The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP019088	Xanthomonas oryzae pv. oryzae strain MAI99 chromosome, complete genome	4698819	7509	60934	4698819	transposase,protease	Leptospira_phage(28.57%)	41	NA	NA
AUJ00037.1|7509_8346_+|protease	CAAX protease family protein	protease	NA	NA	NA	NA
AUJ00038.1|8530_9337_+	peptidase	NA	NA	NA	NA	NA
AUJ00039.1|9613_10807_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ00040.1|10960_11629_+	energy transducer TonB	NA	NA	NA	NA	NA
AUJ00041.1|11713_12475_+	biopolymer transporter ExbB	NA	NA	NA	NA	NA
AUJ00042.1|12521_12944_+	biopolymer transporter ExbD	NA	NA	NA	NA	NA
AUJ00043.1|12947_13361_+	biopolymer transporter ExbD	NA	NA	NA	NA	NA
AUJ00044.1|13656_14424_-	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
AUJ00045.1|14434_14704_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ00046.1|14778_16239_-	cardiolipin synthase	NA	NA	NA	NA	NA
AUJ00047.1|17384_18761_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.0	4.1e-63
AUJ03270.1|18989_19874_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.7	2.0e-87
AUJ00048.1|20006_20993_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	40.6	9.9e-43
AUJ03271.1|21252_22311_-	radical SAM protein	NA	NA	NA	NA	NA
AUJ00049.1|23450_24791_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ00050.1|25008_25701_+|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
AUJ03272.1|25817_26138_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ00051.1|27435_28959_-	peptidase S41	NA	A0A0R6PIZ1	Moraxella_phage	29.2	1.0e-25
AUJ03273.1|29063_30281_-	peptidase M23	NA	NA	NA	NA	NA
AUJ00052.1|30459_31116_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ00053.1|31278_33090_+	aminopeptidase	NA	NA	NA	NA	NA
AUJ00054.1|33237_33588_-	peptidase propeptide and ypeb domain-containing protein	NA	NA	NA	NA	NA
AUJ00055.1|33894_35025_-	cellulase	NA	NA	NA	NA	NA
AUJ00056.1|35807_36860_-	cellulase	NA	NA	NA	NA	NA
AUJ00057.1|37560_38634_-	cellulase	NA	NA	NA	NA	NA
AUJ00058.1|38750_38957_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ00059.1|38942_40001_+	hydroxyacid dehydrogenase	NA	A0A2K9L339	Tupanvirus	45.7	3.9e-77
AUJ00060.1|41043_41307_+|transposase	transposase	transposase	NA	NA	NA	NA
AUJ00061.1|43061_44120_+|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	43.5	6.2e-75
AUJ00062.1|44201_45683_-	glutamate synthase small subunit	NA	NA	NA	NA	NA
AUJ00063.1|45877_50350_-	glutamate synthase large subunit	NA	NA	NA	NA	NA
AUJ00064.1|50551_50932_-	Elastase inhibitor AFLEI Flags: Precursor	NA	NA	NA	NA	NA
AUJ00065.1|50988_52266_+	DNA topoisomerase	NA	A0A0U2TSJ7	Niemeyer_virus	35.3	1.4e-41
AUJ00066.1|52468_52774_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ03274.1|53263_53431_+	amino acid transporter	NA	NA	NA	NA	NA
AUJ03275.1|53960_55100_+	saccharopine dehydrogenase	NA	NA	NA	NA	NA
AUJ00067.1|55413_56199_-	Tat pathway signal protein	NA	NA	NA	NA	NA
AUJ03276.1|56209_58774_-	TonB-dependent receptor	NA	NA	NA	NA	NA
AUJ00068.1|58970_60128_+	XylR family transcriptional regulator	NA	NA	NA	NA	NA
AUJ00069.1|60170_60590_+|transposase	transposase	transposase	NA	NA	NA	NA
AUJ03277.1|60508_60934_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 2
CP019088	Xanthomonas oryzae pv. oryzae strain MAI99 chromosome, complete genome	4698819	206558	330717	4698819	tRNA,transposase,integrase	Leptospira_phage(21.43%)	102	249221:249237	276107:276123
AUJ03294.1|206558_206984_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AUJ00172.1|207292_210685_-	Avirulence protein AvrBs3	NA	NA	NA	NA	NA
AUJ00173.1|212463_212679_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ03295.1|213094_214327_+	lipase	NA	NA	NA	NA	NA
AUJ00174.1|214661_214964_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ00175.1|215120_215885_-	2,5-didehydrogluconate reductase B	NA	A0A2H4PQR8	Staphylococcus_phage	33.9	4.2e-33
AUJ00176.1|215907_216966_+|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	43.2	1.8e-74
AUJ00177.1|217068_218097_-	NADP-dependent oxidoreductase	NA	NA	NA	NA	NA
AUJ00178.1|218235_219207_-	alcohol dehydrogenase	NA	NA	NA	NA	NA
AUJ00179.1|219439_220294_+	methyltransferase	NA	NA	NA	NA	NA
AUJ03296.1|220386_220959_+	pseudouridine synthase	NA	NA	NA	NA	NA
AUJ00180.1|220980_221175_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ00181.1|221281_221722_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ00182.1|222023_224525_-	ATP-dependent helicase HrpB	NA	A0A2H4UU36	Bodo_saltans_virus	25.7	4.6e-20
AUJ00183.1|224678_225317_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ00184.1|225909_226383_-	hypothetical protein	NA	Q9EYF4	Enterobacteria_phage	48.7	2.1e-35
AUJ03297.1|226568_227273_-	hydroxyisourate hydrolase	NA	NA	NA	NA	NA
AUJ00185.1|227822_228236_-	DUF4440 domain-containing protein	NA	NA	NA	NA	NA
AUJ00186.1|229123_230380_-	aminotransferase V	NA	NA	NA	NA	NA
AUJ00187.1|231516_231909_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
AUJ00188.1|232020_234528_+	peptidase	NA	NA	NA	NA	NA
AUJ00189.1|234705_235164_-	gas vesicle protein	NA	NA	NA	NA	NA
AUJ00190.1|236297_237266_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.7	5.1e-100
AUJ00191.1|237470_237722_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ00192.1|238158_238344_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ00193.1|239099_239408_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ00194.1|239404_239836_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ00195.1|240916_241729_+	hydrolase TatD	NA	NA	NA	NA	NA
AUJ00196.1|242425_242623_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ00197.1|242598_243486_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUJ00198.1|243501_244863_+	MFS transporter	NA	NA	NA	NA	NA
AUJ00199.1|245302_246184_+	NAD-dependent deacetylase	NA	A0A068EPD4	Bacillus_phage	23.3	6.6e-14
AUJ00200.1|246263_247361_+	oxidoreductase	NA	NA	NA	NA	NA
AUJ00201.1|247398_248277_+	oxidoreductase	NA	NA	NA	NA	NA
AUJ03298.1|248619_249012_+	hypothetical protein	NA	NA	NA	NA	NA
249221:249237	attL	CATTGCGCCGATGCGCT	NA	NA	NA	NA
AUJ00202.1|249230_250082_+	formyltetrahydrofolate deformylase	NA	NA	NA	NA	NA
AUJ00203.1|250165_250843_-	DNA-binding response regulator	NA	NA	NA	NA	NA
AUJ00204.1|250875_251283_-	ATP-binding protein	NA	W8CYF6	Bacillus_phage	32.5	4.7e-15
AUJ00205.1|251279_251525_-	histidine kinase	NA	NA	NA	NA	NA
AUJ03299.1|251541_252438_-	5,10-methylenetetrahydrofolate reductase	NA	NA	NA	NA	NA
AUJ00206.1|252695_253361_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ00207.1|253360_254275_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUJ00208.1|254465_255059_+	FMN reductase	NA	NA	NA	NA	NA
AUJ00209.1|255201_256185_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ00210.1|256212_257241_+	5-methyltetrahydropteroyltriglutamate-- homocysteine methyltransferase	NA	NA	NA	NA	NA
AUJ03300.1|257448_258405_-	2-keto-3-deoxygluconate transporter	NA	NA	NA	NA	NA
AUJ00211.1|260833_261712_-	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
AUJ00212.1|261848_262280_+	transcriptional regulator	NA	NA	NA	NA	NA
AUJ03301.1|262497_262740_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ00213.1|263628_263892_-|transposase	transposase	transposase	NA	NA	NA	NA
AUJ00214.1|263860_264160_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ00215.1|264262_264535_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ00216.1|264812_265079_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ00217.1|265149_265359_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ00218.1|265357_266326_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	9.6e-99
AUJ03302.1|266772_266982_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ00219.1|267191_267437_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ00220.1|267680_270968_-	avirulence protein	NA	NA	NA	NA	NA
AUJ00221.1|271892_272861_+|integrase	integron integrase	integrase	A0A1P8DJJ6	Virus_Rctr41k	44.0	5.9e-56
AUJ00222.1|273060_274437_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.0	6.0e-62
AUJ00223.1|274614_276453_-	dihydroxy-acid dehydratase	NA	NA	NA	NA	NA
276107:276123	attR	AGCGCATCGGCGCAATG	NA	NA	NA	NA
AUJ03303.1|276627_276894_+	zinc/iron-chelating domain-containing protein	NA	NA	NA	NA	NA
AUJ00224.1|276919_277465_-	gamma carbonic anhydrase family protein	NA	NA	NA	NA	NA
AUJ00225.1|277940_279251_+	MFS transporter	NA	NA	NA	NA	NA
AUJ00226.1|279389_280649_+	phosphodiesterase	NA	NA	NA	NA	NA
AUJ03304.1|281133_281634_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
AUJ03305.1|281605_281992_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AUJ00227.1|283629_285528_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ00228.1|286102_286990_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AUJ00229.1|287087_288278_+	4-hydroxybenzoate 3-monooxygenase	NA	NA	NA	NA	NA
AUJ00230.1|288689_289202_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ00231.1|290758_291742_-	oxidoreductase	NA	NA	NA	NA	NA
AUJ00232.1|291842_292919_-	Rieske (2Fe-2S) protein	NA	NA	NA	NA	NA
AUJ03306.1|293170_294034_+	3-oxoadipate--succinyl-CoA transferase	NA	NA	NA	NA	NA
AUJ00233.1|294817_296026_+	3-oxoadipyl-CoA thiolase	NA	NA	NA	NA	NA
AUJ00234.1|296104_296842_+	protocatechuate 3,4-dioxygenase subunit beta	NA	NA	NA	NA	NA
AUJ00235.1|296846_297410_+	protocatechuate 3,4-dioxygenase subunit alpha	NA	NA	NA	NA	NA
AUJ00236.1|297907_299260_+	3-carboxy-cis,cis-muconate cycloisomerase	NA	NA	NA	NA	NA
AUJ00237.1|299270_300053_+	3-oxoadipate enol-lactonase	NA	NA	NA	NA	NA
AUJ00238.1|300078_300483_+	4-carboxymuconolactone decarboxylase	NA	NA	NA	NA	NA
AUJ00239.1|301962_302823_-	IclR family transcriptional regulator	NA	NA	NA	NA	NA
AUJ00240.1|302970_303831_+	serine protein kinase RIO	NA	NA	NA	NA	NA
AUJ00241.1|307125_309030_-|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG	tRNA	NA	NA	NA	NA
AUJ00242.1|309290_309470_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ00243.1|309603_310071_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ00244.1|310228_311188_+	serine/threonine dehydratase	NA	NA	NA	NA	NA
AUJ00245.1|311172_311787_+	protein sanA-like protein	NA	NA	NA	NA	NA
AUJ00246.1|311829_312249_+	isopropylmalate/homocitrate/citramalate synthase	NA	NA	NA	NA	NA
AUJ00247.1|312501_313407_-	aspartyl beta-hydroxylase	NA	S4VR59	Pandoravirus	39.1	9.8e-37
AUJ00248.1|313655_314540_-	malonyl-[acyl-carrier protein] O-methyltransferase BioC	NA	NA	NA	NA	NA
AUJ03307.1|315429_316191_-	pimeloyl-[acyl-carrier protein] methyl ester esterase	NA	NA	NA	NA	NA
AUJ00249.1|316354_316729_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ00250.1|316920_318126_-	8-amino-7-oxononanoate synthase	NA	NA	NA	NA	NA
AUJ00251.1|318217_319252_-	biotin synthase BioB	NA	NA	NA	NA	NA
AUJ00252.1|319295_320027_+	amidophosphoribosyltransferase	NA	NA	NA	NA	NA
AUJ00253.1|320282_321188_-	4-hydroxybenzoate octaprenyltransferase	NA	NA	NA	NA	NA
AUJ00254.1|322135_323194_+|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	43.5	6.2e-75
AUJ00255.1|323229_325170_-	HpaF protein	NA	NA	NA	NA	NA
AUJ00256.1|325733_328142_-	serine kinase	NA	NA	NA	NA	NA
AUJ03308.1|328349_329204_-|transposase	transposase	transposase	U5P429	Shigella_phage	57.3	1.1e-85
AUJ00257.1|329608_330595_-|transposase	transposase	transposase	S5WIU1	Leptospira_phage	40.6	3.4e-43
AUJ00258.1|330447_330717_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 3
CP019088	Xanthomonas oryzae pv. oryzae strain MAI99 chromosome, complete genome	4698819	359890	394019	4698819	transposase	Acidithiobacillus_phage(37.5%)	25	NA	NA
AUJ00285.1|359890_360859_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	1.6e-98
AUJ00286.1|360984_362709_-	ABC transporter substrate-binding protein	NA	A0A0P0CRE2	Ostreococcus_lucimarinus_virus	28.7	3.0e-34
AUJ00287.1|362719_362932_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ00288.1|362949_363891_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ00289.1|365447_366506_-|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	43.5	6.2e-75
AUJ00290.1|366526_368161_-	GGDEF domain-containing protein	NA	NA	NA	NA	NA
AUJ03311.1|368770_370228_+	starch synthase	NA	NA	NA	NA	NA
AUJ00291.1|370224_372456_+	glycogen-branching enzyme	NA	NA	NA	NA	NA
AUJ00292.1|372458_374216_+	malto-oligosyltrehalose trehalohydrolase	NA	NA	NA	NA	NA
AUJ03312.1|374272_376162_+	4-alpha-glucanotransferase	NA	NA	NA	NA	NA
AUJ00293.1|376158_378762_+	malto-oligosyltrehalose synthase	NA	NA	NA	NA	NA
AUJ00294.1|378784_378970_+	DUF2934 domain-containing protein	NA	NA	NA	NA	NA
AUJ00295.1|379083_381246_+	glycogen debranching enzyme	NA	NA	NA	NA	NA
AUJ03313.1|381262_381895_+	NAD-dependent dehydratase	NA	NA	NA	NA	NA
AUJ00296.1|382260_383637_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	55.5	2.0e-78
AUJ00297.1|383718_384474_-	3-oxoacyl-ACP reductase	NA	NA	NA	NA	NA
AUJ00298.1|384437_384743_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ00299.1|384824_386261_+	pyridine nucleotide-disulfide oxidoreductase	NA	NA	NA	NA	NA
AUJ00300.1|386609_387041_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ00301.1|387511_388888_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.7	3.2e-63
AUJ00302.1|389080_390457_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.3	2.1e-62
AUJ00303.1|390493_390688_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ00304.1|391127_392417_-	RNA helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.2	6.0e-40
AUJ00305.1|392424_392676_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ00306.1|393038_394019_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	56.7	1.4e-89
>prophage 4
CP019088	Xanthomonas oryzae pv. oryzae strain MAI99 chromosome, complete genome	4698819	492791	620182	4698819	tRNA,transposase,capsid,portal,terminase,plate,integrase,head,tail	Stenotrophomonas_phage(39.62%)	106	518418:518462	561400:561444
AUJ00381.1|492791_493355_-|tRNA	tRNA threonylcarbamoyladenosine biosynthesis protein RimN	tRNA	NA	NA	NA	NA
AUJ00382.1|493365_495858_-	DNA topoisomerase I	NA	A0A0G2YA05	Acanthamoeba_polyphaga_mimivirus	35.3	1.9e-114
AUJ00383.1|496040_497315_-	RDD family protein	NA	NA	NA	NA	NA
AUJ00384.1|497356_498079_-	pilus assembly protein PilA	NA	NA	NA	NA	NA
AUJ00385.1|498119_498593_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ00386.1|498635_499778_-	DNA protecting protein DprA	NA	NA	NA	NA	NA
AUJ00387.1|499849_500986_-	peptidoglycan-binding protein LysM	NA	G3MBQ1	Bacillus_virus	57.1	1.7e-09
AUJ00388.1|501118_501631_+	peptide deformylase	NA	E3SLL2	Synechococcus_phage	43.0	2.6e-18
AUJ00389.1|502031_502955_+|tRNA	methionyl-tRNA formyltransferase	tRNA	NA	NA	NA	NA
AUJ00390.1|502954_504268_+	16S rRNA (cytosine(967)-C(5))-methyltransferase	NA	NA	NA	NA	NA
AUJ00391.1|506218_507496_+	polymerase	NA	NA	NA	NA	NA
AUJ00392.1|507693_508518_-	lipopolysaccharide biosynthesis protein	NA	NA	NA	NA	NA
AUJ00393.1|508518_509577_+	CDP-glycerol glycerophosphotransferase	NA	NA	NA	NA	NA
AUJ00394.1|509743_511249_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ03327.1|511245_511755_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ00395.1|511864_512998_-	GTP cyclohydrolase	NA	A0A2H4PQS2	Staphylococcus_phage	44.2	6.1e-28
AUJ00396.1|513240_513762_+	N-acetyltransferase	NA	NA	NA	NA	NA
AUJ00397.1|513960_514875_-	lipid A biosynthesis lauroyl acyltransferase	NA	NA	NA	NA	NA
AUJ00398.1|514975_515416_+|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
AUJ00399.1|515524_517399_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	35.5	1.8e-37
AUJ00400.1|517591_517912_+	hypothetical protein	NA	NA	NA	NA	NA
518418:518462	attL	CTCATAATCCTTTGGTTGAAGGTTCGAATCCTTCTGGGCCCACCA	NA	NA	NA	NA
AUJ00401.1|518531_519719_-|integrase	integrase	integrase	V9IQN0	Stenotrophomonas_phage	50.5	6.0e-111
AUJ00402.1|519718_519943_-	hypothetical protein	NA	V9IQX6	Stenotrophomonas_phage	71.4	6.1e-17
AUJ00403.1|519939_520146_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ00404.1|520142_520415_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ03329.1|520411_520561_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ00405.1|520653_520929_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ03328.1|520921_521077_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ00406.1|521090_521501_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ00407.1|521726_522005_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ03330.1|522001_522220_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ03331.1|522528_525201_-	bifunctional DNA primase/helicase	NA	V9IQW5	Stenotrophomonas_phage	69.7	0.0e+00
AUJ00408.1|525234_525447_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ00409.1|525443_525722_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ00410.1|525732_526053_-	hypothetical protein	NA	V9IQW3	Stenotrophomonas_phage	56.5	6.3e-23
AUJ00411.1|526055_526313_-	DNA-binding protein	NA	A0A2H4JE67	uncultured_Caudovirales_phage	46.4	6.6e-07
AUJ00412.1|526384_526822_+	transcriptional regulator	NA	E5E3P4	Burkholderia_phage	32.0	5.4e-09
AUJ03332.1|527182_527467_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ00413.1|527482_528469_-	late control protein	NA	V9IQM7	Stenotrophomonas_phage	54.8	2.5e-94
AUJ00414.1|528465_528867_-	oxidoreductase	NA	V9IQX3	Stenotrophomonas_phage	62.3	6.0e-39
AUJ00415.1|528879_531750_-|tail	phage tail tape measure protein	tail	V9IQL1	Stenotrophomonas_phage	47.5	6.2e-194
AUJ00416.1|531782_531896_-	hypothetical protein	NA	A0A0M4R2P3	Salmonella_phage	68.6	4.2e-06
AUJ00417.1|531904_532207_-|tail	phage tail protein	tail	A4PE51	Ralstonia_virus	62.6	6.3e-25
AUJ00418.1|532252_532762_-|tail	phage major tail tube protein	tail	V9IQX1	Stenotrophomonas_phage	79.9	1.8e-72
AUJ00419.1|532792_533959_-|tail	phage tail protein	tail	E5FFG9	Burkholderia_phage	62.4	4.6e-132
AUJ00420.1|533970_534330_-|plate	baseplate assembly protein	plate	V9IQW0	Stenotrophomonas_phage	66.1	4.3e-36
AUJ00421.1|534326_534890_-|plate	baseplate assembly protein	plate	Q9ZXL0	Pseudomonas_virus	43.7	3.1e-25
AUJ00422.1|534950_535529_-|tail	phage tail protein	tail	NA	NA	NA	NA
AUJ00423.1|535536_537042_-	hypothetical protein	NA	V9IQX0	Stenotrophomonas_phage	47.0	2.1e-52
AUJ00424.1|537051_537597_-|tail	phage tail protein I	tail	V9IQK7	Stenotrophomonas_phage	54.7	3.5e-50
AUJ00425.1|537589_538480_-|plate	baseplate assembly protein	plate	V9IQV9	Stenotrophomonas_phage	53.7	7.2e-85
AUJ00426.1|538561_539011_-	phage virion morphogenesis protein	NA	V9IQH0	Stenotrophomonas_phage	54.7	1.8e-36
AUJ00427.1|538998_539418_-|tail	phage tail protein	tail	A0A2H4J906	uncultured_Caudovirales_phage	65.2	2.0e-40
AUJ00428.1|539891_540533_-	lysozyme	NA	V9IQK6	Stenotrophomonas_phage	60.9	7.9e-49
AUJ00429.1|540529_540805_-	hypothetical protein	NA	V9IQV8	Stenotrophomonas_phage	59.8	3.0e-21
AUJ00430.1|540797_541154_-	hypothetical protein	NA	V9IQG9	Stenotrophomonas_phage	56.1	4.5e-22
AUJ00431.1|541158_541368_-|tail	phage tail protein	tail	K4PAW7	Burkholderia_phage	59.4	5.4e-15
AUJ00432.1|541367_541835_-|head	head completion/stabilization protein	head	V9IQW6	Stenotrophomonas_phage	49.7	9.2e-31
AUJ00433.1|541934_542654_-|terminase	terminase	terminase	Q9ZXM2	Pseudomonas_virus	63.4	2.0e-69
AUJ00434.1|542657_543677_-|capsid	phage major capsid protein, P2 family	capsid	Q9ZXM3	Pseudomonas_virus	70.9	2.1e-136
AUJ00435.1|543723_544566_-|capsid	phage capsid protein	capsid	A0A2H4J928	uncultured_Caudovirales_phage	52.6	1.7e-67
AUJ00436.1|544687_546472_+|terminase	terminase	terminase	V9IQL5	Stenotrophomonas_phage	75.1	1.2e-267
AUJ00437.1|546471_547491_+|portal	phage portal protein	portal	A0A2H4J922	uncultured_Caudovirales_phage	72.5	4.1e-140
AUJ00438.1|547511_547742_+	hypothetical protein	NA	V9IQK2	Stenotrophomonas_phage	54.8	1.9e-13
AUJ00439.1|547674_548379_+	DNA modification methylase	NA	V9IQV5	Stenotrophomonas_phage	77.8	3.3e-109
AUJ00440.1|548410_548878_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ00441.1|548877_550056_-	DNA-binding protein	NA	NA	NA	NA	NA
AUJ00442.1|550786_553546_+	type IV secretion protein Rhs	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	27.3	1.8e-41
AUJ00443.1|553554_554481_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ00444.1|554477_557312_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ00445.1|557339_558071_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ00446.1|558097_560440_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ00447.1|561511_561745_-	hypothetical protein	NA	V9IQN0	Stenotrophomonas_phage	53.1	4.1e-16
561400:561444	attR	CTCATAATCCTTTGGTTGAAGGTTCGAATCCTTCTGGGCCCACCA	NA	NA	NA	NA
AUJ00448.1|562101_562956_+|transposase	transposase	transposase	U5P429	Shigella_phage	57.7	6.3e-86
AUJ03333.1|563621_564902_-	transcription termination factor Rho	NA	NA	NA	NA	NA
AUJ00449.1|565727_566069_-	thiol reductase thioredoxin	NA	A0A1J0GW78	Streptomyces_phage	44.4	2.3e-15
AUJ00450.1|566267_567992_+	ATP-dependent RNA helicase RhlB	NA	A0A1V0SBR7	Catovirus	29.4	1.1e-47
AUJ00451.1|568067_568754_+	cell division ATP-binding protein FtsE	NA	NA	NA	NA	NA
AUJ00452.1|568750_569701_+	ABC transporter permease	NA	NA	NA	NA	NA
AUJ03334.1|569757_570552_+	histidine kinase	NA	NA	NA	NA	NA
AUJ00453.1|570548_571274_+	uracil-DNA glycosylase	NA	A0A0B5IW78	Pandoravirus	44.3	4.7e-50
AUJ00454.1|571490_572366_+	RNA polymerase factor sigma-32	NA	A0A248SJA5	Salicola_phage	39.5	3.6e-44
AUJ00455.1|572444_573059_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ00456.1|573111_574404_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
AUJ00457.1|576694_576982_+	co-chaperone GroES	NA	A0A221S331	uncultured_virus	40.0	5.1e-16
AUJ00458.1|577125_578766_+	molecular chaperone GroEL	NA	A0A2I7SAK5	Vibrio_phage	63.5	5.1e-177
AUJ00459.1|579066_581343_-	type III secretion system effector protein	NA	NA	NA	NA	NA
AUJ00460.1|582450_583419_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	7.3e-99
AUJ00461.1|585804_586773_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	2.5e-99
AUJ00462.1|587704_588778_+	3-deoxy-7-phosphoheptulonate synthase	NA	S4W5F1	Pandoravirus	47.9	4.3e-84
AUJ00463.1|589264_591472_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ00464.1|591565_593983_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ00465.1|594246_595167_-	gluconolactonase	NA	NA	NA	NA	NA
AUJ00466.1|595166_595685_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ00467.1|595846_598672_+	bifunctional glutamine synthetase adenylyltransferase/deadenyltransferase	NA	NA	NA	NA	NA
AUJ00468.1|598767_599328_-	hypothetical protein	NA	A0A2I7SAW6	Vibrio_phage	30.2	1.4e-12
AUJ00469.1|601034_602411_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.3	2.1e-62
AUJ00470.1|603395_603998_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ00471.1|606503_607004_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ00472.1|607904_608852_-	nucleoside-diphosphate sugar epimerase	NA	NA	NA	NA	NA
AUJ00473.1|608988_609579_+	nitroreductase family protein	NA	NA	NA	NA	NA
AUJ00474.1|609789_610533_+	polyisoprenoid-binding protein	NA	NA	NA	NA	NA
AUJ00475.1|612848_615536_+	pyruvate dehydrogenase (acetyl-transferring), homodimeric type	NA	NA	NA	NA	NA
AUJ00476.1|615622_616360_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ00477.1|616370_617747_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.3	7.1e-63
AUJ00478.1|618805_620182_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.3	7.1e-63
>prophage 5
CP019088	Xanthomonas oryzae pv. oryzae strain MAI99 chromosome, complete genome	4698819	628110	710937	4698819	tRNA,transposase,protease	Acidithiobacillus_phage(14.29%)	54	NA	NA
AUJ00483.1|628110_629073_-|transposase	DDE transposase	transposase	NA	NA	NA	NA
AUJ00484.1|629360_630737_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.0	6.0e-62
AUJ00485.1|631742_635567_+	avirulence protein	NA	NA	NA	NA	NA
AUJ03335.1|635659_636052_+|transposase	transposase	transposase	NA	NA	NA	NA
AUJ00486.1|635945_636470_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	42.9	8.7e-22
AUJ00487.1|636636_638220_-	oxidoreductase	NA	M1NLX1	Moumouvirus	27.5	6.5e-36
AUJ00488.1|638610_638802_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ03336.1|641302_643615_-	S9 family peptidase	NA	NA	NA	NA	NA
AUJ00489.1|645530_646622_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ03337.1|647586_648495_-	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AUJ00490.1|648662_649538_+	EamA family transporter	NA	NA	NA	NA	NA
AUJ00491.1|649815_651588_-	cellulase	NA	NA	NA	NA	NA
AUJ00492.1|651985_653686_-	1,4-beta-cellobiosidase	NA	NA	NA	NA	NA
AUJ00493.1|654840_656217_+	D-serine/D-alanine/glycine transporter	NA	NA	NA	NA	NA
AUJ00494.1|656303_657299_-	type III secretion system effector protein	NA	NA	NA	NA	NA
AUJ00495.1|657544_658456_+	magnesium transporter	NA	NA	NA	NA	NA
AUJ00496.1|658990_659275_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ00497.1|659604_660051_+	autotransporter	NA	NA	NA	NA	NA
AUJ00498.1|660362_660626_+|transposase	transposase	transposase	NA	NA	NA	NA
AUJ00499.1|660478_661465_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	41.9	4.5e-43
AUJ00500.1|662173_663550_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.0	6.0e-62
AUJ03338.1|663587_664247_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	62.0	6.6e-67
AUJ00501.1|664722_666414_-	alpha,alpha-trehalase	NA	NA	NA	NA	NA
AUJ00502.1|666666_667452_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ00503.1|668695_669700_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ03339.1|669738_670680_-	histidine kinase	NA	NA	NA	NA	NA
AUJ00504.1|671203_674092_-	peptidase M16	NA	NA	NA	NA	NA
AUJ00505.1|674344_676927_+	sensor domain-containing diguanylate cyclase	NA	G3MA91	Bacillus_virus	29.2	3.2e-08
AUJ00506.1|677504_677981_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AUJ00507.1|680906_682361_-	endoglucanase	NA	H2DE45	Erwinia_phage	32.6	5.2e-48
AUJ00508.1|682568_684056_+	sodium-independent anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	57.1	2.4e-125
AUJ03340.1|684335_685289_+	hypothetical protein	NA	A0A127AWB9	Bacillus_phage	38.0	1.7e-15
AUJ00509.1|685457_687107_+	peptidase M20	NA	NA	NA	NA	NA
AUJ00510.1|688098_690036_+	glucan biosynthesis glucosyltransferase H	NA	NA	NA	NA	NA
AUJ00511.1|690187_690856_+	carboxylesterase	NA	NA	NA	NA	NA
AUJ00512.1|690860_691913_+	histidine kinase	NA	Q9EYF3	Enterobacteria_phage	33.6	1.4e-18
AUJ00513.1|691943_692681_+	DNA-binding response regulator	NA	NA	NA	NA	NA
AUJ00514.1|692711_693626_+	hydroxymethylbilane synthase	NA	NA	NA	NA	NA
AUJ00515.1|694188_694989_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ00516.1|695550_696516_+	transcriptional regulator	NA	NA	NA	NA	NA
AUJ00517.1|696624_697194_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ00518.1|697578_697890_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ00519.1|697957_700051_+	S9 family peptidase	NA	NA	NA	NA	NA
AUJ00520.1|700645_701830_-	aminotransferase	NA	NA	NA	NA	NA
AUJ00521.1|701855_702038_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ03341.1|701975_704075_+	oligopeptidase B	NA	F2Y2Z7	Organic_Lake_phycodnavirus	26.1	1.7e-28
AUJ03342.1|704418_704817_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ00522.1|704874_705117_+	sugar transporter	NA	NA	NA	NA	NA
AUJ00523.1|705106_705961_+	diaminopimelate epimerase	NA	NA	NA	NA	NA
AUJ00524.1|705948_706629_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ03343.1|706786_707740_+	tyrosine recombinase XerC	NA	A0A142F2H8	Mycobacterium_phage	28.1	1.8e-12
AUJ00525.1|708255_708807_+	HslU--HslV peptidase proteolytic subunit	NA	NA	NA	NA	NA
AUJ00526.1|708911_710279_+|protease	ATP-dependent protease ATP-binding subunit HslU	protease	A0A2H5BJT2	Erwinia_phage	29.5	4.7e-43
AUJ00527.1|710481_710937_-|tRNA	tRNA-specific adenosine deaminase	tRNA	NA	NA	NA	NA
>prophage 6
CP019088	Xanthomonas oryzae pv. oryzae strain MAI99 chromosome, complete genome	4698819	728115	803895	4698819	tRNA,transposase,protease,tail	Tupanvirus(11.76%)	54	NA	NA
AUJ00542.1|728115_729147_+|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	43.5	7.9e-75
AUJ00543.1|730448_731840_+	endopolygalacturonase	NA	NA	NA	NA	NA
AUJ00544.1|732108_733248_+	lytic murein transglycosylase B	NA	NA	NA	NA	NA
AUJ00545.1|733244_734660_+	hypothetical protein	NA	F5B3X9	Synechococcus_phage	50.6	4.3e-15
AUJ00546.1|735161_736367_+	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	40.9	1.6e-66
AUJ00547.1|736666_737320_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ00548.1|737446_737725_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ00549.1|737712_738411_+	octanoyltransferase	NA	NA	NA	NA	NA
AUJ00550.1|738425_739439_+	lipoyl synthase	NA	NA	NA	NA	NA
AUJ00551.1|739837_742021_+|tail,protease	tail-specific protease	tail,protease	A0A0R6PIZ1	Moraxella_phage	31.4	3.7e-82
AUJ00552.1|742312_743179_-	endonuclease	NA	NA	NA	NA	NA
AUJ00553.1|743340_744396_+	ADP-ribose pyrophosphatase	NA	A0A1B0V161	Roseobacter_phage	47.1	3.7e-80
AUJ00554.1|744518_745922_+	nicotinate phosphoribosyltransferase	NA	A0A218M332	Acidovorax_phage	52.6	6.6e-133
AUJ03344.1|748105_748903_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ00555.1|749027_749408_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ00556.1|749579_750917_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ00557.1|750937_751879_+	6-phosphogluconate dehydrogenase (decarboxylating)	NA	M4SJX8	Cyanophage	44.6	8.5e-68
AUJ00558.1|752218_753277_-	oxidoreductase	NA	NA	NA	NA	NA
AUJ03345.1|753436_753799_+	BON domain-containing protein	NA	NA	NA	NA	NA
AUJ00559.1|754083_755895_+	histidine kinase	NA	A0A2K9L0Z8	Tupanvirus	27.8	3.5e-09
AUJ00560.1|755891_756332_+	response regulator	NA	NA	NA	NA	NA
AUJ00561.1|756335_757838_+	hybrid sensor histidine kinase/response regulator	NA	A0A2K9L5I4	Tupanvirus	26.9	4.9e-09
AUJ00562.1|757929_758445_+	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
AUJ00563.1|758613_759351_-	pteridine reductase	NA	NA	NA	NA	NA
AUJ03346.1|759418_760603_+	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AUJ00564.1|761698_761893_-	hypothetical protein	NA	U5P4I9	Shigella_phage	51.0	2.2e-07
AUJ00565.1|762003_762972_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.7	2.3e-100
AUJ00566.1|764000_766709_+	TonB-dependent receptor	NA	NA	NA	NA	NA
AUJ00567.1|766859_769754_+	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	25.2	2.0e-22
AUJ00568.1|769750_772147_+	alpha-N-acetylglucosaminidase	NA	NA	NA	NA	NA
AUJ00569.1|772280_773447_+	DUF5009 domain-containing protein	NA	NA	NA	NA	NA
AUJ00570.1|773661_774429_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AUJ00571.1|774473_775751_+	glucose/galactose MFS transporter	NA	NA	NA	NA	NA
AUJ00572.1|775791_776859_+	LacI family transcriptional regulator	NA	NA	NA	NA	NA
AUJ00573.1|776865_777894_+	iron dicitrate transport regulator FecR	NA	NA	NA	NA	NA
AUJ03347.1|777896_779051_+	N-acetylglucosamine-6-phosphate deacetylase	NA	NA	NA	NA	NA
AUJ00574.1|779555_780161_-	poly-beta-1,6-N-acetyl-D-glucosamine biosynthesis protein PgaD	NA	NA	NA	NA	NA
AUJ00575.1|780157_781411_-	poly-beta-1,6 N-acetyl-D-glucosamine synthase	NA	NA	NA	NA	NA
AUJ00576.1|781412_783311_-	poly-beta-1,6-N-acetyl-D-glucosamine N-deacetylase PgaB	NA	NA	NA	NA	NA
AUJ00577.1|783312_785355_-	poly-beta-1,6 N-acetyl-D-glucosamine export porin PgaA	NA	NA	NA	NA	NA
AUJ00578.1|785912_786536_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	42.0	2.8e-35
AUJ00579.1|786568_787801_-|tRNA	multifunctional CCA tRNA nucleotidyl transferase/2'3'-cyclic phosphodiesterase/2'nucleotidase/phosphatase	tRNA	K4IEX3	Salmonella_phage	41.5	2.3e-73
AUJ00580.1|788021_788990_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	7.3e-99
AUJ03348.1|791171_791528_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ00581.1|791567_792260_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ00582.1|794354_795092_-	endonuclease	NA	NA	NA	NA	NA
AUJ00583.1|795141_795957_-	thiol:disulfide interchange protein	NA	NA	NA	NA	NA
AUJ00584.1|796048_796699_-	dihydroneopterin aldolase	NA	NA	NA	NA	NA
AUJ03349.1|796792_797533_-	cytochrome C	NA	NA	NA	NA	NA
AUJ00585.1|797734_798358_+	YihA family ribosome biogenesis GTP-binding protein	NA	NA	NA	NA	NA
AUJ03350.1|798451_799147_-	nodulin 21	NA	NA	NA	NA	NA
AUJ00586.1|799362_800727_+	glutamate--cysteine ligase	NA	NA	NA	NA	NA
AUJ00587.1|800913_801843_-	two-component system sensor protein	NA	W8CYF6	Bacillus_phage	25.2	1.7e-15
AUJ00588.1|802518_803895_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.0	6.0e-62
>prophage 7
CP019088	Xanthomonas oryzae pv. oryzae strain MAI99 chromosome, complete genome	4698819	832442	902219	4698819	transposase,protease	Streptococcus_phage(25.0%)	56	NA	NA
AUJ00615.1|832442_832919_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AUJ00616.1|834868_836221_+	type III secretion system effector protein	NA	NA	NA	NA	NA
AUJ00617.1|836670_836763_+	K+-transporting ATPase subunit F	NA	NA	NA	NA	NA
AUJ00618.1|836778_838572_+	potassium-transporting ATPase subunit KdpA	NA	NA	NA	NA	NA
AUJ00619.1|838584_840633_+	potassium-transporting ATPase subunit B	NA	E4ZFI9	Streptococcus_phage	28.2	1.7e-36
AUJ00620.1|840673_841303_+	potassium-transporting ATPase C chain	NA	NA	NA	NA	NA
AUJ00621.1|841353_844014_+	two-component sensor histidine kinase	NA	B5LWN0	Feldmannia_species_virus	28.1	1.6e-10
AUJ00622.1|844003_844720_+	DNA-binding response regulator	NA	NA	NA	NA	NA
AUJ00623.1|846570_846834_+|transposase	transposase	transposase	NA	NA	NA	NA
AUJ00624.1|846686_847673_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	41.9	4.5e-43
AUJ00625.1|848227_849613_-	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
AUJ03352.1|849609_850149_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ00626.1|850178_850547_-	YraN family protein	NA	NA	NA	NA	NA
AUJ00627.1|850551_852282_-	penicillin-binding protein activator	NA	NA	NA	NA	NA
AUJ00628.1|852363_853185_+	rRNA (cytidine-2'-O-)-methyltransferase	NA	M1PLC5	Streptococcus_phage	38.3	9.5e-39
AUJ03353.1|854600_854825_-	plasmid maintenance protein CcdB	NA	NA	NA	NA	NA
AUJ00629.1|854900_855668_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ00630.1|855982_856438_+	cell division/cell wall cluster transcriptional repressor MraZ	NA	NA	NA	NA	NA
AUJ03354.1|856482_857496_+	16S rRNA (cytosine(1402)-N(4))-methyltransferase	NA	NA	NA	NA	NA
AUJ00631.1|857492_857756_+	cell division protein FtsL	NA	NA	NA	NA	NA
AUJ00632.1|857889_859767_+	cell division protein	NA	NA	NA	NA	NA
AUJ00633.1|859763_861251_+	UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2, 6-diaminopimelate ligase	NA	NA	NA	NA	NA
AUJ00634.1|861247_862759_+	UDP-N-acetylmuramoylalanyl-D-glutamyl-2, 6-diaminopimelate--D-alanyl-D-alanine ligase	NA	NA	NA	NA	NA
AUJ00635.1|862748_863834_+	phospho-N-acetylmuramoyl-pentapeptide- transferase	NA	NA	NA	NA	NA
AUJ00636.1|863833_865207_+	cell division protein FtsW	NA	NA	NA	NA	NA
AUJ00637.1|865203_866529_+	UDP-N-acetylglucosamine--N-acetylmuramyl- (pentapeptide) pyrophosphoryl-undecaprenol N-acetylglucosamine transferase	NA	NA	NA	NA	NA
AUJ00638.1|866525_867959_+	UDP-N-acetylmuramate--L-alanine ligase	NA	NA	NA	NA	NA
AUJ00639.1|867955_868912_+	D-alanine--D-alanine ligase	NA	NA	NA	NA	NA
AUJ00640.1|869036_869858_+	cell division protein FtsQ	NA	NA	NA	NA	NA
AUJ00641.1|869854_871090_+	cell division protein FtsA	NA	NA	NA	NA	NA
AUJ00642.1|871398_872643_+	cell division protein FtsZ	NA	NA	NA	NA	NA
AUJ00643.1|872870_873782_+	UDP-3-O-[3-hydroxymyristoyl] N-acetylglucosamine deacetylase	NA	NA	NA	NA	NA
AUJ00644.1|873968_874421_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ00645.1|874421_875363_+	peptidase M23	NA	A0A292GJG6	Xanthomonas_phage	46.4	2.0e-29
AUJ00646.1|875519_878258_+	preprotein translocase subunit SecA	NA	NA	NA	NA	NA
AUJ00647.1|878723_879092_+	glyoxalase	NA	NA	NA	NA	NA
AUJ00648.1|879232_880180_+	DNA mismatch repair protein MutT	NA	NA	NA	NA	NA
AUJ00649.1|880365_880995_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ00650.1|881362_882190_-	methylenetetrahydrofolate reductase [NAD(P)H]	NA	NA	NA	NA	NA
AUJ00651.1|882229_883609_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ00652.1|884104_885082_+	NAD(P)H-quinone oxidoreductase	NA	NA	NA	NA	NA
AUJ03355.1|885318_887076_+|protease	protease	protease	NA	NA	NA	NA
AUJ00653.1|887155_887338_-	glyoxalase	NA	NA	NA	NA	NA
AUJ00654.1|887938_888874_+	D-galactose 1-dehydrogenase	NA	NA	NA	NA	NA
AUJ00655.1|889413_889836_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ00656.1|890022_890568_+	nucleoprotein/polynucleotide-associated enzyme	NA	NA	NA	NA	NA
AUJ00657.1|890797_891355_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ00658.1|891505_892192_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ00659.1|892684_893617_+	sulfotransferase	NA	A0A1X9T5H0	Ranid_herpesvirus	36.4	1.2e-05
AUJ03356.1|893648_894431_+	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AUJ00660.1|894660_896103_-	adenosylhomocysteinase	NA	S4W1G4	Pandoravirus	30.9	1.1e-47
AUJ00661.1|896415_896961_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ00662.1|897154_899869_+	phosphoenolpyruvate carboxylase	NA	NA	NA	NA	NA
AUJ00663.1|899928_900564_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
AUJ00664.1|901116_902103_-|transposase	transposase	transposase	S5WIU1	Leptospira_phage	41.9	4.5e-43
AUJ00665.1|901955_902219_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 8
CP019088	Xanthomonas oryzae pv. oryzae strain MAI99 chromosome, complete genome	4698819	1073223	1134237	4698819	transposase,protease	Leptospira_phage(18.18%)	47	NA	NA
AUJ00808.1|1073223_1074282_-|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	43.2	1.8e-74
AUJ00809.1|1075315_1076284_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	59.7	2.8e-98
AUJ00810.1|1078186_1079560_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ00811.1|1079658_1081698_-	NADPH-dependent 2,4-dienoyl-CoA reductase	NA	NA	NA	NA	NA
AUJ00812.1|1081905_1082928_-	NADPH:quinone reductase	NA	NA	NA	NA	NA
AUJ03372.1|1082901_1083096_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ00813.1|1083343_1084441_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ00814.1|1084633_1085143_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ00815.1|1085162_1086023_+	pseudouridylate synthase	NA	NA	NA	NA	NA
AUJ00816.1|1085973_1086366_-	HNH endonuclease	NA	NA	NA	NA	NA
AUJ00817.1|1086368_1087577_-	glycine C-acetyltransferase	NA	V5LQ39	Emiliania_huxleyi_virus	26.5	2.9e-20
AUJ03373.1|1087748_1088765_+	sulfate transporter subunit	NA	NA	NA	NA	NA
AUJ00818.1|1088768_1089629_+	sulfate ABC transporter permease subunit CysT	NA	NA	NA	NA	NA
AUJ00819.1|1089625_1090579_+	sulfate ABC transporter permease subunit CysW	NA	NA	NA	NA	NA
AUJ03374.1|1090586_1091621_+	sulfate ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	32.7	2.0e-25
AUJ00820.1|1091980_1092694_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ03375.1|1092763_1093786_-	L-threonine 3-dehydrogenase	NA	NA	NA	NA	NA
AUJ00821.1|1094301_1096635_-	TonB-dependent receptor	NA	NA	NA	NA	NA
AUJ03376.1|1099049_1101200_+	dipeptidyl-peptidase 7	NA	NA	NA	NA	NA
AUJ00822.1|1101292_1101937_+	histidine phosphatase family protein	NA	NA	NA	NA	NA
AUJ00823.1|1102118_1102469_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ00824.1|1102907_1104206_+	bifunctional tetrahydrofolate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
AUJ00825.1|1104273_1105356_+	SPOR domain-containing protein	NA	NA	NA	NA	NA
AUJ00826.1|1105570_1106311_+	colicin V synthesis protein	NA	NA	NA	NA	NA
AUJ00827.1|1106347_1107814_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	40.1	8.3e-86
AUJ00828.1|1107952_1108777_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ00829.1|1109496_1109973_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AUJ00830.1|1110757_1111177_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ00831.1|1111356_1112100_-	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
AUJ00832.1|1112252_1112603_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ00833.1|1112734_1113277_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
AUJ00834.1|1113257_1114394_-	glycosyl transferase	NA	NA	NA	NA	NA
AUJ00835.1|1114598_1116125_-	exopolyphosphatase	NA	NA	NA	NA	NA
AUJ00836.1|1116296_1118399_-	RNA degradosome polyphosphate kinase	NA	NA	NA	NA	NA
AUJ00837.1|1118502_1119846_-	phosphate regulon sensor histidine kinase PhoR	NA	W8CYF6	Bacillus_phage	33.8	5.0e-29
AUJ00838.1|1119903_1120593_-	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	35.7	5.9e-34
AUJ03377.1|1120767_1122414_-	peptidase	NA	NA	NA	NA	NA
AUJ00839.1|1122563_1122872_+	glutaredoxin 3	NA	A0A2L0UZG6	Agrobacterium_phage	43.2	4.7e-07
AUJ00840.1|1122868_1123264_+	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
AUJ00841.1|1123478_1124486_+	isocitrate dehydrogenase	NA	NA	NA	NA	NA
AUJ00842.1|1124626_1125388_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ00843.1|1126594_1127653_+|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	42.9	2.6e-73
AUJ00844.1|1127809_1127992_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ00845.1|1128969_1129938_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	9.6e-99
AUJ00846.1|1131213_1131687_-	histidine kinase	NA	NA	NA	NA	NA
AUJ00847.1|1132225_1133518_+	trigger factor	NA	NA	NA	NA	NA
AUJ00848.1|1133610_1134237_+|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	57.4	1.0e-56
>prophage 9
CP019088	Xanthomonas oryzae pv. oryzae strain MAI99 chromosome, complete genome	4698819	1243142	1320048	4698819	transposase,protease	Bacillus_phage(15.38%)	56	NA	NA
AUJ00926.1|1243142_1244540_-|protease	serine protease	protease	NA	NA	NA	NA
AUJ00927.1|1244967_1246938_+	oligopeptide transporter, OPT family	NA	NA	NA	NA	NA
AUJ00928.1|1246852_1247527_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ00929.1|1247782_1248628_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ03389.1|1248916_1251037_+	peptidase S9	NA	NA	NA	NA	NA
AUJ00930.1|1251313_1251775_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ00931.1|1251906_1252632_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AUJ00932.1|1253449_1255591_+	outer protein P	NA	NA	NA	NA	NA
AUJ00933.1|1255707_1257843_+	outer protein P	NA	NA	NA	NA	NA
AUJ00934.1|1258807_1259002_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ03390.1|1259913_1261152_-	type III secretion system effector protein	NA	NA	NA	NA	NA
AUJ00935.1|1261977_1264083_-	catalase HPII	NA	A0A2K9L0T1	Tupanvirus	47.7	1.9e-136
AUJ00936.1|1264300_1264474_-	oxidoreductase	NA	NA	NA	NA	NA
AUJ00937.1|1265732_1266380_-	VRR-NUC domain-containing protein	NA	Q8W6S1	Burkholderia_virus	45.5	6.5e-35
AUJ00938.1|1266376_1266928_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ00939.1|1267051_1267234_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ03391.1|1267293_1270227_-	glycine dehydrogenase (aminomethyl-transferring)	NA	M4QFZ1	Prochlorococcus_phage	49.9	8.9e-257
AUJ00940.1|1270694_1270886_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ03392.1|1271316_1272120_+	sulfotransferase	NA	M4QPS9	Synechococcus_phage	27.7	9.0e-26
AUJ03393.1|1272208_1273420_+	hemolysin D	NA	NA	NA	NA	NA
AUJ00941.1|1273416_1275576_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	28.0	2.2e-34
AUJ00942.1|1276384_1276789_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ00943.1|1276870_1278889_-	peptidase M20	NA	NA	NA	NA	NA
AUJ00944.1|1279000_1280671_-	phosphoethanolamine transferase	NA	NA	NA	NA	NA
AUJ03394.1|1280667_1281432_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ03395.1|1281531_1283202_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ00945.1|1283484_1284201_+	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	34.4	2.8e-23
AUJ00946.1|1284193_1285486_+	two-component sensor histidine kinase	NA	NA	NA	NA	NA
AUJ00947.1|1285637_1286129_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ00948.1|1286197_1286455_-	cell division topological specificity factor MinE	NA	NA	NA	NA	NA
AUJ00949.1|1286457_1287267_-	septum site-determining protein MinD	NA	NA	NA	NA	NA
AUJ00950.1|1287302_1288043_-	septum site-determining protein MinC	NA	NA	NA	NA	NA
AUJ00951.1|1288047_1288647_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AUJ00952.1|1288891_1290088_+	two-component sensor histidine kinase	NA	NA	NA	NA	NA
AUJ00953.1|1290087_1290729_+	DNA-binding response regulator	NA	NA	NA	NA	NA
AUJ00954.1|1291079_1292276_+	polyketide cyclase	NA	NA	NA	NA	NA
AUJ00955.1|1292357_1292744_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ00956.1|1292746_1293421_+	DNA-3-methyladenine glycosylase	NA	NA	NA	NA	NA
AUJ03396.1|1293484_1294111_-	peptidase	NA	NA	NA	NA	NA
AUJ00957.1|1294412_1294592_-	Arc family DNA binding domain-containing protein	NA	NA	NA	NA	NA
AUJ00958.1|1294588_1294873_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ00959.1|1295488_1296691_+	phosphoribosylglycinamide formyltransferase 2	NA	NA	NA	NA	NA
AUJ00960.1|1297667_1298399_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ00961.1|1298598_1299477_+	hypothetical protein	NA	A8ATW4	Listeria_phage	34.5	3.9e-06
AUJ00962.1|1299584_1299845_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ00963.1|1299904_1301386_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ00964.1|1301401_1305139_+	type VI secretion protein VasK	NA	NA	NA	NA	NA
AUJ00965.1|1305135_1306119_+	type VI secretion-associated protein	NA	NA	NA	NA	NA
AUJ00966.1|1306115_1306910_+	cell envelope biogenesis protein OmpA	NA	NA	NA	NA	NA
AUJ00967.1|1306962_1308033_-	type VI secretion protein	NA	NA	NA	NA	NA
AUJ00968.1|1308936_1309995_+|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	43.2	1.8e-74
AUJ00969.1|1310066_1312889_+	type IV secretion protein Rhs	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	28.4	1.0e-52
AUJ03397.1|1313394_1314411_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	37.3	7.3e-49
AUJ00970.1|1315518_1316895_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	54.8	3.0e-77
AUJ00971.1|1317038_1318415_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	46.6	5.1e-61
AUJ00972.1|1319079_1320048_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	7.3e-99
>prophage 10
CP019088	Xanthomonas oryzae pv. oryzae strain MAI99 chromosome, complete genome	4698819	1342459	1395096	4698819	transposase	Ralstonia_phage(30.0%)	42	NA	NA
AUJ00987.1|1342459_1343446_-|transposase	transposase	transposase	S5WIU1	Leptospira_phage	41.4	2.6e-43
AUJ00988.1|1343298_1343562_-|transposase	transposase	transposase	NA	NA	NA	NA
AUJ00989.1|1346069_1347134_-	uroporphyrinogen decarboxylase	NA	NA	NA	NA	NA
AUJ00990.1|1347148_1347400_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ03400.1|1347699_1348812_-	3-dehydroquinate synthase	NA	NA	NA	NA	NA
AUJ00991.1|1348808_1349351_-	shikimate kinase	NA	NA	NA	NA	NA
AUJ00992.1|1349517_1350117_+	pyridoxamine 5'-phosphate oxidase	NA	NA	NA	NA	NA
AUJ00993.1|1350297_1350714_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ00994.1|1350726_1351500_+	PspA-IM30 family protein	NA	NA	NA	NA	NA
AUJ00995.1|1351525_1352608_+	potassium channel protein	NA	NA	NA	NA	NA
AUJ00996.1|1352610_1353282_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ00997.1|1353319_1353724_+	DUF350 domain-containing protein	NA	NA	NA	NA	NA
AUJ00998.1|1353736_1354309_+	hypothetical protein	NA	A0A191ZBZ0	Erwinia_phage	28.1	6.4e-10
AUJ00999.1|1354310_1355477_+	hypothetical protein	NA	B2ZXR7	Ralstonia_phage	41.6	6.4e-73
AUJ03401.1|1358422_1360105_+	peptidase M1	NA	NA	NA	NA	NA
AUJ01000.1|1361154_1364301_+	TonB-dependent receptor	NA	NA	NA	NA	NA
AUJ01001.1|1364320_1364557_-	transcriptional regulator	NA	NA	NA	NA	NA
AUJ01002.1|1364632_1365385_+	peptide ABC transporter permease	NA	NA	NA	NA	NA
AUJ01003.1|1365395_1366442_+	cupin	NA	NA	NA	NA	NA
AUJ01004.1|1366482_1368000_+	tryptophan halogenase	NA	A0A1D7SF58	Cyanophage	31.8	5.8e-50
AUJ01005.1|1368037_1369042_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
AUJ03402.1|1369186_1369585_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ01006.1|1369716_1371093_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	54.8	6.0e-78
AUJ01007.1|1371235_1371421_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ03403.1|1371680_1372634_-	endoproteinase ArgC	NA	NA	NA	NA	NA
AUJ01008.1|1373519_1374902_-	porin	NA	NA	NA	NA	NA
AUJ01009.1|1375094_1375859_+	LuxR family transcriptional regulator	NA	NA	NA	NA	NA
AUJ01010.1|1376172_1377114_+	amino acid amidase	NA	NA	NA	NA	NA
AUJ01011.1|1377869_1379258_+	amino acid transporter	NA	NA	NA	NA	NA
AUJ03404.1|1381207_1382626_-|transposase	ISL3 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	41.0	8.8e-93
AUJ01012.1|1382618_1383521_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ01013.1|1383520_1384762_-	DNA (cytosine-5-)-methyltransferase	NA	M1PSQ0	Streptococcus_phage	34.7	3.2e-54
AUJ01014.1|1384994_1385963_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	59.7	1.6e-98
AUJ01015.1|1387083_1388100_+	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
AUJ03405.1|1388160_1388955_-	phospholipase	NA	NA	NA	NA	NA
AUJ01016.1|1389114_1390476_-	magnesium transporter	NA	NA	NA	NA	NA
AUJ01017.1|1390538_1390763_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ01018.1|1390763_1392494_-	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	24.1	1.0e-10
AUJ01019.1|1392552_1392822_-	phosphocarrier protein HPr	NA	NA	NA	NA	NA
AUJ01020.1|1392814_1393207_-	PTS fructose IIA subunit family protein	NA	NA	NA	NA	NA
AUJ01021.1|1393600_1394569_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	59.7	5.6e-99
AUJ01022.1|1394694_1395096_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
>prophage 11
CP019088	Xanthomonas oryzae pv. oryzae strain MAI99 chromosome, complete genome	4698819	1419965	1482891	4698819	transposase	Ralstonia_phage(27.27%)	57	NA	NA
AUJ01052.1|1419965_1421024_+|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	43.5	6.2e-75
AUJ01053.1|1421090_1422059_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	2.5e-99
AUJ01054.1|1422362_1422692_-	benzene 1,2-dioxygenase	NA	NA	NA	NA	NA
AUJ01055.1|1422688_1423228_-	N-acetyltransferase	NA	NA	NA	NA	NA
AUJ01056.1|1423437_1424406_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.7	3.0e-100
AUJ01057.1|1424519_1425764_-	cysteine sulfinate desulfinase	NA	Q2XUY6	environmental_halophage	41.7	5.0e-92
AUJ01058.1|1425760_1427023_-	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
AUJ01059.1|1427022_1427787_-	ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	28.5	2.0e-11
AUJ01060.1|1428044_1429502_-	Fe-S cluster assembly protein SufB	NA	NA	NA	NA	NA
AUJ01061.1|1429517_1429976_-	transcriptional regulator	NA	NA	NA	NA	NA
AUJ01062.1|1430147_1430615_+	SET domain-containing protein-lysine N-methyltransferase	NA	NA	NA	NA	NA
AUJ01063.1|1430719_1430938_+	peptidase	NA	NA	NA	NA	NA
AUJ01064.1|1431544_1432141_-	DUF1439 domain-containing protein	NA	NA	NA	NA	NA
AUJ01065.1|1432196_1432739_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ01066.1|1432796_1433138_-	DUF3861 domain-containing protein	NA	NA	NA	NA	NA
AUJ03407.1|1433195_1433810_-	peptidase	NA	NA	NA	NA	NA
AUJ01067.1|1433941_1434367_-	DNA-binding protein	NA	NA	NA	NA	NA
AUJ01068.1|1434922_1435921_-	pyrroline-5-carboxylate reductase	NA	NA	NA	NA	NA
AUJ01069.1|1435826_1436519_-	YggS family pyridoxal phosphate enzyme	NA	NA	NA	NA	NA
AUJ01070.1|1437700_1438738_+	twitching motility protein PilT	NA	NA	NA	NA	NA
AUJ01071.1|1438851_1439982_+	type IV pili twitching motility protein PilT	NA	NA	NA	NA	NA
AUJ03408.1|1440271_1440928_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ01072.1|1442030_1442603_-	DNA-3-methyladenine glycosylase	NA	NA	NA	NA	NA
AUJ01073.1|1442599_1443034_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ01074.1|1443879_1444446_+	DUF179 domain-containing protein	NA	NA	NA	NA	NA
AUJ01075.1|1444438_1444906_+	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
AUJ01076.1|1444919_1445867_+	aspartate carbamoyltransferase	NA	NA	NA	NA	NA
AUJ01077.1|1446303_1446738_+	OsmC family peroxiredoxin	NA	NA	NA	NA	NA
AUJ01078.1|1446920_1447490_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ01079.1|1447787_1448669_-	phenazine biosynthesis protein PhzF family	NA	NA	NA	NA	NA
AUJ01080.1|1449761_1452371_+	diaminopimelate decarboxylase	NA	NA	NA	NA	NA
AUJ01081.1|1452354_1452813_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ01082.1|1452809_1454165_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ01083.1|1454145_1455552_+	UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase	NA	NA	NA	NA	NA
AUJ01084.1|1455598_1455772_+	AsmA family protein	NA	NA	NA	NA	NA
AUJ03409.1|1455907_1456690_+	dienelactone hydrolase	NA	NA	NA	NA	NA
AUJ01085.1|1456784_1457753_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	1.5e-99
AUJ01086.1|1458007_1459006_-	octaprenyl-diphosphate synthase	NA	NA	NA	NA	NA
AUJ01087.1|1459281_1459815_+	single-stranded DNA-binding protein	NA	L7TJL2	Pseudomonas_virus	60.9	1.9e-32
AUJ01088.1|1459834_1460047_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ01089.1|1460097_1461582_-	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	37.5	5.0e-14
AUJ01090.1|1465094_1465772_+	HAD family hydrolase	NA	NA	NA	NA	NA
AUJ01091.1|1466007_1466214_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ01092.1|1466308_1466533_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ01093.1|1466532_1468605_-	carbon starvation protein A	NA	NA	NA	NA	NA
AUJ03410.1|1468888_1469695_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ01094.1|1469865_1470153_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ01095.1|1470556_1473373_+	type IV secretion protein Rhs	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	28.6	4.7e-53
AUJ01096.1|1473372_1474269_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ01097.1|1474265_1474730_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ01098.1|1474750_1475233_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ03411.1|1475382_1475862_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ01099.1|1475948_1477685_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ01100.1|1478155_1478350_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ01101.1|1478465_1479842_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	48.1	9.9e-65
AUJ01102.1|1480492_1481089_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ01103.1|1481514_1482891_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	54.8	1.0e-77
>prophage 12
CP019088	Xanthomonas oryzae pv. oryzae strain MAI99 chromosome, complete genome	4698819	1490517	1527301	4698819	tRNA,transposase	Shigella_phage(42.86%)	30	NA	NA
AUJ03414.1|1490517_1491372_+|transposase	transposase	transposase	U5P429	Shigella_phage	57.7	4.8e-86
AUJ03415.1|1491503_1492625_-	chemotaxis response regulator protein-glutamate methylesterase	NA	NA	NA	NA	NA
AUJ01107.1|1492639_1493467_-	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AUJ01108.1|1493450_1494734_-	diguanylate phosphodiesterase	NA	NA	NA	NA	NA
AUJ01109.1|1494760_1495276_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ03416.1|1495286_1497299_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	61.5	1.3e-09
AUJ03417.1|1497354_1497537_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ01110.1|1497511_1499515_-	chemotaxis protein CheA	NA	NA	NA	NA	NA
AUJ01111.1|1499533_1499863_-	anti-anti-sigma factor	NA	NA	NA	NA	NA
AUJ01112.1|1500352_1503817_-	transcription-repair coupling factor	NA	NA	NA	NA	NA
AUJ01113.1|1503930_1504122_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ01114.1|1504210_1504753_-	N-acetyltransferase	NA	NA	NA	NA	NA
AUJ03418.1|1505177_1506086_-	23S rRNA (adenine(2030)-N(6))-methyltransferase RlmJ	NA	NA	NA	NA	NA
AUJ01115.1|1507616_1508429_-	peptidase C1	NA	NA	NA	NA	NA
AUJ01116.1|1509374_1509986_+	N-acetyltransferase	NA	NA	NA	NA	NA
AUJ01117.1|1510104_1510989_+	nitrilase	NA	NA	NA	NA	NA
AUJ01118.1|1511010_1512102_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ01119.1|1512170_1513574_+|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
AUJ01120.1|1513587_1514094_+	Fur family transcriptional regulator	NA	NA	NA	NA	NA
AUJ01121.1|1514496_1514955_+	cupin	NA	NA	NA	NA	NA
AUJ01122.1|1515732_1515936_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ03419.1|1516099_1516372_+|transposase	transposase	transposase	U5P4I9	Shigella_phage	58.8	1.2e-19
AUJ01123.1|1516389_1517244_+|transposase	transposase	transposase	U5P429	Shigella_phage	56.9	9.1e-85
AUJ01124.1|1517352_1518369_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	37.6	2.5e-49
AUJ01125.1|1518654_1520031_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	53.7	8.9e-74
AUJ03420.1|1520058_1520949_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ01126.1|1521635_1522232_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ03421.1|1524771_1525044_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ01127.1|1525715_1526246_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ01128.1|1526242_1527301_-|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	43.2	8.9e-74
>prophage 13
CP019088	Xanthomonas oryzae pv. oryzae strain MAI99 chromosome, complete genome	4698819	1569964	1633650	4698819	tRNA,transposase,protease	Ralstonia_phage(30.0%)	52	NA	NA
AUJ01155.1|1569964_1570933_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	7.3e-99
AUJ01156.1|1571256_1571550_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ03427.1|1571628_1572042_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ03428.1|1572733_1573642_-	peptidylprolyl isomerase	NA	NA	NA	NA	NA
AUJ01157.1|1573770_1574004_-	DUF378 domain-containing protein	NA	NA	NA	NA	NA
AUJ01158.1|1574477_1574771_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ01159.1|1575663_1576113_-	tetrameric acyl-CoA thioesterase	NA	NA	NA	NA	NA
AUJ01160.1|1576378_1577236_-	co-chaperone YbbN	NA	A0A1J0GW78	Streptomyces_phage	41.8	1.0e-11
AUJ01161.1|1577440_1578052_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ01162.1|1578163_1580806_+|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	40.0	4.7e-172
AUJ01163.1|1581319_1581955_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ01164.1|1581977_1583006_+	DNA polymerase III subunit delta	NA	NA	NA	NA	NA
AUJ01165.1|1583002_1583902_+	nicotinic acid mononucleotide adenylyltransferase	NA	NA	NA	NA	NA
AUJ01166.1|1583958_1584375_+	ribosome silencing factor RsfS	NA	NA	NA	NA	NA
AUJ01167.1|1584386_1585502_+	molecular chaperone DnaJ	NA	NA	NA	NA	NA
AUJ01168.1|1585827_1586037_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ01169.1|1586591_1587062_+	23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH	NA	NA	NA	NA	NA
AUJ01170.1|1587499_1588174_-	energy transducer TonB	NA	NA	NA	NA	NA
AUJ01171.1|1588484_1591595_-	Oar protein	NA	NA	NA	NA	NA
AUJ01172.1|1592061_1592796_-	SIMPL domain-containing protein	NA	NA	NA	NA	NA
AUJ01173.1|1592934_1593507_+	septum formation inhibitor Maf	NA	NA	NA	NA	NA
AUJ01174.1|1593506_1595006_+	ribonuclease E/G	NA	NA	NA	NA	NA
AUJ01175.1|1595146_1599067_+	DUF3971 domain-containing protein	NA	NA	NA	NA	NA
AUJ03429.1|1599072_1599825_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ01176.1|1599923_1601369_+|protease	metalloprotease TldD	protease	NA	NA	NA	NA
AUJ01177.1|1601625_1602207_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ03430.1|1602352_1603720_+|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
AUJ03431.1|1603794_1604199_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ03432.1|1604325_1604712_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ01178.1|1604781_1605879_-|protease	protease	protease	NA	NA	NA	NA
AUJ01179.1|1606607_1607084_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AUJ01180.1|1607195_1608071_-	(2E,6E)-farnesyl diphosphate synthase	NA	NA	NA	NA	NA
AUJ01181.1|1608072_1608333_-	exodeoxyribonuclease VII small subunit	NA	NA	NA	NA	NA
AUJ01182.1|1608364_1609669_-|tRNA	tRNA(Ile)-lysidine synthase	tRNA	NA	NA	NA	NA
AUJ01183.1|1609702_1611409_-	alkaline phosphatase	NA	NA	NA	NA	NA
AUJ01184.1|1611551_1612892_+	dicarboxylate/amino acid:cation symporter	NA	NA	NA	NA	NA
AUJ03433.1|1613063_1613738_+	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AUJ01185.1|1613984_1614476_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
AUJ01186.1|1614683_1615433_-	hypothetical protein	NA	A0A0K2SUC1	Clostridium_phage	38.5	1.2e-19
AUJ03434.1|1615542_1616115_-	glycoside hydrolase	NA	A0A1V0DZX6	Clostridioides_phage	40.5	3.4e-19
AUJ01187.1|1616189_1616669_+	peptidylprolyl isomerase	NA	NA	NA	NA	NA
AUJ01188.1|1616897_1618142_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ01189.1|1618149_1619400_+	amino acid dehydrogenase	NA	NA	NA	NA	NA
AUJ01190.1|1619396_1620767_+	glutathione-disulfide reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	25.8	2.4e-34
AUJ01191.1|1621153_1621423_+|transposase	transposase	transposase	NA	NA	NA	NA
AUJ01192.1|1622279_1622621_+	cysteine methyltransferase	NA	NA	NA	NA	NA
AUJ01193.1|1622661_1623360_+|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
AUJ01194.1|1623610_1624579_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	9.6e-99
AUJ01195.1|1625162_1626188_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	37.6	1.9e-49
AUJ01196.1|1628583_1630599_-	peptidase M13	NA	NA	NA	NA	NA
AUJ03435.1|1631268_1632285_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	37.6	9.6e-49
AUJ01197.1|1632681_1633650_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	2.5e-99
>prophage 14
CP019088	Xanthomonas oryzae pv. oryzae strain MAI99 chromosome, complete genome	4698819	1698578	1757313	4698819	tRNA,transposase,integrase	Tetraselmis_virus(12.5%)	49	1696969:1696985	1771750:1771766
1696969:1696985	attL	TGGCCGAAGGCCGCGCC	NA	NA	NA	NA
AUJ01251.1|1698578_1699505_+|tRNA	tRNA pseudouridine(55) synthase	tRNA	NA	NA	NA	NA
AUJ01252.1|1699661_1699922_+	30S ribosomal protein S15	NA	NA	NA	NA	NA
AUJ01253.1|1700088_1702203_+	polyribonucleotide nucleotidyltransferase	NA	NA	NA	NA	NA
AUJ01254.1|1702576_1703617_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ01255.1|1703680_1704556_-	nicotinate-nucleotide diphosphorylase (carboxylating)	NA	NA	NA	NA	NA
AUJ01256.1|1704552_1704822_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ01257.1|1704880_1705384_+	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	38.7	3.6e-17
AUJ01258.1|1705380_1706526_+	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
AUJ01259.1|1706667_1707246_-	superoxide dismutase	NA	Q56AR7	Bacillus_thuringiensis_phage	39.6	8.4e-34
AUJ01260.1|1707367_1707688_+	monothiol glutaredoxin, Grx4 family	NA	NA	NA	NA	NA
AUJ01261.1|1707684_1708428_+	short-chain dehydrogenase	NA	NA	NA	NA	NA
AUJ01262.1|1708424_1709024_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ01263.1|1709793_1712988_+	Oar protein	NA	NA	NA	NA	NA
AUJ01264.1|1713094_1714480_+	LOG family protein	NA	NA	NA	NA	NA
AUJ01265.1|1714649_1715165_+	pre-pilin like leader sequence	NA	A0A1W6JT76	Pseudomonas_phage	42.5	1.1e-05
AUJ01266.1|1715161_1715638_+	type IV pilus modification protein PilV	NA	NA	NA	NA	NA
AUJ01267.1|1715634_1716801_+	pilus assembly protein PilW	NA	NA	NA	NA	NA
AUJ03442.1|1717269_1721271_+	pilus assembly protein	NA	NA	NA	NA	NA
AUJ01268.1|1721283_1721733_+	pilus assembly protein PilE	NA	NA	NA	NA	NA
AUJ01269.1|1721909_1722452_-	prepilin-type N-terminal cleavage/methylation domain-containing protein	NA	NA	NA	NA	NA
AUJ01270.1|1722590_1724612_+	excinuclease ABC subunit B	NA	NA	NA	NA	NA
AUJ01271.1|1725826_1726096_-|transposase	transposase	transposase	NA	NA	NA	NA
AUJ03443.1|1726406_1726841_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ01272.1|1727264_1728359_-	acyltransferase	NA	NA	NA	NA	NA
AUJ01273.1|1728786_1730454_-	urocanate hydratase	NA	NA	NA	NA	NA
AUJ01274.1|1730470_1731328_-	N-formylglutamate deformylase	NA	NA	NA	NA	NA
AUJ01275.1|1731512_1733054_-	histidine ammonia-lyase	NA	A0A1V0S940	Catovirus	42.8	2.7e-79
AUJ01276.1|1733067_1734273_-	imidazolonepropionase	NA	NA	NA	NA	NA
AUJ01277.1|1734348_1735704_+	formimidoylglutamate deiminase	NA	NA	NA	NA	NA
AUJ01278.1|1736057_1736762_+	histidine utilization repressor	NA	NA	NA	NA	NA
AUJ01279.1|1736918_1737923_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ01280.1|1738495_1739059_-	poly(hydroxyalcanoate) granule associated protein	NA	NA	NA	NA	NA
AUJ01281.1|1739220_1739496_-	polyhydroxyalkanoic acid synthase	NA	NA	NA	NA	NA
AUJ03444.1|1739736_1740546_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ01282.1|1740487_1741144_-	sulfoxide reductase heme-binding subunit YedZ	NA	NA	NA	NA	NA
AUJ01283.1|1741445_1742414_-	mononuclear molybdenum enzyme YedY	NA	NA	NA	NA	NA
AUJ01284.1|1742588_1743674_+	phosphoserine transaminase	NA	M1Q1P2	Streptococcus_phage	43.6	1.7e-75
AUJ01285.1|1743756_1744965_+	chorismate mutase	NA	NA	NA	NA	NA
AUJ01286.1|1745086_1746400_+	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
AUJ01287.1|1746763_1747240_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AUJ01288.1|1747428_1747698_+|transposase	transposase	transposase	NA	NA	NA	NA
AUJ01289.1|1747550_1748537_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	41.4	2.6e-43
AUJ03445.1|1748956_1749424_-	energy transducer TonB	NA	NA	NA	NA	NA
AUJ01290.1|1749854_1750823_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.7	3.0e-100
AUJ01291.1|1750944_1751712_-	energy transducer TonB	NA	NA	NA	NA	NA
AUJ01292.1|1751718_1753110_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	49.6	1.0e-93
AUJ01293.1|1753570_1754155_-	FMN-dependent NADH-azoreductase	NA	NA	NA	NA	NA
AUJ01294.1|1754254_1755271_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUJ03446.1|1755894_1757313_+|integrase	integrase	integrase	NA	NA	NA	NA
1771750:1771766	attR	TGGCCGAAGGCCGCGCC	NA	NA	NA	NA
>prophage 15
CP019088	Xanthomonas oryzae pv. oryzae strain MAI99 chromosome, complete genome	4698819	1839187	1849075	4698819	tRNA	Escherichia_phage(28.57%)	9	NA	NA
AUJ03459.1|1839187_1840864_+	2-polyprenylphenol 6-hydroxylase	NA	E5EQ95	Micromonas_sp._RCC1109_virus	27.3	2.1e-37
AUJ01357.1|1840952_1841594_+	LexA repressor 2	NA	A0A1W6JNS2	Morganella_phage	40.2	2.4e-13
AUJ01358.1|1841766_1842801_+	DNA recombination/repair protein RecA	NA	A0A0S2MVG1	Bacillus_phage	61.0	1.6e-112
AUJ01359.1|1843102_1843591_+	recombination regulator RecX	NA	NA	NA	NA	NA
AUJ01360.1|1843692_1846341_+|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	39.8	2.4e-83
AUJ01361.1|1846480_1846693_+	carbon storage regulator	NA	J7I430	Pseudomonas_phage	76.5	1.3e-13
AUJ01362.1|1847220_1847403_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ01363.1|1848414_1848669_+	hypothetical protein	NA	A0A0N7C1X7	Escherichia_phage	59.6	4.5e-08
AUJ01364.1|1848583_1849075_+	lysozyme	NA	D5LH07	Escherichia_phage	67.7	4.6e-57
>prophage 16
CP019088	Xanthomonas oryzae pv. oryzae strain MAI99 chromosome, complete genome	4698819	1974676	2059449	4698819	tRNA,transposase	uncultured_Caudovirales_phage(36.36%)	53	NA	NA
AUJ01468.1|1974676_1976194_+|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	38.5	8.6e-86
AUJ01469.1|1976335_1977472_+	two-component system response regulator	NA	NA	NA	NA	NA
AUJ01470.1|1977473_1977812_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ01471.1|1977836_1980014_+	hybrid sensor histidine kinase/response regulator	NA	A0A1V0SGX0	Hokovirus	33.1	1.3e-47
AUJ01472.1|1980025_1980895_-	enoyl-CoA hydratase	NA	NA	NA	NA	NA
AUJ01473.1|1981071_1982754_-	long-chain fatty acid--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	26.2	2.1e-32
AUJ01474.1|1983403_1986172_-	aconitate hydratase	NA	NA	NA	NA	NA
AUJ01475.1|1986319_1986568_+	AbrB family transcriptional regulator	NA	NA	NA	NA	NA
AUJ01476.1|1986564_1986975_+	VapC toxin family PIN domain ribonuclease	NA	NA	NA	NA	NA
AUJ01477.1|1987040_1989632_+	aconitate hydratase B	NA	NA	NA	NA	NA
AUJ01478.1|1989985_1990801_+	2-succinyl-6-hydroxy-2, 4-cyclohexadiene-1-carboxylate synthase	NA	NA	NA	NA	NA
AUJ01479.1|1991456_1993643_-	bifunctional diguanylate cyclase/phosphodiesterase	NA	NA	NA	NA	NA
AUJ01480.1|1993808_1994885_-	chemotaxis response regulator protein-glutamate methylesterase	NA	NA	NA	NA	NA
AUJ01481.1|1994881_1995478_-	chemoreceptor glutamine deamidase CheD	NA	NA	NA	NA	NA
AUJ01482.1|1995474_1996341_-	chemotaxis protein CheR	NA	NA	NA	NA	NA
AUJ01483.1|1996586_1998977_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	58.3	3.9e-08
AUJ01484.1|1999055_1999439_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ01485.1|1999754_2000237_-	chemotaxis protein CheW	NA	NA	NA	NA	NA
AUJ01486.1|2000372_2001170_-	pilus assembly protein PilZ	NA	NA	NA	NA	NA
AUJ01487.1|2002211_2004473_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	54.5	1.3e-10
AUJ01488.1|2004884_2007146_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	41.7	2.5e-12
AUJ03468.1|2007737_2009702_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	47.4	1.5e-10
AUJ01489.1|2010257_2011316_-|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	43.5	6.2e-75
AUJ01490.1|2014316_2016560_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	41.8	3.4e-14
AUJ01491.1|2016818_2018195_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.3	2.1e-62
AUJ01492.1|2018476_2020690_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	63.2	1.9e-09
AUJ01493.1|2020887_2023257_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	61.7	2.7e-09
AUJ01494.1|2023270_2024032_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ01495.1|2029539_2031801_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	61.4	2.8e-08
AUJ01496.1|2032699_2034709_-	chemotaxis protein CheA	NA	NA	NA	NA	NA
AUJ01497.1|2034742_2035108_-	response regulator	NA	W8CYM9	Bacillus_phage	39.3	2.7e-14
AUJ01498.1|2035104_2035413_-	anti-anti-sigma factor	NA	NA	NA	NA	NA
AUJ01499.1|2035513_2036536_-	chemotaxis protein	NA	NA	NA	NA	NA
AUJ01500.1|2036532_2037315_-	chromosome partitioning protein ParA	NA	Q8JL10	Natrialba_phage	35.7	1.7e-13
AUJ01501.1|2037316_2038291_-	flagellar motor protein MotD	NA	NA	NA	NA	NA
AUJ01502.1|2038297_2039038_-	flagellar motor protein	NA	NA	NA	NA	NA
AUJ01503.1|2039126_2039480_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ01504.1|2041766_2042474_-	superoxide dismutase	NA	Q56AR7	Bacillus_thuringiensis_phage	51.2	1.4e-51
AUJ01505.1|2042476_2043421_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ01506.1|2043990_2046210_-	TonB-dependent siderophore receptor	NA	A0A0P0I887	Acinetobacter_phage	28.6	3.7e-05
AUJ01507.1|2046464_2046917_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ03469.1|2047808_2050850_+	TonB-dependent receptor	NA	NA	NA	NA	NA
AUJ01508.1|2051528_2052497_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	7.3e-99
AUJ01509.1|2052495_2052933_+|transposase	transposase	transposase	NA	NA	NA	NA
AUJ01510.1|2052980_2053415_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ01511.1|2054809_2055133_+	hypothetical protein	NA	Q6H9S4	Enterobacteria_phage	57.9	2.0e-24
AUJ01512.1|2055129_2056032_+|transposase	transposase	transposase	Q8W6R2	Burkholderia_virus	67.7	1.6e-103
AUJ01513.1|2056127_2056529_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ01514.1|2056525_2057035_+	hypothetical protein	NA	A4PE24	Ralstonia_virus	36.0	1.3e-09
AUJ03470.1|2057015_2057357_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ01515.1|2057370_2057967_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ01516.1|2057864_2058074_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ01517.1|2058072_2059449_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.0	6.0e-62
>prophage 17
CP019088	Xanthomonas oryzae pv. oryzae strain MAI99 chromosome, complete genome	4698819	2139522	2201963	4698819	tRNA,transposase,protease	Ralstonia_phage(25.0%)	47	NA	NA
AUJ01584.1|2139522_2140659_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
AUJ01585.1|2140655_2141114_-	NUDIX hydrolase	NA	NA	NA	NA	NA
AUJ01586.1|2141364_2141685_+|protease	ATP-dependent Clp protease adaptor ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	1.3e-12
AUJ01587.1|2141827_2144110_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	44.6	5.1e-175
AUJ01588.1|2144317_2144536_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
AUJ03474.1|2144616_2145369_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
AUJ01589.1|2145502_2146132_-	cinnamoyl-CoA reductase	NA	NA	NA	NA	NA
AUJ01590.1|2146807_2147929_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AUJ01591.1|2147986_2148955_-	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.5	2.0e-64
AUJ01592.1|2149238_2151596_+	cell division protein FtsK	NA	G1D482	Mycobacterium_virus	45.8	2.5e-84
AUJ01593.1|2151758_2153687_+	transglutaminase	NA	NA	NA	NA	NA
AUJ03475.1|2153793_2154423_+	outer membrane lipoprotein carrier protein LolA	NA	NA	NA	NA	NA
AUJ01594.1|2154535_2158702_-	type III effector	NA	NA	NA	NA	NA
AUJ03476.1|2158938_2160315_+	recombination factor protein RarA	NA	G3MBE0	Bacillus_virus	38.3	4.0e-74
AUJ01595.1|2160346_2160673_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ01596.1|2160669_2161077_-	fluoride ion transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	49.1	7.5e-21
AUJ01597.1|2161108_2161459_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ01598.1|2161455_2162787_-	voltage-gated chloride channel protein	NA	A0A1X9I5Z9	Streptococcus_phage	35.2	4.3e-41
AUJ01599.1|2163107_2164313_-	acetyl-CoA acetyltransferase	NA	NA	NA	NA	NA
AUJ01600.1|2164477_2166850_-	3-hydroxyacyl-CoA dehydrogenase	NA	NA	NA	NA	NA
AUJ01601.1|2166874_2167507_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
AUJ01602.1|2167725_2168151_+	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	41.7	1.1e-19
AUJ01603.1|2168169_2169375_+	23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN	NA	NA	NA	NA	NA
AUJ01604.1|2169385_2170174_+	type IV pilus biogenesis/stability protein PilW	NA	NA	NA	NA	NA
AUJ01605.1|2170170_2171031_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ01606.1|2171101_2171740_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ01607.1|2171736_2172957_+	outer membrane protein assembly factor BamB	NA	NA	NA	NA	NA
AUJ01608.1|2172967_2174365_+	ribosome biogenesis GTPase Der	NA	NA	NA	NA	NA
AUJ01609.1|2174679_2175900_+	molybdopterin molybdenumtransferase MoeA	NA	NA	NA	NA	NA
AUJ01610.1|2176391_2177552_-	molybdopterin biosynthesis protein MoeB	NA	NA	NA	NA	NA
AUJ03477.1|2178400_2179417_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	37.3	3.3e-49
AUJ01611.1|2180499_2181468_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	59.7	2.8e-98
AUJ01612.1|2181616_2182006_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ01613.1|2181944_2182322_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ01614.1|2182527_2183781_+	molybdopterin molybdenumtransferase MoeA	NA	NA	NA	NA	NA
AUJ01615.1|2183818_2184388_+	molybdenum cofactor guanylyltransferase	NA	NA	NA	NA	NA
AUJ01616.1|2184371_2184734_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ01617.1|2187108_2188086_-	siroheme synthase	NA	NA	NA	NA	NA
AUJ01618.1|2189407_2189596_+	nitrate transport ATP-binding protein	NA	NA	NA	NA	NA
AUJ01619.1|2189608_2189884_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ01620.1|2190528_2190786_+	stress-induced protein	NA	NA	NA	NA	NA
AUJ01621.1|2191011_2191980_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	1.1e-99
AUJ01622.1|2192621_2193107_+	YciE/YciF family protein	NA	NA	NA	NA	NA
AUJ01623.1|2193213_2194134_+	peptidase	NA	NA	NA	NA	NA
AUJ01624.1|2195323_2197135_-	GGDEF domain-containing protein	NA	NA	NA	NA	NA
AUJ01625.1|2197885_2200984_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ01626.1|2200994_2201963_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	5.6e-99
>prophage 18
CP019088	Xanthomonas oryzae pv. oryzae strain MAI99 chromosome, complete genome	4698819	2315790	2374652	4698819	transposase	Leptospira_phage(25.0%)	39	NA	NA
AUJ01651.1|2315790_2316285_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	39.7	3.1e-29
AUJ01652.1|2318263_2321389_-	multidrug efflux RND transporter permease subunit	NA	NA	NA	NA	NA
AUJ01653.1|2321440_2322553_-	efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
AUJ01654.1|2322676_2323255_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
AUJ01655.1|2324432_2324990_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ01656.1|2325809_2327897_+	type III effector	NA	NA	NA	NA	NA
AUJ03480.1|2329834_2332924_+	histidine kinase	NA	NA	NA	NA	NA
AUJ01657.1|2333309_2334095_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	47.6	2.8e-48
AUJ03481.1|2335208_2335916_+	DNA-binding response regulator	NA	NA	NA	NA	NA
AUJ01658.1|2335912_2336905_+	cytochrome-c peroxidase	NA	NA	NA	NA	NA
AUJ01659.1|2336901_2339361_+	two-component sensor histidine kinase	NA	NA	NA	NA	NA
AUJ01660.1|2339474_2340455_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUJ01661.1|2340463_2341492_+	type VI secretion system protein ImpA	NA	NA	NA	NA	NA
AUJ01662.1|2341664_2341991_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ01663.1|2341987_2344891_-	serine/threonine protein kinase	NA	A0A2R8FF19	Brazilian_cedratvirus	25.0	1.9e-09
AUJ01664.1|2344887_2345610_-	phosphoprotein phosphatase	NA	NA	NA	NA	NA
AUJ01665.1|2345606_2346254_-	type VI secretion-associated protein	NA	NA	NA	NA	NA
AUJ01666.1|2346250_2349709_-	type VI secretion protein	NA	NA	NA	NA	NA
AUJ01667.1|2349712_2351029_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ01668.1|2351030_2352368_-	type VI secretion system-associated protein	NA	NA	NA	NA	NA
AUJ01669.1|2352364_2353753_-	peptide-binding protein	NA	NA	NA	NA	NA
AUJ01670.1|2353749_2354289_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ01671.1|2354297_2356235_-	type IV secretion protein Rhs	NA	A0A077K8Q4	Ralstonia_phage	28.6	7.7e-39
AUJ01672.1|2356498_2356960_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ01673.1|2357062_2357266_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ01674.1|2358310_2359687_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	55.1	4.6e-78
AUJ01675.1|2359849_2360818_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	7.3e-99
AUJ01676.1|2360912_2361263_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ01677.1|2361259_2364031_-	ClpV1 family T6SS ATPase	NA	H6X3M6	Enterobacteria_phage	29.3	1.2e-77
AUJ01678.1|2364063_2365074_-	type VI secretion protein	NA	NA	NA	NA	NA
AUJ01679.1|2365037_2366915_-	type VI secretion system protein ImpG	NA	NA	NA	NA	NA
AUJ01680.1|2366918_2367422_-	type VI secretion system lysozyme	NA	NA	NA	NA	NA
AUJ01681.1|2367409_2368243_-	ImpE protein	NA	NA	NA	NA	NA
AUJ01682.1|2368278_2368782_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ01683.1|2368881_2370396_-	EvpB family type VI secretion protein	NA	NA	NA	NA	NA
AUJ03482.1|2370388_2370895_-	type VI secretion system-associated protein	NA	NA	NA	NA	NA
AUJ01684.1|2371561_2372038_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AUJ03483.1|2373398_2373602_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ01685.1|2373638_2374652_-|transposase	transposase	transposase	S5WIU1	Leptospira_phage	41.0	6.6e-42
>prophage 19
CP019088	Xanthomonas oryzae pv. oryzae strain MAI99 chromosome, complete genome	4698819	2625215	2708372	4698819	tRNA,transposase	Ralstonia_phage(16.67%)	47	NA	NA
AUJ01876.1|2625215_2626670_+|tRNA	tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase	tRNA	NA	NA	NA	NA
AUJ01877.1|2627093_2628080_+	PhoH family protein	NA	A0A1B2ICF6	Erwinia_phage	47.7	4.8e-45
AUJ01878.1|2628510_2629155_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ01879.1|2629209_2629695_+	endoribonuclease YbeY	NA	NA	NA	NA	NA
AUJ01880.1|2629694_2630213_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ01881.1|2630307_2631186_+	magnesium/cobalt efflux protein	NA	NA	NA	NA	NA
AUJ03505.1|2631200_2632463_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ01882.1|2632478_2633480_+	magnesium transporter CorA	NA	NA	NA	NA	NA
AUJ03506.1|2633631_2634996_-	succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
AUJ01883.1|2635470_2636319_-	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
AUJ01884.1|2636315_2637227_-	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
AUJ01885.1|2637355_2638489_-	polyamine ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	35.3	7.4e-26
AUJ01886.1|2638634_2640146_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ01887.1|2640132_2641719_-	MFS transporter	NA	NA	NA	NA	NA
AUJ01888.1|2641715_2642918_-	multidrug ABC transporter permease	NA	NA	NA	NA	NA
AUJ01889.1|2643766_2644735_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	59.7	3.6e-98
AUJ01890.1|2647354_2648740_-	glutamine synthetase	NA	NA	NA	NA	NA
AUJ03507.1|2649386_2650766_+	glutamine synthetase	NA	NA	NA	NA	NA
AUJ01891.1|2650765_2652082_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
AUJ01892.1|2652218_2653463_+	diguanylate cyclase response regulator	NA	A0A127AWB9	Bacillus_phage	36.4	1.9e-19
AUJ01893.1|2653768_2655049_-	MFS transporter	NA	NA	NA	NA	NA
AUJ01894.1|2655350_2655659_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ01895.1|2655618_2657967_-	CbbBc protein	NA	NA	NA	NA	NA
AUJ01896.1|2657963_2658809_-	sulfurtransferase FdhD	NA	NA	NA	NA	NA
AUJ01897.1|2658815_2660495_-	MFS transporter	NA	NA	NA	NA	NA
AUJ01898.1|2661023_2662376_+	aspartate aminotransferase family protein	NA	NA	NA	NA	NA
AUJ01899.1|2662436_2665568_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ01900.1|2665732_2666587_+	plasmid replication/partition related protein	NA	A0A1B1INV8	uncultured_Mediterranean_phage	38.7	3.2e-13
AUJ01901.1|2666757_2668062_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ01902.1|2668203_2672298_+	hybrid sensor histidine kinase/response regulator	NA	A0A1V0SGX0	Hokovirus	28.4	5.0e-56
AUJ01903.1|2673390_2674359_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.7	5.1e-100
AUJ01904.1|2674845_2679855_-	glutamate dehydrogenase	NA	NA	NA	NA	NA
AUJ01905.1|2680132_2680792_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
AUJ01906.1|2680806_2682114_+	efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
AUJ01907.1|2682126_2685297_+	multidrug efflux RND transporter permease	NA	NA	NA	NA	NA
AUJ01908.1|2687988_2688984_-	LacI family transcriptional regulator	NA	NA	NA	NA	NA
AUJ01909.1|2689144_2691661_+	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	28.5	6.3e-09
AUJ01910.1|2691657_2692614_+	1-phosphofructokinase	NA	NA	NA	NA	NA
AUJ01911.1|2692772_2694515_+	PTS fructose transporter subunit EIIBC	NA	NA	NA	NA	NA
AUJ03508.1|2694833_2695970_+	carbohydrate porin	NA	NA	NA	NA	NA
AUJ01912.1|2696364_2699127_+	type IV secretion protein Rhs	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	27.4	3.6e-42
AUJ01913.1|2699397_2700123_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ03509.1|2700601_2701618_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	37.6	2.5e-49
AUJ01914.1|2704193_2704937_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ01915.1|2705553_2706930_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.3	2.1e-62
AUJ01916.1|2707269_2707533_+|transposase	transposase	transposase	NA	NA	NA	NA
AUJ01917.1|2707385_2708372_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	41.9	4.5e-43
>prophage 20
CP019088	Xanthomonas oryzae pv. oryzae strain MAI99 chromosome, complete genome	4698819	2901210	2946142	4698819	transposase	Ralstonia_phage(13.33%)	36	NA	NA
AUJ02053.1|2901210_2902179_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.7	5.1e-100
AUJ03534.1|2903570_2904587_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	37.6	2.5e-49
AUJ02054.1|2904759_2905662_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ02055.1|2905859_2907227_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	47.9	1.6e-112
AUJ02056.1|2907478_2907991_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ02057.1|2907920_2908160_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ02058.1|2908502_2910002_+	transcriptional regulator	NA	NA	NA	NA	NA
AUJ02059.1|2909998_2910931_+	N-acetyltransferase	NA	NA	NA	NA	NA
AUJ02060.1|2911111_2913940_+	2-oxoglutarate dehydrogenase subunit E1	NA	NA	NA	NA	NA
AUJ02061.1|2913982_2915185_+	dihydrolipoamide succinyltransferase	NA	NA	NA	NA	NA
AUJ02062.1|2915426_2916863_+	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	26.8	3.7e-38
AUJ02063.1|2917061_2917655_+	Rossman fold protein, TIGR00730 family	NA	A0A2I2L3F0	Orpheovirus	27.5	2.1e-11
AUJ03535.1|2917919_2918513_+	IMPACT family protein	NA	A0A1X9I5T8	Streptococcus_phage	41.2	8.1e-16
AUJ02064.1|2918509_2920279_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	30.5	5.2e-58
AUJ02065.1|2920521_2921376_+	RND transporter	NA	NA	NA	NA	NA
AUJ02066.1|2921372_2922776_+	multidrug transporter	NA	NA	NA	NA	NA
AUJ02067.1|2923127_2923322_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ02068.1|2923601_2924723_-	prephenate dehydrogenase	NA	NA	NA	NA	NA
AUJ02069.1|2924719_2925637_-	pyridoxal kinase	NA	NA	NA	NA	NA
AUJ02070.1|2926164_2927295_-	molecular chaperone DnaJ	NA	Q8QNB4	Ectocarpus_siliculosus_virus	30.0	1.4e-24
AUJ02071.1|2927454_2929380_-	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	50.6	2.2e-147
AUJ02072.1|2929521_2930040_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
AUJ02073.1|2930140_2931193_-	heat-inducible transcriptional repressor HrcA	NA	NA	NA	NA	NA
AUJ02074.1|2931309_2932974_+	DNA repair protein RecN	NA	NA	NA	NA	NA
AUJ02075.1|2933416_2933842_-	ferric iron uptake transcriptional regulator	NA	NA	NA	NA	NA
AUJ02076.1|2933931_2934327_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ02077.1|2934673_2934949_-	RnfH family protein	NA	NA	NA	NA	NA
AUJ02078.1|2934962_2935394_-	ubiquinone-binding protein	NA	NA	NA	NA	NA
AUJ02079.1|2935454_2935958_+	SsrA-binding protein	NA	W5RAM5	Staphylococcus_phage	41.9	5.8e-23
AUJ02080.1|2936122_2938570_-	serine peptidase	NA	A0A218KC60	Bacillus_phage	26.7	2.6e-15
AUJ02081.1|2939691_2940072_-	hypothetical protein	NA	Q6H9S4	Enterobacteria_phage	56.2	2.3e-19
AUJ02082.1|2940319_2941288_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.7	5.1e-100
AUJ02083.1|2941510_2942887_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	46.3	7.3e-60
AUJ03536.1|2943655_2944348_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ02084.1|2945039_2945303_+|transposase	transposase	transposase	NA	NA	NA	NA
AUJ02085.1|2945155_2946142_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	41.9	4.5e-43
>prophage 21
CP019088	Xanthomonas oryzae pv. oryzae strain MAI99 chromosome, complete genome	4698819	2955670	3017721	4698819	tRNA,transposase,protease	Acidithiobacillus_phage(17.65%)	49	NA	NA
AUJ02092.1|2955670_2957047_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.3	2.1e-62
AUJ02093.1|2957097_2958141_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	54.1	1.5e-76
AUJ02094.1|2958189_2958453_+|transposase	transposase	transposase	NA	NA	NA	NA
AUJ02095.1|2958305_2959292_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	41.9	4.5e-43
AUJ02096.1|2960671_2960896_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ03539.1|2960929_2962045_+	GGDEF domain-containing protein	NA	NA	NA	NA	NA
AUJ02097.1|2962641_2963616_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	37.0	2.6e-19
AUJ02098.1|2965478_2966204_-	OmpA family lipoprotein	NA	G3M9Z0	Bacillus_virus	33.9	1.8e-09
AUJ03540.1|2966213_2966393_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ02099.1|2966988_2967465_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AUJ02100.1|2967472_2968927_-	deoxyribodipyrimidine photolyase	NA	A0A1V0S949	Catovirus	31.5	4.4e-47
AUJ02101.1|2968993_2970424_-	replicative DNA helicase	NA	O80281	Escherichia_phage	53.6	3.8e-120
AUJ02102.1|2970645_2971200_-	NADPH-dependent oxidoreductase	NA	A0A2P0ZL77	Lactobacillus_phage	34.1	1.2e-18
AUJ02103.1|2971416_2973357_-	asparagine synthetase B	NA	A0A1B1ISV2	uncultured_Mediterranean_phage	30.8	2.6e-26
AUJ03541.1|2973532_2974162_-	glutathione S-transferase	NA	NA	NA	NA	NA
AUJ02104.1|2978237_2979029_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ02105.1|2979174_2979390_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ02106.1|2979389_2980157_+	DNAase	NA	NA	NA	NA	NA
AUJ02107.1|2980218_2981049_-|tRNA	tRNA threonylcarbamoyladenosine dehydratase	tRNA	NA	NA	NA	NA
AUJ02108.1|2981121_2981550_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ02109.1|2981681_2982161_+	peptidoglycan-associated outer membrane lipoprotein precursor	NA	NA	NA	NA	NA
AUJ02110.1|2982411_2982627_-	cold-shock protein	NA	A0A1X9IGI9	Lactococcus_phage	59.7	6.5e-16
AUJ02111.1|2982593_2982827_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ02112.1|2982854_2983340_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ03542.1|2983541_2984024_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	58.6	4.1e-42
AUJ02113.1|2985958_2988190_+	chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	59.7	1.5e-09
AUJ02114.1|2988333_2989710_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	55.1	4.6e-78
AUJ02115.1|2990828_2991797_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	5.6e-99
AUJ02116.1|2992118_2992436_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ02117.1|2992541_2992724_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ02118.1|2993364_2994333_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	1.9e-99
AUJ02119.1|2995423_2996059_-	glutathione S-transferase	NA	NA	NA	NA	NA
AUJ02120.1|2996194_2997712_-	fumarate hydratase	NA	NA	NA	NA	NA
AUJ02121.1|2997751_2998012_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ02122.1|2998046_2999927_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	38.9	5.2e-24
AUJ02123.1|3000115_3000895_+	ferredoxin--NADP(+) reductase	NA	NA	NA	NA	NA
AUJ02124.1|3000976_3001462_-	glutathione peroxidase	NA	A0A1S7DM81	Molluscum_contagiosum_virus	36.2	2.8e-14
AUJ03543.1|3003919_3004159_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ02125.1|3004408_3005122_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ03544.1|3006653_3007142_+	RNA polymerase subunit sigma-70	NA	NA	NA	NA	NA
AUJ03545.1|3007303_3007882_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ02126.1|3007973_3008474_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
AUJ02127.1|3008540_3009386_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ02128.1|3009436_3009715_-	N-acetyltransferase	NA	NA	NA	NA	NA
AUJ02129.1|3009934_3010123_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ02130.1|3010536_3011145_-|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
AUJ02131.1|3012341_3014159_+	peptidase M14	NA	NA	NA	NA	NA
AUJ02132.1|3014230_3016477_+	glycosyl hydrolase	NA	NA	NA	NA	NA
AUJ02133.1|3017244_3017721_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 22
CP019088	Xanthomonas oryzae pv. oryzae strain MAI99 chromosome, complete genome	4698819	3177120	3264116	4698819	transposase,protease	Hokovirus(26.67%)	53	NA	NA
AUJ02255.1|3177120_3178497_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.3	2.3e-61
AUJ03560.1|3179411_3179741_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ02256.1|3179931_3181863_-	alpha-L-fucosidase	NA	NA	NA	NA	NA
AUJ02257.1|3182308_3183163_+|transposase	transposase	transposase	U5P429	Shigella_phage	57.7	2.8e-86
AUJ03561.1|3183198_3186738_-	histidine kinase	NA	A0A1V0SGX0	Hokovirus	33.3	2.6e-45
AUJ02258.1|3187240_3190807_-	histidine kinase	NA	A0A1V0SGX0	Hokovirus	33.3	7.7e-45
AUJ02259.1|3190872_3194436_-	histidine kinase	NA	A0A1V0SGX0	Hokovirus	30.7	8.3e-39
AUJ02260.1|3194729_3198305_-	hybrid sensor histidine kinase/response regulator	NA	A0A1V0SGX0	Hokovirus	32.2	4.6e-37
AUJ02261.1|3198401_3199064_+	polyisoprenoid-binding protein	NA	NA	NA	NA	NA
AUJ02262.1|3199060_3199624_+	cytochrome b	NA	NA	NA	NA	NA
AUJ02263.1|3199633_3200203_+	polyisoprenoid-binding protein	NA	NA	NA	NA	NA
AUJ03562.1|3200520_3200910_+	cold-shock protein	NA	NA	NA	NA	NA
AUJ02264.1|3200995_3201229_-	thioredoxin family protein	NA	NA	NA	NA	NA
AUJ02265.1|3201316_3202699_+	L-serine ammonia-lyase	NA	NA	NA	NA	NA
AUJ02266.1|3204466_3205684_-	O-succinylhomoserine (thiol)-lyase	NA	NA	NA	NA	NA
AUJ02267.1|3205680_3206712_-	homoserine acetyltransferase	NA	NA	NA	NA	NA
AUJ02268.1|3207030_3207930_+	peptidase	NA	S5M424	Bacillus_phage	30.6	3.0e-06
AUJ02269.1|3208062_3209667_+	peptide chain release factor 3	NA	NA	NA	NA	NA
AUJ02270.1|3209742_3210387_+	hemolysin III	NA	NA	NA	NA	NA
AUJ02271.1|3212307_3213684_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.3	7.1e-63
AUJ02272.1|3215315_3215744_-	histidine kinase	NA	NA	NA	NA	NA
AUJ03563.1|3215703_3216744_-	glycosyl transferase family 2	NA	F1C5B0	Cronobacter_phage	42.6	1.3e-72
AUJ02273.1|3216752_3217490_-	monofunctional biosynthetic peptidoglycan transglycosylase	NA	NA	NA	NA	NA
AUJ02274.1|3217564_3218455_+	heat-shock protein Hsp33	NA	NA	NA	NA	NA
AUJ02275.1|3218575_3219445_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ02276.1|3219840_3222750_+	TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	24.4	6.6e-26
AUJ02277.1|3222858_3223467_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
AUJ02278.1|3223669_3224527_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
AUJ02279.1|3224523_3226998_+	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
AUJ03564.1|3227392_3227746_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ02280.1|3229725_3231105_+	serine hydrolase	NA	NA	NA	NA	NA
AUJ02281.1|3231791_3232235_-	histidine biosynthesis protein HisIE	NA	NA	NA	NA	NA
AUJ02282.1|3232652_3232868_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ02283.1|3233250_3233646_-	glycine cleavage system protein H	NA	NA	NA	NA	NA
AUJ02284.1|3233782_3234892_-	glycine cleavage system protein T	NA	NA	NA	NA	NA
AUJ02285.1|3235064_3235499_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ02286.1|3235502_3236468_-	hypothetical protein	NA	J3IZE5	Acanthamoeba_polyphaga_lentillevirus	33.5	1.5e-22
AUJ02287.1|3236765_3237101_-	hypothetical protein	NA	A0A218MNG8	uncultured_virus	56.4	9.2e-25
AUJ02288.1|3237097_3238117_-	nucleoside triphosphate pyrophosphohydrolase	NA	NA	NA	NA	NA
AUJ02289.1|3238361_3239162_-	3'(2'),5'-bisphosphate nucleotidase CysQ	NA	NA	NA	NA	NA
AUJ02290.1|3239158_3239716_-	ADP compounds hydrolase NudE	NA	NA	NA	NA	NA
AUJ02291.1|3239748_3241167_+	aspartate aminotransferase family protein	NA	NA	NA	NA	NA
AUJ02292.1|3241157_3241892_+	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
AUJ02293.1|3242193_3243210_-	glucokinase	NA	NA	NA	NA	NA
AUJ02294.1|3243910_3246619_+	TonB-dependent receptor	NA	NA	NA	NA	NA
AUJ02295.1|3246827_3248513_+	alpha-L-fucosidase	NA	NA	NA	NA	NA
AUJ03565.1|3248528_3249584_+	glycosyl hydrolase	NA	A0A2P1CFB9	Microbacterium_phage	24.3	2.9e-08
AUJ02296.1|3252513_3255135_+	beta-mannosidase	NA	NA	NA	NA	NA
AUJ02297.1|3255343_3258013_+	beta-glucosidase	NA	NA	NA	NA	NA
AUJ02298.1|3258157_3260272_-	ABC transporter	NA	W8CYL7	Bacillus_phage	26.5	1.4e-33
AUJ02299.1|3260275_3260722_-|protease	protease	protease	NA	NA	NA	NA
AUJ02300.1|3261634_3261898_-|transposase	transposase	transposase	NA	NA	NA	NA
AUJ02301.1|3262739_3264116_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.3	2.1e-62
>prophage 23
CP019088	Xanthomonas oryzae pv. oryzae strain MAI99 chromosome, complete genome	4698819	3408941	3520694	4698819	tRNA,transposase	Acidithiobacillus_phage(20.0%)	82	NA	NA
AUJ02398.1|3408941_3409928_-|transposase	transposase	transposase	S5WIU1	Leptospira_phage	41.0	1.7e-42
AUJ02399.1|3409780_3410044_-|transposase	transposase	transposase	NA	NA	NA	NA
AUJ02400.1|3410012_3410465_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ02401.1|3410355_3411267_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ02402.1|3411391_3413977_-	ATP-dependent chaperone ClpB	NA	A0A1C3S747	Escherichia_phage	35.4	3.8e-126
AUJ02403.1|3414422_3414728_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ02404.1|3415108_3417724_+	DNA mismatch repair protein MutS	NA	A0A1V0SGG8	Hokovirus	22.5	2.8e-28
AUJ02405.1|3418024_3418639_+	calcium-binding protein	NA	NA	NA	NA	NA
AUJ02406.1|3419071_3421318_+	catalase-peroxidase	NA	NA	NA	NA	NA
AUJ03575.1|3421441_3421849_-	RNA-binding protein	NA	NA	NA	NA	NA
AUJ02407.1|3422189_3423680_+	MATE family efflux transporter	NA	NA	NA	NA	NA
AUJ02408.1|3424298_3424706_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
AUJ02409.1|3424850_3425609_-|tRNA	tRNA (guanine(37)-N(1))-methyltransferase	tRNA	NA	NA	NA	NA
AUJ02410.1|3425673_3426186_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
AUJ03576.1|3426229_3426487_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
AUJ02411.1|3426596_3427394_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ02412.1|3428633_3429869_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ02413.1|3430017_3431394_-	signal recognition particle protein	NA	NA	NA	NA	NA
AUJ02414.1|3431785_3432577_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ02415.1|3432863_3433913_-	galactose mutarotase	NA	NA	NA	NA	NA
AUJ03577.1|3434152_3435736_+	alpha-N-arabinofuranosidase	NA	NA	NA	NA	NA
AUJ02416.1|3435923_3436400_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AUJ02417.1|3436365_3436722_-|transposase	transposase	transposase	NA	NA	NA	NA
AUJ02418.1|3437816_3439778_-	hybrid sensor histidine kinase/response regulator	NA	NA	NA	NA	NA
AUJ02419.1|3439761_3440649_-	histidine kinase	NA	Q8QKV7	Ectocarpus_siliculosus_virus	33.0	9.3e-24
AUJ02420.1|3440645_3441656_-	ATP-binding protein	NA	NA	NA	NA	NA
AUJ02421.1|3441646_3442042_-	anti-sigma regulatory factor	NA	NA	NA	NA	NA
AUJ02422.1|3442038_3442401_-	anti-anti-sigma factor	NA	NA	NA	NA	NA
AUJ03578.1|3442402_3443245_-	polyvinylalcohol dehydrogenase	NA	NA	NA	NA	NA
AUJ02423.1|3443919_3446244_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ02424.1|3446268_3448239_-	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	21.2	3.5e-15
AUJ02425.1|3448350_3449781_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AUJ02426.1|3450541_3451333_+	transcriptional regulator	NA	NA	NA	NA	NA
AUJ02427.1|3451550_3451832_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ02428.1|3452639_3454034_-	DNA repair protein RadA	NA	NA	NA	NA	NA
AUJ02429.1|3454341_3455328_-|transposase	transposase	transposase	S5WIU1	Leptospira_phage	41.9	3.4e-43
AUJ02430.1|3455180_3455450_-|transposase	transposase	transposase	NA	NA	NA	NA
AUJ02431.1|3455621_3456998_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	48.1	9.9e-65
AUJ02432.1|3457113_3458331_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ02433.1|3459219_3459429_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ02434.1|3459838_3461215_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.0	6.0e-62
AUJ02435.1|3463783_3464752_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	7.3e-99
AUJ02436.1|3465428_3465824_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ02437.1|3465986_3467363_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.3	2.7e-62
AUJ02438.1|3467383_3467773_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ02439.1|3467774_3472514_-	type IV secretion protein Rhs	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	43.3	1.8e-20
AUJ02440.1|3472657_3474277_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ02441.1|3474300_3476547_-	type IV secretion protein Rhs	NA	A0A077K8Q4	Ralstonia_phage	31.5	6.8e-55
AUJ03579.1|3476771_3478469_-	peptidase M61	NA	NA	NA	NA	NA
AUJ02442.1|3478820_3479156_-	cytochrome o ubiquinol oxidase subunit IV	NA	NA	NA	NA	NA
AUJ03580.1|3479155_3479782_-	cytochrome o ubiquinol oxidase subunit III	NA	NA	NA	NA	NA
AUJ02443.1|3479784_3481785_-	cytochrome ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
AUJ02444.1|3483233_3484184_-	4-hydroxy-3-methylbut-2-enyl diphosphate reductase	NA	NA	NA	NA	NA
AUJ02445.1|3484256_3484775_-	signal peptidase II	NA	NA	NA	NA	NA
AUJ02446.1|3485089_3487921_-|tRNA	isoleucine--tRNA ligase	tRNA	A0A1V0SGW1	Hokovirus	22.2	1.4e-41
AUJ02447.1|3489142_3490747_-	lipid II flippase MurJ	NA	NA	NA	NA	NA
AUJ02448.1|3490863_3491133_+	30S ribosomal protein S20	NA	NA	NA	NA	NA
AUJ02449.1|3491224_3492277_-	Obg family GTPase CgtA	NA	NA	NA	NA	NA
AUJ02450.1|3492512_3492773_-	50S ribosomal protein L27	NA	NA	NA	NA	NA
AUJ02451.1|3492785_3493106_-	50S ribosomal protein L21	NA	NA	NA	NA	NA
AUJ02452.1|3493398_3496356_+	ABC-ATPase UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	56.1	2.5e-307
AUJ02453.1|3496352_3496760_+	thioesterase	NA	NA	NA	NA	NA
AUJ02454.1|3496873_3497338_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ02455.1|3497361_3498132_+	enoyl-CoA hydratase	NA	NA	NA	NA	NA
AUJ02456.1|3498202_3499108_+	acyl-CoA thioesterase II	NA	NA	NA	NA	NA
AUJ02457.1|3499335_3499839_+	pathogenicity-like protein	NA	NA	NA	NA	NA
AUJ02458.1|3499950_3500715_+	RNA polymerase subunit sigma	NA	NA	NA	NA	NA
AUJ03581.1|3500956_3501412_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ03582.1|3501545_3502127_-	calcium-binding protein	NA	NA	NA	NA	NA
AUJ02459.1|3502326_3503082_+	arginyltransferase	NA	NA	NA	NA	NA
AUJ02460.1|3503035_3504367_+	endonuclease	NA	NA	NA	NA	NA
AUJ02461.1|3504718_3505138_-|transposase	transposase	transposase	NA	NA	NA	NA
AUJ02462.1|3505339_3506941_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ02463.1|3507387_3508464_+	DUF4432 domain-containing protein	NA	NA	NA	NA	NA
AUJ02464.1|3508560_3509034_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ02465.1|3509270_3511706_+	ligand-gated channel	NA	A0A0P0I887	Acinetobacter_phage	22.6	1.0e-11
AUJ03583.1|3512238_3512778_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ02466.1|3512983_3513742_+	trehalose-phosphatase	NA	NA	NA	NA	NA
AUJ02467.1|3513786_3515565_+	glucoamylase	NA	NA	NA	NA	NA
AUJ02468.1|3515561_3516929_+	trehalose-6-phosphate synthase	NA	NA	NA	NA	NA
AUJ02469.1|3517531_3520009_+	membrane-bound PQQ-dependent dehydrogenase, glucose/quinate/shikimate family	NA	NA	NA	NA	NA
AUJ03584.1|3520430_3520694_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 24
CP019088	Xanthomonas oryzae pv. oryzae strain MAI99 chromosome, complete genome	4698819	3552372	3576030	4698819	tRNA,transposase	Leptospira_phage(42.86%)	19	NA	NA
AUJ02488.1|3552372_3553341_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	59.7	1.6e-98
AUJ02489.1|3553699_3554092_-	histone-like nucleoid-structuring protein	NA	NA	NA	NA	NA
AUJ03589.1|3554427_3555282_-|transposase	transposase	transposase	U5P429	Shigella_phage	58.1	2.2e-86
AUJ02490.1|3557235_3558204_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	7.3e-99
AUJ02491.1|3558448_3559825_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.3	2.1e-62
AUJ02492.1|3560089_3560809_-|transposase	transposase	transposase	S5WIU1	Leptospira_phage	41.3	1.8e-41
AUJ02493.1|3560827_3561814_-|transposase	transposase	transposase	S5WIU1	Leptospira_phage	40.6	9.9e-43
AUJ02494.1|3561666_3561930_-|transposase	transposase	transposase	NA	NA	NA	NA
AUJ02495.1|3566877_3567078_+	sulfur carrier protein ThiS	NA	NA	NA	NA	NA
AUJ02496.1|3567440_3568235_+	thiazole synthase	NA	NA	NA	NA	NA
AUJ02497.1|3568536_3569295_+|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
AUJ02498.1|3569370_3571233_+	SLC13 family permease	NA	NA	NA	NA	NA
AUJ02499.1|3571290_3571632_-	ferredoxin	NA	NA	NA	NA	NA
AUJ02500.1|3571890_3572166_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ02501.1|3572339_3572816_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AUJ02502.1|3572781_3573246_-|transposase	transposase	transposase	NA	NA	NA	NA
AUJ02503.1|3573758_3574472_+	fumarylacetoacetate hydrolase	NA	NA	NA	NA	NA
AUJ02504.1|3574532_3574964_+	large-conductance mechanosensitive channel	NA	NA	NA	NA	NA
AUJ02505.1|3574971_3576030_+|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	43.5	6.2e-75
>prophage 25
CP019088	Xanthomonas oryzae pv. oryzae strain MAI99 chromosome, complete genome	4698819	3708627	3765104	4698819	transposase,protease	Tenacibaculum_phage(12.5%)	44	NA	NA
AUJ02599.1|3708627_3708984_+|transposase	transposase	transposase	NA	NA	NA	NA
AUJ02600.1|3708949_3709426_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AUJ02601.1|3709472_3710132_-	serine/threonine protein kinase	NA	NA	NA	NA	NA
AUJ02602.1|3710283_3712371_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ02603.1|3712484_3712754_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ02604.1|3713093_3713978_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ02605.1|3714124_3714721_-|protease	ATP-dependent protease	protease	NA	NA	NA	NA
AUJ03601.1|3714720_3716079_-	UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl- meso-diaminopimelate ligase	NA	NA	NA	NA	NA
AUJ02606.1|3716443_3717007_-	adenylate kinase	NA	A0A1B4XWI3	Tenacibaculum_phage	31.4	2.1e-13
AUJ02607.1|3717166_3718423_+	6-phosphofructokinase	NA	NA	NA	NA	NA
AUJ02608.1|3718722_3719691_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	59.7	1.6e-98
AUJ02609.1|3721066_3721591_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ02610.1|3721839_3723867_+	sodium-translocating pyrophosphatase	NA	NA	NA	NA	NA
AUJ02611.1|3724159_3724642_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ02612.1|3724838_3725375_+	inorganic pyrophosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	53.6	6.1e-47
AUJ02613.1|3725521_3726637_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ02614.1|3727250_3730220_-	TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	24.6	1.6e-40
AUJ02615.1|3730265_3731159_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AUJ02616.1|3731269_3733621_-	biopolymer transporter Tol	NA	NA	NA	NA	NA
AUJ02617.1|3734045_3735923_-	phosphomethylpyrimidine synthase ThiC	NA	NA	NA	NA	NA
AUJ02618.1|3737204_3738206_+	ketol-acid reductoisomerase	NA	NA	NA	NA	NA
AUJ02619.1|3738246_3739968_+	acetolactate synthase 2 catalytic subunit	NA	E4WLQ6	Ostreococcus_tauri_virus	32.9	8.0e-64
AUJ02620.1|3739951_3740209_+	acetolactate synthase	NA	NA	NA	NA	NA
AUJ02621.1|3740284_3741409_+	serine/threonine dehydratase	NA	NA	NA	NA	NA
AUJ02622.1|3741405_3742968_+	2-isopropylmalate synthase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	24.4	4.3e-08
AUJ02623.1|3743291_3744365_-	3-isopropylmalate dehydrogenase	NA	NA	NA	NA	NA
AUJ03602.1|3744401_3745151_-	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AUJ02624.1|3745183_3745831_-	3-isopropylmalate dehydratase small subunit	NA	NA	NA	NA	NA
AUJ02625.1|3745898_3747347_-	3-isopropylmalate dehydratase large subunit	NA	NA	NA	NA	NA
AUJ03603.1|3747467_3748352_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUJ02626.1|3748596_3749379_-	GGDEF domain-containing protein	NA	NA	NA	NA	NA
AUJ02627.1|3750140_3750794_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
AUJ03604.1|3750923_3751580_+	protein-L-isoaspartate O-methyltransferase	NA	NA	NA	NA	NA
AUJ02628.1|3751600_3752980_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ02629.1|3753254_3754571_-	3-deoxy-D-manno-octulosonic acid transferase	NA	NA	NA	NA	NA
AUJ02630.1|3754647_3755568_+	lipid A biosynthesis lauroyl acyltransferase	NA	NA	NA	NA	NA
AUJ02631.1|3755800_3757135_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ02632.1|3757115_3758228_-	glycosyl transferase	NA	NA	NA	NA	NA
AUJ02633.1|3758238_3758436_-	zinc-finger domain-containing protein	NA	NA	NA	NA	NA
AUJ02634.1|3758767_3760894_-	ABC transporter	NA	W8CYL7	Bacillus_phage	26.4	9.0e-33
AUJ03605.1|3761815_3763078_-	hemolysin D	NA	NA	NA	NA	NA
AUJ03606.1|3763564_3764581_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	37.3	5.6e-49
AUJ02635.1|3764496_3764799_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ02636.1|3764834_3765104_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 26
CP019088	Xanthomonas oryzae pv. oryzae strain MAI99 chromosome, complete genome	4698819	3818288	3937902	4698819	tRNA,transposase,protease	Enterobacteria_phage(12.9%)	102	NA	NA
AUJ02668.1|3818288_3819257_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.7	3.0e-100
AUJ02669.1|3819458_3819881_-	arsenate reductase (glutaredoxin)	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	62.2	1.0e-41
AUJ02670.1|3820491_3820881_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ02671.1|3820873_3822526_+|protease	serine protease	protease	NA	NA	NA	NA
AUJ02672.1|3822977_3823784_-|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	37.1	9.1e-10
AUJ02673.1|3823836_3825015_-	nicotinate phosphoribosyltransferase	NA	A0A2L0UZQ6	Agrobacterium_phage	33.3	6.9e-51
AUJ02674.1|3825401_3826367_-	glycosidase-like protein	NA	NA	NA	NA	NA
AUJ03613.1|3826495_3827794_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ02675.1|3827843_3829751_-	glycosyltransferase	NA	NA	NA	NA	NA
AUJ03614.1|3829763_3830666_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ02676.1|3830915_3831755_-	glycosyl transferase	NA	NA	NA	NA	NA
AUJ02677.1|3832365_3833523_+	aminoglycoside phosphotransferase	NA	NA	NA	NA	NA
AUJ02678.1|3833558_3835721_+	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
AUJ02679.1|3836095_3836671_+	aminotransferase	NA	NA	NA	NA	NA
AUJ02680.1|3836776_3837505_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AUJ02681.1|3837935_3838775_-	glycosyltransferase	NA	NA	NA	NA	NA
AUJ02682.1|3838771_3841075_-	type II secretion system protein GspD	NA	A7BJX1	Enterobacteria_phage	24.4	1.5e-09
AUJ02683.1|3841071_3841902_-	general secretion pathway protein GspN	NA	NA	NA	NA	NA
AUJ02684.1|3841891_3842545_-	general secretion pathway protein GspM	NA	NA	NA	NA	NA
AUJ02685.1|3842528_3843650_-	general secretion pathway protein GspL	NA	NA	NA	NA	NA
AUJ02686.1|3843646_3844498_-	general secretion pathway protein GspK	NA	NA	NA	NA	NA
AUJ02687.1|3844494_3845130_-	general secretion pathway protein GspJ	NA	NA	NA	NA	NA
AUJ02688.1|3845126_3845543_-	general secretion pathway protein GspI	NA	NA	NA	NA	NA
AUJ02689.1|3845539_3846049_-	type II secretion system protein GspH	NA	NA	NA	NA	NA
AUJ02690.1|3846058_3846490_-	type II secretion system protein GspG	NA	NA	NA	NA	NA
AUJ02691.1|3846757_3847975_-	type II secretion system protein GspF	NA	NA	NA	NA	NA
AUJ02692.1|3847974_3848154_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ02693.1|3848150_3849890_-	type II secretion system protein GspE	NA	NA	NA	NA	NA
AUJ02694.1|3850007_3851891_-|protease	protease	protease	A0A1B0T6A2	Bacillus_phage	30.7	7.0e-21
AUJ02695.1|3852111_3858192_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ02696.1|3859169_3863222_-	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	56.9	5.8e-121
AUJ03615.1|3863114_3863381_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ02697.1|3863637_3864435_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ02698.1|3864918_3865890_-	site-specific tyrosine recombinase XerD	NA	A0A0K0N6I5	Gordonia_phage	30.3	1.9e-14
AUJ02699.1|3866315_3866783_+	RDD family protein	NA	NA	NA	NA	NA
AUJ02700.1|3866880_3867192_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ03616.1|3867196_3868303_-	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
AUJ02701.1|3868299_3869382_-	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
AUJ02702.1|3869489_3870962_+	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	36.5	9.0e-48
AUJ02703.1|3870961_3871318_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ02704.1|3871317_3871743_+	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
AUJ02705.1|3871753_3872986_+	ATPase	NA	NA	NA	NA	NA
AUJ02706.1|3872988_3873636_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ02707.1|3873764_3876707_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	34.2	2.2e-130
AUJ03617.1|3877366_3879403_+	lytic murein transglycosylase	NA	A0A0H3V0Q1	Geobacillus_virus	36.7	1.4e-14
AUJ02708.1|3879859_3881236_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.7	9.2e-63
AUJ03618.1|3881589_3882606_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	37.6	2.5e-49
AUJ03619.1|3883959_3884976_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	37.6	2.5e-49
AUJ02709.1|3885175_3886162_-|transposase	transposase	transposase	S5WIU1	Leptospira_phage	41.0	1.3e-42
AUJ02710.1|3886014_3886284_-|transposase	transposase	transposase	NA	NA	NA	NA
AUJ03620.1|3886836_3887310_-	ribosomal-protein-alanine N-acetyltransferase	NA	NA	NA	NA	NA
AUJ02711.1|3887315_3887783_-	alanine acetyltransferase	NA	NA	NA	NA	NA
AUJ02712.1|3887793_3888567_-	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
AUJ03621.1|3888731_3889103_+	DUF4124 domain-containing protein	NA	NA	NA	NA	NA
AUJ02713.1|3889214_3890909_+|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
AUJ02714.1|3891051_3891513_+	DNA-binding protein	NA	NA	NA	NA	NA
AUJ02715.1|3891590_3892850_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ02716.1|3893019_3894132_+	ABC transporter permease	NA	NA	NA	NA	NA
AUJ02717.1|3894217_3895060_+	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	30.5	2.4e-13
AUJ02718.1|3895062_3895989_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUJ02719.1|3895985_3896630_+	ABC transporter	NA	NA	NA	NA	NA
AUJ02720.1|3896772_3897249_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AUJ02721.1|3897657_3897915_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ02722.1|3898030_3898639_-	alpha-ketoglutarate-dependent dioxygenase AlkB	NA	A0A2K9L0M4	Tupanvirus	34.6	1.8e-23
AUJ02723.1|3898755_3900405_+	electron transfer flavoprotein-ubiquinone oxidoreductase	NA	NA	NA	NA	NA
AUJ03622.1|3900424_3903250_+	polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
AUJ02724.1|3903273_3903912_-	succinyl-CoA--3-ketoacid-CoA transferase	NA	NA	NA	NA	NA
AUJ02725.1|3903911_3904643_-	succinyl-CoA--3-ketoacid-CoA transferase	NA	NA	NA	NA	NA
AUJ02726.1|3904776_3906123_+	phosphomannomutase/phosphoglucomutase	NA	A0A127AWJ1	Bacillus_phage	26.9	2.6e-33
AUJ02727.1|3906168_3907572_+	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	28.8	1.6e-41
AUJ02728.1|3907688_3908597_-	NAD(P)-dependent oxidoreductase	NA	A0A1D7XFA3	Escherichia_phage	33.8	5.4e-27
AUJ02729.1|3908593_3909151_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	48.1	1.7e-44
AUJ02730.1|3909147_3910035_-	glucose-1-phosphate thymidylyltransferase	NA	I7I009	Enterobacteria_phage	58.2	2.2e-94
AUJ02731.1|3910090_3911146_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	48.0	4.3e-84
AUJ02732.1|3911527_3912274_+	EtfB protein	NA	NA	NA	NA	NA
AUJ02733.1|3912273_3913215_+	electron transfer flavoprotein subunit alpha	NA	NA	NA	NA	NA
AUJ02734.1|3913440_3914259_+	sugar ABC transporter permease	NA	NA	NA	NA	NA
AUJ02735.1|3914248_3915562_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.6	2.9e-13
AUJ02736.1|3916177_3916447_+|transposase	transposase	transposase	NA	NA	NA	NA
AUJ02737.1|3916299_3917286_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	41.4	2.6e-43
AUJ02738.1|3917282_3918365_-	acyltransferase	NA	A9YX16	Burkholderia_phage	33.0	6.6e-40
AUJ02739.1|3918370_3919534_-	glycosyl transferase	NA	NA	NA	NA	NA
AUJ02740.1|3919524_3919815_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ02741.1|3919835_3920762_-	glycosyltransferase	NA	NA	NA	NA	NA
AUJ02742.1|3921793_3922870_-	NAD-dependent dehydratase	NA	A0A1V0SG19	Hokovirus	21.8	2.4e-10
AUJ02743.1|3922904_3923705_-	methyltransferase	NA	H8ZJI6	Ostreococcus_tauri_virus	28.0	9.3e-07
AUJ02744.1|3923751_3924945_-	cystathionine beta-lyase	NA	NA	NA	NA	NA
AUJ02745.1|3925035_3926406_-	cystathionine beta-synthase	NA	A0A1X9I5F1	Streptococcus_phage	38.8	2.6e-49
AUJ02746.1|3926646_3926865_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ02747.1|3927206_3928097_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ02748.1|3928093_3928477_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ02749.1|3928575_3929709_+	type IV pili twitching motility protein PilT	NA	NA	NA	NA	NA
AUJ02750.1|3930048_3930711_-	maleylacetoacetate isomerase	NA	NA	NA	NA	NA
AUJ03623.1|3930754_3931744_-	2-keto-4-pentenoate hydratase	NA	NA	NA	NA	NA
AUJ02751.1|3931905_3932031_-	fumarylacetoacetate hydrolase	NA	NA	NA	NA	NA
AUJ02752.1|3932123_3933506_+	RNA helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	36.3	6.4e-56
AUJ03624.1|3933930_3934284_+	6-carboxytetrahydropterin synthase QueD	NA	NA	NA	NA	NA
AUJ03625.1|3934476_3934812_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ02753.1|3934926_3935601_-	dethiobiotin synthase	NA	NA	NA	NA	NA
AUJ02754.1|3935925_3936408_+	diguanylate cyclase	NA	NA	NA	NA	NA
AUJ02755.1|3936404_3936803_+	transcriptional regulator	NA	NA	NA	NA	NA
AUJ02756.1|3936933_3937902_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	4.3e-99
>prophage 27
CP019088	Xanthomonas oryzae pv. oryzae strain MAI99 chromosome, complete genome	4698819	4050018	4121017	4698819	tRNA,transposase,integrase	Leptospira_phage(27.27%)	59	4036635:4036655	4102747:4102767
4036635:4036655	attL	TTTAGAGCGGCTAACAACACG	NA	NA	NA	NA
AUJ02845.1|4050018_4050987_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	7.3e-99
AUJ02846.1|4051219_4051600_+	response regulator	NA	NA	NA	NA	NA
AUJ03637.1|4051568_4051799_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ02847.1|4051834_4053133_-	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
AUJ02848.1|4053263_4053479_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ02849.1|4053650_4053932_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ02850.1|4054233_4055643_+	cytochrome ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
AUJ02851.1|4055633_4056650_+	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
AUJ02852.1|4057225_4057477_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ02853.1|4058449_4059613_+	glutathione-dependent formaldehyde dehydrogenase	NA	E3SJ82	Synechococcus_phage	28.5	1.0e-09
AUJ02854.1|4060254_4060569_+	zinc/iron-chelating domain-containing protein	NA	NA	NA	NA	NA
AUJ02855.1|4060578_4060800_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ02856.1|4061241_4061454_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ02857.1|4061792_4062530_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ02858.1|4062540_4065192_+	chemotaxis protein	NA	NA	NA	NA	NA
AUJ02859.1|4065188_4065863_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ02860.1|4065859_4066525_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ02861.1|4066609_4068751_-	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
AUJ02862.1|4068840_4070109_-	ABC transporter permease	NA	NA	NA	NA	NA
AUJ02863.1|4070108_4071545_-	ABC transporter permease	NA	NA	NA	NA	NA
AUJ02864.1|4071555_4072278_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.6	6.8e-17
AUJ02865.1|4073672_4075904_-	isocitrate dehydrogenase, NADP-dependent	NA	NA	NA	NA	NA
AUJ03638.1|4076093_4077806_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ02866.1|4077874_4078150_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ02867.1|4078644_4079460_-	preQ(1) synthase	NA	A0A2I7SAX1	Vibrio_phage	35.5	1.3e-35
AUJ03639.1|4079633_4079954_+|integrase	integrase	integrase	NA	NA	NA	NA
AUJ02868.1|4080182_4081502_-	N-acyl-L-amino acid amidohydrolase	NA	NA	NA	NA	NA
AUJ02869.1|4081761_4083006_+	efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
AUJ02870.1|4083100_4086349_+	acriflavine resistance protein B	NA	NA	NA	NA	NA
AUJ02871.1|4086482_4089623_+	acriflavin resistance protein	NA	NA	NA	NA	NA
AUJ03640.1|4090241_4090457_+	VOC family protein	NA	NA	NA	NA	NA
AUJ02872.1|4090933_4092301_-	DUF1338 domain-containing protein	NA	NA	NA	NA	NA
AUJ02873.1|4092310_4092520_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ03641.1|4092618_4093236_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ02874.1|4094089_4094842_-	haloacid dehalogenase	NA	NA	NA	NA	NA
AUJ02875.1|4094879_4095320_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ03642.1|4095526_4095868_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ02876.1|4096093_4096471_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ02877.1|4096667_4096865_-	CPXCG motif-containing cysteine-rich protein	NA	NA	NA	NA	NA
AUJ03643.1|4098005_4098809_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A223VZK2	Agrobacterium_phage	29.3	2.9e-08
AUJ03644.1|4099087_4100437_+	NlpC-P60 family protein	NA	NA	NA	NA	NA
AUJ02878.1|4100433_4101537_+	dipeptide epimerase	NA	NA	NA	NA	NA
AUJ02879.1|4101557_4102616_+|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	43.2	1.8e-74
AUJ02880.1|4103499_4104276_+	hypothetical protein	NA	NA	NA	NA	NA
4102747:4102767	attR	CGTGTTGTTAGCCGCTCTAAA	NA	NA	NA	NA
AUJ02881.1|4104272_4105589_+	amino acid transporter	NA	NA	NA	NA	NA
AUJ02882.1|4105801_4106083_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ02883.1|4106255_4106588_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ02884.1|4106642_4107077_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ02885.1|4107261_4108440_+	glucose dehydrogenase	NA	NA	NA	NA	NA
AUJ02886.1|4108979_4111151_-	beta-glucosidase	NA	NA	NA	NA	NA
AUJ02887.1|4111379_4111736_-	dihydroneopterin aldolase	NA	NA	NA	NA	NA
AUJ02888.1|4111815_4112880_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	57.4	5.1e-101
AUJ02889.1|4113159_4113375_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
AUJ03645.1|4113772_4114219_+|tRNA	glutamyl-tRNA amidotransferase	tRNA	A0A292GL36	Xanthomonas_phage	44.5	3.9e-23
AUJ02890.1|4115239_4116298_+|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	43.2	1.8e-74
AUJ02891.1|4116837_4117800_+	BrkB protein	NA	NA	NA	NA	NA
AUJ02892.1|4117888_4119637_+	DNA primase	NA	A0A1S5RF71	Helicobacter_phage	34.8	6.5e-45
AUJ02893.1|4119908_4120178_+|transposase	transposase	transposase	NA	NA	NA	NA
AUJ02894.1|4120030_4121017_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	41.9	4.5e-43
>prophage 28
CP019088	Xanthomonas oryzae pv. oryzae strain MAI99 chromosome, complete genome	4698819	4136957	4189497	4698819	tRNA,transposase,protease	Leptospira_phage(14.29%)	42	NA	NA
AUJ02908.1|4136957_4137416_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
AUJ02909.1|4138733_4139003_+|transposase	transposase	transposase	NA	NA	NA	NA
AUJ02910.1|4138855_4139842_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	41.4	2.6e-43
AUJ02911.1|4139855_4139978_-|transposase	transposase	transposase	NA	NA	NA	NA
AUJ03648.1|4146040_4147252_-|tRNA	tyrosine--tRNA ligase	tRNA	NA	NA	NA	NA
AUJ02912.1|4147422_4148841_+	hypothetical protein	NA	A0A0K2CNY2	Brevibacillus_phage	37.9	6.9e-13
AUJ02913.1|4149211_4150345_+	anhydro-N-acetylmuramic acid kinase	NA	NA	NA	NA	NA
AUJ02914.1|4150382_4150610_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ03649.1|4150668_4151889_-	MFS transporter	NA	NA	NA	NA	NA
AUJ02915.1|4152283_4153084_-	exodeoxyribonuclease III	NA	E3T4M6	Cafeteria_roenbergensis_virus	29.0	3.1e-26
AUJ02916.1|4153211_4153871_+	orotate phosphoribosyltransferase	NA	NA	NA	NA	NA
AUJ02917.1|4153893_4154652_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ02918.1|4154689_4155487_+	chromosome partitioning protein	NA	Q8JL10	Natrialba_phage	30.3	9.5e-20
AUJ02919.1|4155486_4156413_+	chromosome partitioning protein ParB	NA	I3NLC2	Bifidobacterium_phage	34.9	1.0e-12
AUJ02920.1|4156448_4156757_+	mitomycin resistance protein	NA	NA	NA	NA	NA
AUJ02921.1|4156961_4157927_+	protein CapI	NA	A0A1V0SKV4	Klosneuvirus	30.5	1.6e-29
AUJ02922.1|4158293_4159016_+	dolichol-phosphate mannosyltransferase	NA	NA	NA	NA	NA
AUJ02923.1|4159015_4159357_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ02924.1|4159774_4160323_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ03650.1|4160430_4161825_-	phosphomannomutase/phosphoglucomutase	NA	A0A127AWJ1	Bacillus_phage	29.5	2.6e-49
AUJ02925.1|4162792_4163260_-	deoxyuridine 5'-triphosphate nucleotidohydrolase	NA	Q2NP83	Xanthomonas_phage	96.1	1.1e-79
AUJ02926.1|4163256_4164531_-	bifunctional 4'-phosphopantothenoylcysteine decarboxylase/phosphopantothenoylcysteine synthetase	NA	Q9HH70	Methanothermobacter_phage	31.2	5.8e-35
AUJ03651.1|4164627_4165305_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ02927.1|4167259_4168141_+	sporulation protein	NA	NA	NA	NA	NA
AUJ02928.1|4168147_4168627_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ02929.1|4168718_4169474_+	NADP-dependent 3-hydroxy acid dehydrogenase	NA	NA	NA	NA	NA
AUJ02930.1|4169754_4170645_-|transposase	transposase	transposase	S5WIU1	Leptospira_phage	42.0	1.1e-37
AUJ02931.1|4170497_4170767_-|transposase	transposase	transposase	NA	NA	NA	NA
AUJ02932.1|4170853_4174756_-	avirulence protein	NA	NA	NA	NA	NA
AUJ03652.1|4175539_4176247_-	hypothetical protein	NA	U5P429	Shigella_phage	59.1	3.4e-69
AUJ02933.1|4176291_4176564_-|transposase	transposase	transposase	U5P4I9	Shigella_phage	58.8	1.2e-19
AUJ02934.1|4176937_4177207_-	hypothetical protein	NA	A0A077K814	Ralstonia_phage	64.8	1.2e-19
AUJ02935.1|4177396_4179283_-	arginine decarboxylase	NA	NA	NA	NA	NA
AUJ02936.1|4179521_4180379_+	spermidine synthase	NA	A0A1C9C533	Heterosigma_akashiwo_virus	32.5	2.2e-14
AUJ02937.1|4180817_4181429_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ02938.1|4181621_4182434_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ03653.1|4183112_4183649_+	kinase	NA	NA	NA	NA	NA
AUJ02939.1|4183997_4185983_-	beta-N-acetylglucosaminidase	NA	NA	NA	NA	NA
AUJ03654.1|4186596_4186935_-	transcriptional regulator	NA	NA	NA	NA	NA
AUJ02940.1|4187124_4187403_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ02941.1|4187419_4188940_+|protease	ATP-dependent protease	protease	NA	NA	NA	NA
AUJ02942.1|4189020_4189497_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 29
CP019088	Xanthomonas oryzae pv. oryzae strain MAI99 chromosome, complete genome	4698819	4226084	4294545	4698819	tRNA,transposase	Staphylococcus_phage(20.0%)	60	NA	NA
AUJ02970.1|4226084_4227374_-|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
AUJ02971.1|4227542_4227752_-	CsbD family protein	NA	NA	NA	NA	NA
AUJ02972.1|4227992_4228127_-	entericidin	NA	NA	NA	NA	NA
AUJ02973.1|4228201_4228354_-	entericidin	NA	NA	NA	NA	NA
AUJ02974.1|4228461_4229385_-	arginase	NA	A0A0N9R043	Chrysochromulina_ericina_virus	34.4	1.7e-28
AUJ02975.1|4229706_4230372_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ02976.1|4230368_4230911_+	GTPase	NA	NA	NA	NA	NA
AUJ02977.1|4231414_4232098_+	thymidylate kinase	NA	K7R9G5	Vibrio_phage	33.8	1.3e-14
AUJ02978.1|4233837_4234566_-	pantothenate kinase	NA	NA	NA	NA	NA
AUJ03659.1|4234562_4235528_-	bifunctional biotin--[acetyl-CoA-carboxylase] synthetase/biotin operon repressor	NA	NA	NA	NA	NA
AUJ02979.1|4235885_4236197_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ02980.1|4236205_4236961_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ03660.1|4237113_4238298_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ03661.1|4238417_4240007_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ02981.1|4240126_4241542_-	two-component sensor histidine kinase	NA	NA	NA	NA	NA
AUJ02982.1|4241571_4242255_-	DNA-binding response regulator	NA	NA	NA	NA	NA
AUJ02983.1|4242326_4242629_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ02984.1|4242964_4243975_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
AUJ02985.1|4244391_4245246_-|transposase	transposase	transposase	U5P429	Shigella_phage	57.7	6.3e-86
AUJ02986.1|4245630_4249122_-	Avirulence protein AvrBs3	NA	NA	NA	NA	NA
AUJ02987.1|4249918_4250098_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ02988.1|4250199_4250469_+|transposase	transposase	transposase	NA	NA	NA	NA
AUJ03662.1|4251502_4251697_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ02989.1|4252448_4253024_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ02990.1|4253082_4254606_-	catalase	NA	A0A2K9L0T1	Tupanvirus	48.0	2.8e-97
AUJ02991.1|4255049_4256018_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	2.5e-99
AUJ03663.1|4256461_4256932_-	hemolysin D	NA	NA	NA	NA	NA
AUJ03664.1|4256893_4257082_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ03665.1|4257616_4259749_-	ATP-dependent DNA helicase DinG	NA	NA	NA	NA	NA
AUJ02992.1|4260235_4260610_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ02993.1|4260599_4261451_-	shikimate dehydrogenase	NA	NA	NA	NA	NA
AUJ02994.1|4261503_4262385_+	TolB-like protein	NA	NA	NA	NA	NA
AUJ02995.1|4263050_4265612_-	iron-uptake factor	NA	NA	NA	NA	NA
AUJ02996.1|4265844_4266597_+	endonuclease	NA	H6X497	Enterobacteria_phage	33.3	2.8e-21
AUJ02997.1|4266724_4267639_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUJ02998.1|4267731_4268709_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ02999.1|4268896_4269889_-	porphobilinogen synthase	NA	NA	NA	NA	NA
AUJ03666.1|4270109_4270328_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ03667.1|4270578_4271034_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ03000.1|4271134_4272964_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ03001.1|4273129_4275367_-	S9 family peptidase	NA	NA	NA	NA	NA
AUJ03668.1|4276960_4277977_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	37.6	3.3e-49
AUJ03002.1|4277948_4278149_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ03003.1|4278147_4279524_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	48.1	9.9e-65
AUJ03004.1|4281942_4282953_+	energy transducer TonB	NA	NA	NA	NA	NA
AUJ03005.1|4283353_4284547_-	sodium ABC transporter permease	NA	NA	NA	NA	NA
AUJ03006.1|4284543_4285290_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.3	5.2e-20
AUJ03007.1|4285321_4286923_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
AUJ03008.1|4286983_4287184_-	transcriptional regulator	NA	NA	NA	NA	NA
AUJ03669.1|4287180_4287588_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ03009.1|4288216_4288489_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ03010.1|4288554_4289544_+	cation transporter	NA	NA	NA	NA	NA
AUJ03011.1|4289613_4290375_-	ferredoxin--NADP(+) reductase	NA	NA	NA	NA	NA
AUJ03012.1|4290477_4291473_+	ABC transporter	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	30.2	8.5e-26
AUJ03013.1|4291490_4292282_+	ABC transporter permease	NA	NA	NA	NA	NA
AUJ03014.1|4292283_4292868_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ03015.1|4292986_4293925_+	2-dehydropantoate 2-reductase	NA	NA	NA	NA	NA
AUJ03016.1|4293924_4294107_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ03017.1|4294038_4294242_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ03018.1|4294281_4294545_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 30
CP019088	Xanthomonas oryzae pv. oryzae strain MAI99 chromosome, complete genome	4698819	4369012	4427794	4698819	transposase	Ralstonia_phage(42.86%)	42	NA	NA
AUJ03068.1|4369012_4370389_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	46.6	1.3e-61
AUJ03069.1|4370602_4371274_+	4-carboxy-4-hydroxy-2-oxoadipate aldolase/oxaloacetate decarboxylase	NA	NA	NA	NA	NA
AUJ03070.1|4372313_4372553_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ03071.1|4372549_4373572_+	4-oxalomesaconate hydratase	NA	NA	NA	NA	NA
AUJ03072.1|4373961_4374129_-	50S ribosomal protein L33	NA	NA	NA	NA	NA
AUJ03073.1|4374142_4374379_-	50S ribosomal protein L28	NA	NA	NA	NA	NA
AUJ03678.1|4374563_4374890_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ03679.1|4377402_4378041_-	16S rRNA methyltransferase G	NA	NA	NA	NA	NA
AUJ03680.1|4378263_4379892_+	alkaline phosphatase	NA	NA	NA	NA	NA
AUJ03074.1|4381665_4382262_-	4-phosphopantetheinyl transferase	NA	NA	NA	NA	NA
AUJ03075.1|4382388_4382640_+	transglycosylase	NA	NA	NA	NA	NA
AUJ03076.1|4382701_4383139_-	aldehyde-activating protein	NA	NA	NA	NA	NA
AUJ03077.1|4383135_4383915_-	exodeoxyribonuclease III	NA	NA	NA	NA	NA
AUJ03078.1|4385593_4387321_-	cation acetate symporter	NA	NA	NA	NA	NA
AUJ03079.1|4387317_4387635_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ03080.1|4389400_4391344_+	acetyl-coenzyme A synthetase	NA	A0A2H4PQU7	Staphylococcus_phage	37.8	8.7e-83
AUJ03081.1|4391605_4392274_+	DNA-binding response regulator	NA	NA	NA	NA	NA
AUJ03082.1|4393538_4393742_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ03083.1|4395095_4395317_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ03084.1|4395313_4396324_+	oxidoreductase	NA	NA	NA	NA	NA
AUJ03085.1|4396320_4397193_+	amidohydrolase	NA	NA	NA	NA	NA
AUJ03086.1|4397189_4397960_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
AUJ03087.1|4398129_4398987_+	2-hydroxyhepta-2,4-diene-1,7-dioate isomerase	NA	NA	NA	NA	NA
AUJ03088.1|4399509_4400829_+	L-fuconate dehydratase	NA	NA	NA	NA	NA
AUJ03089.1|4401323_4402292_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	1.9e-99
AUJ03681.1|4402417_4402783_-	L-fucose mutarotase	NA	NA	NA	NA	NA
AUJ03090.1|4402779_4404081_-	L-fucose:H+ symporter permease	NA	NA	NA	NA	NA
AUJ03091.1|4404261_4405038_+	transcriptional regulator	NA	NA	NA	NA	NA
AUJ03682.1|4405514_4406099_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ03683.1|4406291_4409741_-	hybrid sensor histidine kinase/response regulator	NA	NA	NA	NA	NA
AUJ03092.1|4410492_4413135_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ03684.1|4413238_4415638_-	NdvB protein	NA	NA	NA	NA	NA
AUJ03093.1|4415640_4417023_-	MFS transporter	NA	NA	NA	NA	NA
AUJ03685.1|4417237_4417765_+	gluconokinase	NA	NA	NA	NA	NA
AUJ03094.1|4418669_4420331_+	polyvinylalcohol dehydrogenase	NA	A0A0M4JT37	Mollivirus	36.1	1.7e-82
AUJ03095.1|4420662_4420968_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ03686.1|4420870_4421311_-	3-dehydroquinate dehydratase	NA	NA	NA	NA	NA
AUJ03096.1|4421330_4421759_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ03097.1|4423299_4423569_+|transposase	transposase	transposase	NA	NA	NA	NA
AUJ03098.1|4423421_4424408_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	41.4	2.6e-43
AUJ03099.1|4424426_4425395_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	1.9e-99
AUJ03100.1|4426825_4427794_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	2.5e-99
>prophage 31
CP019088	Xanthomonas oryzae pv. oryzae strain MAI99 chromosome, complete genome	4698819	4463064	4533829	4698819	tRNA,transposase	Acidithiobacillus_phage(21.43%)	47	NA	NA
AUJ03119.1|4463064_4463982_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	62.5	3.1e-83
AUJ03120.1|4464072_4464612_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ03121.1|4464615_4465953_+	xylose isomerase	NA	NA	NA	NA	NA
AUJ03122.1|4466178_4467261_-	LacI family transcriptional regulator	NA	NA	NA	NA	NA
AUJ03123.1|4467400_4469596_+	alpha-glucuronidase	NA	NA	NA	NA	NA
AUJ03124.1|4469592_4471557_+	9-O-acetylesterase	NA	NA	NA	NA	NA
AUJ03125.1|4471568_4472828_+	bifunctional D-altronate/D-mannonate dehydratase	NA	Q6A202	Oenococcus_phage	26.0	3.5e-40
AUJ03689.1|4472827_4474528_+	glycoside hydrolase 43 family protein	NA	NA	NA	NA	NA
AUJ03126.1|4474530_4477245_+	glucan 1,4-alpha-glucosidase	NA	NA	NA	NA	NA
AUJ03127.1|4477467_4478988_+	mannitol dehydrogenase	NA	G8DCZ3	Micromonas_pusilla_virus	31.4	2.5e-45
AUJ03128.1|4478982_4480041_-|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	43.2	1.8e-74
AUJ03129.1|4480196_4481573_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.3	2.1e-62
AUJ03130.1|4481749_4482853_+	restriction endonuclease	NA	A0A1S5SAB0	Streptococcus_phage	40.4	9.4e-58
AUJ03131.1|4482944_4483319_-	glyoxalase/bleomycin resistance/extradiol dioxygenase family protein	NA	NA	NA	NA	NA
AUJ03690.1|4484019_4485036_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	37.6	1.9e-49
AUJ03132.1|4485658_4486714_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ03133.1|4486940_4488359_-	uronate isomerase	NA	NA	NA	NA	NA
AUJ03134.1|4488399_4489377_-	1,4-beta-xylanase	NA	NA	NA	NA	NA
AUJ03135.1|4490781_4492263_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ03691.1|4492604_4495478_+	TonB-dependent receptor	NA	NA	NA	NA	NA
AUJ03136.1|4495576_4497064_+	MFS transporter	NA	NA	NA	NA	NA
AUJ03137.1|4497095_4498130_+	alpha-N-arabinofuranosidase	NA	NA	NA	NA	NA
AUJ03138.1|4498471_4499005_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ03139.1|4499286_4500255_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.7	6.6e-100
AUJ03140.1|4500257_4500440_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ03692.1|4501728_4502301_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ03141.1|4502439_4502658_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ03142.1|4502803_4503058_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ03143.1|4503294_4504275_-	alcohol dehydrogenase	NA	NA	NA	NA	NA
AUJ03144.1|4504470_4507134_-	glycerol-3-phosphate 1-O-acyltransferase	NA	NA	NA	NA	NA
AUJ03145.1|4507133_4508114_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ03146.1|4508106_4508352_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ03147.1|4508520_4509573_+	LacI family transcriptional regulator	NA	NA	NA	NA	NA
AUJ03148.1|4509737_4512776_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ03149.1|4513077_4513509_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ03150.1|4513614_4514991_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.7	3.2e-63
AUJ03151.1|4517739_4519269_+	tryptophan halogenase	NA	M4T1E3	Cyanophage	28.5	3.9e-46
AUJ03152.1|4519575_4520355_-	orotidine 5'-phosphate decarboxylase	NA	NA	NA	NA	NA
AUJ03693.1|4520351_4521311_-	acid phosphatase	NA	NA	NA	NA	NA
AUJ03153.1|4521641_4522307_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ03154.1|4523705_4525682_-	DNA helicase Rep	NA	A7KV33	Bacillus_phage	37.2	6.3e-113
AUJ03155.1|4525888_4526518_+	thymidine kinase	NA	A0A023W530	Serratia_phage	55.0	1.1e-52
AUJ03156.1|4526976_4528215_+	histidine kinase	NA	NA	NA	NA	NA
AUJ03694.1|4528357_4529956_-	glucan biosynthesis protein D	NA	NA	NA	NA	NA
AUJ03157.1|4530024_4531116_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ03695.1|4531348_4532164_-	DNA-formamidopyrimidine glycosylase	NA	A0A127AWE5	Bacillus_phage	27.0	1.1e-18
AUJ03158.1|4532452_4533829_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.3	2.1e-62
>prophage 32
CP019088	Xanthomonas oryzae pv. oryzae strain MAI99 chromosome, complete genome	4698819	4548583	4611375	4698819	transposase,protease	Acidithiobacillus_phage(31.25%)	50	NA	NA
AUJ03166.1|4548583_4549960_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	46.3	4.3e-60
AUJ03167.1|4550091_4551273_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ03168.1|4551370_4554802_-	ATP-binding protein	NA	NA	NA	NA	NA
AUJ03169.1|4554949_4555648_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ03170.1|4555631_4557104_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ03171.1|4557100_4557688_-	cytoplasmic protein	NA	NA	NA	NA	NA
AUJ03172.1|4557687_4558884_-	chromosome segregation protein SMC	NA	NA	NA	NA	NA
AUJ03173.1|4558957_4559587_-	GTP cyclohydrolase I FolE	NA	E7DN69	Pneumococcus_phage	49.5	4.2e-47
AUJ03174.1|4559680_4560178_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
AUJ03696.1|4560293_4560437_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ03175.1|4561591_4562116_+	FUSC family protein	NA	NA	NA	NA	NA
AUJ03697.1|4562087_4563104_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	37.6	2.5e-49
AUJ03176.1|4563510_4564872_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	27.1	5.8e-33
AUJ03177.1|4565052_4566429_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	48.1	9.9e-65
AUJ03698.1|4567117_4567831_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ03178.1|4567861_4568368_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ03179.1|4568641_4568848_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ03180.1|4568834_4569947_+	plasmid stabilization protein ParE	NA	NA	NA	NA	NA
AUJ03181.1|4570295_4571282_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	40.6	2.9e-42
AUJ03182.1|4571343_4571979_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ03183.1|4572160_4572955_-	peptidase	NA	NA	NA	NA	NA
AUJ03699.1|4573125_4573599_+	ATPase	NA	NA	NA	NA	NA
AUJ03184.1|4576081_4576411_-	thiol reductase thioredoxin	NA	A0A0K1Y9C9	Streptomyces_phage	32.5	7.2e-06
AUJ03185.1|4576431_4576830_-	attachment protein	NA	NA	NA	NA	NA
AUJ03186.1|4577789_4578260_-	DNA mismatch repair protein MutT	NA	NA	NA	NA	NA
AUJ03187.1|4580007_4581384_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.0	6.0e-62
AUJ03188.1|4581426_4581507_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ03189.1|4581528_4581912_+|protease	metalloprotease	protease	NA	NA	NA	NA
AUJ03190.1|4581908_4582220_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ03700.1|4582479_4582962_-	ATPase	NA	NA	NA	NA	NA
AUJ03701.1|4583510_4584428_+	histidine kinase	NA	NA	NA	NA	NA
AUJ03191.1|4584669_4584858_+	CsbD family protein	NA	NA	NA	NA	NA
AUJ03192.1|4585502_4585760_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ03193.1|4585884_4586334_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ03194.1|4586553_4587471_+	hypothetical protein	NA	K7PHD1	Enterobacteria_phage	47.3	1.7e-68
AUJ03195.1|4587480_4588425_-	hypothetical protein	NA	S5WIU1	Leptospira_phage	38.7	2.0e-32
AUJ03196.1|4588789_4591570_-	TonB-dependent receptor	NA	NA	NA	NA	NA
AUJ03197.1|4591856_4592879_+	2-keto-3-deoxygluconate kinase	NA	NA	NA	NA	NA
AUJ03702.1|4593499_4594708_-	trans-2-enoyl-CoA reductase	NA	NA	NA	NA	NA
AUJ03198.1|4596679_4597846_+	alpha-hydroxy-acid oxidizing enzyme	NA	NA	NA	NA	NA
AUJ03199.1|4599797_4601174_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	54.8	1.0e-77
AUJ03200.1|4601184_4601478_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ03201.1|4601588_4603784_-	ligand-gated channel	NA	A0A1B0VCF0	Salmonella_phage	40.6	2.4e-65
AUJ03202.1|4603882_4605085_+	aromatic amino acid aminotransferase	NA	NA	NA	NA	NA
AUJ03203.1|4605355_4606366_+	fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	37.8	7.3e-49
AUJ03204.1|4606640_4607108_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ03703.1|4607757_4608300_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	42.3	3.0e-33
AUJ03205.1|4608484_4609861_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	55.1	4.6e-78
AUJ03206.1|4609976_4610300_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ03207.1|4610406_4611375_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	1.9e-99
>prophage 33
CP019088	Xanthomonas oryzae pv. oryzae strain MAI99 chromosome, complete genome	4698819	4619261	4686951	4698819	transposase,protease	Ralstonia_phage(25.0%)	57	NA	NA
AUJ03211.1|4619261_4620593_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	46.6	2.2e-61
AUJ03705.1|4620658_4621774_+	enterochelin esterase	NA	NA	NA	NA	NA
AUJ03706.1|4621885_4622296_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ03212.1|4622555_4623011_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ03213.1|4622943_4623141_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ03214.1|4623234_4624122_-	pseudouridylate synthase	NA	NA	NA	NA	NA
AUJ03215.1|4624455_4626033_+	chlamydia polymorphic membrane family protein	NA	NA	NA	NA	NA
AUJ03216.1|4626527_4627355_+	restriction endonuclease	NA	NA	NA	NA	NA
AUJ03217.1|4628081_4629140_+|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	42.9	2.6e-73
AUJ03218.1|4629296_4629479_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ03219.1|4630999_4631986_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	41.4	2.6e-43
AUJ03707.1|4632222_4632744_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ03220.1|4632781_4633750_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	1.9e-99
AUJ03221.1|4634218_4634956_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ03222.1|4634973_4635666_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ03223.1|4636859_4637885_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	37.6	1.9e-49
AUJ03224.1|4637922_4638255_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ03225.1|4638247_4638724_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ03226.1|4638726_4639161_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ03227.1|4639276_4639522_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ03228.1|4639522_4639717_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ03229.1|4639858_4640191_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ03230.1|4640439_4640538_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ03231.1|4640640_4642035_-	nucleoside hydrolase	NA	NA	NA	NA	NA
AUJ03232.1|4642918_4643173_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	71.4	5.9e-16
AUJ03233.1|4643190_4643469_-	plasmid maintenance system killer protein	NA	A0A222YWE2	Escherichia_phage	37.0	2.9e-08
AUJ03234.1|4643566_4645828_-	exodeoxyribonuclease V subunit alpha	NA	A0A0N9S864	Staphylococcus_phage	44.9	1.5e-09
AUJ03235.1|4646015_4650077_-	exodeoxyribonuclease V subunit beta	NA	S5MMD7	Bacillus_phage	22.5	3.2e-10
AUJ03236.1|4650073_4653487_-	exodeoxyribonuclease V subunit gamma	NA	NA	NA	NA	NA
AUJ03237.1|4653812_4654466_-	hypothetical protein	NA	G3M9Y6	Bacillus_virus	24.2	7.1e-05
AUJ03238.1|4654516_4655653_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ03239.1|4655792_4656761_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	7.3e-99
AUJ03708.1|4656940_4657942_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	61.5	2.7e-96
AUJ03240.1|4659518_4660208_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.8	1.8e-35
AUJ03241.1|4660220_4661378_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ03709.1|4661513_4662701_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ03242.1|4662782_4662971_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ03243.1|4663016_4664003_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	40.6	9.9e-43
AUJ03244.1|4664327_4665122_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	28.5	5.8e-09
AUJ03245.1|4665121_4665871_+	ABC transporter permease	NA	NA	NA	NA	NA
AUJ03246.1|4665882_4666434_+	outer membrane lipid asymmetry maintenance protein MlaD	NA	NA	NA	NA	NA
AUJ03247.1|4666430_4667093_+	organic solvent ABC transporter	NA	NA	NA	NA	NA
AUJ03248.1|4667067_4667373_+	anti-sigma B factor antagonist	NA	NA	NA	NA	NA
AUJ03249.1|4667383_4668442_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ03250.1|4668514_4669036_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ03251.1|4669123_4670500_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.7	3.2e-63
AUJ03710.1|4670868_4671414_-	glutathione peroxidase	NA	Q70H87	Fowlpox_virus	34.5	2.0e-16
AUJ03711.1|4672553_4674134_-	recombinase RmuC	NA	NA	NA	NA	NA
AUJ03252.1|4674481_4675450_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	1.5e-99
AUJ03253.1|4678024_4678540_-	PucR family transcriptional regulator	NA	NA	NA	NA	NA
AUJ03254.1|4678611_4679781_-	glycerate kinase	NA	W6LM47	Streptococcus_phage	38.6	4.9e-41
AUJ03255.1|4679806_4681171_-	MFS transporter	NA	NA	NA	NA	NA
AUJ03256.1|4682965_4683286_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ03257.1|4683404_4684571_-	rRNA large subunit methyltransferase I	NA	NA	NA	NA	NA
AUJ03258.1|4684833_4685790_+	hypothetical protein	NA	K4F9T9	Cronobacter_phage	29.9	1.4e-30
AUJ03259.1|4685977_4686169_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ03260.1|4686165_4686951_+|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
