosome I, complete sequence	2204592	2098271	2104391	2204592		Bacillus_phage(66.67%)	4	NA	NA
AUI55311.1|2098271_2099216_-	glycosyltransferase	NA	U5P087	Shigella_phage	36.5	7.5e-40
AUI55312.1|2099229_2100009_-	polysaccharide deacetylase	NA	NA	NA	NA	NA
AUI55313.1|2100734_2103254_+	ribonucleoside-diphosphate reductase subunit alpha	NA	A0A127AW21	Bacillus_phage	44.3	7.3e-183
AUI55496.1|2103344_2104391_+	ribonucleotide-diphosphate reductase subunit beta	NA	A0A127AVZ3	Bacillus_phage	34.8	6.8e-58
>prophage 124
CP023863	Prevotella jejuni strain CD3:33 chromosome I, complete sequence	2204592	2109162	2113228	2204592		Klosneuvirus(50.0%)	2	NA	NA
AUI55317.1|2109162_2111823_+	DNA mismatch repair protein MutS	NA	A0A1V0SJ67	Klosneuvirus	23.6	1.0e-49
AUI55318.1|2111923_2113228_-	Fic family protein	NA	A0A1V0E025	Clostridioides_phage	33.2	5.9e-27
>prophage 125
CP023863	Prevotella jejuni strain CD3:33 chromosome I, complete sequence	2204592	2122187	2123177	2204592		Pandoravirus(100.0%)	1	NA	NA
AUI55326.1|2122187_2123177_-	aminodeoxychorismate synthase component I	NA	S4VNU7	Pandoravirus	34.6	7.2e-17
>prophage 126
CP023863	Prevotella jejuni strain CD3:33 chromosome I, complete sequence	2204592	2127560	2128067	2204592		Tetraselmis_virus(100.0%)	1	NA	NA
AUI55330.1|2127560_2128067_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	41.7	9.0e-24
>prophage 127
CP023863	Prevotella jejuni strain CD3:33 chromosome I, complete sequence	2204592	2134555	2139352	2204592	tRNA	Staphylococcus_phage(50.0%)	3	NA	NA
AUI55335.1|2134555_2137459_+|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	41.0	1.5e-203
AUI55336.1|2137615_2138602_+	YitT family protein	NA	NA	NA	NA	NA
AUI55337.1|2138770_2139352_+	non-canonical purine NTP diphosphatase	NA	A0A2P1DNP2	Cassava_brown_streak_virus	33.2	1.4e-17
>prophage 128
CP023863	Prevotella jejuni strain CD3:33 chromosome I, complete sequence	2204592	2149662	2152425	2204592		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
AUI55344.1|2149662_2152425_-	DNA polymerase I	NA	A0A1B1IST8	uncultured_Mediterranean_phage	28.2	1.6e-53
>prophage 129
CP023863	Prevotella jejuni strain CD3:33 chromosome I, complete sequence	2204592	2158509	2159040	2204592		Tupanvirus(100.0%)	1	NA	NA
AUI55349.1|2158509_2159040_-	adenine phosphoribosyltransferase	NA	A0A2K9L2N8	Tupanvirus	37.4	2.8e-15
>prophage 130
CP023863	Prevotella jejuni strain CD3:33 chromosome I, complete sequence	2204592	2180623	2182054	2204592		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
AUI55359.1|2180623_2182054_+	hypothetical protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	29.4	4.2e-18
>prophage 131
CP023863	Prevotella jejuni strain CD3:33 chromosome I, complete sequence	2204592	2185662	2187687	2204592		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
AUI55363.1|2185662_2187687_+	RHS repeat protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	31.7	1.7e-17
>prophage 132
CP023863	Prevotella jejuni strain CD3:33 chromosome I, complete sequence	2204592	2194127	2194619	2204592		Bacillus_phage(100.0%)	1	NA	NA
AUI55499.1|2194127_2194619_+	hypothetical protein	NA	O64024	Bacillus_phage	40.0	1.1e-34
>prophage 133
CP023863	Prevotella jejuni strain CD3:33 chromosome I, complete sequence	2204592	2201042	2203755	2204592	transposase	unidentified_phage(50.0%)	2	NA	NA
AUI55374.1|2201042_2201981_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	26.3	4.3e-19
AUI55501.1|2202108_2203755_+|transposase	IS5/IS1182 family transposase	transposase	A0A146ICT8	Staphylococcus_phage	32.5	1.9e-59
>prophage 1
CP023864	Prevotella jejuni strain CD3:33 chromosome II, complete sequence	1708414	1141676	1204739	1708414	integrase,transposase	Staphylococcus_phage(20.0%)	45	1138706:1138726	1201375:1201395
1138706:1138726	attL	GCATCCCACATATAATATTTC	NA	NA	NA	NA
AUI56263.1|1141676_1142624_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	34.1	1.8e-33
AUI56264.1|1142929_1143595_-	hypothetical protein	NA	NA	NA	NA	NA
AUI56265.1|1144823_1145039_-	hypothetical protein	NA	NA	NA	NA	NA
AUI56266.1|1146331_1146586_-	hypothetical protein	NA	NA	NA	NA	NA
AUI56267.1|1148858_1149041_+	hypothetical protein	NA	NA	NA	NA	NA
AUI56268.1|1149689_1150058_+	SMI1/KNR4 family protein	NA	NA	NA	NA	NA
AUI56269.1|1150451_1150802_+	cyclopropane-fatty-acyl-phospholipid synthase	NA	NA	NA	NA	NA
AUI56270.1|1151913_1152540_-	hypothetical protein	NA	NA	NA	NA	NA
AUI56271.1|1152644_1153253_-	hypothetical protein	NA	NA	NA	NA	NA
AUI56272.1|1154688_1154940_-	hypothetical protein	NA	NA	NA	NA	NA
AUI56273.1|1155393_1155597_-	hypothetical protein	NA	NA	NA	NA	NA
AUI56274.1|1156150_1156336_-	hypothetical protein	NA	NA	NA	NA	NA
AUI56275.1|1157926_1158613_+	hypothetical protein	NA	NA	NA	NA	NA
AUI56276.1|1159204_1159867_+	ParA family protein	NA	NA	NA	NA	NA
AUI56717.1|1160188_1160800_+	hypothetical protein	NA	NA	NA	NA	NA
AUI56718.1|1161142_1162384_+|transposase	transposase	transposase	NA	NA	NA	NA
AUI56277.1|1162424_1162877_-	hypothetical protein	NA	NA	NA	NA	NA
AUI56278.1|1163036_1163603_-	hypothetical protein	NA	NA	NA	NA	NA
AUI56279.1|1164398_1164872_-	hypothetical protein	NA	NA	NA	NA	NA
AUI56280.1|1165289_1165940_+	hypothetical protein	NA	NA	NA	NA	NA
AUI56281.1|1167134_1167605_+	DUF4065 domain-containing protein	NA	I6R0L8	Salmonella_phage	31.9	3.4e-09
AUI56282.1|1167629_1168472_+	hypothetical protein	NA	NA	NA	NA	NA
AUI56283.1|1170874_1171942_-	mobilization protein	NA	NA	NA	NA	NA
AUI56284.1|1171925_1172357_-	hypothetical protein	NA	NA	NA	NA	NA
AUI56285.1|1172684_1173164_-	DUF3408 domain-containing protein	NA	NA	NA	NA	NA
AUI56286.1|1173927_1174527_+	hypothetical protein	NA	NA	NA	NA	NA
AUI56287.1|1174794_1175613_+	hypothetical protein	NA	NA	NA	NA	NA
AUI56288.1|1175627_1176740_+	hypothetical protein	NA	A0A1V0SAC2	Catovirus	24.5	6.2e-09
AUI56289.1|1176742_1178983_+	hypothetical protein	NA	NA	NA	NA	NA
AUI56290.1|1178969_1180022_+	DUF1848 domain-containing protein	NA	NA	NA	NA	NA
AUI56291.1|1180100_1180685_+	hypothetical protein	NA	NA	NA	NA	NA
AUI56292.1|1180681_1181659_+	DUF4868 domain-containing protein	NA	NA	NA	NA	NA
AUI56293.1|1181743_1183429_+	AAA family ATPase	NA	NA	NA	NA	NA
AUI56294.1|1183709_1183997_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AUI56295.1|1188037_1189300_-|integrase	integrase	integrase	NA	NA	NA	NA
AUI56296.1|1189362_1190592_-|integrase	integrase	integrase	H7BUI8	unidentified_phage	34.6	3.6e-26
AUI56297.1|1191285_1192554_+	hypothetical protein	NA	A0A2I7RNF1	Vibrio_phage	31.1	1.3e-10
AUI56298.1|1192550_1193234_+	hypothetical protein	NA	NA	NA	NA	NA
AUI56299.1|1193747_1197044_+	TonB-dependent receptor	NA	NA	NA	NA	NA
AUI56300.1|1197064_1198873_+	RagB/SusD family nutrient uptake outer membrane protein	NA	NA	NA	NA	NA
AUI56301.1|1200234_1200444_+	hypothetical protein	NA	NA	NA	NA	NA
AUI56302.1|1200490_1202002_+	hypothetical protein	NA	NA	NA	NA	NA
1201375:1201395	attR	GAAATATTATATGTGGGATGC	NA	NA	NA	NA
AUI56303.1|1203039_1203270_+	hypothetical protein	NA	NA	NA	NA	NA
AUI56304.1|1203409_1203754_+|transposase	transposase family protein	transposase	NA	NA	NA	NA
AUI56305.1|1203869_1204739_+|transposase	DDE transposase	transposase	NA	NA	NA	NA
