The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP019090	Xanthomonas oryzae pv. oryzae strain MAI129 chromosome, complete genome	4703963	7440	60864	4703963	protease,transposase	Leptospira_phage(28.57%)	42	NA	NA
AUJ07381.1|7440_8277_+|protease	CAAX protease family protein	protease	NA	NA	NA	NA
AUJ07382.1|8461_9268_+	peptidase	NA	NA	NA	NA	NA
AUJ07383.1|9544_10738_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ07384.1|10891_11560_+	energy transducer TonB	NA	NA	NA	NA	NA
AUJ07385.1|11644_12406_+	biopolymer transporter ExbB	NA	NA	NA	NA	NA
AUJ07386.1|12452_12875_+	biopolymer transporter ExbD	NA	NA	NA	NA	NA
AUJ07387.1|12878_13292_+	biopolymer transporter ExbD	NA	NA	NA	NA	NA
AUJ07388.1|13587_14355_-	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
AUJ07389.1|14365_14635_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ07390.1|14709_16170_-	cardiolipin synthase	NA	NA	NA	NA	NA
AUJ07391.1|17315_18692_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.0	4.1e-63
AUJ10615.1|18920_19805_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.7	2.0e-87
AUJ07392.1|19937_20924_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	40.6	9.9e-43
AUJ10616.1|21183_22242_-	radical SAM protein	NA	NA	NA	NA	NA
AUJ07393.1|23381_24722_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ07394.1|24939_25632_+|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
AUJ10617.1|25748_26069_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ07395.1|27366_28890_-	peptidase S41	NA	A0A0R6PIZ1	Moraxella_phage	29.2	1.0e-25
AUJ10618.1|28994_30212_-	peptidase M23	NA	NA	NA	NA	NA
AUJ07396.1|30390_31047_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ07397.1|31209_33021_+	aminopeptidase	NA	NA	NA	NA	NA
AUJ07398.1|33168_33519_-	peptidase propeptide and ypeb domain-containing protein	NA	NA	NA	NA	NA
AUJ07399.1|33825_34956_-	cellulase	NA	NA	NA	NA	NA
AUJ07400.1|35738_36791_-	cellulase	NA	NA	NA	NA	NA
AUJ07401.1|37491_38565_-	cellulase	NA	NA	NA	NA	NA
AUJ07402.1|38681_38888_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ07403.1|38873_39932_+	hydroxyacid dehydrogenase	NA	A0A2K9L339	Tupanvirus	45.7	3.9e-77
AUJ07404.1|40974_41238_+|transposase	transposase	transposase	NA	NA	NA	NA
AUJ07405.1|42339_42969_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ07406.1|42991_44050_+|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	43.5	6.2e-75
AUJ07407.1|44131_45613_-	glutamate synthase small subunit	NA	NA	NA	NA	NA
AUJ07408.1|45807_50280_-	glutamate synthase large subunit	NA	NA	NA	NA	NA
AUJ07409.1|50481_50862_-	Elastase inhibitor AFLEI Flags: Precursor	NA	NA	NA	NA	NA
AUJ07410.1|50918_52196_+	DNA topoisomerase	NA	A0A0U2TSJ7	Niemeyer_virus	35.3	1.4e-41
AUJ07411.1|52398_52704_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ10619.1|53193_53361_+	amino acid transporter	NA	NA	NA	NA	NA
AUJ10620.1|53890_55030_+	saccharopine dehydrogenase	NA	NA	NA	NA	NA
AUJ07412.1|55343_56129_-	Tat pathway signal protein	NA	NA	NA	NA	NA
AUJ10621.1|56139_58704_-	TonB-dependent receptor	NA	NA	NA	NA	NA
AUJ07413.1|58900_60058_+	XylR family transcriptional regulator	NA	NA	NA	NA	NA
AUJ07414.1|60100_60520_+|transposase	transposase	transposase	NA	NA	NA	NA
AUJ10622.1|60438_60864_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 2
CP019090	Xanthomonas oryzae pv. oryzae strain MAI129 chromosome, complete genome	4703963	206489	330646	4703963	tRNA,integrase,transposase	Leptospira_phage(21.43%)	101	249151:249167	276037:276053
AUJ10638.1|206489_206915_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AUJ07518.1|207223_210616_-	Avirulence protein AvrBs3	NA	NA	NA	NA	NA
AUJ07519.1|212394_212610_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ07520.1|214591_214894_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ07521.1|215050_215815_-	2,5-didehydrogluconate reductase B	NA	A0A2H4PQR8	Staphylococcus_phage	33.9	4.2e-33
AUJ07522.1|215837_216896_+|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	43.2	1.8e-74
AUJ07523.1|216998_218027_-	NADP-dependent oxidoreductase	NA	NA	NA	NA	NA
AUJ07524.1|218165_219137_-	alcohol dehydrogenase	NA	NA	NA	NA	NA
AUJ07525.1|219369_220224_+	methyltransferase	NA	NA	NA	NA	NA
AUJ10639.1|220316_220889_+	pseudouridine synthase	NA	NA	NA	NA	NA
AUJ07526.1|220910_221105_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ07527.1|221211_221652_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ07528.1|221953_224455_-	ATP-dependent helicase HrpB	NA	A0A2H4UU36	Bodo_saltans_virus	25.7	4.6e-20
AUJ07529.1|224608_225247_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ07530.1|225839_226313_-	hypothetical protein	NA	Q9EYF4	Enterobacteria_phage	48.0	1.1e-34
AUJ10640.1|226498_227203_-	hydroxyisourate hydrolase	NA	NA	NA	NA	NA
AUJ07531.1|227752_228166_-	DUF4440 domain-containing protein	NA	NA	NA	NA	NA
AUJ07532.1|229053_230310_-	aminotransferase V	NA	NA	NA	NA	NA
AUJ07533.1|231446_231839_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
AUJ07534.1|231950_234458_+	peptidase	NA	NA	NA	NA	NA
AUJ07535.1|234635_235094_-	gas vesicle protein	NA	NA	NA	NA	NA
AUJ07536.1|236227_237196_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.7	5.1e-100
AUJ07537.1|237400_237652_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ07538.1|238088_238274_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ07539.1|239029_239338_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ07540.1|239334_239766_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ07541.1|240846_241659_+	hydrolase TatD	NA	NA	NA	NA	NA
AUJ07542.1|242355_242553_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ07543.1|242528_243416_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUJ07544.1|243431_244793_+	MFS transporter	NA	NA	NA	NA	NA
AUJ07545.1|245232_246114_+	NAD-dependent deacetylase	NA	A0A068EPD4	Bacillus_phage	23.3	6.6e-14
AUJ07546.1|246193_247291_+	oxidoreductase	NA	NA	NA	NA	NA
AUJ07547.1|247328_248207_+	oxidoreductase	NA	NA	NA	NA	NA
AUJ10641.1|248549_248942_+	hypothetical protein	NA	NA	NA	NA	NA
249151:249167	attL	CATTGCGCCGATGCGCT	NA	NA	NA	NA
AUJ07548.1|249160_250012_+	formyltetrahydrofolate deformylase	NA	NA	NA	NA	NA
AUJ07549.1|250095_250773_-	DNA-binding response regulator	NA	NA	NA	NA	NA
AUJ07550.1|250805_251213_-	ATP-binding protein	NA	W8CYF6	Bacillus_phage	32.5	4.7e-15
AUJ07551.1|251209_251455_-	histidine kinase	NA	NA	NA	NA	NA
AUJ10642.1|251471_252368_-	5,10-methylenetetrahydrofolate reductase	NA	NA	NA	NA	NA
AUJ07552.1|252625_253291_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ07553.1|253290_254205_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUJ07554.1|254395_254989_+	FMN reductase	NA	NA	NA	NA	NA
AUJ07555.1|255131_256115_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ07556.1|256142_257171_+	5-methyltetrahydropteroyltriglutamate-- homocysteine methyltransferase	NA	NA	NA	NA	NA
AUJ10643.1|257378_258335_-	2-keto-3-deoxygluconate transporter	NA	NA	NA	NA	NA
AUJ07557.1|260763_261642_-	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
AUJ07558.1|261778_262210_+	transcriptional regulator	NA	NA	NA	NA	NA
AUJ10644.1|262427_262670_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ07559.1|263558_263822_-|transposase	transposase	transposase	NA	NA	NA	NA
AUJ07560.1|263790_264090_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ07561.1|264192_264465_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ07562.1|264742_265009_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ07563.1|265079_265289_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ07564.1|265287_266256_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	9.6e-99
AUJ10645.1|266702_266912_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ07565.1|267121_267367_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ07566.1|267610_270898_-	avirulence protein	NA	NA	NA	NA	NA
AUJ07567.1|271822_272791_+|integrase	integron integrase	integrase	A0A1P8DJJ6	Virus_Rctr41k	44.0	5.9e-56
AUJ07568.1|272990_274367_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.0	6.0e-62
AUJ07569.1|274544_276383_-	dihydroxy-acid dehydratase	NA	NA	NA	NA	NA
276037:276053	attR	AGCGCATCGGCGCAATG	NA	NA	NA	NA
AUJ10646.1|276557_276824_+	zinc/iron-chelating domain-containing protein	NA	NA	NA	NA	NA
AUJ07570.1|276849_277395_-	gamma carbonic anhydrase family protein	NA	NA	NA	NA	NA
AUJ07571.1|277870_279181_+	MFS transporter	NA	NA	NA	NA	NA
AUJ07572.1|279319_280579_+	phosphodiesterase	NA	NA	NA	NA	NA
AUJ10647.1|281063_281564_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
AUJ10648.1|281535_281922_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AUJ07573.1|283558_285457_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ07574.1|286031_286919_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AUJ07575.1|287016_288207_+	4-hydroxybenzoate 3-monooxygenase	NA	NA	NA	NA	NA
AUJ07576.1|288618_289131_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ07577.1|290687_291671_-	oxidoreductase	NA	NA	NA	NA	NA
AUJ07578.1|291771_292848_-	Rieske (2Fe-2S) protein	NA	NA	NA	NA	NA
AUJ10649.1|293099_293963_+	3-oxoadipate--succinyl-CoA transferase	NA	NA	NA	NA	NA
AUJ07579.1|294746_295955_+	3-oxoadipyl-CoA thiolase	NA	NA	NA	NA	NA
AUJ07580.1|296033_296771_+	protocatechuate 3,4-dioxygenase subunit beta	NA	NA	NA	NA	NA
AUJ07581.1|296775_297339_+	protocatechuate 3,4-dioxygenase subunit alpha	NA	NA	NA	NA	NA
AUJ07582.1|297836_299189_+	3-carboxy-cis,cis-muconate cycloisomerase	NA	NA	NA	NA	NA
AUJ07583.1|299199_299982_+	3-oxoadipate enol-lactonase	NA	NA	NA	NA	NA
AUJ07584.1|300007_300412_+	4-carboxymuconolactone decarboxylase	NA	NA	NA	NA	NA
AUJ07585.1|301891_302752_-	IclR family transcriptional regulator	NA	NA	NA	NA	NA
AUJ07586.1|302899_303760_+	serine protein kinase RIO	NA	NA	NA	NA	NA
AUJ07587.1|307054_308959_-|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG	tRNA	NA	NA	NA	NA
AUJ07588.1|309219_309399_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ07589.1|309532_310000_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ07590.1|310157_311117_+	serine/threonine dehydratase	NA	NA	NA	NA	NA
AUJ07591.1|311101_311716_+	protein sanA-like protein	NA	NA	NA	NA	NA
AUJ07592.1|311758_312178_+	isopropylmalate/homocitrate/citramalate synthase	NA	NA	NA	NA	NA
AUJ07593.1|312430_313336_-	aspartyl beta-hydroxylase	NA	S4VR59	Pandoravirus	39.1	9.8e-37
AUJ07594.1|313584_314469_-	malonyl-[acyl-carrier protein] O-methyltransferase BioC	NA	NA	NA	NA	NA
AUJ10650.1|315358_316120_-	pimeloyl-[acyl-carrier protein] methyl ester esterase	NA	NA	NA	NA	NA
AUJ07595.1|316283_316658_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ07596.1|316849_318055_-	8-amino-7-oxononanoate synthase	NA	NA	NA	NA	NA
AUJ07597.1|318146_319181_-	biotin synthase BioB	NA	NA	NA	NA	NA
AUJ07598.1|319224_319956_+	amidophosphoribosyltransferase	NA	NA	NA	NA	NA
AUJ07599.1|320211_321117_-	4-hydroxybenzoate octaprenyltransferase	NA	NA	NA	NA	NA
AUJ07600.1|322064_323123_+|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	43.5	6.2e-75
AUJ07601.1|323158_325099_-	HpaF protein	NA	NA	NA	NA	NA
AUJ07602.1|325662_328071_-	serine kinase	NA	NA	NA	NA	NA
AUJ10651.1|328278_329133_-|transposase	transposase	transposase	U5P429	Shigella_phage	57.3	1.1e-85
AUJ07603.1|329537_330524_-|transposase	transposase	transposase	S5WIU1	Leptospira_phage	40.6	3.4e-43
AUJ07604.1|330376_330646_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 3
CP019090	Xanthomonas oryzae pv. oryzae strain MAI129 chromosome, complete genome	4703963	359812	393941	4703963	transposase	Acidithiobacillus_phage(37.5%)	25	NA	NA
AUJ07631.1|359812_360781_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	1.6e-98
AUJ07632.1|360906_362631_-	ABC transporter substrate-binding protein	NA	A0A0P0CRE2	Ostreococcus_lucimarinus_virus	28.7	3.0e-34
AUJ07633.1|362641_362854_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ07634.1|362871_363813_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ07635.1|365369_366428_-|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	43.5	6.2e-75
AUJ07636.1|366448_368083_-	GGDEF domain-containing protein	NA	NA	NA	NA	NA
AUJ10654.1|368692_370150_+	starch synthase	NA	NA	NA	NA	NA
AUJ07637.1|370146_372378_+	glycogen-branching enzyme	NA	NA	NA	NA	NA
AUJ07638.1|372380_374138_+	malto-oligosyltrehalose trehalohydrolase	NA	NA	NA	NA	NA
AUJ10655.1|374194_376084_+	4-alpha-glucanotransferase	NA	NA	NA	NA	NA
AUJ07639.1|376080_378684_+	malto-oligosyltrehalose synthase	NA	NA	NA	NA	NA
AUJ07640.1|378706_378892_+	DUF2934 domain-containing protein	NA	NA	NA	NA	NA
AUJ07641.1|379005_381168_+	glycogen debranching enzyme	NA	NA	NA	NA	NA
AUJ10656.1|381184_381817_+	NAD-dependent dehydratase	NA	NA	NA	NA	NA
AUJ07642.1|382182_383559_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	55.5	2.0e-78
AUJ07643.1|383640_384396_-	3-oxoacyl-ACP reductase	NA	NA	NA	NA	NA
AUJ07644.1|384359_384665_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ07645.1|384746_386183_+	pyridine nucleotide-disulfide oxidoreductase	NA	NA	NA	NA	NA
AUJ07646.1|386531_386963_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ07647.1|387433_388810_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.7	3.2e-63
AUJ07648.1|389002_390379_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.3	2.1e-62
AUJ07649.1|390415_390610_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ07650.1|391049_392339_-	RNA helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.2	6.0e-40
AUJ07651.1|392346_392598_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ07652.1|392960_393941_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	56.7	1.4e-89
>prophage 4
CP019090	Xanthomonas oryzae pv. oryzae strain MAI129 chromosome, complete genome	4703963	492689	620080	4703963	capsid,tail,tRNA,portal,head,integrase,terminase,transposase,plate	Stenotrophomonas_phage(39.62%)	106	518316:518360	561298:561342
AUJ07729.1|492689_493253_-|tRNA	tRNA threonylcarbamoyladenosine biosynthesis protein RimN	tRNA	NA	NA	NA	NA
AUJ07730.1|493263_495756_-	DNA topoisomerase I	NA	A0A0G2YA05	Acanthamoeba_polyphaga_mimivirus	35.3	1.9e-114
AUJ07731.1|495938_497213_-	RDD family protein	NA	NA	NA	NA	NA
AUJ07732.1|497254_497977_-	pilus assembly protein PilA	NA	NA	NA	NA	NA
AUJ07733.1|498017_498491_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ07734.1|498533_499676_-	DNA protecting protein DprA	NA	NA	NA	NA	NA
AUJ07735.1|499747_500884_-	peptidoglycan-binding protein LysM	NA	G3MBQ1	Bacillus_virus	57.1	1.7e-09
AUJ07736.1|501016_501529_+	peptide deformylase	NA	E3SLL2	Synechococcus_phage	43.0	2.6e-18
AUJ07737.1|501929_502853_+|tRNA	methionyl-tRNA formyltransferase	tRNA	NA	NA	NA	NA
AUJ07738.1|502852_504166_+	16S rRNA (cytosine(967)-C(5))-methyltransferase	NA	NA	NA	NA	NA
AUJ07739.1|506116_507394_+	polymerase	NA	NA	NA	NA	NA
AUJ07740.1|507591_508416_-	lipopolysaccharide biosynthesis protein	NA	NA	NA	NA	NA
AUJ07741.1|508416_509475_+	CDP-glycerol glycerophosphotransferase	NA	NA	NA	NA	NA
AUJ07742.1|509641_511147_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ10668.1|511143_511653_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ07743.1|511762_512896_-	GTP cyclohydrolase	NA	A0A2H4PQS2	Staphylococcus_phage	44.2	6.1e-28
AUJ07744.1|513138_513660_+	N-acetyltransferase	NA	NA	NA	NA	NA
AUJ07745.1|513858_514773_-	lipid A biosynthesis lauroyl acyltransferase	NA	NA	NA	NA	NA
AUJ07746.1|514873_515314_+|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
AUJ07747.1|515422_517297_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	35.5	1.8e-37
AUJ07748.1|517489_517810_+	hypothetical protein	NA	NA	NA	NA	NA
518316:518360	attL	CTCATAATCCTTTGGTTGAAGGTTCGAATCCTTCTGGGCCCACCA	NA	NA	NA	NA
AUJ07749.1|518429_519617_-|integrase	integrase	integrase	V9IQN0	Stenotrophomonas_phage	50.5	6.0e-111
AUJ07750.1|519616_519841_-	hypothetical protein	NA	V9IQX6	Stenotrophomonas_phage	71.4	6.1e-17
AUJ07751.1|519837_520044_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ07752.1|520040_520313_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ10670.1|520309_520459_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ07753.1|520551_520827_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ10669.1|520819_520975_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ07754.1|520988_521399_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ07755.1|521624_521903_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ10671.1|521899_522118_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ10672.1|522426_525099_-	bifunctional DNA primase/helicase	NA	V9IQW5	Stenotrophomonas_phage	69.7	0.0e+00
AUJ07756.1|525132_525345_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ07757.1|525341_525620_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ07758.1|525630_525951_-	hypothetical protein	NA	V9IQW3	Stenotrophomonas_phage	56.5	6.3e-23
AUJ07759.1|525953_526211_-	DNA-binding protein	NA	A0A2H4JE67	uncultured_Caudovirales_phage	46.4	6.6e-07
AUJ07760.1|526282_526720_+	transcriptional regulator	NA	E5E3P4	Burkholderia_phage	32.0	5.4e-09
AUJ10673.1|527080_527365_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ07761.1|527380_528367_-	late control protein	NA	V9IQM7	Stenotrophomonas_phage	54.8	2.5e-94
AUJ07762.1|528363_528765_-	oxidoreductase	NA	V9IQX3	Stenotrophomonas_phage	62.3	6.0e-39
AUJ07763.1|528777_531648_-|tail	phage tail tape measure protein	tail	V9IQL1	Stenotrophomonas_phage	47.5	6.2e-194
AUJ07764.1|531680_531794_-	hypothetical protein	NA	A0A0M4R2P3	Salmonella_phage	68.6	4.2e-06
AUJ07765.1|531802_532105_-|tail	phage tail protein	tail	A4PE51	Ralstonia_virus	62.6	6.3e-25
AUJ07766.1|532150_532660_-|tail	phage major tail tube protein	tail	V9IQX1	Stenotrophomonas_phage	79.9	1.8e-72
AUJ07767.1|532690_533857_-|tail	phage tail protein	tail	E5FFG9	Burkholderia_phage	62.4	4.6e-132
AUJ07768.1|533868_534228_-|plate	baseplate assembly protein	plate	V9IQW0	Stenotrophomonas_phage	66.1	4.3e-36
AUJ07769.1|534224_534788_-|plate	baseplate assembly protein	plate	Q9ZXL0	Pseudomonas_virus	43.7	3.1e-25
AUJ07770.1|534848_535427_-|tail	phage tail protein	tail	NA	NA	NA	NA
AUJ07771.1|535434_536940_-	hypothetical protein	NA	V9IQX0	Stenotrophomonas_phage	47.0	2.1e-52
AUJ07772.1|536949_537495_-|tail	phage tail protein I	tail	V9IQK7	Stenotrophomonas_phage	54.7	3.5e-50
AUJ07773.1|537487_538378_-|plate	baseplate assembly protein	plate	V9IQV9	Stenotrophomonas_phage	53.7	7.2e-85
AUJ07774.1|538459_538909_-	phage virion morphogenesis protein	NA	V9IQH0	Stenotrophomonas_phage	54.7	1.8e-36
AUJ07775.1|538896_539316_-|tail	phage tail protein	tail	A0A2H4J906	uncultured_Caudovirales_phage	65.2	2.0e-40
AUJ07776.1|539789_540431_-	lysozyme	NA	V9IQK6	Stenotrophomonas_phage	60.9	7.9e-49
AUJ07777.1|540427_540703_-	hypothetical protein	NA	V9IQV8	Stenotrophomonas_phage	59.8	3.0e-21
AUJ07778.1|540695_541052_-	hypothetical protein	NA	V9IQG9	Stenotrophomonas_phage	56.1	4.5e-22
AUJ07779.1|541056_541266_-|tail	phage tail protein	tail	K4PAW7	Burkholderia_phage	59.4	5.4e-15
AUJ07780.1|541265_541733_-|head	head completion/stabilization protein	head	V9IQW6	Stenotrophomonas_phage	49.7	9.2e-31
AUJ07781.1|541832_542552_-|terminase	terminase	terminase	Q9ZXM2	Pseudomonas_virus	63.4	2.0e-69
AUJ07782.1|542555_543575_-|capsid	phage major capsid protein, P2 family	capsid	Q9ZXM3	Pseudomonas_virus	70.9	2.1e-136
AUJ07783.1|543621_544464_-|capsid	phage capsid protein	capsid	A0A2H4J928	uncultured_Caudovirales_phage	52.6	1.7e-67
AUJ07784.1|544585_546370_+|terminase	terminase	terminase	V9IQL5	Stenotrophomonas_phage	75.1	1.2e-267
AUJ07785.1|546369_547389_+|portal	phage portal protein	portal	A0A2H4J922	uncultured_Caudovirales_phage	72.5	4.1e-140
AUJ07786.1|547409_547640_+	hypothetical protein	NA	V9IQK2	Stenotrophomonas_phage	54.8	1.9e-13
AUJ07787.1|547572_548277_+	DNA modification methylase	NA	V9IQV5	Stenotrophomonas_phage	77.8	3.3e-109
AUJ07788.1|548308_548776_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ07789.1|548775_549954_-	DNA-binding protein	NA	NA	NA	NA	NA
AUJ07790.1|550684_553444_+	type IV secretion protein Rhs	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	27.3	1.8e-41
AUJ07791.1|553452_554379_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ07792.1|554375_557210_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ07793.1|557237_557969_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ07794.1|557995_560338_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ07795.1|561409_561643_-	hypothetical protein	NA	V9IQN0	Stenotrophomonas_phage	53.1	4.1e-16
561298:561342	attR	CTCATAATCCTTTGGTTGAAGGTTCGAATCCTTCTGGGCCCACCA	NA	NA	NA	NA
AUJ07796.1|561999_562854_+|transposase	transposase	transposase	U5P429	Shigella_phage	57.7	6.3e-86
AUJ10674.1|563519_564800_-	transcription termination factor Rho	NA	NA	NA	NA	NA
AUJ07797.1|565625_565967_-	thiol reductase thioredoxin	NA	A0A1J0GW78	Streptomyces_phage	44.4	2.3e-15
AUJ07798.1|566165_567890_+	ATP-dependent RNA helicase RhlB	NA	A0A1V0SBR7	Catovirus	29.4	1.1e-47
AUJ07799.1|567965_568652_+	cell division ATP-binding protein FtsE	NA	NA	NA	NA	NA
AUJ07800.1|568648_569599_+	ABC transporter permease	NA	NA	NA	NA	NA
AUJ10675.1|569655_570450_+	histidine kinase	NA	NA	NA	NA	NA
AUJ07801.1|570446_571172_+	uracil-DNA glycosylase	NA	A0A0B5IW78	Pandoravirus	44.3	4.7e-50
AUJ07802.1|571388_572264_+	RNA polymerase factor sigma-32	NA	A0A248SJA5	Salicola_phage	39.5	3.6e-44
AUJ07803.1|572342_572957_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ07804.1|573009_574302_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
AUJ07805.1|576592_576880_+	co-chaperone GroES	NA	A0A221S331	uncultured_virus	40.0	5.1e-16
AUJ07806.1|577023_578664_+	molecular chaperone GroEL	NA	A0A2I7SAK5	Vibrio_phage	63.5	5.1e-177
AUJ07807.1|578964_581241_-	type III secretion system effector protein	NA	NA	NA	NA	NA
AUJ07808.1|582348_583317_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	7.3e-99
AUJ07809.1|585702_586671_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	2.5e-99
AUJ07810.1|587602_588676_+	3-deoxy-7-phosphoheptulonate synthase	NA	S4W5F1	Pandoravirus	47.9	4.3e-84
AUJ07811.1|589162_591370_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ07812.1|591463_593881_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ07813.1|594144_595065_-	gluconolactonase	NA	NA	NA	NA	NA
AUJ07814.1|595064_595583_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ07815.1|595744_598570_+	bifunctional glutamine synthetase adenylyltransferase/deadenyltransferase	NA	NA	NA	NA	NA
AUJ07816.1|598665_599226_-	hypothetical protein	NA	A0A2I7SAW6	Vibrio_phage	30.2	1.4e-12
AUJ07817.1|600932_602309_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.3	2.1e-62
AUJ07818.1|603293_603896_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ07819.1|606401_606902_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ07820.1|607802_608750_-	nucleoside-diphosphate sugar epimerase	NA	NA	NA	NA	NA
AUJ07821.1|608886_609477_+	nitroreductase family protein	NA	NA	NA	NA	NA
AUJ07822.1|609687_610431_+	polyisoprenoid-binding protein	NA	NA	NA	NA	NA
AUJ07823.1|612746_615434_+	pyruvate dehydrogenase (acetyl-transferring), homodimeric type	NA	NA	NA	NA	NA
AUJ07824.1|615520_616258_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ07825.1|616268_617645_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.3	7.1e-63
AUJ07826.1|618703_620080_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.3	7.1e-63
>prophage 5
CP019090	Xanthomonas oryzae pv. oryzae strain MAI129 chromosome, complete genome	4703963	628008	710835	4703963	protease,tRNA,transposase	Acidithiobacillus_phage(14.29%)	54	NA	NA
AUJ07831.1|628008_628971_-|transposase	DDE transposase	transposase	NA	NA	NA	NA
AUJ07832.1|629258_630635_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.0	6.0e-62
AUJ07833.1|631640_635465_+	avirulence protein	NA	NA	NA	NA	NA
AUJ10676.1|635557_635950_+|transposase	transposase	transposase	NA	NA	NA	NA
AUJ07834.1|635843_636368_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	42.9	8.7e-22
AUJ07835.1|636534_638118_-	oxidoreductase	NA	M1NLX1	Moumouvirus	27.5	6.5e-36
AUJ07836.1|638508_638700_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ10677.1|641200_643513_-	S9 family peptidase	NA	NA	NA	NA	NA
AUJ07837.1|645428_646520_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ10678.1|647484_648393_-	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AUJ07838.1|648560_649436_+	EamA family transporter	NA	NA	NA	NA	NA
AUJ07839.1|649713_651486_-	cellulase	NA	NA	NA	NA	NA
AUJ07840.1|651883_653584_-	1,4-beta-cellobiosidase	NA	NA	NA	NA	NA
AUJ07841.1|654738_656115_+	D-serine/D-alanine/glycine transporter	NA	NA	NA	NA	NA
AUJ07842.1|656201_657197_-	type III secretion system effector protein	NA	NA	NA	NA	NA
AUJ07843.1|657442_658354_+	magnesium transporter	NA	NA	NA	NA	NA
AUJ07844.1|658888_659173_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ07845.1|659502_659949_+	autotransporter	NA	NA	NA	NA	NA
AUJ07846.1|660260_660524_+|transposase	transposase	transposase	NA	NA	NA	NA
AUJ07847.1|660376_661363_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	41.9	4.5e-43
AUJ07848.1|662071_663448_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.0	6.0e-62
AUJ10679.1|663485_664145_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	62.0	6.6e-67
AUJ07849.1|664620_666312_-	alpha,alpha-trehalase	NA	NA	NA	NA	NA
AUJ07850.1|666564_667350_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ07851.1|668593_669598_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ10680.1|669636_670578_-	histidine kinase	NA	NA	NA	NA	NA
AUJ07852.1|671101_673990_-	peptidase M16	NA	NA	NA	NA	NA
AUJ07853.1|674242_676825_+	sensor domain-containing diguanylate cyclase	NA	G3MA91	Bacillus_virus	29.2	3.2e-08
AUJ07854.1|677402_677879_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AUJ07855.1|680804_682259_-	endoglucanase	NA	H2DE45	Erwinia_phage	32.6	5.2e-48
AUJ07856.1|682466_683954_+	sodium-independent anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	57.1	2.4e-125
AUJ10681.1|684233_685187_+	hypothetical protein	NA	A0A127AWB9	Bacillus_phage	38.0	1.7e-15
AUJ07857.1|685355_687005_+	peptidase M20	NA	NA	NA	NA	NA
AUJ07858.1|687996_689934_+	glucan biosynthesis glucosyltransferase H	NA	NA	NA	NA	NA
AUJ07859.1|690085_690754_+	carboxylesterase	NA	NA	NA	NA	NA
AUJ07860.1|690758_691811_+	histidine kinase	NA	Q9EYF3	Enterobacteria_phage	33.6	1.4e-18
AUJ07861.1|691841_692579_+	DNA-binding response regulator	NA	NA	NA	NA	NA
AUJ07862.1|692609_693524_+	hydroxymethylbilane synthase	NA	NA	NA	NA	NA
AUJ07863.1|694086_694887_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ07864.1|695448_696414_+	transcriptional regulator	NA	NA	NA	NA	NA
AUJ07865.1|696522_697092_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ07866.1|697476_697788_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ07867.1|697855_699949_+	S9 family peptidase	NA	NA	NA	NA	NA
AUJ07868.1|700543_701728_-	aminotransferase	NA	NA	NA	NA	NA
AUJ07869.1|701753_701936_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ10682.1|701873_703973_+	oligopeptidase B	NA	F2Y2Z7	Organic_Lake_phycodnavirus	26.1	1.7e-28
AUJ10683.1|704316_704715_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ07870.1|704772_705015_+	sugar transporter	NA	NA	NA	NA	NA
AUJ07871.1|705004_705859_+	diaminopimelate epimerase	NA	NA	NA	NA	NA
AUJ07872.1|705846_706527_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ10684.1|706684_707638_+	tyrosine recombinase XerC	NA	A0A142F2H8	Mycobacterium_phage	28.1	1.8e-12
AUJ07873.1|708153_708705_+	HslU--HslV peptidase proteolytic subunit	NA	NA	NA	NA	NA
AUJ07874.1|708809_710177_+|protease	ATP-dependent protease ATP-binding subunit HslU	protease	A0A2H5BJT2	Erwinia_phage	29.5	4.7e-43
AUJ07875.1|710379_710835_-|tRNA	tRNA-specific adenosine deaminase	tRNA	NA	NA	NA	NA
>prophage 6
CP019090	Xanthomonas oryzae pv. oryzae strain MAI129 chromosome, complete genome	4703963	728013	803793	4703963	protease,tail,tRNA,transposase	Tupanvirus(11.76%)	54	NA	NA
AUJ07889.1|728013_729045_+|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	43.5	7.9e-75
AUJ07890.1|730346_731738_+	endopolygalacturonase	NA	NA	NA	NA	NA
AUJ07891.1|732006_733146_+	lytic murein transglycosylase B	NA	NA	NA	NA	NA
AUJ07892.1|733142_734558_+	hypothetical protein	NA	F5B3X9	Synechococcus_phage	50.6	4.3e-15
AUJ07893.1|735059_736265_+	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	40.9	1.6e-66
AUJ07894.1|736564_737218_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ07895.1|737344_737623_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ07896.1|737610_738309_+	octanoyltransferase	NA	NA	NA	NA	NA
AUJ07897.1|738323_739337_+	lipoyl synthase	NA	NA	NA	NA	NA
AUJ07898.1|739735_741919_+|tail,protease	tail-specific protease	tail,protease	A0A0R6PIZ1	Moraxella_phage	31.4	4.8e-82
AUJ07899.1|742210_743077_-	endonuclease	NA	NA	NA	NA	NA
AUJ07900.1|743238_744294_+	ADP-ribose pyrophosphatase	NA	A0A1B0V161	Roseobacter_phage	47.1	3.7e-80
AUJ07901.1|744416_745820_+	nicotinate phosphoribosyltransferase	NA	A0A218M332	Acidovorax_phage	52.6	6.6e-133
AUJ10686.1|748003_748801_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ07902.1|748925_749306_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ07903.1|749477_750815_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ07904.1|750835_751777_+	6-phosphogluconate dehydrogenase (decarboxylating)	NA	M4SJX8	Cyanophage	44.6	8.5e-68
AUJ07905.1|752116_753175_-	oxidoreductase	NA	NA	NA	NA	NA
AUJ10687.1|753334_753697_+	BON domain-containing protein	NA	NA	NA	NA	NA
AUJ07906.1|753981_755793_+	histidine kinase	NA	A0A2K9L0Z8	Tupanvirus	27.8	3.5e-09
AUJ07907.1|755789_756230_+	response regulator	NA	NA	NA	NA	NA
AUJ07908.1|756233_757736_+	hybrid sensor histidine kinase/response regulator	NA	A0A2K9L5I4	Tupanvirus	26.9	4.9e-09
AUJ07909.1|757827_758343_+	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
AUJ07910.1|758511_759249_-	pteridine reductase	NA	NA	NA	NA	NA
AUJ10688.1|759316_760501_+	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AUJ07911.1|761596_761791_-	hypothetical protein	NA	U5P4I9	Shigella_phage	51.0	2.2e-07
AUJ07912.1|761901_762870_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.7	2.3e-100
AUJ07913.1|763898_766607_+	TonB-dependent receptor	NA	NA	NA	NA	NA
AUJ07914.1|766757_769652_+	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	25.2	2.0e-22
AUJ07915.1|769648_772045_+	alpha-N-acetylglucosaminidase	NA	NA	NA	NA	NA
AUJ07916.1|772178_773345_+	DUF5009 domain-containing protein	NA	NA	NA	NA	NA
AUJ07917.1|773559_774327_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AUJ07918.1|774371_775649_+	glucose/galactose MFS transporter	NA	NA	NA	NA	NA
AUJ07919.1|775689_776757_+	LacI family transcriptional regulator	NA	NA	NA	NA	NA
AUJ07920.1|776763_777792_+	iron dicitrate transport regulator FecR	NA	NA	NA	NA	NA
AUJ10689.1|777794_778949_+	N-acetylglucosamine-6-phosphate deacetylase	NA	NA	NA	NA	NA
AUJ07921.1|779453_780059_-	poly-beta-1,6-N-acetyl-D-glucosamine biosynthesis protein PgaD	NA	NA	NA	NA	NA
AUJ07922.1|780055_781309_-	poly-beta-1,6 N-acetyl-D-glucosamine synthase	NA	NA	NA	NA	NA
AUJ07923.1|781310_783209_-	poly-beta-1,6-N-acetyl-D-glucosamine N-deacetylase PgaB	NA	NA	NA	NA	NA
AUJ07924.1|783210_785253_-	poly-beta-1,6 N-acetyl-D-glucosamine export porin PgaA	NA	NA	NA	NA	NA
AUJ07925.1|785810_786434_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	42.0	2.8e-35
AUJ07926.1|786466_787699_-|tRNA	multifunctional CCA tRNA nucleotidyl transferase/2'3'-cyclic phosphodiesterase/2'nucleotidase/phosphatase	tRNA	K4IEX3	Salmonella_phage	41.5	2.3e-73
AUJ07927.1|787919_788888_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	7.3e-99
AUJ10690.1|791069_791426_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ07928.1|791465_792158_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ07929.1|794252_794990_-	endonuclease	NA	NA	NA	NA	NA
AUJ07930.1|795039_795855_-	thiol:disulfide interchange protein	NA	NA	NA	NA	NA
AUJ07931.1|795946_796597_-	dihydroneopterin aldolase	NA	NA	NA	NA	NA
AUJ10691.1|796690_797431_-	cytochrome C	NA	NA	NA	NA	NA
AUJ07932.1|797632_798256_+	YihA family ribosome biogenesis GTP-binding protein	NA	NA	NA	NA	NA
AUJ10692.1|798349_799045_-	nodulin 21	NA	NA	NA	NA	NA
AUJ07933.1|799260_800625_+	glutamate--cysteine ligase	NA	NA	NA	NA	NA
AUJ07934.1|800811_801741_-	two-component system sensor protein	NA	W8CYF6	Bacillus_phage	25.2	1.7e-15
AUJ07935.1|802416_803793_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.0	6.0e-62
>prophage 7
CP019090	Xanthomonas oryzae pv. oryzae strain MAI129 chromosome, complete genome	4703963	832340	902118	4703963	protease,transposase	Streptococcus_phage(25.0%)	56	NA	NA
AUJ07962.1|832340_832817_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AUJ07963.1|834766_836119_+	type III secretion system effector protein	NA	NA	NA	NA	NA
AUJ07964.1|836568_836661_+	K+-transporting ATPase subunit F	NA	NA	NA	NA	NA
AUJ07965.1|836676_838470_+	potassium-transporting ATPase subunit KdpA	NA	NA	NA	NA	NA
AUJ07966.1|838482_840531_+	potassium-transporting ATPase subunit B	NA	E4ZFI9	Streptococcus_phage	28.2	1.7e-36
AUJ07967.1|840571_841201_+	potassium-transporting ATPase C chain	NA	NA	NA	NA	NA
AUJ07968.1|841251_843912_+	two-component sensor histidine kinase	NA	B5LWN0	Feldmannia_species_virus	28.1	1.6e-10
AUJ07969.1|843901_844618_+	DNA-binding response regulator	NA	NA	NA	NA	NA
AUJ07970.1|846468_846732_+|transposase	transposase	transposase	NA	NA	NA	NA
AUJ07971.1|846584_847571_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	41.9	4.5e-43
AUJ07972.1|848125_849511_-	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
AUJ10694.1|849507_850047_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ07973.1|850076_850445_-	YraN family protein	NA	NA	NA	NA	NA
AUJ07974.1|850449_852180_-	penicillin-binding protein activator	NA	NA	NA	NA	NA
AUJ07975.1|852261_853083_+	rRNA (cytidine-2'-O-)-methyltransferase	NA	M1PLC5	Streptococcus_phage	38.3	9.5e-39
AUJ10695.1|854499_854724_-	plasmid maintenance protein CcdB	NA	NA	NA	NA	NA
AUJ07976.1|854799_855567_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ07977.1|855881_856337_+	cell division/cell wall cluster transcriptional repressor MraZ	NA	NA	NA	NA	NA
AUJ10696.1|856381_857395_+	16S rRNA (cytosine(1402)-N(4))-methyltransferase	NA	NA	NA	NA	NA
AUJ07978.1|857391_857655_+	cell division protein FtsL	NA	NA	NA	NA	NA
AUJ07979.1|857788_859666_+	cell division protein	NA	NA	NA	NA	NA
AUJ07980.1|859662_861150_+	UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2, 6-diaminopimelate ligase	NA	NA	NA	NA	NA
AUJ07981.1|861146_862658_+	UDP-N-acetylmuramoylalanyl-D-glutamyl-2, 6-diaminopimelate--D-alanyl-D-alanine ligase	NA	NA	NA	NA	NA
AUJ07982.1|862647_863733_+	phospho-N-acetylmuramoyl-pentapeptide- transferase	NA	NA	NA	NA	NA
AUJ07983.1|863732_865106_+	cell division protein FtsW	NA	NA	NA	NA	NA
AUJ07984.1|865102_866428_+	UDP-N-acetylglucosamine--N-acetylmuramyl- (pentapeptide) pyrophosphoryl-undecaprenol N-acetylglucosamine transferase	NA	NA	NA	NA	NA
AUJ07985.1|866424_867858_+	UDP-N-acetylmuramate--L-alanine ligase	NA	NA	NA	NA	NA
AUJ07986.1|867854_868811_+	D-alanine--D-alanine ligase	NA	NA	NA	NA	NA
AUJ07987.1|868935_869757_+	cell division protein FtsQ	NA	NA	NA	NA	NA
AUJ07988.1|869753_870989_+	cell division protein FtsA	NA	NA	NA	NA	NA
AUJ07989.1|871297_872542_+	cell division protein FtsZ	NA	NA	NA	NA	NA
AUJ07990.1|872769_873681_+	UDP-3-O-[3-hydroxymyristoyl] N-acetylglucosamine deacetylase	NA	NA	NA	NA	NA
AUJ07991.1|873867_874320_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ07992.1|874320_875262_+	peptidase M23	NA	A0A292GJG6	Xanthomonas_phage	46.4	2.0e-29
AUJ07993.1|875418_878157_+	preprotein translocase subunit SecA	NA	NA	NA	NA	NA
AUJ07994.1|878622_878991_+	glyoxalase	NA	NA	NA	NA	NA
AUJ07995.1|879131_880079_+	DNA mismatch repair protein MutT	NA	NA	NA	NA	NA
AUJ07996.1|880264_880894_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ07997.1|881261_882089_-	methylenetetrahydrofolate reductase [NAD(P)H]	NA	NA	NA	NA	NA
AUJ07998.1|882128_883508_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ07999.1|884003_884981_+	NAD(P)H-quinone oxidoreductase	NA	NA	NA	NA	NA
AUJ10697.1|885217_886975_+|protease	protease	protease	NA	NA	NA	NA
AUJ08000.1|887054_887237_-	glyoxalase	NA	NA	NA	NA	NA
AUJ08001.1|887837_888773_+	D-galactose 1-dehydrogenase	NA	NA	NA	NA	NA
AUJ08002.1|889312_889735_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ08003.1|889921_890467_+	nucleoprotein/polynucleotide-associated enzyme	NA	NA	NA	NA	NA
AUJ08004.1|890696_891254_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ08005.1|891404_892091_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ08006.1|892583_893516_+	sulfotransferase	NA	A0A1X9T5H0	Ranid_herpesvirus	36.4	1.2e-05
AUJ10698.1|893547_894330_+	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AUJ08007.1|894559_896002_-	adenosylhomocysteinase	NA	S4W1G4	Pandoravirus	30.9	1.1e-47
AUJ08008.1|896314_896860_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ08009.1|897053_899768_+	phosphoenolpyruvate carboxylase	NA	NA	NA	NA	NA
AUJ08010.1|899827_900463_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
AUJ08011.1|901015_902002_-|transposase	transposase	transposase	S5WIU1	Leptospira_phage	41.9	4.5e-43
AUJ08012.1|901854_902118_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 8
CP019090	Xanthomonas oryzae pv. oryzae strain MAI129 chromosome, complete genome	4703963	1073122	1134136	4703963	protease,transposase	Leptospira_phage(18.18%)	47	NA	NA
AUJ08154.1|1073122_1074181_-|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	43.2	1.8e-74
AUJ08155.1|1075214_1076183_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	59.7	2.8e-98
AUJ08156.1|1078085_1079459_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ08157.1|1079557_1081597_-	NADPH-dependent 2,4-dienoyl-CoA reductase	NA	NA	NA	NA	NA
AUJ08158.1|1081804_1082827_-	NADPH:quinone reductase	NA	NA	NA	NA	NA
AUJ10715.1|1082800_1082995_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ08159.1|1083242_1084340_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ08160.1|1084532_1085042_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ08161.1|1085061_1085922_+	pseudouridylate synthase	NA	NA	NA	NA	NA
AUJ08162.1|1085872_1086265_-	HNH endonuclease	NA	NA	NA	NA	NA
AUJ08163.1|1086267_1087476_-	glycine C-acetyltransferase	NA	V5LQ39	Emiliania_huxleyi_virus	26.5	2.9e-20
AUJ10716.1|1087647_1088664_+	sulfate transporter subunit	NA	NA	NA	NA	NA
AUJ08164.1|1088667_1089528_+	sulfate ABC transporter permease subunit CysT	NA	NA	NA	NA	NA
AUJ08165.1|1089524_1090478_+	sulfate ABC transporter permease subunit CysW	NA	NA	NA	NA	NA
AUJ10717.1|1090485_1091520_+	sulfate ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	32.7	2.0e-25
AUJ08166.1|1091879_1092593_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ10718.1|1092662_1093685_-	L-threonine 3-dehydrogenase	NA	NA	NA	NA	NA
AUJ08167.1|1094200_1096534_-	TonB-dependent receptor	NA	NA	NA	NA	NA
AUJ10719.1|1098948_1101099_+	dipeptidyl-peptidase 7	NA	NA	NA	NA	NA
AUJ08168.1|1101191_1101836_+	histidine phosphatase family protein	NA	NA	NA	NA	NA
AUJ08169.1|1102017_1102368_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ08170.1|1102806_1104105_+	bifunctional tetrahydrofolate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
AUJ08171.1|1104172_1105255_+	SPOR domain-containing protein	NA	NA	NA	NA	NA
AUJ08172.1|1105469_1106210_+	colicin V synthesis protein	NA	NA	NA	NA	NA
AUJ08173.1|1106246_1107713_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	40.1	8.3e-86
AUJ10720.1|1107851_1108676_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ08174.1|1109395_1109872_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AUJ08175.1|1110656_1111076_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ08176.1|1111255_1111999_-	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
AUJ08177.1|1112151_1112502_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ08178.1|1112633_1113176_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
AUJ08179.1|1113156_1114293_-	glycosyl transferase	NA	NA	NA	NA	NA
AUJ08180.1|1114497_1116024_-	exopolyphosphatase	NA	NA	NA	NA	NA
AUJ08181.1|1116195_1118298_-	RNA degradosome polyphosphate kinase	NA	NA	NA	NA	NA
AUJ08182.1|1118401_1119745_-	phosphate regulon sensor histidine kinase PhoR	NA	W8CYF6	Bacillus_phage	33.8	5.0e-29
AUJ08183.1|1119802_1120492_-	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	35.7	5.9e-34
AUJ10721.1|1120666_1122313_-	peptidase	NA	NA	NA	NA	NA
AUJ08184.1|1122462_1122771_+	glutaredoxin 3	NA	A0A2L0UZG6	Agrobacterium_phage	43.2	4.7e-07
AUJ08185.1|1122767_1123163_+	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
AUJ08186.1|1123377_1124385_+	isocitrate dehydrogenase	NA	NA	NA	NA	NA
AUJ08187.1|1124525_1125287_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ08188.1|1126493_1127552_+|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	42.9	2.6e-73
AUJ08189.1|1127708_1127891_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ08190.1|1128868_1129837_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	9.6e-99
AUJ08191.1|1131112_1131586_-	histidine kinase	NA	NA	NA	NA	NA
AUJ10722.1|1132124_1133417_+	trigger factor	NA	NA	NA	NA	NA
AUJ08192.1|1133509_1134136_+|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	57.4	1.0e-56
>prophage 9
CP019090	Xanthomonas oryzae pv. oryzae strain MAI129 chromosome, complete genome	4703963	1243047	1319953	4703963	protease,transposase	Bacillus_phage(15.38%)	56	NA	NA
AUJ08269.1|1243047_1244445_-|protease	serine protease	protease	NA	NA	NA	NA
AUJ08270.1|1244872_1246843_+	oligopeptide transporter, OPT family	NA	NA	NA	NA	NA
AUJ08271.1|1246757_1247432_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ08272.1|1247687_1248533_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ10734.1|1248821_1250942_+	peptidase S9	NA	NA	NA	NA	NA
AUJ08273.1|1251218_1251680_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ08274.1|1251811_1252537_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AUJ08275.1|1253354_1255496_+	outer protein P	NA	NA	NA	NA	NA
AUJ08276.1|1255612_1257748_+	outer protein P	NA	NA	NA	NA	NA
AUJ08277.1|1258712_1258907_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ10735.1|1259818_1261057_-	type III secretion system effector protein	NA	NA	NA	NA	NA
AUJ08278.1|1261882_1263988_-	catalase HPII	NA	A0A2K9L0T1	Tupanvirus	47.7	1.9e-136
AUJ08279.1|1264205_1264379_-	oxidoreductase	NA	NA	NA	NA	NA
AUJ08280.1|1265637_1266285_-	VRR-NUC domain-containing protein	NA	Q8W6S1	Burkholderia_virus	45.5	6.5e-35
AUJ08281.1|1266281_1266833_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ08282.1|1266956_1267139_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ10736.1|1267198_1270132_-	glycine dehydrogenase (aminomethyl-transferring)	NA	M4QFZ1	Prochlorococcus_phage	49.9	8.9e-257
AUJ08283.1|1270599_1270791_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ10737.1|1271221_1272025_+	sulfotransferase	NA	M4QPS9	Synechococcus_phage	27.7	9.0e-26
AUJ10738.1|1272113_1273325_+	hemolysin D	NA	NA	NA	NA	NA
AUJ08284.1|1273321_1275481_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	28.0	2.2e-34
AUJ08285.1|1276289_1276694_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ08286.1|1276775_1278794_-	peptidase M20	NA	NA	NA	NA	NA
AUJ08287.1|1278905_1280576_-	phosphoethanolamine transferase	NA	NA	NA	NA	NA
AUJ10739.1|1280572_1281337_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ10740.1|1281436_1283107_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ08288.1|1283389_1284106_+	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	34.4	2.8e-23
AUJ08289.1|1284098_1285391_+	two-component sensor histidine kinase	NA	NA	NA	NA	NA
AUJ08290.1|1285542_1286034_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ08291.1|1286102_1286360_-	cell division topological specificity factor MinE	NA	NA	NA	NA	NA
AUJ08292.1|1286362_1287172_-	septum site-determining protein MinD	NA	NA	NA	NA	NA
AUJ08293.1|1287207_1287948_-	septum site-determining protein MinC	NA	NA	NA	NA	NA
AUJ08294.1|1287952_1288552_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AUJ08295.1|1288796_1289993_+	two-component sensor histidine kinase	NA	NA	NA	NA	NA
AUJ08296.1|1289992_1290634_+	DNA-binding response regulator	NA	NA	NA	NA	NA
AUJ08297.1|1290984_1292181_+	polyketide cyclase	NA	NA	NA	NA	NA
AUJ08298.1|1292262_1292649_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ08299.1|1292651_1293326_+	DNA-3-methyladenine glycosylase	NA	NA	NA	NA	NA
AUJ10741.1|1293389_1294016_-	peptidase	NA	NA	NA	NA	NA
AUJ08300.1|1294317_1294497_-	Arc family DNA binding domain-containing protein	NA	NA	NA	NA	NA
AUJ08301.1|1294493_1294778_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ08302.1|1295393_1296596_+	phosphoribosylglycinamide formyltransferase 2	NA	NA	NA	NA	NA
AUJ08303.1|1297572_1298304_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ08304.1|1298503_1299382_+	hypothetical protein	NA	A8ATW4	Listeria_phage	34.5	3.9e-06
AUJ08305.1|1299489_1299750_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ08306.1|1299809_1301291_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ08307.1|1301306_1305044_+	type VI secretion protein VasK	NA	NA	NA	NA	NA
AUJ08308.1|1305040_1306024_+	type VI secretion-associated protein	NA	NA	NA	NA	NA
AUJ08309.1|1306020_1306815_+	cell envelope biogenesis protein OmpA	NA	NA	NA	NA	NA
AUJ08310.1|1306867_1307938_-	type VI secretion protein	NA	NA	NA	NA	NA
AUJ08311.1|1308841_1309900_+|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	43.2	1.8e-74
AUJ08312.1|1309971_1312794_+	type IV secretion protein Rhs	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	28.4	1.0e-52
AUJ10742.1|1313299_1314316_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	37.3	7.3e-49
AUJ08313.1|1315423_1316800_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	54.8	3.0e-77
AUJ08314.1|1316943_1318320_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	46.6	5.1e-61
AUJ08315.1|1318984_1319953_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	7.3e-99
>prophage 10
CP019090	Xanthomonas oryzae pv. oryzae strain MAI129 chromosome, complete genome	4703963	1342364	1395001	4703963	transposase	Ralstonia_phage(27.27%)	43	NA	NA
AUJ08330.1|1342364_1343351_-|transposase	transposase	transposase	S5WIU1	Leptospira_phage	41.4	2.6e-43
AUJ08331.1|1343203_1343467_-|transposase	transposase	transposase	NA	NA	NA	NA
AUJ08332.1|1343511_1344288_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	53.1	4.1e-52
AUJ08333.1|1345974_1347039_-	uroporphyrinogen decarboxylase	NA	NA	NA	NA	NA
AUJ08334.1|1347053_1347305_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ10745.1|1347604_1348717_-	3-dehydroquinate synthase	NA	NA	NA	NA	NA
AUJ08335.1|1348713_1349256_-	shikimate kinase	NA	NA	NA	NA	NA
AUJ08336.1|1349422_1350022_+	pyridoxamine 5'-phosphate oxidase	NA	NA	NA	NA	NA
AUJ08337.1|1350202_1350619_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ08338.1|1350631_1351405_+	PspA-IM30 family protein	NA	NA	NA	NA	NA
AUJ08339.1|1351430_1352513_+	potassium channel protein	NA	NA	NA	NA	NA
AUJ08340.1|1352515_1353187_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ08341.1|1353224_1353629_+	DUF350 domain-containing protein	NA	NA	NA	NA	NA
AUJ08342.1|1353641_1354214_+	hypothetical protein	NA	A0A191ZBZ0	Erwinia_phage	28.1	6.4e-10
AUJ08343.1|1354215_1355382_+	hypothetical protein	NA	B2ZXR7	Ralstonia_phage	41.6	6.4e-73
AUJ10746.1|1358327_1360010_+	peptidase M1	NA	NA	NA	NA	NA
AUJ08344.1|1361059_1364206_+	TonB-dependent receptor	NA	NA	NA	NA	NA
AUJ08345.1|1364225_1364462_-	transcriptional regulator	NA	NA	NA	NA	NA
AUJ08346.1|1364537_1365290_+	peptide ABC transporter permease	NA	NA	NA	NA	NA
AUJ08347.1|1365300_1366347_+	cupin	NA	NA	NA	NA	NA
AUJ08348.1|1366387_1367905_+	tryptophan halogenase	NA	A0A1D7SF58	Cyanophage	31.8	5.8e-50
AUJ08349.1|1367942_1368947_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
AUJ10747.1|1369091_1369490_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ08350.1|1369621_1370998_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	54.8	6.0e-78
AUJ08351.1|1371140_1371326_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ10748.1|1371585_1372539_-	endoproteinase ArgC	NA	NA	NA	NA	NA
AUJ08352.1|1373424_1374807_-	porin	NA	NA	NA	NA	NA
AUJ08353.1|1374999_1375764_+	LuxR family transcriptional regulator	NA	NA	NA	NA	NA
AUJ08354.1|1376077_1377019_+	amino acid amidase	NA	NA	NA	NA	NA
AUJ08355.1|1377774_1379163_+	amino acid transporter	NA	NA	NA	NA	NA
AUJ10749.1|1381112_1382531_-|transposase	ISL3 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	41.0	8.8e-93
AUJ08356.1|1382523_1383426_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ08357.1|1383425_1384667_-	DNA (cytosine-5-)-methyltransferase	NA	M1PSQ0	Streptococcus_phage	34.7	3.2e-54
AUJ08358.1|1384899_1385868_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	59.7	1.6e-98
AUJ08359.1|1386988_1388005_+	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
AUJ10750.1|1388065_1388860_-	phospholipase	NA	NA	NA	NA	NA
AUJ08360.1|1389019_1390381_-	magnesium transporter	NA	NA	NA	NA	NA
AUJ08361.1|1390443_1390668_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ08362.1|1390668_1392399_-	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	24.1	1.0e-10
AUJ08363.1|1392457_1392727_-	phosphocarrier protein HPr	NA	NA	NA	NA	NA
AUJ08364.1|1392719_1393112_-	PTS fructose IIA subunit family protein	NA	NA	NA	NA	NA
AUJ08365.1|1393505_1394474_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	59.7	5.6e-99
AUJ08366.1|1394599_1395001_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
>prophage 11
CP019090	Xanthomonas oryzae pv. oryzae strain MAI129 chromosome, complete genome	4703963	1419870	1482796	4703963	transposase	Ralstonia_phage(27.27%)	57	NA	NA
AUJ08396.1|1419870_1420929_+|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	43.5	6.2e-75
AUJ08397.1|1420995_1421964_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	2.5e-99
AUJ08398.1|1422267_1422597_-	benzene 1,2-dioxygenase	NA	NA	NA	NA	NA
AUJ08399.1|1422593_1423133_-	N-acetyltransferase	NA	NA	NA	NA	NA
AUJ08400.1|1423342_1424311_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.7	3.0e-100
AUJ08401.1|1424424_1425669_-	cysteine sulfinate desulfinase	NA	Q2XUY6	environmental_halophage	41.7	5.0e-92
AUJ08402.1|1425665_1426928_-	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
AUJ08403.1|1426927_1427692_-	ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	28.5	2.0e-11
AUJ08404.1|1427949_1429407_-	Fe-S cluster assembly protein SufB	NA	NA	NA	NA	NA
AUJ08405.1|1429422_1429881_-	transcriptional regulator	NA	NA	NA	NA	NA
AUJ08406.1|1430052_1430520_+	SET domain-containing protein-lysine N-methyltransferase	NA	NA	NA	NA	NA
AUJ08407.1|1430624_1430843_+	peptidase	NA	NA	NA	NA	NA
AUJ08408.1|1431449_1432046_-	DUF1439 domain-containing protein	NA	NA	NA	NA	NA
AUJ08409.1|1432101_1432644_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ08410.1|1432701_1433043_-	DUF3861 domain-containing protein	NA	NA	NA	NA	NA
AUJ10752.1|1433100_1433715_-	peptidase	NA	NA	NA	NA	NA
AUJ08411.1|1433846_1434272_-	DNA-binding protein	NA	NA	NA	NA	NA
AUJ08412.1|1434827_1435826_-	pyrroline-5-carboxylate reductase	NA	NA	NA	NA	NA
AUJ08413.1|1435731_1436424_-	YggS family pyridoxal phosphate enzyme	NA	NA	NA	NA	NA
AUJ08414.1|1437605_1438643_+	twitching motility protein PilT	NA	NA	NA	NA	NA
AUJ08415.1|1438756_1439887_+	type IV pili twitching motility protein PilT	NA	NA	NA	NA	NA
AUJ10753.1|1440176_1440833_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ08416.1|1441935_1442508_-	DNA-3-methyladenine glycosylase	NA	NA	NA	NA	NA
AUJ08417.1|1442504_1442939_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ08418.1|1443784_1444351_+	DUF179 domain-containing protein	NA	NA	NA	NA	NA
AUJ08419.1|1444343_1444811_+	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
AUJ08420.1|1444824_1445772_+	aspartate carbamoyltransferase	NA	NA	NA	NA	NA
AUJ08421.1|1446208_1446643_+	OsmC family peroxiredoxin	NA	NA	NA	NA	NA
AUJ08422.1|1446825_1447395_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ08423.1|1447692_1448574_-	phenazine biosynthesis protein PhzF family	NA	NA	NA	NA	NA
AUJ08424.1|1449666_1452276_+	diaminopimelate decarboxylase	NA	NA	NA	NA	NA
AUJ08425.1|1452259_1452718_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ08426.1|1452714_1454070_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ08427.1|1454050_1455457_+	UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase	NA	NA	NA	NA	NA
AUJ08428.1|1455503_1455677_+	AsmA family protein	NA	NA	NA	NA	NA
AUJ10754.1|1455812_1456595_+	dienelactone hydrolase	NA	NA	NA	NA	NA
AUJ08429.1|1456689_1457658_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	1.5e-99
AUJ08430.1|1457912_1458911_-	octaprenyl-diphosphate synthase	NA	NA	NA	NA	NA
AUJ08431.1|1459186_1459720_+	single-stranded DNA-binding protein	NA	L7TJL2	Pseudomonas_virus	60.9	1.9e-32
AUJ08432.1|1459739_1459952_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ08433.1|1460002_1461487_-	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	37.5	5.0e-14
AUJ08434.1|1464999_1465677_+	HAD family hydrolase	NA	NA	NA	NA	NA
AUJ08435.1|1465912_1466119_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ08436.1|1466213_1466438_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ08437.1|1466437_1468510_-	carbon starvation protein A	NA	NA	NA	NA	NA
AUJ08438.1|1468793_1469600_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ08439.1|1469770_1470058_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ08440.1|1470461_1473278_+	type IV secretion protein Rhs	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	28.6	4.7e-53
AUJ08441.1|1473277_1474174_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ08442.1|1474170_1474635_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ08443.1|1474655_1475138_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ10755.1|1475287_1475767_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ08444.1|1475853_1477590_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ08445.1|1478060_1478255_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ08446.1|1478370_1479747_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	48.1	9.9e-65
AUJ08447.1|1480397_1480994_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ08448.1|1481419_1482796_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	54.8	1.0e-77
>prophage 12
CP019090	Xanthomonas oryzae pv. oryzae strain MAI129 chromosome, complete genome	4703963	1490422	1527206	4703963	tRNA,transposase	Shigella_phage(42.86%)	30	NA	NA
AUJ10758.1|1490422_1491277_+|transposase	transposase	transposase	U5P429	Shigella_phage	57.7	4.8e-86
AUJ10759.1|1491408_1492530_-	chemotaxis response regulator protein-glutamate methylesterase	NA	NA	NA	NA	NA
AUJ08452.1|1492544_1493372_-	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AUJ08453.1|1493355_1494639_-	diguanylate phosphodiesterase	NA	NA	NA	NA	NA
AUJ08454.1|1494665_1495181_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ10760.1|1495191_1497204_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	61.5	1.3e-09
AUJ10761.1|1497259_1497442_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ08455.1|1497416_1499420_-	chemotaxis protein CheA	NA	NA	NA	NA	NA
AUJ08456.1|1499438_1499768_-	anti-anti-sigma factor	NA	NA	NA	NA	NA
AUJ08457.1|1500257_1503722_-	transcription-repair coupling factor	NA	NA	NA	NA	NA
AUJ08458.1|1503835_1504027_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ08459.1|1504115_1504658_-	N-acetyltransferase	NA	NA	NA	NA	NA
AUJ10762.1|1505082_1505991_-	23S rRNA (adenine(2030)-N(6))-methyltransferase RlmJ	NA	NA	NA	NA	NA
AUJ08460.1|1507521_1508334_-	peptidase C1	NA	NA	NA	NA	NA
AUJ08461.1|1509279_1509891_+	N-acetyltransferase	NA	NA	NA	NA	NA
AUJ08462.1|1510009_1510894_+	nitrilase	NA	NA	NA	NA	NA
AUJ08463.1|1510915_1512007_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ08464.1|1512075_1513479_+|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
AUJ08465.1|1513492_1513999_+	Fur family transcriptional regulator	NA	NA	NA	NA	NA
AUJ08466.1|1514401_1514860_+	cupin	NA	NA	NA	NA	NA
AUJ08467.1|1515637_1515841_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ08468.1|1516004_1516277_+|transposase	transposase	transposase	U5P4I9	Shigella_phage	58.8	1.2e-19
AUJ08469.1|1516294_1517149_+|transposase	transposase	transposase	U5P429	Shigella_phage	56.9	9.1e-85
AUJ08470.1|1517257_1518274_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	37.6	2.5e-49
AUJ08471.1|1518559_1519936_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	53.7	8.9e-74
AUJ10763.1|1519963_1520854_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ08472.1|1521540_1522137_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ10764.1|1524676_1524949_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ08473.1|1525620_1526151_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ08474.1|1526147_1527206_-|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	43.2	8.9e-74
>prophage 13
CP019090	Xanthomonas oryzae pv. oryzae strain MAI129 chromosome, complete genome	4703963	1569867	1633540	4703963	protease,tRNA,transposase	Ralstonia_phage(30.0%)	52	NA	NA
AUJ08501.1|1569867_1570836_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	7.3e-99
AUJ08502.1|1571159_1571453_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ10770.1|1571531_1571945_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ10771.1|1572636_1573545_-	peptidylprolyl isomerase	NA	NA	NA	NA	NA
AUJ08503.1|1573673_1573907_-	DUF378 domain-containing protein	NA	NA	NA	NA	NA
AUJ08504.1|1574380_1574674_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ08505.1|1575566_1576016_-	tetrameric acyl-CoA thioesterase	NA	NA	NA	NA	NA
AUJ08506.1|1576281_1577139_-	co-chaperone YbbN	NA	A0A1J0GW78	Streptomyces_phage	41.8	1.0e-11
AUJ08507.1|1577343_1577955_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ08508.1|1578053_1580696_+|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	40.0	4.7e-172
AUJ08509.1|1581209_1581845_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ08510.1|1581867_1582896_+	DNA polymerase III subunit delta	NA	NA	NA	NA	NA
AUJ08511.1|1582892_1583792_+	nicotinic acid mononucleotide adenylyltransferase	NA	NA	NA	NA	NA
AUJ08512.1|1583848_1584265_+	ribosome silencing factor RsfS	NA	NA	NA	NA	NA
AUJ08513.1|1584276_1585392_+	molecular chaperone DnaJ	NA	NA	NA	NA	NA
AUJ08514.1|1585717_1585927_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ08515.1|1586481_1586952_+	23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH	NA	NA	NA	NA	NA
AUJ08516.1|1587389_1588064_-	energy transducer TonB	NA	NA	NA	NA	NA
AUJ08517.1|1588374_1591485_-	Oar protein	NA	NA	NA	NA	NA
AUJ08518.1|1591951_1592686_-	SIMPL domain-containing protein	NA	NA	NA	NA	NA
AUJ08519.1|1592824_1593397_+	septum formation inhibitor Maf	NA	NA	NA	NA	NA
AUJ08520.1|1593396_1594896_+	ribonuclease E/G	NA	NA	NA	NA	NA
AUJ08521.1|1595036_1598957_+	DUF3971 domain-containing protein	NA	NA	NA	NA	NA
AUJ10772.1|1598962_1599715_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ08522.1|1599813_1601259_+|protease	metalloprotease TldD	protease	NA	NA	NA	NA
AUJ08523.1|1601515_1602097_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ10773.1|1602242_1603610_+|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
AUJ10774.1|1603684_1604089_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ10775.1|1604215_1604602_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ08524.1|1604671_1605769_-|protease	protease	protease	NA	NA	NA	NA
AUJ08525.1|1606497_1606974_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AUJ08526.1|1607085_1607961_-	(2E,6E)-farnesyl diphosphate synthase	NA	NA	NA	NA	NA
AUJ08527.1|1607962_1608223_-	exodeoxyribonuclease VII small subunit	NA	NA	NA	NA	NA
AUJ08528.1|1608254_1609559_-|tRNA	tRNA(Ile)-lysidine synthase	tRNA	NA	NA	NA	NA
AUJ08529.1|1609592_1611299_-	alkaline phosphatase	NA	NA	NA	NA	NA
AUJ08530.1|1611441_1612782_+	dicarboxylate/amino acid:cation symporter	NA	NA	NA	NA	NA
AUJ10776.1|1612953_1613628_+	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AUJ08531.1|1613874_1614366_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
AUJ08532.1|1614573_1615323_-	hypothetical protein	NA	A0A0K2SUC1	Clostridium_phage	38.5	1.2e-19
AUJ10777.1|1615432_1616005_-	glycoside hydrolase	NA	A0A1V0DZX6	Clostridioides_phage	40.5	3.4e-19
AUJ08533.1|1616079_1616559_+	peptidylprolyl isomerase	NA	NA	NA	NA	NA
AUJ08534.1|1616787_1618032_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ08535.1|1618039_1619290_+	amino acid dehydrogenase	NA	NA	NA	NA	NA
AUJ08536.1|1619286_1620657_+	glutathione-disulfide reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	25.8	2.4e-34
AUJ08537.1|1621043_1621313_+|transposase	transposase	transposase	NA	NA	NA	NA
AUJ08538.1|1622169_1622511_+	cysteine methyltransferase	NA	NA	NA	NA	NA
AUJ08539.1|1622551_1623250_+|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
AUJ08540.1|1623500_1624469_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	9.6e-99
AUJ08541.1|1625052_1626078_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	37.6	1.9e-49
AUJ08542.1|1628473_1630489_-	peptidase M13	NA	NA	NA	NA	NA
AUJ10778.1|1631158_1632175_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	37.6	9.6e-49
AUJ08543.1|1632571_1633540_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	2.5e-99
>prophage 14
CP019090	Xanthomonas oryzae pv. oryzae strain MAI129 chromosome, complete genome	4703963	1698468	1757205	4703963	tRNA,integrase,transposase	Tetraselmis_virus(12.5%)	50	1696859:1696875	1771642:1771658
1696859:1696875	attL	TGGCCGAAGGCCGCGCC	NA	NA	NA	NA
AUJ08596.1|1698468_1699395_+|tRNA	tRNA pseudouridine(55) synthase	tRNA	NA	NA	NA	NA
AUJ08597.1|1699551_1699812_+	30S ribosomal protein S15	NA	NA	NA	NA	NA
AUJ08598.1|1699978_1702093_+	polyribonucleotide nucleotidyltransferase	NA	NA	NA	NA	NA
AUJ08599.1|1702466_1703507_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ08600.1|1703570_1704446_-	nicotinate-nucleotide diphosphorylase (carboxylating)	NA	NA	NA	NA	NA
AUJ08601.1|1704442_1704712_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ08602.1|1704770_1705274_+	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	38.7	3.6e-17
AUJ08603.1|1705270_1706416_+	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
AUJ08604.1|1706557_1707136_-	superoxide dismutase	NA	Q56AR7	Bacillus_thuringiensis_phage	39.6	8.4e-34
AUJ08605.1|1707257_1707578_+	monothiol glutaredoxin, Grx4 family	NA	NA	NA	NA	NA
AUJ08606.1|1707574_1708318_+	short-chain dehydrogenase	NA	NA	NA	NA	NA
AUJ08607.1|1708314_1708914_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ08608.1|1709683_1712878_+	Oar protein	NA	NA	NA	NA	NA
AUJ08609.1|1712984_1714370_+	LOG family protein	NA	NA	NA	NA	NA
AUJ08610.1|1714539_1715055_+	pre-pilin like leader sequence	NA	A0A1W6JT76	Pseudomonas_phage	42.5	1.1e-05
AUJ08611.1|1715051_1715528_+	type IV pilus modification protein PilV	NA	NA	NA	NA	NA
AUJ08612.1|1715524_1716691_+	pilus assembly protein PilW	NA	NA	NA	NA	NA
AUJ08613.1|1716694_1717204_+	pilus assembly protein	NA	NA	NA	NA	NA
AUJ10786.1|1717160_1721162_+	pilus assembly protein	NA	NA	NA	NA	NA
AUJ08614.1|1721174_1721624_+	pilus assembly protein PilE	NA	NA	NA	NA	NA
AUJ08615.1|1721800_1722343_-	prepilin-type N-terminal cleavage/methylation domain-containing protein	NA	NA	NA	NA	NA
AUJ08616.1|1722481_1724503_+	excinuclease ABC subunit B	NA	NA	NA	NA	NA
AUJ08617.1|1725717_1725987_-|transposase	transposase	transposase	NA	NA	NA	NA
AUJ10787.1|1726297_1726732_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ08618.1|1727155_1728250_-	acyltransferase	NA	NA	NA	NA	NA
AUJ08619.1|1728677_1730345_-	urocanate hydratase	NA	NA	NA	NA	NA
AUJ08620.1|1730361_1731219_-	N-formylglutamate deformylase	NA	NA	NA	NA	NA
AUJ08621.1|1731403_1732945_-	histidine ammonia-lyase	NA	A0A1V0S940	Catovirus	42.8	2.7e-79
AUJ08622.1|1732958_1734164_-	imidazolonepropionase	NA	NA	NA	NA	NA
AUJ08623.1|1734239_1735595_+	formimidoylglutamate deiminase	NA	NA	NA	NA	NA
AUJ10788.1|1735949_1736654_+	histidine utilization repressor	NA	NA	NA	NA	NA
AUJ08624.1|1736810_1737815_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ08625.1|1738387_1738951_-	poly(hydroxyalcanoate) granule associated protein	NA	NA	NA	NA	NA
AUJ08626.1|1739112_1739388_-	polyhydroxyalkanoic acid synthase	NA	NA	NA	NA	NA
AUJ10789.1|1739628_1740438_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ08627.1|1740379_1741036_-	sulfoxide reductase heme-binding subunit YedZ	NA	NA	NA	NA	NA
AUJ08628.1|1741337_1742306_-	mononuclear molybdenum enzyme YedY	NA	NA	NA	NA	NA
AUJ08629.1|1742480_1743566_+	phosphoserine transaminase	NA	M1Q1P2	Streptococcus_phage	43.6	1.7e-75
AUJ08630.1|1743648_1744857_+	chorismate mutase	NA	NA	NA	NA	NA
AUJ08631.1|1744978_1746292_+	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
AUJ08632.1|1746655_1747132_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AUJ08633.1|1747320_1747590_+|transposase	transposase	transposase	NA	NA	NA	NA
AUJ08634.1|1747442_1748429_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	41.4	2.6e-43
AUJ10790.1|1748848_1749316_-	energy transducer TonB	NA	NA	NA	NA	NA
AUJ08635.1|1749746_1750715_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.7	3.0e-100
AUJ08636.1|1750836_1751604_-	energy transducer TonB	NA	NA	NA	NA	NA
AUJ08637.1|1751610_1753002_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	49.6	1.0e-93
AUJ08638.1|1753462_1754047_-	FMN-dependent NADH-azoreductase	NA	NA	NA	NA	NA
AUJ08639.1|1754146_1755163_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUJ10791.1|1755786_1757205_+|integrase	integrase	integrase	NA	NA	NA	NA
1771642:1771658	attR	TGGCCGAAGGCCGCGCC	NA	NA	NA	NA
>prophage 15
CP019090	Xanthomonas oryzae pv. oryzae strain MAI129 chromosome, complete genome	4703963	1839079	1848967	4703963	tRNA	Escherichia_phage(28.57%)	9	NA	NA
AUJ10804.1|1839079_1840756_+	2-polyprenylphenol 6-hydroxylase	NA	E5EQ95	Micromonas_sp._RCC1109_virus	27.3	2.1e-37
AUJ08702.1|1840844_1841486_+	LexA repressor 2	NA	A0A1W6JNS2	Morganella_phage	40.2	2.4e-13
AUJ08703.1|1841658_1842693_+	DNA recombination/repair protein RecA	NA	A0A0S2MVG1	Bacillus_phage	61.0	1.6e-112
AUJ08704.1|1842994_1843483_+	recombination regulator RecX	NA	NA	NA	NA	NA
AUJ08705.1|1843584_1846233_+|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	39.8	2.4e-83
AUJ08706.1|1846372_1846585_+	carbon storage regulator	NA	J7I430	Pseudomonas_phage	76.5	1.3e-13
AUJ08707.1|1847112_1847295_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ08708.1|1848306_1848561_+	hypothetical protein	NA	A0A0N7C1X7	Escherichia_phage	59.6	4.5e-08
AUJ08709.1|1848475_1848967_+	lysozyme	NA	D5LH07	Escherichia_phage	67.7	4.6e-57
>prophage 16
CP019090	Xanthomonas oryzae pv. oryzae strain MAI129 chromosome, complete genome	4703963	1974568	2059341	4703963	tRNA,transposase	uncultured_Caudovirales_phage(36.36%)	53	NA	NA
AUJ08812.1|1974568_1976086_+|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	38.5	8.6e-86
AUJ08813.1|1976227_1977364_+	two-component system response regulator	NA	NA	NA	NA	NA
AUJ08814.1|1977365_1977704_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ08815.1|1977728_1979906_+	hybrid sensor histidine kinase/response regulator	NA	A0A1V0SGX0	Hokovirus	33.1	1.3e-47
AUJ08816.1|1979917_1980787_-	enoyl-CoA hydratase	NA	NA	NA	NA	NA
AUJ08817.1|1980963_1982646_-	long-chain fatty acid--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	26.2	2.1e-32
AUJ08818.1|1983295_1986064_-	aconitate hydratase	NA	NA	NA	NA	NA
AUJ08819.1|1986211_1986460_+	AbrB family transcriptional regulator	NA	NA	NA	NA	NA
AUJ08820.1|1986456_1986867_+	VapC toxin family PIN domain ribonuclease	NA	NA	NA	NA	NA
AUJ08821.1|1986932_1989524_+	aconitate hydratase B	NA	NA	NA	NA	NA
AUJ08822.1|1989877_1990693_+	2-succinyl-6-hydroxy-2, 4-cyclohexadiene-1-carboxylate synthase	NA	NA	NA	NA	NA
AUJ08823.1|1991348_1993535_-	bifunctional diguanylate cyclase/phosphodiesterase	NA	NA	NA	NA	NA
AUJ08824.1|1993700_1994777_-	chemotaxis response regulator protein-glutamate methylesterase	NA	NA	NA	NA	NA
AUJ08825.1|1994773_1995370_-	chemoreceptor glutamine deamidase CheD	NA	NA	NA	NA	NA
AUJ08826.1|1995366_1996233_-	chemotaxis protein CheR	NA	NA	NA	NA	NA
AUJ08827.1|1996478_1998869_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	58.3	3.9e-08
AUJ08828.1|1998947_1999331_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ08829.1|1999646_2000129_-	chemotaxis protein CheW	NA	NA	NA	NA	NA
AUJ08830.1|2000264_2001062_-	pilus assembly protein PilZ	NA	NA	NA	NA	NA
AUJ08831.1|2002103_2004365_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	54.5	1.3e-10
AUJ08832.1|2004776_2007038_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	41.7	2.5e-12
AUJ10814.1|2007629_2009594_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	47.4	1.5e-10
AUJ08833.1|2010149_2011208_-|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	43.5	6.2e-75
AUJ08834.1|2014208_2016452_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	41.8	3.4e-14
AUJ08835.1|2016710_2018087_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.3	2.1e-62
AUJ08836.1|2018368_2020582_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	63.2	1.9e-09
AUJ08837.1|2020779_2023149_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	61.7	2.7e-09
AUJ08838.1|2023162_2023924_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ08839.1|2029431_2031693_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	61.4	2.8e-08
AUJ08840.1|2032591_2034601_-	chemotaxis protein CheA	NA	NA	NA	NA	NA
AUJ08841.1|2034634_2035000_-	response regulator	NA	W8CYM9	Bacillus_phage	39.3	2.7e-14
AUJ08842.1|2034996_2035305_-	anti-anti-sigma factor	NA	NA	NA	NA	NA
AUJ08843.1|2035405_2036428_-	chemotaxis protein	NA	NA	NA	NA	NA
AUJ08844.1|2036424_2037207_-	chromosome partitioning protein ParA	NA	Q8JL10	Natrialba_phage	35.7	1.7e-13
AUJ08845.1|2037208_2038183_-	flagellar motor protein MotD	NA	NA	NA	NA	NA
AUJ08846.1|2038189_2038930_-	flagellar motor protein	NA	NA	NA	NA	NA
AUJ08847.1|2039018_2039372_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ08848.1|2041658_2042366_-	superoxide dismutase	NA	Q56AR7	Bacillus_thuringiensis_phage	51.2	1.4e-51
AUJ08849.1|2042368_2043313_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ08850.1|2043882_2046102_-	TonB-dependent siderophore receptor	NA	A0A0P0I887	Acinetobacter_phage	28.6	3.7e-05
AUJ08851.1|2046356_2046809_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ10815.1|2047700_2050742_+	TonB-dependent receptor	NA	NA	NA	NA	NA
AUJ08852.1|2051420_2052389_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	7.3e-99
AUJ08853.1|2052387_2052825_+|transposase	transposase	transposase	NA	NA	NA	NA
AUJ08854.1|2052872_2053307_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ08855.1|2054701_2055025_+	hypothetical protein	NA	Q6H9S4	Enterobacteria_phage	57.9	2.0e-24
AUJ08856.1|2055021_2055924_+|transposase	transposase	transposase	Q8W6R2	Burkholderia_virus	67.7	1.6e-103
AUJ08857.1|2056019_2056421_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ08858.1|2056417_2056927_+	hypothetical protein	NA	A4PE24	Ralstonia_virus	36.0	1.3e-09
AUJ10816.1|2056907_2057249_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ08859.1|2057262_2057859_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ08860.1|2057756_2057966_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ08861.1|2057964_2059341_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.0	6.0e-62
>prophage 17
CP019090	Xanthomonas oryzae pv. oryzae strain MAI129 chromosome, complete genome	4703963	2139414	2201855	4703963	protease,tRNA,transposase	Ralstonia_phage(25.0%)	47	NA	NA
AUJ08928.1|2139414_2140551_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
AUJ08929.1|2140547_2141006_-	NUDIX hydrolase	NA	NA	NA	NA	NA
AUJ08930.1|2141256_2141577_+|protease	ATP-dependent Clp protease adaptor ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	1.3e-12
AUJ08931.1|2141719_2144002_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	44.6	5.1e-175
AUJ08932.1|2144209_2144428_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
AUJ10820.1|2144508_2145261_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
AUJ08933.1|2145394_2146024_-	cinnamoyl-CoA reductase	NA	NA	NA	NA	NA
AUJ08934.1|2146699_2147821_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AUJ08935.1|2147878_2148847_-	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.5	2.0e-64
AUJ08936.1|2149130_2151488_+	cell division protein FtsK	NA	G1D482	Mycobacterium_virus	45.8	2.5e-84
AUJ08937.1|2151650_2153579_+	transglutaminase	NA	NA	NA	NA	NA
AUJ10821.1|2153685_2154315_+	outer membrane lipoprotein carrier protein LolA	NA	NA	NA	NA	NA
AUJ08938.1|2154427_2158594_-	type III effector	NA	NA	NA	NA	NA
AUJ10822.1|2158830_2160207_+	recombination factor protein RarA	NA	G3MBE0	Bacillus_virus	38.3	4.0e-74
AUJ08939.1|2160238_2160565_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ08940.1|2160561_2160969_-	fluoride ion transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	49.1	7.5e-21
AUJ08941.1|2161000_2161351_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ08942.1|2161347_2162679_-	voltage-gated chloride channel protein	NA	A0A1X9I5Z9	Streptococcus_phage	35.2	4.3e-41
AUJ08943.1|2162999_2164205_-	acetyl-CoA acetyltransferase	NA	NA	NA	NA	NA
AUJ08944.1|2164369_2166742_-	3-hydroxyacyl-CoA dehydrogenase	NA	NA	NA	NA	NA
AUJ08945.1|2166766_2167399_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
AUJ08946.1|2167617_2168043_+	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	41.7	1.1e-19
AUJ08947.1|2168061_2169267_+	23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN	NA	NA	NA	NA	NA
AUJ08948.1|2169277_2170066_+	type IV pilus biogenesis/stability protein PilW	NA	NA	NA	NA	NA
AUJ08949.1|2170062_2170923_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ08950.1|2170993_2171632_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ08951.1|2171628_2172849_+	outer membrane protein assembly factor BamB	NA	NA	NA	NA	NA
AUJ08952.1|2172859_2174257_+	ribosome biogenesis GTPase Der	NA	NA	NA	NA	NA
AUJ08953.1|2174571_2175792_+	molybdopterin molybdenumtransferase MoeA	NA	NA	NA	NA	NA
AUJ08954.1|2176283_2177444_-	molybdopterin biosynthesis protein MoeB	NA	NA	NA	NA	NA
AUJ10823.1|2178292_2179309_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	37.3	3.3e-49
AUJ08955.1|2180391_2181360_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	59.7	2.8e-98
AUJ08956.1|2181508_2181898_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ08957.1|2181836_2182214_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ08958.1|2182419_2183673_+	molybdopterin molybdenumtransferase MoeA	NA	NA	NA	NA	NA
AUJ08959.1|2183710_2184280_+	molybdenum cofactor guanylyltransferase	NA	NA	NA	NA	NA
AUJ08960.1|2184263_2184626_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ08961.1|2187000_2187978_-	siroheme synthase	NA	NA	NA	NA	NA
AUJ08962.1|2189299_2189488_+	nitrate transport ATP-binding protein	NA	NA	NA	NA	NA
AUJ08963.1|2189500_2189776_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ08964.1|2190420_2190678_+	stress-induced protein	NA	NA	NA	NA	NA
AUJ08965.1|2190903_2191872_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	1.1e-99
AUJ08966.1|2192513_2192999_+	YciE/YciF family protein	NA	NA	NA	NA	NA
AUJ08967.1|2193105_2194026_+	peptidase	NA	NA	NA	NA	NA
AUJ08968.1|2195215_2197027_-	GGDEF domain-containing protein	NA	NA	NA	NA	NA
AUJ08969.1|2197777_2200876_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ08970.1|2200886_2201855_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	5.6e-99
>prophage 18
CP019090	Xanthomonas oryzae pv. oryzae strain MAI129 chromosome, complete genome	4703963	2315375	2374237	4703963	transposase	Leptospira_phage(25.0%)	39	NA	NA
AUJ08996.1|2315375_2315870_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	39.7	3.1e-29
AUJ08997.1|2317848_2320974_-	multidrug efflux RND transporter permease subunit	NA	NA	NA	NA	NA
AUJ08998.1|2321025_2322138_-	efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
AUJ08999.1|2322261_2322840_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
AUJ09000.1|2324017_2324575_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ09001.1|2325394_2327482_+	type III effector	NA	NA	NA	NA	NA
AUJ10826.1|2329419_2332509_+	histidine kinase	NA	NA	NA	NA	NA
AUJ09002.1|2332894_2333680_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	47.6	2.8e-48
AUJ10827.1|2334793_2335501_+	DNA-binding response regulator	NA	NA	NA	NA	NA
AUJ09003.1|2335497_2336490_+	cytochrome-c peroxidase	NA	NA	NA	NA	NA
AUJ09004.1|2336486_2338946_+	two-component sensor histidine kinase	NA	NA	NA	NA	NA
AUJ09005.1|2339059_2340040_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUJ09006.1|2340048_2341077_+	type VI secretion system protein ImpA	NA	NA	NA	NA	NA
AUJ09007.1|2341249_2341576_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ09008.1|2341572_2344476_-	serine/threonine protein kinase	NA	A0A2R8FF19	Brazilian_cedratvirus	25.0	1.9e-09
AUJ09009.1|2344472_2345195_-	phosphoprotein phosphatase	NA	NA	NA	NA	NA
AUJ09010.1|2345191_2345839_-	type VI secretion-associated protein	NA	NA	NA	NA	NA
AUJ09011.1|2345835_2349294_-	type VI secretion protein	NA	NA	NA	NA	NA
AUJ09012.1|2349297_2350614_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ09013.1|2350615_2351953_-	type VI secretion system-associated protein	NA	NA	NA	NA	NA
AUJ09014.1|2351949_2353338_-	peptide-binding protein	NA	NA	NA	NA	NA
AUJ09015.1|2353334_2353874_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ09016.1|2353882_2355820_-	type IV secretion protein Rhs	NA	A0A077K8Q4	Ralstonia_phage	28.6	7.7e-39
AUJ09017.1|2356083_2356545_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ09018.1|2356647_2356851_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ09019.1|2357895_2359272_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	55.1	4.6e-78
AUJ09020.1|2359434_2360403_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	7.3e-99
AUJ09021.1|2360497_2360848_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ09022.1|2360844_2363616_-	ClpV1 family T6SS ATPase	NA	H6X3M6	Enterobacteria_phage	29.3	1.2e-77
AUJ09023.1|2363648_2364659_-	type VI secretion protein	NA	NA	NA	NA	NA
AUJ09024.1|2364622_2366500_-	type VI secretion system protein ImpG	NA	NA	NA	NA	NA
AUJ09025.1|2366503_2367007_-	type VI secretion system lysozyme	NA	NA	NA	NA	NA
AUJ09026.1|2366994_2367828_-	ImpE protein	NA	NA	NA	NA	NA
AUJ09027.1|2367863_2368367_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ09028.1|2368466_2369981_-	EvpB family type VI secretion protein	NA	NA	NA	NA	NA
AUJ10828.1|2369973_2370480_-	type VI secretion system-associated protein	NA	NA	NA	NA	NA
AUJ09029.1|2371146_2371623_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AUJ10829.1|2372983_2373187_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ09030.1|2373223_2374237_-|transposase	transposase	transposase	S5WIU1	Leptospira_phage	41.0	6.6e-42
>prophage 19
CP019090	Xanthomonas oryzae pv. oryzae strain MAI129 chromosome, complete genome	4703963	2624799	2707956	4703963	tRNA,transposase	Ralstonia_phage(16.67%)	47	NA	NA
AUJ09221.1|2624799_2626254_+|tRNA	tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase	tRNA	NA	NA	NA	NA
AUJ09222.1|2626677_2627664_+	PhoH family protein	NA	A0A1B2ICF6	Erwinia_phage	47.7	4.8e-45
AUJ09223.1|2628094_2628739_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ09224.1|2628793_2629279_+	endoribonuclease YbeY	NA	NA	NA	NA	NA
AUJ09225.1|2629278_2629797_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ09226.1|2629891_2630770_+	magnesium/cobalt efflux protein	NA	NA	NA	NA	NA
AUJ10850.1|2630784_2632047_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ09227.1|2632062_2633064_+	magnesium transporter CorA	NA	NA	NA	NA	NA
AUJ10851.1|2633215_2634580_-	succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
AUJ09228.1|2635054_2635903_-	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
AUJ09229.1|2635899_2636811_-	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
AUJ09230.1|2636939_2638073_-	polyamine ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	35.3	7.4e-26
AUJ09231.1|2638218_2639730_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ09232.1|2639716_2641303_-	MFS transporter	NA	NA	NA	NA	NA
AUJ09233.1|2641299_2642502_-	multidrug ABC transporter permease	NA	NA	NA	NA	NA
AUJ09234.1|2643350_2644319_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	59.7	3.6e-98
AUJ09235.1|2646938_2648324_-	glutamine synthetase	NA	NA	NA	NA	NA
AUJ10852.1|2648970_2650350_+	glutamine synthetase	NA	NA	NA	NA	NA
AUJ09236.1|2650349_2651666_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
AUJ09237.1|2651802_2653047_+	diguanylate cyclase response regulator	NA	A0A127AWB9	Bacillus_phage	36.4	1.9e-19
AUJ09238.1|2653352_2654633_-	MFS transporter	NA	NA	NA	NA	NA
AUJ09239.1|2654934_2655243_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ09240.1|2655202_2657551_-	CbbBc protein	NA	NA	NA	NA	NA
AUJ09241.1|2657547_2658393_-	sulfurtransferase FdhD	NA	NA	NA	NA	NA
AUJ09242.1|2658399_2660079_-	MFS transporter	NA	NA	NA	NA	NA
AUJ09243.1|2660607_2661960_+	aspartate aminotransferase family protein	NA	NA	NA	NA	NA
AUJ09244.1|2662020_2665152_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ09245.1|2665316_2666171_+	plasmid replication/partition related protein	NA	A0A1B1INV8	uncultured_Mediterranean_phage	38.7	3.2e-13
AUJ09246.1|2666341_2667646_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ09247.1|2667787_2671882_+	hybrid sensor histidine kinase/response regulator	NA	A0A1V0SGX0	Hokovirus	28.4	5.0e-56
AUJ09248.1|2672974_2673943_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.7	5.1e-100
AUJ09249.1|2674429_2679439_-	glutamate dehydrogenase	NA	NA	NA	NA	NA
AUJ09250.1|2679716_2680376_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
AUJ09251.1|2680390_2681698_+	efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
AUJ09252.1|2681710_2684881_+	multidrug efflux RND transporter permease	NA	NA	NA	NA	NA
AUJ09253.1|2687572_2688568_-	LacI family transcriptional regulator	NA	NA	NA	NA	NA
AUJ09254.1|2688728_2691245_+	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	28.5	6.3e-09
AUJ09255.1|2691241_2692198_+	1-phosphofructokinase	NA	NA	NA	NA	NA
AUJ09256.1|2692356_2694099_+	PTS fructose transporter subunit EIIBC	NA	NA	NA	NA	NA
AUJ10853.1|2694417_2695554_+	carbohydrate porin	NA	NA	NA	NA	NA
AUJ09257.1|2695948_2698711_+	type IV secretion protein Rhs	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	27.4	3.6e-42
AUJ09258.1|2698981_2699707_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ10854.1|2700185_2701202_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	37.6	2.5e-49
AUJ09259.1|2703777_2704521_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ09260.1|2705137_2706514_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.3	2.1e-62
AUJ09261.1|2706853_2707117_+|transposase	transposase	transposase	NA	NA	NA	NA
AUJ09262.1|2706969_2707956_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	41.9	4.5e-43
>prophage 20
CP019090	Xanthomonas oryzae pv. oryzae strain MAI129 chromosome, complete genome	4703963	2901947	2946879	4703963	transposase	Ralstonia_phage(13.33%)	36	NA	NA
AUJ09400.1|2901947_2902916_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.7	5.1e-100
AUJ10878.1|2904307_2905324_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	37.6	2.5e-49
AUJ09401.1|2905496_2906399_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ09402.1|2906596_2907964_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	47.9	1.6e-112
AUJ09403.1|2908215_2908728_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ09404.1|2908657_2908897_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ09405.1|2909239_2910739_+	transcriptional regulator	NA	NA	NA	NA	NA
AUJ09406.1|2910735_2911668_+	N-acetyltransferase	NA	NA	NA	NA	NA
AUJ09407.1|2911848_2914677_+	2-oxoglutarate dehydrogenase subunit E1	NA	NA	NA	NA	NA
AUJ09408.1|2914719_2915922_+	dihydrolipoamide succinyltransferase	NA	NA	NA	NA	NA
AUJ09409.1|2916163_2917600_+	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	26.8	3.7e-38
AUJ09410.1|2917798_2918392_+	Rossman fold protein, TIGR00730 family	NA	A0A2I2L3F0	Orpheovirus	27.5	2.1e-11
AUJ10879.1|2918656_2919250_+	IMPACT family protein	NA	A0A1X9I5T8	Streptococcus_phage	41.2	8.1e-16
AUJ09411.1|2919246_2921016_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	30.5	5.2e-58
AUJ09412.1|2921258_2922113_+	RND transporter	NA	NA	NA	NA	NA
AUJ09413.1|2922109_2923513_+	multidrug transporter	NA	NA	NA	NA	NA
AUJ09414.1|2923864_2924059_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ09415.1|2924338_2925460_-	prephenate dehydrogenase	NA	NA	NA	NA	NA
AUJ09416.1|2925456_2926374_-	pyridoxal kinase	NA	NA	NA	NA	NA
AUJ09417.1|2926901_2928032_-	molecular chaperone DnaJ	NA	Q8QNB4	Ectocarpus_siliculosus_virus	30.0	1.4e-24
AUJ09418.1|2928191_2930117_-	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	50.6	2.2e-147
AUJ09419.1|2930258_2930777_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
AUJ09420.1|2930877_2931930_-	heat-inducible transcriptional repressor HrcA	NA	NA	NA	NA	NA
AUJ09421.1|2932046_2933711_+	DNA repair protein RecN	NA	NA	NA	NA	NA
AUJ09422.1|2934153_2934579_-	ferric iron uptake transcriptional regulator	NA	NA	NA	NA	NA
AUJ09423.1|2934668_2935064_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ09424.1|2935410_2935686_-	RnfH family protein	NA	NA	NA	NA	NA
AUJ09425.1|2935699_2936131_-	ubiquinone-binding protein	NA	NA	NA	NA	NA
AUJ09426.1|2936191_2936695_+	SsrA-binding protein	NA	W5RAM5	Staphylococcus_phage	41.9	5.8e-23
AUJ09427.1|2936859_2939307_-	serine peptidase	NA	A0A218KC60	Bacillus_phage	26.7	2.6e-15
AUJ09428.1|2940428_2940809_-	hypothetical protein	NA	Q6H9S4	Enterobacteria_phage	56.2	2.3e-19
AUJ09429.1|2941056_2942025_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.7	5.1e-100
AUJ09430.1|2942247_2943624_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	46.3	7.3e-60
AUJ10880.1|2944392_2945085_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ09431.1|2945776_2946040_+|transposase	transposase	transposase	NA	NA	NA	NA
AUJ09432.1|2945892_2946879_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	41.9	4.5e-43
>prophage 21
CP019090	Xanthomonas oryzae pv. oryzae strain MAI129 chromosome, complete genome	4703963	2956407	3018457	4703963	protease,tRNA,transposase	Acidithiobacillus_phage(17.65%)	48	NA	NA
AUJ09439.1|2956407_2957784_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.3	2.1e-62
AUJ09440.1|2957834_2958878_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	54.1	1.5e-76
AUJ09441.1|2958926_2959190_+|transposase	transposase	transposase	NA	NA	NA	NA
AUJ09442.1|2959042_2960029_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	41.9	4.5e-43
AUJ09443.1|2961408_2961633_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ10883.1|2961666_2962782_+	GGDEF domain-containing protein	NA	NA	NA	NA	NA
AUJ09444.1|2963378_2964353_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	37.0	2.6e-19
AUJ09445.1|2966215_2966941_-	OmpA family lipoprotein	NA	G3M9Z0	Bacillus_virus	33.9	1.8e-09
AUJ10884.1|2966950_2967130_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ09446.1|2967725_2968202_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AUJ09447.1|2968209_2969664_-	deoxyribodipyrimidine photolyase	NA	A0A1V0S949	Catovirus	31.5	4.4e-47
AUJ09448.1|2969730_2971161_-	replicative DNA helicase	NA	O80281	Escherichia_phage	53.6	3.8e-120
AUJ09449.1|2971382_2971937_-	NADPH-dependent oxidoreductase	NA	A0A2P0ZL77	Lactobacillus_phage	34.1	1.2e-18
AUJ09450.1|2972153_2974094_-	asparagine synthetase B	NA	A0A1B1ISV2	uncultured_Mediterranean_phage	30.8	2.6e-26
AUJ10885.1|2974269_2974899_-	glutathione S-transferase	NA	NA	NA	NA	NA
AUJ09451.1|2978974_2979766_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ09452.1|2979911_2980127_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ09453.1|2980126_2980894_+	DNAase	NA	NA	NA	NA	NA
AUJ09454.1|2980955_2981786_-|tRNA	tRNA threonylcarbamoyladenosine dehydratase	tRNA	NA	NA	NA	NA
AUJ09455.1|2981858_2982287_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ09456.1|2982418_2982898_+	peptidoglycan-associated outer membrane lipoprotein precursor	NA	NA	NA	NA	NA
AUJ09457.1|2983148_2983364_-	cold-shock protein	NA	A0A1X9IGI9	Lactococcus_phage	59.7	6.5e-16
AUJ09458.1|2983330_2983564_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ09459.1|2983591_2984077_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ10886.1|2984278_2984761_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	58.6	4.1e-42
AUJ09460.1|2986695_2988927_+	chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	59.7	1.5e-09
AUJ09461.1|2989070_2990447_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	55.1	4.6e-78
AUJ09462.1|2991565_2992534_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	5.6e-99
AUJ09463.1|2992855_2993905_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ09464.1|2994101_2995070_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	1.9e-99
AUJ09465.1|2996160_2996796_-	glutathione S-transferase	NA	NA	NA	NA	NA
AUJ09466.1|2996931_2998449_-	fumarate hydratase	NA	NA	NA	NA	NA
AUJ09467.1|2998487_2998748_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ09468.1|2998782_3000663_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	38.9	5.2e-24
AUJ09469.1|3000851_3001631_+	ferredoxin--NADP(+) reductase	NA	NA	NA	NA	NA
AUJ09470.1|3001712_3002198_-	glutathione peroxidase	NA	A0A1S7DM81	Molluscum_contagiosum_virus	36.2	2.8e-14
AUJ10887.1|3004655_3004895_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ09471.1|3005144_3005858_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ10888.1|3007389_3007878_+	RNA polymerase subunit sigma-70	NA	NA	NA	NA	NA
AUJ10889.1|3008039_3008618_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ09472.1|3008709_3009210_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
AUJ09473.1|3009276_3010122_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ09474.1|3010172_3010451_-	N-acetyltransferase	NA	NA	NA	NA	NA
AUJ09475.1|3010670_3010859_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ09476.1|3011272_3011881_-|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
AUJ09477.1|3013077_3014895_+	peptidase M14	NA	NA	NA	NA	NA
AUJ09478.1|3014966_3017213_+	glycosyl hydrolase	NA	NA	NA	NA	NA
AUJ09479.1|3017980_3018457_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 22
CP019090	Xanthomonas oryzae pv. oryzae strain MAI129 chromosome, complete genome	4703963	3177856	3264852	4703963	protease,transposase	Hokovirus(26.67%)	53	NA	NA
AUJ09599.1|3177856_3179233_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.3	2.3e-61
AUJ10906.1|3180147_3180477_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ09600.1|3180667_3182599_-	alpha-L-fucosidase	NA	NA	NA	NA	NA
AUJ09601.1|3183044_3183899_+|transposase	transposase	transposase	U5P429	Shigella_phage	57.7	2.8e-86
AUJ10907.1|3183934_3187474_-	histidine kinase	NA	A0A1V0SGX0	Hokovirus	33.3	2.6e-45
AUJ09602.1|3187976_3191543_-	histidine kinase	NA	A0A1V0SGX0	Hokovirus	33.3	7.7e-45
AUJ09603.1|3191608_3195172_-	histidine kinase	NA	A0A1V0SGX0	Hokovirus	30.7	8.3e-39
AUJ09604.1|3195465_3199041_-	hybrid sensor histidine kinase/response regulator	NA	A0A1V0SGX0	Hokovirus	32.2	4.6e-37
AUJ09605.1|3199137_3199800_+	polyisoprenoid-binding protein	NA	NA	NA	NA	NA
AUJ09606.1|3199796_3200360_+	cytochrome b	NA	NA	NA	NA	NA
AUJ09607.1|3200369_3200939_+	polyisoprenoid-binding protein	NA	NA	NA	NA	NA
AUJ10908.1|3201256_3201646_+	cold-shock protein	NA	NA	NA	NA	NA
AUJ09608.1|3201731_3201965_-	thioredoxin family protein	NA	NA	NA	NA	NA
AUJ09609.1|3202052_3203435_+	L-serine ammonia-lyase	NA	NA	NA	NA	NA
AUJ09610.1|3205202_3206420_-	O-succinylhomoserine (thiol)-lyase	NA	NA	NA	NA	NA
AUJ09611.1|3206416_3207448_-	homoserine acetyltransferase	NA	NA	NA	NA	NA
AUJ09612.1|3207766_3208666_+	peptidase	NA	S5M424	Bacillus_phage	30.6	3.0e-06
AUJ09613.1|3208798_3210403_+	peptide chain release factor 3	NA	NA	NA	NA	NA
AUJ09614.1|3210478_3211123_+	hemolysin III	NA	NA	NA	NA	NA
AUJ09615.1|3213043_3214420_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.3	7.1e-63
AUJ09616.1|3216051_3216480_-	histidine kinase	NA	NA	NA	NA	NA
AUJ10909.1|3216439_3217480_-	glycosyl transferase family 2	NA	F1C5B0	Cronobacter_phage	42.6	1.3e-72
AUJ09617.1|3217488_3218226_-	monofunctional biosynthetic peptidoglycan transglycosylase	NA	NA	NA	NA	NA
AUJ09618.1|3218300_3219191_+	heat-shock protein Hsp33	NA	NA	NA	NA	NA
AUJ09619.1|3219311_3220181_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ09620.1|3220576_3223486_+	TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	24.4	6.6e-26
AUJ09621.1|3223594_3224203_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
AUJ09622.1|3224405_3225263_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
AUJ09623.1|3225259_3227734_+	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
AUJ10910.1|3228128_3228482_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ09624.1|3230461_3231841_+	serine hydrolase	NA	NA	NA	NA	NA
AUJ09625.1|3232527_3232971_-	histidine biosynthesis protein HisIE	NA	NA	NA	NA	NA
AUJ09626.1|3233388_3233604_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ09627.1|3233986_3234382_-	glycine cleavage system protein H	NA	NA	NA	NA	NA
AUJ09628.1|3234518_3235628_-	glycine cleavage system protein T	NA	NA	NA	NA	NA
AUJ09629.1|3235800_3236235_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ09630.1|3236238_3237204_-	hypothetical protein	NA	J3IZE5	Acanthamoeba_polyphaga_lentillevirus	33.5	1.5e-22
AUJ09631.1|3237501_3237837_-	hypothetical protein	NA	A0A218MNG8	uncultured_virus	56.4	9.2e-25
AUJ09632.1|3237833_3238853_-	nucleoside triphosphate pyrophosphohydrolase	NA	NA	NA	NA	NA
AUJ09633.1|3239097_3239898_-	3'(2'),5'-bisphosphate nucleotidase CysQ	NA	NA	NA	NA	NA
AUJ09634.1|3239894_3240452_-	ADP compounds hydrolase NudE	NA	NA	NA	NA	NA
AUJ09635.1|3240484_3241903_+	aspartate aminotransferase family protein	NA	NA	NA	NA	NA
AUJ09636.1|3241893_3242628_+	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
AUJ09637.1|3242929_3243946_-	glucokinase	NA	NA	NA	NA	NA
AUJ09638.1|3244646_3247355_+	TonB-dependent receptor	NA	NA	NA	NA	NA
AUJ09639.1|3247563_3249249_+	alpha-L-fucosidase	NA	NA	NA	NA	NA
AUJ10911.1|3249264_3250320_+	glycosyl hydrolase	NA	A0A2P1CFB9	Microbacterium_phage	24.3	2.9e-08
AUJ09640.1|3253249_3255871_+	beta-mannosidase	NA	NA	NA	NA	NA
AUJ09641.1|3256079_3258749_+	beta-glucosidase	NA	NA	NA	NA	NA
AUJ09642.1|3258893_3261008_-	ABC transporter	NA	W8CYL7	Bacillus_phage	26.5	1.4e-33
AUJ09643.1|3261011_3261458_-|protease	protease	protease	NA	NA	NA	NA
AUJ09644.1|3262370_3262634_-|transposase	transposase	transposase	NA	NA	NA	NA
AUJ09645.1|3263475_3264852_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.3	2.1e-62
>prophage 23
CP019090	Xanthomonas oryzae pv. oryzae strain MAI129 chromosome, complete genome	4703963	3409663	3521409	4703963	tRNA,transposase	Acidithiobacillus_phage(20.0%)	82	NA	NA
AUJ09740.1|3409663_3410650_-|transposase	transposase	transposase	S5WIU1	Leptospira_phage	41.0	1.7e-42
AUJ09741.1|3410502_3410766_-|transposase	transposase	transposase	NA	NA	NA	NA
AUJ09742.1|3410734_3411187_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ09743.1|3411077_3411989_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ09744.1|3412113_3414699_-	ATP-dependent chaperone ClpB	NA	A0A1C3S747	Escherichia_phage	35.4	3.8e-126
AUJ09745.1|3415144_3415450_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ09746.1|3415830_3418446_+	DNA mismatch repair protein MutS	NA	A0A1V0SGG8	Hokovirus	22.5	2.8e-28
AUJ09747.1|3418746_3419361_+	calcium-binding protein	NA	NA	NA	NA	NA
AUJ09748.1|3419793_3422040_+	catalase-peroxidase	NA	NA	NA	NA	NA
AUJ10922.1|3422163_3422571_-	RNA-binding protein	NA	NA	NA	NA	NA
AUJ09749.1|3422911_3424402_+	MATE family efflux transporter	NA	NA	NA	NA	NA
AUJ09750.1|3425020_3425428_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
AUJ09751.1|3425572_3426331_-|tRNA	tRNA (guanine(37)-N(1))-methyltransferase	tRNA	NA	NA	NA	NA
AUJ09752.1|3426395_3426908_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
AUJ10923.1|3426951_3427209_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
AUJ09753.1|3427318_3428116_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ09754.1|3429355_3430591_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ09755.1|3430739_3432116_-	signal recognition particle protein	NA	NA	NA	NA	NA
AUJ09756.1|3432150_3432486_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ09757.1|3432500_3433292_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ09758.1|3433578_3434628_-	galactose mutarotase	NA	NA	NA	NA	NA
AUJ10924.1|3434867_3436451_+	alpha-N-arabinofuranosidase	NA	NA	NA	NA	NA
AUJ09759.1|3436638_3437115_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AUJ09760.1|3437080_3437437_-|transposase	transposase	transposase	NA	NA	NA	NA
AUJ09761.1|3438531_3440493_-	hybrid sensor histidine kinase/response regulator	NA	NA	NA	NA	NA
AUJ09762.1|3440476_3441364_-	histidine kinase	NA	Q8QKV7	Ectocarpus_siliculosus_virus	33.0	9.3e-24
AUJ09763.1|3441360_3442371_-	ATP-binding protein	NA	NA	NA	NA	NA
AUJ09764.1|3442361_3442757_-	anti-sigma regulatory factor	NA	NA	NA	NA	NA
AUJ09765.1|3442753_3443116_-	anti-anti-sigma factor	NA	NA	NA	NA	NA
AUJ10925.1|3443117_3443960_-	polyvinylalcohol dehydrogenase	NA	NA	NA	NA	NA
AUJ09766.1|3444634_3446959_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ09767.1|3446983_3448954_-	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	21.2	3.5e-15
AUJ09768.1|3449065_3450496_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AUJ09769.1|3451256_3452048_+	transcriptional regulator	NA	NA	NA	NA	NA
AUJ09770.1|3453354_3454749_-	DNA repair protein RadA	NA	NA	NA	NA	NA
AUJ09771.1|3455056_3456043_-|transposase	transposase	transposase	S5WIU1	Leptospira_phage	41.9	3.4e-43
AUJ09772.1|3455895_3456165_-|transposase	transposase	transposase	NA	NA	NA	NA
AUJ09773.1|3456336_3457713_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	48.1	9.9e-65
AUJ09774.1|3457828_3459046_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ09775.1|3459934_3460144_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ09776.1|3460553_3461930_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.0	6.0e-62
AUJ09777.1|3464498_3465467_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	7.3e-99
AUJ09778.1|3466143_3466539_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ09779.1|3466701_3468078_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.3	2.7e-62
AUJ09780.1|3468098_3468488_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ09781.1|3468489_3473229_-	type IV secretion protein Rhs	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	43.3	1.8e-20
AUJ09782.1|3473372_3474992_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ09783.1|3475015_3477262_-	type IV secretion protein Rhs	NA	A0A077K8Q4	Ralstonia_phage	31.5	6.8e-55
AUJ10926.1|3477486_3479184_-	peptidase M61	NA	NA	NA	NA	NA
AUJ09784.1|3479535_3479871_-	cytochrome o ubiquinol oxidase subunit IV	NA	NA	NA	NA	NA
AUJ10927.1|3479870_3480497_-	cytochrome o ubiquinol oxidase subunit III	NA	NA	NA	NA	NA
AUJ09785.1|3480499_3482500_-	cytochrome ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
AUJ09786.1|3483948_3484899_-	4-hydroxy-3-methylbut-2-enyl diphosphate reductase	NA	NA	NA	NA	NA
AUJ09787.1|3484971_3485490_-	signal peptidase II	NA	NA	NA	NA	NA
AUJ09788.1|3485804_3488636_-|tRNA	isoleucine--tRNA ligase	tRNA	A0A1V0SGW1	Hokovirus	22.2	1.4e-41
AUJ09789.1|3489857_3491462_-	lipid II flippase MurJ	NA	NA	NA	NA	NA
AUJ09790.1|3491578_3491848_+	30S ribosomal protein S20	NA	NA	NA	NA	NA
AUJ09791.1|3491939_3492992_-	Obg family GTPase CgtA	NA	NA	NA	NA	NA
AUJ09792.1|3493227_3493488_-	50S ribosomal protein L27	NA	NA	NA	NA	NA
AUJ09793.1|3493500_3493821_-	50S ribosomal protein L21	NA	NA	NA	NA	NA
AUJ09794.1|3494113_3497071_+	ABC-ATPase UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	56.1	2.5e-307
AUJ09795.1|3497067_3497475_+	thioesterase	NA	NA	NA	NA	NA
AUJ09796.1|3497588_3498053_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ09797.1|3498076_3498847_+	enoyl-CoA hydratase	NA	NA	NA	NA	NA
AUJ09798.1|3498917_3499823_+	acyl-CoA thioesterase II	NA	NA	NA	NA	NA
AUJ09799.1|3500050_3500554_+	pathogenicity-like protein	NA	NA	NA	NA	NA
AUJ09800.1|3500665_3501430_+	RNA polymerase subunit sigma	NA	NA	NA	NA	NA
AUJ10928.1|3501671_3502127_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ10929.1|3502260_3502842_-	calcium-binding protein	NA	NA	NA	NA	NA
AUJ09801.1|3503041_3503797_+	arginyltransferase	NA	NA	NA	NA	NA
AUJ09802.1|3503750_3505082_+	endonuclease	NA	NA	NA	NA	NA
AUJ09803.1|3505433_3505853_-|transposase	transposase	transposase	NA	NA	NA	NA
AUJ09804.1|3506054_3507656_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ09805.1|3508102_3509179_+	DUF4432 domain-containing protein	NA	NA	NA	NA	NA
AUJ09806.1|3509275_3509749_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ09807.1|3509985_3512421_+	ligand-gated channel	NA	A0A0P0I887	Acinetobacter_phage	22.6	1.0e-11
AUJ10930.1|3512953_3513493_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ09808.1|3513698_3514457_+	trehalose-phosphatase	NA	NA	NA	NA	NA
AUJ09809.1|3514501_3516280_+	glucoamylase	NA	NA	NA	NA	NA
AUJ09810.1|3516276_3517644_+	trehalose-6-phosphate synthase	NA	NA	NA	NA	NA
AUJ09811.1|3518246_3520724_+	membrane-bound PQQ-dependent dehydrogenase, glucose/quinate/shikimate family	NA	NA	NA	NA	NA
AUJ10931.1|3521145_3521409_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 24
CP019090	Xanthomonas oryzae pv. oryzae strain MAI129 chromosome, complete genome	4703963	3553087	3576745	4703963	tRNA,transposase	Leptospira_phage(42.86%)	19	NA	NA
AUJ09830.1|3553087_3554056_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	59.7	1.6e-98
AUJ09831.1|3554414_3554807_-	histone-like nucleoid-structuring protein	NA	NA	NA	NA	NA
AUJ10936.1|3555142_3555997_-|transposase	transposase	transposase	U5P429	Shigella_phage	58.1	2.2e-86
AUJ09832.1|3557950_3558919_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	7.3e-99
AUJ09833.1|3559163_3560540_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.3	2.1e-62
AUJ09834.1|3560804_3561524_-|transposase	transposase	transposase	S5WIU1	Leptospira_phage	41.3	1.8e-41
AUJ09835.1|3561542_3562529_-|transposase	transposase	transposase	S5WIU1	Leptospira_phage	40.6	9.9e-43
AUJ09836.1|3562381_3562645_-|transposase	transposase	transposase	NA	NA	NA	NA
AUJ09837.1|3567592_3567793_+	sulfur carrier protein ThiS	NA	NA	NA	NA	NA
AUJ09838.1|3568155_3568950_+	thiazole synthase	NA	NA	NA	NA	NA
AUJ09839.1|3569251_3570010_+|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
AUJ09840.1|3570085_3571948_+	SLC13 family permease	NA	NA	NA	NA	NA
AUJ09841.1|3572005_3572347_-	ferredoxin	NA	NA	NA	NA	NA
AUJ09842.1|3572605_3572881_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ09843.1|3573054_3573531_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AUJ09844.1|3573496_3573961_-|transposase	transposase	transposase	NA	NA	NA	NA
AUJ09845.1|3574473_3575187_+	fumarylacetoacetate hydrolase	NA	NA	NA	NA	NA
AUJ09846.1|3575247_3575679_+	large-conductance mechanosensitive channel	NA	NA	NA	NA	NA
AUJ09847.1|3575686_3576745_+|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	43.5	6.2e-75
>prophage 25
CP019090	Xanthomonas oryzae pv. oryzae strain MAI129 chromosome, complete genome	4703963	3709341	3765818	4703963	protease,transposase	Tenacibaculum_phage(12.5%)	44	NA	NA
AUJ09942.1|3709341_3709698_+|transposase	transposase	transposase	NA	NA	NA	NA
AUJ09943.1|3709663_3710140_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AUJ09944.1|3710186_3710846_-	serine/threonine protein kinase	NA	NA	NA	NA	NA
AUJ09945.1|3710997_3713085_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ09946.1|3713198_3713468_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ09947.1|3713807_3714692_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ09948.1|3714838_3715435_-|protease	ATP-dependent protease	protease	NA	NA	NA	NA
AUJ10947.1|3715434_3716793_-	UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl- meso-diaminopimelate ligase	NA	NA	NA	NA	NA
AUJ09949.1|3717157_3717721_-	adenylate kinase	NA	A0A1B4XWI3	Tenacibaculum_phage	31.4	2.1e-13
AUJ09950.1|3717880_3719137_+	6-phosphofructokinase	NA	NA	NA	NA	NA
AUJ09951.1|3719436_3720405_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	59.7	1.6e-98
AUJ09952.1|3721780_3722305_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ09953.1|3722553_3724581_+	sodium-translocating pyrophosphatase	NA	NA	NA	NA	NA
AUJ09954.1|3724873_3725356_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ09955.1|3725552_3726089_+	inorganic pyrophosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	53.6	6.1e-47
AUJ09956.1|3726235_3727351_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ09957.1|3727964_3730934_-	TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	24.6	1.6e-40
AUJ09958.1|3730979_3731873_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AUJ09959.1|3731983_3734335_-	biopolymer transporter Tol	NA	NA	NA	NA	NA
AUJ09960.1|3734759_3736637_-	phosphomethylpyrimidine synthase ThiC	NA	NA	NA	NA	NA
AUJ09961.1|3737918_3738920_+	ketol-acid reductoisomerase	NA	NA	NA	NA	NA
AUJ09962.1|3738960_3740682_+	acetolactate synthase 2 catalytic subunit	NA	E4WLQ6	Ostreococcus_tauri_virus	32.9	8.0e-64
AUJ09963.1|3740665_3740923_+	acetolactate synthase	NA	NA	NA	NA	NA
AUJ09964.1|3740998_3742123_+	serine/threonine dehydratase	NA	NA	NA	NA	NA
AUJ09965.1|3742119_3743682_+	2-isopropylmalate synthase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	24.4	4.3e-08
AUJ09966.1|3744005_3745079_-	3-isopropylmalate dehydrogenase	NA	NA	NA	NA	NA
AUJ10948.1|3745115_3745865_-	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AUJ09967.1|3745897_3746545_-	3-isopropylmalate dehydratase small subunit	NA	NA	NA	NA	NA
AUJ09968.1|3746612_3748061_-	3-isopropylmalate dehydratase large subunit	NA	NA	NA	NA	NA
AUJ10949.1|3748181_3749066_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUJ09969.1|3749310_3750093_-	GGDEF domain-containing protein	NA	NA	NA	NA	NA
AUJ09970.1|3750854_3751508_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
AUJ10950.1|3751637_3752294_+	protein-L-isoaspartate O-methyltransferase	NA	NA	NA	NA	NA
AUJ09971.1|3752314_3753694_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ09972.1|3753968_3755285_-	3-deoxy-D-manno-octulosonic acid transferase	NA	NA	NA	NA	NA
AUJ09973.1|3755361_3756282_+	lipid A biosynthesis lauroyl acyltransferase	NA	NA	NA	NA	NA
AUJ09974.1|3756514_3757849_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ09975.1|3757829_3758942_-	glycosyl transferase	NA	NA	NA	NA	NA
AUJ09976.1|3758952_3759150_-	zinc-finger domain-containing protein	NA	NA	NA	NA	NA
AUJ09977.1|3759481_3761608_-	ABC transporter	NA	W8CYL7	Bacillus_phage	26.4	9.0e-33
AUJ10951.1|3762529_3763792_-	hemolysin D	NA	NA	NA	NA	NA
AUJ10952.1|3764278_3765295_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	37.3	5.6e-49
AUJ09978.1|3765210_3765513_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ09979.1|3765548_3765818_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 26
CP019090	Xanthomonas oryzae pv. oryzae strain MAI129 chromosome, complete genome	4703963	3819001	3942969	4703963	protease,tRNA,transposase	Enterobacteria_phage(12.5%)	104	NA	NA
AUJ10011.1|3819001_3819970_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.7	3.0e-100
AUJ10012.1|3820171_3820594_-	arsenate reductase (glutaredoxin)	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	62.2	1.0e-41
AUJ10013.1|3821186_3821576_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ10014.1|3821568_3823221_+|protease	serine protease	protease	NA	NA	NA	NA
AUJ10015.1|3823672_3824479_-|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	37.1	9.1e-10
AUJ10016.1|3824531_3825710_-	nicotinate phosphoribosyltransferase	NA	A0A2L0UZQ6	Agrobacterium_phage	33.3	6.9e-51
AUJ10017.1|3826096_3827062_-	glycosidase-like protein	NA	NA	NA	NA	NA
AUJ10959.1|3827190_3828489_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ10018.1|3828538_3830446_-	glycosyltransferase	NA	NA	NA	NA	NA
AUJ10960.1|3830458_3831361_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ10019.1|3831610_3832450_-	glycosyl transferase	NA	NA	NA	NA	NA
AUJ10020.1|3833060_3834218_+	aminoglycoside phosphotransferase	NA	NA	NA	NA	NA
AUJ10021.1|3834253_3836416_+	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
AUJ10022.1|3836790_3837366_+	aminotransferase	NA	NA	NA	NA	NA
AUJ10023.1|3837471_3838200_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AUJ10024.1|3838630_3839470_-	glycosyltransferase	NA	NA	NA	NA	NA
AUJ10025.1|3839466_3841770_-	type II secretion system protein GspD	NA	A7BJX1	Enterobacteria_phage	24.4	1.5e-09
AUJ10026.1|3841766_3842597_-	general secretion pathway protein GspN	NA	NA	NA	NA	NA
AUJ10027.1|3842586_3843240_-	general secretion pathway protein GspM	NA	NA	NA	NA	NA
AUJ10028.1|3843223_3844345_-	general secretion pathway protein GspL	NA	NA	NA	NA	NA
AUJ10029.1|3844341_3845193_-	general secretion pathway protein GspK	NA	NA	NA	NA	NA
AUJ10030.1|3845189_3845825_-	general secretion pathway protein GspJ	NA	NA	NA	NA	NA
AUJ10031.1|3845821_3846238_-	general secretion pathway protein GspI	NA	NA	NA	NA	NA
AUJ10032.1|3846234_3846744_-	type II secretion system protein GspH	NA	NA	NA	NA	NA
AUJ10033.1|3846753_3847185_-	type II secretion system protein GspG	NA	NA	NA	NA	NA
AUJ10034.1|3847452_3848670_-	type II secretion system protein GspF	NA	NA	NA	NA	NA
AUJ10035.1|3848669_3848849_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ10036.1|3848845_3850585_-	type II secretion system protein GspE	NA	NA	NA	NA	NA
AUJ10037.1|3850702_3852586_-|protease	protease	protease	A0A1B0T6A2	Bacillus_phage	30.7	7.0e-21
AUJ10038.1|3852806_3858887_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ10039.1|3859864_3863917_-	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	56.9	5.8e-121
AUJ10961.1|3863809_3864076_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ10040.1|3864332_3865130_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ10041.1|3865613_3866585_-	site-specific tyrosine recombinase XerD	NA	A0A0K0N6I5	Gordonia_phage	30.3	1.9e-14
AUJ10042.1|3867010_3867478_+	RDD family protein	NA	NA	NA	NA	NA
AUJ10043.1|3867575_3867887_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ10962.1|3867891_3868998_-	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
AUJ10044.1|3868994_3870077_-	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
AUJ10045.1|3870184_3871657_+	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	36.5	9.0e-48
AUJ10046.1|3871656_3872013_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ10047.1|3872012_3872438_+	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
AUJ10048.1|3872448_3873681_+	ATPase	NA	NA	NA	NA	NA
AUJ10049.1|3873683_3874331_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ10050.1|3874459_3877402_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	34.2	2.2e-130
AUJ10963.1|3878061_3880098_+	lytic murein transglycosylase	NA	A0A0H3V0Q1	Geobacillus_virus	36.7	1.4e-14
AUJ10051.1|3880554_3881931_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.7	9.2e-63
AUJ10964.1|3882284_3883301_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	37.6	2.5e-49
AUJ10965.1|3884654_3885671_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	37.6	2.5e-49
AUJ10052.1|3885870_3886857_-|transposase	transposase	transposase	S5WIU1	Leptospira_phage	41.0	1.3e-42
AUJ10053.1|3886709_3886979_-|transposase	transposase	transposase	NA	NA	NA	NA
AUJ10966.1|3887531_3888005_-	ribosomal-protein-alanine N-acetyltransferase	NA	NA	NA	NA	NA
AUJ10054.1|3888010_3888478_-	alanine acetyltransferase	NA	NA	NA	NA	NA
AUJ10055.1|3888488_3889262_-	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
AUJ10967.1|3889426_3889798_+	DUF4124 domain-containing protein	NA	NA	NA	NA	NA
AUJ10056.1|3889909_3891604_+|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
AUJ10057.1|3891746_3892208_+	DNA-binding protein	NA	NA	NA	NA	NA
AUJ10058.1|3892285_3893545_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ10059.1|3893714_3894827_+	ABC transporter permease	NA	NA	NA	NA	NA
AUJ10060.1|3894912_3895755_+	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	30.5	2.4e-13
AUJ10061.1|3895757_3896684_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUJ10062.1|3896680_3897325_+	ABC transporter	NA	NA	NA	NA	NA
AUJ10063.1|3897467_3897944_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AUJ10064.1|3898352_3898610_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ10065.1|3898725_3899334_-	alpha-ketoglutarate-dependent dioxygenase AlkB	NA	A0A2K9L0M4	Tupanvirus	34.6	1.8e-23
AUJ10066.1|3899450_3901100_+	electron transfer flavoprotein-ubiquinone oxidoreductase	NA	NA	NA	NA	NA
AUJ10968.1|3901119_3903945_+	polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
AUJ10067.1|3903968_3904607_-	succinyl-CoA--3-ketoacid-CoA transferase	NA	NA	NA	NA	NA
AUJ10068.1|3904606_3905338_-	succinyl-CoA--3-ketoacid-CoA transferase	NA	NA	NA	NA	NA
AUJ10069.1|3905471_3906818_+	phosphomannomutase/phosphoglucomutase	NA	A0A127AWJ1	Bacillus_phage	26.9	2.6e-33
AUJ10070.1|3906863_3908267_+	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	28.8	1.6e-41
AUJ10071.1|3908383_3909292_-	NAD(P)-dependent oxidoreductase	NA	A0A1D7XFA3	Escherichia_phage	33.8	5.4e-27
AUJ10072.1|3909288_3909846_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	48.1	1.7e-44
AUJ10073.1|3909842_3910730_-	glucose-1-phosphate thymidylyltransferase	NA	I7I009	Enterobacteria_phage	58.2	2.2e-94
AUJ10074.1|3910785_3911841_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	48.0	4.3e-84
AUJ10075.1|3912222_3912969_+	EtfB protein	NA	NA	NA	NA	NA
AUJ10076.1|3912968_3913910_+	electron transfer flavoprotein subunit alpha	NA	NA	NA	NA	NA
AUJ10077.1|3914135_3914954_+	sugar ABC transporter permease	NA	NA	NA	NA	NA
AUJ10078.1|3914943_3916257_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.6	2.9e-13
AUJ10079.1|3916872_3917142_+|transposase	transposase	transposase	NA	NA	NA	NA
AUJ10080.1|3916994_3917981_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	41.4	2.6e-43
AUJ10081.1|3920013_3921390_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.7	3.2e-63
AUJ10082.1|3922053_3922317_-|transposase	transposase	transposase	NA	NA	NA	NA
AUJ10083.1|3922361_3923432_-	acyltransferase	NA	A9YX16	Burkholderia_phage	33.0	6.5e-40
AUJ10084.1|3923437_3924601_-	glycosyl transferase	NA	NA	NA	NA	NA
AUJ10085.1|3924591_3924882_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ10086.1|3924902_3925829_-	glycosyltransferase	NA	NA	NA	NA	NA
AUJ10087.1|3926860_3927937_-	NAD-dependent dehydratase	NA	A0A1V0SG19	Hokovirus	21.8	2.4e-10
AUJ10088.1|3927971_3928772_-	methyltransferase	NA	H8ZJI6	Ostreococcus_tauri_virus	28.0	9.3e-07
AUJ10089.1|3928818_3930012_-	cystathionine beta-lyase	NA	NA	NA	NA	NA
AUJ10090.1|3930102_3931473_-	cystathionine beta-synthase	NA	A0A1X9I5F1	Streptococcus_phage	38.8	2.6e-49
AUJ10091.1|3931713_3931932_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ10092.1|3932273_3933164_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ10093.1|3933160_3933544_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ10094.1|3933642_3934776_+	type IV pili twitching motility protein PilT	NA	NA	NA	NA	NA
AUJ10095.1|3935115_3935778_-	maleylacetoacetate isomerase	NA	NA	NA	NA	NA
AUJ10969.1|3935821_3936811_-	2-keto-4-pentenoate hydratase	NA	NA	NA	NA	NA
AUJ10096.1|3936972_3937098_-	fumarylacetoacetate hydrolase	NA	NA	NA	NA	NA
AUJ10097.1|3937190_3938573_+	RNA helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	36.3	6.4e-56
AUJ10970.1|3938997_3939351_+	6-carboxytetrahydropterin synthase QueD	NA	NA	NA	NA	NA
AUJ10971.1|3939543_3939879_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ10098.1|3939993_3940668_-	dethiobiotin synthase	NA	NA	NA	NA	NA
AUJ10099.1|3940992_3941475_+	diguanylate cyclase	NA	NA	NA	NA	NA
AUJ10100.1|3941471_3941870_+	transcriptional regulator	NA	NA	NA	NA	NA
AUJ10101.1|3942000_3942969_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	4.3e-99
>prophage 27
CP019090	Xanthomonas oryzae pv. oryzae strain MAI129 chromosome, complete genome	4703963	4055085	4126093	4703963	tRNA,integrase,transposase	Leptospira_phage(27.27%)	59	4041702:4041722	4107814:4107834
4041702:4041722	attL	TTTAGAGCGGCTAACAACACG	NA	NA	NA	NA
AUJ10190.1|4055085_4056054_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	7.3e-99
AUJ10191.1|4056286_4056667_+	response regulator	NA	NA	NA	NA	NA
AUJ10983.1|4056635_4056866_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ10192.1|4056901_4058200_-	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
AUJ10193.1|4058330_4058546_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ10194.1|4058717_4058999_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ10195.1|4059300_4060710_+	cytochrome ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
AUJ10196.1|4060700_4061717_+	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
AUJ10197.1|4062292_4062544_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ10198.1|4063516_4064680_+	glutathione-dependent formaldehyde dehydrogenase	NA	E3SJ82	Synechococcus_phage	28.5	1.0e-09
AUJ10199.1|4065321_4065636_+	zinc/iron-chelating domain-containing protein	NA	NA	NA	NA	NA
AUJ10200.1|4065645_4065867_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ10201.1|4066308_4066521_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ10202.1|4066859_4067597_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ10203.1|4067607_4070259_+	chemotaxis protein	NA	NA	NA	NA	NA
AUJ10204.1|4070255_4070930_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ10205.1|4070926_4071592_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ10206.1|4071676_4073818_-	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
AUJ10207.1|4073907_4075176_-	ABC transporter permease	NA	NA	NA	NA	NA
AUJ10208.1|4075175_4076612_-	ABC transporter permease	NA	NA	NA	NA	NA
AUJ10209.1|4076622_4077345_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.6	6.8e-17
AUJ10210.1|4078739_4080971_-	isocitrate dehydrogenase, NADP-dependent	NA	NA	NA	NA	NA
AUJ10984.1|4081160_4082873_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ10211.1|4082941_4083217_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ10212.1|4083711_4084527_-	preQ(1) synthase	NA	A0A2I7SAX1	Vibrio_phage	35.5	1.3e-35
AUJ10985.1|4084700_4085021_+|integrase	integrase	integrase	NA	NA	NA	NA
AUJ10213.1|4085249_4086569_-	N-acyl-L-amino acid amidohydrolase	NA	NA	NA	NA	NA
AUJ10214.1|4086828_4088073_+	efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
AUJ10215.1|4088167_4091416_+	acriflavine resistance protein B	NA	NA	NA	NA	NA
AUJ10216.1|4091549_4094690_+	acriflavin resistance protein	NA	NA	NA	NA	NA
AUJ10986.1|4095308_4095524_+	VOC family protein	NA	NA	NA	NA	NA
AUJ10217.1|4096000_4097368_-	DUF1338 domain-containing protein	NA	NA	NA	NA	NA
AUJ10218.1|4097377_4097587_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ10987.1|4097685_4098303_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ10219.1|4099156_4099909_-	haloacid dehalogenase	NA	NA	NA	NA	NA
AUJ10220.1|4099946_4100387_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ10988.1|4100593_4100935_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ10221.1|4101160_4101538_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ10222.1|4101734_4101932_-	CPXCG motif-containing cysteine-rich protein	NA	NA	NA	NA	NA
AUJ10989.1|4103072_4103876_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A223VZK2	Agrobacterium_phage	29.3	2.9e-08
AUJ10990.1|4104154_4105504_+	NlpC-P60 family protein	NA	NA	NA	NA	NA
AUJ10223.1|4105500_4106604_+	dipeptide epimerase	NA	NA	NA	NA	NA
AUJ10224.1|4106624_4107683_+|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	43.2	1.8e-74
AUJ10225.1|4108566_4109343_+	hypothetical protein	NA	NA	NA	NA	NA
4107814:4107834	attR	CGTGTTGTTAGCCGCTCTAAA	NA	NA	NA	NA
AUJ10226.1|4109339_4110656_+	amino acid transporter	NA	NA	NA	NA	NA
AUJ10227.1|4110868_4111150_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ10228.1|4111322_4111655_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ10229.1|4111709_4112144_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ10230.1|4112328_4113507_+	glucose dehydrogenase	NA	NA	NA	NA	NA
AUJ10231.1|4114046_4116218_-	beta-glucosidase	NA	NA	NA	NA	NA
AUJ10232.1|4116446_4116803_-	dihydroneopterin aldolase	NA	NA	NA	NA	NA
AUJ10233.1|4116882_4117947_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	57.4	5.1e-101
AUJ10234.1|4118226_4118442_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
AUJ10991.1|4118848_4119295_+|tRNA	glutamyl-tRNA amidotransferase	tRNA	A0A292GL36	Xanthomonas_phage	44.5	3.9e-23
AUJ10235.1|4120315_4121374_+|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	43.2	1.8e-74
AUJ10236.1|4121913_4122876_+	BrkB protein	NA	NA	NA	NA	NA
AUJ10237.1|4122964_4124713_+	DNA primase	NA	A0A1S5RF71	Helicobacter_phage	34.8	6.5e-45
AUJ10238.1|4124984_4125254_+|transposase	transposase	transposase	NA	NA	NA	NA
AUJ10239.1|4125106_4126093_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	41.9	4.5e-43
>prophage 28
CP019090	Xanthomonas oryzae pv. oryzae strain MAI129 chromosome, complete genome	4703963	4142033	4194573	4703963	protease,tRNA,transposase	Leptospira_phage(14.29%)	42	NA	NA
AUJ10253.1|4142033_4142492_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
AUJ10254.1|4143809_4144079_+|transposase	transposase	transposase	NA	NA	NA	NA
AUJ10255.1|4143931_4144918_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	41.4	2.6e-43
AUJ10256.1|4144931_4145054_-|transposase	transposase	transposase	NA	NA	NA	NA
AUJ10994.1|4151116_4152328_-|tRNA	tyrosine--tRNA ligase	tRNA	NA	NA	NA	NA
AUJ10257.1|4152498_4153917_+	hypothetical protein	NA	A0A0K2CNY2	Brevibacillus_phage	37.9	6.9e-13
AUJ10258.1|4154287_4155421_+	anhydro-N-acetylmuramic acid kinase	NA	NA	NA	NA	NA
AUJ10259.1|4155458_4155686_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ10995.1|4155744_4156965_-	MFS transporter	NA	NA	NA	NA	NA
AUJ10260.1|4157359_4158160_-	exodeoxyribonuclease III	NA	E3T4M6	Cafeteria_roenbergensis_virus	29.0	3.1e-26
AUJ10261.1|4158287_4158947_+	orotate phosphoribosyltransferase	NA	NA	NA	NA	NA
AUJ10262.1|4158969_4159728_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ10263.1|4159765_4160563_+	chromosome partitioning protein	NA	Q8JL10	Natrialba_phage	30.3	9.5e-20
AUJ10264.1|4160562_4161489_+	chromosome partitioning protein ParB	NA	I3NLC2	Bifidobacterium_phage	34.9	1.0e-12
AUJ10265.1|4161524_4161833_+	mitomycin resistance protein	NA	NA	NA	NA	NA
AUJ10266.1|4162037_4163003_+	protein CapI	NA	A0A1V0SKV4	Klosneuvirus	30.5	1.6e-29
AUJ10267.1|4163369_4164092_+	dolichol-phosphate mannosyltransferase	NA	NA	NA	NA	NA
AUJ10268.1|4164091_4164433_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ10269.1|4164850_4165399_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ10996.1|4165506_4166901_-	phosphomannomutase/phosphoglucomutase	NA	A0A127AWJ1	Bacillus_phage	29.5	2.6e-49
AUJ10270.1|4167868_4168336_-	deoxyuridine 5'-triphosphate nucleotidohydrolase	NA	Q2NP83	Xanthomonas_phage	96.1	1.1e-79
AUJ10271.1|4168332_4169607_-	bifunctional 4'-phosphopantothenoylcysteine decarboxylase/phosphopantothenoylcysteine synthetase	NA	Q9HH70	Methanothermobacter_phage	31.2	5.8e-35
AUJ10997.1|4169703_4170381_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ10272.1|4172335_4173217_+	sporulation protein	NA	NA	NA	NA	NA
AUJ10273.1|4173223_4173703_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ10274.1|4173794_4174550_+	NADP-dependent 3-hydroxy acid dehydrogenase	NA	NA	NA	NA	NA
AUJ10275.1|4174830_4175721_-|transposase	transposase	transposase	S5WIU1	Leptospira_phage	42.0	1.1e-37
AUJ10276.1|4175573_4175843_-|transposase	transposase	transposase	NA	NA	NA	NA
AUJ10277.1|4175929_4179832_-	avirulence protein	NA	NA	NA	NA	NA
AUJ10998.1|4180615_4181323_-	hypothetical protein	NA	U5P429	Shigella_phage	59.1	3.4e-69
AUJ10278.1|4181367_4181640_-|transposase	transposase	transposase	U5P4I9	Shigella_phage	58.8	1.2e-19
AUJ10279.1|4182013_4182283_-	hypothetical protein	NA	A0A077K814	Ralstonia_phage	64.8	1.2e-19
AUJ10280.1|4182472_4184359_-	arginine decarboxylase	NA	NA	NA	NA	NA
AUJ10281.1|4184597_4185455_+	spermidine synthase	NA	A0A1C9C533	Heterosigma_akashiwo_virus	32.5	2.2e-14
AUJ10282.1|4185893_4186505_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ10283.1|4186697_4187510_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ10999.1|4188188_4188725_+	kinase	NA	NA	NA	NA	NA
AUJ10284.1|4189073_4191059_-	beta-N-acetylglucosaminidase	NA	NA	NA	NA	NA
AUJ11000.1|4191672_4192011_-	transcriptional regulator	NA	NA	NA	NA	NA
AUJ10285.1|4192200_4192479_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ10286.1|4192495_4194016_+|protease	ATP-dependent protease	protease	NA	NA	NA	NA
AUJ10287.1|4194096_4194573_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 29
CP019090	Xanthomonas oryzae pv. oryzae strain MAI129 chromosome, complete genome	4703963	4231160	4299621	4703963	tRNA,transposase	Staphylococcus_phage(20.0%)	60	NA	NA
AUJ10315.1|4231160_4232450_-|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
AUJ10316.1|4232618_4232828_-	CsbD family protein	NA	NA	NA	NA	NA
AUJ10317.1|4233068_4233203_-	entericidin	NA	NA	NA	NA	NA
AUJ10318.1|4233277_4233430_-	entericidin	NA	NA	NA	NA	NA
AUJ10319.1|4233537_4234461_-	arginase	NA	A0A0N9R043	Chrysochromulina_ericina_virus	34.4	1.7e-28
AUJ10320.1|4234782_4235448_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ10321.1|4235444_4235987_+	GTPase	NA	NA	NA	NA	NA
AUJ10322.1|4236490_4237174_+	thymidylate kinase	NA	K7R9G5	Vibrio_phage	33.8	1.3e-14
AUJ10323.1|4238913_4239642_-	pantothenate kinase	NA	NA	NA	NA	NA
AUJ11005.1|4239638_4240604_-	bifunctional biotin--[acetyl-CoA-carboxylase] synthetase/biotin operon repressor	NA	NA	NA	NA	NA
AUJ10324.1|4240961_4241273_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ10325.1|4241281_4242037_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ11006.1|4242189_4243374_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ11007.1|4243493_4245083_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ10326.1|4245202_4246618_-	two-component sensor histidine kinase	NA	NA	NA	NA	NA
AUJ10327.1|4246647_4247331_-	DNA-binding response regulator	NA	NA	NA	NA	NA
AUJ10328.1|4247402_4247705_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ10329.1|4248040_4249051_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
AUJ10330.1|4249467_4250322_-|transposase	transposase	transposase	U5P429	Shigella_phage	57.7	6.3e-86
AUJ10331.1|4250706_4254198_-	Avirulence protein AvrBs3	NA	NA	NA	NA	NA
AUJ10332.1|4254994_4255174_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ10333.1|4255275_4255545_+|transposase	transposase	transposase	NA	NA	NA	NA
AUJ11008.1|4256578_4256773_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ10334.1|4257524_4258100_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ10335.1|4258158_4259682_-	catalase	NA	A0A2K9L0T1	Tupanvirus	48.0	2.8e-97
AUJ10336.1|4260125_4261094_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	2.5e-99
AUJ11009.1|4261537_4262008_-	hemolysin D	NA	NA	NA	NA	NA
AUJ11010.1|4261969_4262158_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ11011.1|4262692_4264825_-	ATP-dependent DNA helicase DinG	NA	NA	NA	NA	NA
AUJ10337.1|4265311_4265686_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ10338.1|4265675_4266527_-	shikimate dehydrogenase	NA	NA	NA	NA	NA
AUJ10339.1|4266579_4267461_+	TolB-like protein	NA	NA	NA	NA	NA
AUJ10340.1|4268126_4270688_-	iron-uptake factor	NA	NA	NA	NA	NA
AUJ10341.1|4270920_4271673_+	endonuclease	NA	H6X497	Enterobacteria_phage	33.3	2.8e-21
AUJ10342.1|4271800_4272715_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUJ10343.1|4272807_4273785_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ10344.1|4273972_4274965_-	porphobilinogen synthase	NA	NA	NA	NA	NA
AUJ11012.1|4275185_4275404_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ11013.1|4275654_4276110_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ10345.1|4276210_4278040_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ10346.1|4278205_4280443_-	S9 family peptidase	NA	NA	NA	NA	NA
AUJ11014.1|4282036_4283053_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	37.6	3.3e-49
AUJ10347.1|4283024_4283225_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ10348.1|4283223_4284600_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	48.1	9.9e-65
AUJ10349.1|4287018_4288029_+	energy transducer TonB	NA	NA	NA	NA	NA
AUJ10350.1|4288429_4289623_-	sodium ABC transporter permease	NA	NA	NA	NA	NA
AUJ10351.1|4289619_4290366_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.3	5.2e-20
AUJ10352.1|4290397_4291999_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
AUJ10353.1|4292059_4292260_-	transcriptional regulator	NA	NA	NA	NA	NA
AUJ11015.1|4292256_4292664_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ10354.1|4293292_4293565_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ10355.1|4293630_4294620_+	cation transporter	NA	NA	NA	NA	NA
AUJ10356.1|4294689_4295451_-	ferredoxin--NADP(+) reductase	NA	NA	NA	NA	NA
AUJ10357.1|4295553_4296549_+	ABC transporter	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	30.2	8.5e-26
AUJ10358.1|4296566_4297358_+	ABC transporter permease	NA	NA	NA	NA	NA
AUJ10359.1|4297359_4297944_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ10360.1|4298062_4299001_+	2-dehydropantoate 2-reductase	NA	NA	NA	NA	NA
AUJ10361.1|4299000_4299183_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ10362.1|4299114_4299318_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ10363.1|4299357_4299621_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 30
CP019090	Xanthomonas oryzae pv. oryzae strain MAI129 chromosome, complete genome	4703963	4374088	4432869	4703963	transposase	Ralstonia_phage(42.86%)	42	NA	NA
AUJ11025.1|4374088_4375465_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	46.6	1.3e-61
AUJ10412.1|4375678_4376350_+	4-carboxy-4-hydroxy-2-oxoadipate aldolase/oxaloacetate decarboxylase	NA	NA	NA	NA	NA
AUJ10413.1|4377389_4377629_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ10414.1|4377625_4378648_+	4-oxalomesaconate hydratase	NA	NA	NA	NA	NA
AUJ10415.1|4379037_4379205_-	50S ribosomal protein L33	NA	NA	NA	NA	NA
AUJ10416.1|4379218_4379455_-	50S ribosomal protein L28	NA	NA	NA	NA	NA
AUJ11026.1|4379639_4379966_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ11027.1|4382478_4383117_-	16S rRNA methyltransferase G	NA	NA	NA	NA	NA
AUJ11028.1|4383339_4384968_+	alkaline phosphatase	NA	NA	NA	NA	NA
AUJ10417.1|4386741_4387338_-	4-phosphopantetheinyl transferase	NA	NA	NA	NA	NA
AUJ10418.1|4387464_4387716_+	transglycosylase	NA	NA	NA	NA	NA
AUJ10419.1|4387777_4388215_-	aldehyde-activating protein	NA	NA	NA	NA	NA
AUJ10420.1|4388211_4388991_-	exodeoxyribonuclease III	NA	NA	NA	NA	NA
AUJ10421.1|4390669_4392397_-	cation acetate symporter	NA	NA	NA	NA	NA
AUJ10422.1|4392393_4392711_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ10423.1|4394476_4396420_+	acetyl-coenzyme A synthetase	NA	A0A2H4PQU7	Staphylococcus_phage	37.8	8.7e-83
AUJ10424.1|4396681_4397350_+	DNA-binding response regulator	NA	NA	NA	NA	NA
AUJ10425.1|4398614_4398818_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ10426.1|4400171_4400393_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ10427.1|4400389_4401400_+	oxidoreductase	NA	NA	NA	NA	NA
AUJ10428.1|4401396_4402269_+	amidohydrolase	NA	NA	NA	NA	NA
AUJ10429.1|4402265_4403036_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
AUJ10430.1|4403205_4404063_+	2-hydroxyhepta-2,4-diene-1,7-dioate isomerase	NA	NA	NA	NA	NA
AUJ10431.1|4404585_4405905_+	L-fuconate dehydratase	NA	NA	NA	NA	NA
AUJ10432.1|4406399_4407368_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	1.9e-99
AUJ11029.1|4407493_4407859_-	L-fucose mutarotase	NA	NA	NA	NA	NA
AUJ10433.1|4407855_4409157_-	L-fucose:H+ symporter permease	NA	NA	NA	NA	NA
AUJ10434.1|4409337_4410114_+	transcriptional regulator	NA	NA	NA	NA	NA
AUJ11030.1|4410590_4411175_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ11031.1|4411367_4414817_-	hybrid sensor histidine kinase/response regulator	NA	NA	NA	NA	NA
AUJ10435.1|4415567_4418210_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ11032.1|4418313_4420713_-	NdvB protein	NA	NA	NA	NA	NA
AUJ10436.1|4420715_4422098_-	MFS transporter	NA	NA	NA	NA	NA
AUJ11033.1|4422312_4422840_+	gluconokinase	NA	NA	NA	NA	NA
AUJ10437.1|4423744_4425406_+	polyvinylalcohol dehydrogenase	NA	A0A0M4JT37	Mollivirus	36.1	1.7e-82
AUJ10438.1|4425737_4426043_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ11034.1|4425945_4426386_-	3-dehydroquinate dehydratase	NA	NA	NA	NA	NA
AUJ10439.1|4426405_4426834_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ10440.1|4428374_4428644_+|transposase	transposase	transposase	NA	NA	NA	NA
AUJ10441.1|4428496_4429483_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	41.4	2.6e-43
AUJ10442.1|4429501_4430470_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	1.9e-99
AUJ10443.1|4431900_4432869_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	2.5e-99
>prophage 31
CP019090	Xanthomonas oryzae pv. oryzae strain MAI129 chromosome, complete genome	4703963	4468139	4538904	4703963	tRNA,transposase	Acidithiobacillus_phage(21.43%)	47	NA	NA
AUJ10462.1|4468139_4469057_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	62.5	3.1e-83
AUJ10463.1|4469147_4469687_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ10464.1|4469690_4471028_+	xylose isomerase	NA	NA	NA	NA	NA
AUJ10465.1|4471253_4472336_-	LacI family transcriptional regulator	NA	NA	NA	NA	NA
AUJ10466.1|4472475_4474671_+	alpha-glucuronidase	NA	NA	NA	NA	NA
AUJ10467.1|4474667_4476632_+	9-O-acetylesterase	NA	NA	NA	NA	NA
AUJ10468.1|4476643_4477903_+	bifunctional D-altronate/D-mannonate dehydratase	NA	Q6A202	Oenococcus_phage	26.0	3.5e-40
AUJ11037.1|4477902_4479603_+	glycoside hydrolase 43 family protein	NA	NA	NA	NA	NA
AUJ10469.1|4479605_4482320_+	glucan 1,4-alpha-glucosidase	NA	NA	NA	NA	NA
AUJ10470.1|4482542_4484063_+	mannitol dehydrogenase	NA	G8DCZ3	Micromonas_pusilla_virus	31.4	2.5e-45
AUJ10471.1|4484057_4485116_-|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	43.2	1.8e-74
AUJ10472.1|4485271_4486648_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.3	2.1e-62
AUJ10473.1|4486824_4487928_+	restriction endonuclease	NA	A0A1S5SAB0	Streptococcus_phage	40.4	9.4e-58
AUJ10474.1|4488019_4488394_-	glyoxalase/bleomycin resistance/extradiol dioxygenase family protein	NA	NA	NA	NA	NA
AUJ10475.1|4489094_4490111_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	37.6	1.9e-49
AUJ10476.1|4490733_4491789_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ10477.1|4492015_4493434_-	uronate isomerase	NA	NA	NA	NA	NA
AUJ10478.1|4493474_4494452_-	1,4-beta-xylanase	NA	NA	NA	NA	NA
AUJ10479.1|4495856_4497338_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ11038.1|4497679_4500553_+	TonB-dependent receptor	NA	NA	NA	NA	NA
AUJ10480.1|4500651_4502139_+	MFS transporter	NA	NA	NA	NA	NA
AUJ10481.1|4502170_4503205_+	alpha-N-arabinofuranosidase	NA	NA	NA	NA	NA
AUJ10482.1|4503546_4504080_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ10483.1|4504361_4505330_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.7	6.6e-100
AUJ10484.1|4505332_4505515_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ11039.1|4506803_4507376_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ10485.1|4507514_4507733_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ10486.1|4507830_4508133_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ10487.1|4508369_4509350_-	alcohol dehydrogenase	NA	NA	NA	NA	NA
AUJ10488.1|4509545_4512209_-	glycerol-3-phosphate 1-O-acyltransferase	NA	NA	NA	NA	NA
AUJ10489.1|4512208_4513189_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ10490.1|4513181_4513427_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ10491.1|4513595_4514648_+	LacI family transcriptional regulator	NA	NA	NA	NA	NA
AUJ10492.1|4514812_4517851_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ10493.1|4518152_4518584_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ10494.1|4518689_4520066_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.7	3.2e-63
AUJ10495.1|4522814_4524344_+	tryptophan halogenase	NA	M4T1E3	Cyanophage	28.5	3.9e-46
AUJ10496.1|4524650_4525430_-	orotidine 5'-phosphate decarboxylase	NA	NA	NA	NA	NA
AUJ11040.1|4525426_4526386_-	acid phosphatase	NA	NA	NA	NA	NA
AUJ10497.1|4526716_4527382_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ10498.1|4528780_4530757_-	DNA helicase Rep	NA	A7KV33	Bacillus_phage	37.2	6.3e-113
AUJ10499.1|4530963_4531593_+	thymidine kinase	NA	A0A023W530	Serratia_phage	55.0	1.1e-52
AUJ10500.1|4532051_4533290_+	histidine kinase	NA	NA	NA	NA	NA
AUJ10501.1|4533432_4535031_-	glucan biosynthesis protein D	NA	NA	NA	NA	NA
AUJ10502.1|4535099_4536191_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ11041.1|4536423_4537239_-	DNA-formamidopyrimidine glycosylase	NA	A0A127AWE5	Bacillus_phage	27.0	1.1e-18
AUJ10503.1|4537527_4538904_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.3	2.1e-62
>prophage 32
CP019090	Xanthomonas oryzae pv. oryzae strain MAI129 chromosome, complete genome	4703963	4553658	4616450	4703963	protease,transposase	Acidithiobacillus_phage(31.25%)	50	NA	NA
AUJ10510.1|4553658_4555035_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	46.3	4.3e-60
AUJ10511.1|4555166_4556348_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ10512.1|4556445_4559877_-	ATP-binding protein	NA	NA	NA	NA	NA
AUJ10513.1|4560024_4560723_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ10514.1|4560706_4562179_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ10515.1|4562175_4562763_-	cytoplasmic protein	NA	NA	NA	NA	NA
AUJ10516.1|4562762_4563959_-	chromosome segregation protein SMC	NA	NA	NA	NA	NA
AUJ10517.1|4564032_4564662_-	GTP cyclohydrolase I FolE	NA	E7DN69	Pneumococcus_phage	49.5	4.2e-47
AUJ10518.1|4564755_4565253_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
AUJ11043.1|4565368_4565512_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ10519.1|4566666_4567191_+	FUSC family protein	NA	NA	NA	NA	NA
AUJ11044.1|4567162_4568179_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	37.6	2.5e-49
AUJ10520.1|4568585_4569947_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	27.1	5.8e-33
AUJ10521.1|4570127_4571504_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	48.1	9.9e-65
AUJ11045.1|4572192_4572906_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ10522.1|4572936_4573443_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ10523.1|4573716_4573923_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ10524.1|4573909_4575022_+	plasmid stabilization protein ParE	NA	NA	NA	NA	NA
AUJ10525.1|4575370_4576357_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	40.6	2.9e-42
AUJ10526.1|4576418_4577054_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ10527.1|4577235_4578030_-	peptidase	NA	NA	NA	NA	NA
AUJ11046.1|4578200_4578674_+	ATPase	NA	NA	NA	NA	NA
AUJ10528.1|4581156_4581486_-	thiol reductase thioredoxin	NA	A0A0K1Y9C9	Streptomyces_phage	32.5	7.2e-06
AUJ10529.1|4581506_4581905_-	attachment protein	NA	NA	NA	NA	NA
AUJ10530.1|4582864_4583335_-	DNA mismatch repair protein MutT	NA	NA	NA	NA	NA
AUJ10531.1|4585082_4586459_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.0	6.0e-62
AUJ10532.1|4586501_4586582_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ10533.1|4586603_4586987_+|protease	metalloprotease	protease	NA	NA	NA	NA
AUJ10534.1|4586983_4587295_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ11047.1|4587554_4588037_-	ATPase	NA	NA	NA	NA	NA
AUJ11048.1|4588585_4589503_+	histidine kinase	NA	NA	NA	NA	NA
AUJ10535.1|4589744_4589933_+	CsbD family protein	NA	NA	NA	NA	NA
AUJ10536.1|4590577_4590835_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ10537.1|4590959_4591409_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ10538.1|4591628_4592546_+	hypothetical protein	NA	K7PHD1	Enterobacteria_phage	47.3	1.7e-68
AUJ10539.1|4592555_4593500_-	hypothetical protein	NA	S5WIU1	Leptospira_phage	38.7	2.0e-32
AUJ10540.1|4593864_4596645_-	TonB-dependent receptor	NA	NA	NA	NA	NA
AUJ10541.1|4596931_4597954_+	2-keto-3-deoxygluconate kinase	NA	NA	NA	NA	NA
AUJ11049.1|4598574_4599783_-	trans-2-enoyl-CoA reductase	NA	NA	NA	NA	NA
AUJ10542.1|4601754_4602921_+	alpha-hydroxy-acid oxidizing enzyme	NA	NA	NA	NA	NA
AUJ10543.1|4604872_4606249_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	54.8	1.0e-77
AUJ10544.1|4606259_4606553_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ10545.1|4606663_4608859_-	ligand-gated channel	NA	A0A1B0VCF0	Salmonella_phage	40.6	2.4e-65
AUJ10546.1|4608957_4610160_+	aromatic amino acid aminotransferase	NA	NA	NA	NA	NA
AUJ10547.1|4610430_4611441_+	fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	37.8	7.3e-49
AUJ10548.1|4611715_4612183_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ11050.1|4612832_4613375_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	42.3	3.0e-33
AUJ10549.1|4613559_4614936_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	55.1	4.6e-78
AUJ10550.1|4615051_4615375_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ10551.1|4615481_4616450_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	1.9e-99
>prophage 33
CP019090	Xanthomonas oryzae pv. oryzae strain MAI129 chromosome, complete genome	4703963	4624336	4692026	4703963	protease,transposase	Ralstonia_phage(25.0%)	57	NA	NA
AUJ10555.1|4624336_4625668_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	46.6	2.2e-61
AUJ11052.1|4625733_4626849_+	enterochelin esterase	NA	NA	NA	NA	NA
AUJ11053.1|4626960_4627371_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ10556.1|4627630_4628086_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ10557.1|4628018_4628216_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ10558.1|4628309_4629197_-	pseudouridylate synthase	NA	NA	NA	NA	NA
AUJ10559.1|4629530_4631108_+	chlamydia polymorphic membrane family protein	NA	NA	NA	NA	NA
AUJ10560.1|4631602_4632430_+	restriction endonuclease	NA	NA	NA	NA	NA
AUJ10561.1|4633156_4634215_+|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	42.9	2.6e-73
AUJ10562.1|4634371_4634554_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ10563.1|4636074_4637061_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	41.4	2.6e-43
AUJ10564.1|4637297_4637819_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ10565.1|4637856_4638825_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	1.9e-99
AUJ10566.1|4639293_4640031_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ10567.1|4640048_4640741_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ10568.1|4641934_4642960_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	37.6	1.9e-49
AUJ10569.1|4642997_4643330_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ10570.1|4643322_4643799_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ10571.1|4643801_4644236_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ10572.1|4644351_4644597_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ10573.1|4644597_4644792_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ10574.1|4644933_4645266_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ10575.1|4645514_4645613_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ10576.1|4645715_4647110_-	nucleoside hydrolase	NA	NA	NA	NA	NA
AUJ10577.1|4647993_4648248_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	71.4	5.9e-16
AUJ10578.1|4648265_4648544_-	plasmid maintenance system killer protein	NA	A0A222YWE2	Escherichia_phage	37.0	2.9e-08
AUJ10579.1|4648641_4650903_-	exodeoxyribonuclease V subunit alpha	NA	A0A0N9S864	Staphylococcus_phage	44.9	1.5e-09
AUJ10580.1|4651090_4655152_-	exodeoxyribonuclease V subunit beta	NA	S5MMD7	Bacillus_phage	22.5	3.2e-10
AUJ10581.1|4655148_4658562_-	exodeoxyribonuclease V subunit gamma	NA	NA	NA	NA	NA
AUJ10582.1|4658887_4659541_-	hypothetical protein	NA	G3M9Y6	Bacillus_virus	24.2	7.1e-05
AUJ10583.1|4659591_4660728_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ10584.1|4660867_4661836_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	7.3e-99
AUJ11054.1|4662015_4663017_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	61.5	2.7e-96
AUJ10585.1|4664593_4665283_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.8	1.8e-35
AUJ10586.1|4665295_4666453_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ11055.1|4666588_4667776_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ10587.1|4667857_4668046_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ10588.1|4668091_4669078_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	40.6	9.9e-43
AUJ10589.1|4669402_4670197_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	28.5	5.8e-09
AUJ10590.1|4670196_4670946_+	ABC transporter permease	NA	NA	NA	NA	NA
AUJ10591.1|4670957_4671509_+	outer membrane lipid asymmetry maintenance protein MlaD	NA	NA	NA	NA	NA
AUJ10592.1|4671505_4672168_+	organic solvent ABC transporter	NA	NA	NA	NA	NA
AUJ10593.1|4672142_4672448_+	anti-sigma B factor antagonist	NA	NA	NA	NA	NA
AUJ10594.1|4672458_4673517_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ10595.1|4673589_4674111_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ10596.1|4674198_4675575_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.7	3.2e-63
AUJ11056.1|4675943_4676489_-	glutathione peroxidase	NA	Q70H87	Fowlpox_virus	34.5	2.0e-16
AUJ11057.1|4677628_4679209_-	recombinase RmuC	NA	NA	NA	NA	NA
AUJ10597.1|4679556_4680525_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	1.5e-99
AUJ10598.1|4683099_4683615_-	PucR family transcriptional regulator	NA	NA	NA	NA	NA
AUJ10599.1|4683686_4684856_-	glycerate kinase	NA	W6LM47	Streptococcus_phage	38.6	4.9e-41
AUJ10600.1|4684881_4686246_-	MFS transporter	NA	NA	NA	NA	NA
AUJ10601.1|4688040_4688361_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ10602.1|4688479_4689646_-	rRNA large subunit methyltransferase I	NA	NA	NA	NA	NA
AUJ10603.1|4689908_4690865_+	hypothetical protein	NA	K4F9T9	Cronobacter_phage	29.9	1.4e-30
AUJ10604.1|4691052_4691244_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ10605.1|4691240_4692026_+|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
