The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP025001	Bacillus siamensis strain SCSIO 05746 chromosome, complete genome	4268316	264860	310069	4268316	holin,lysis,coat	Bacillus_phage(50.0%)	48	NA	NA
AUJ75564.1|264860_265541_-|lysis	CidB/LrgB family autolysis modulator	lysis	NA	NA	NA	NA
AUJ75565.1|265522_265909_-|holin	holin-like protein CidA	holin	NA	NA	NA	NA
AUJ75566.1|266015_266924_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUJ75567.1|266926_267745_+	hydroxyethylthiazole kinase	NA	NA	NA	NA	NA
AUJ75568.1|267741_268410_+	thiamine phosphate synthase	NA	NA	NA	NA	NA
AUJ75569.1|268545_269994_+	iron transporter	NA	NA	NA	NA	NA
AUJ75570.1|269990_271142_+	Efem/EfeO family lipoprotein	NA	NA	NA	NA	NA
AUJ75571.1|271160_272417_+	deferrochelatase/peroxidase EfeB	NA	NA	NA	NA	NA
AUJ75572.1|272501_273104_+	DsbA family oxidoreductase	NA	NA	NA	NA	NA
AUJ75573.1|273800_274481_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AUJ75574.1|274674_274836_-	DNA-binding anti-repressor SinI	NA	NA	NA	NA	NA
AUJ75575.1|275171_275795_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
AUJ79258.1|275874_276261_+	GtrA family protein	NA	NA	NA	NA	NA
AUJ75576.1|276312_277497_+	galactokinase	NA	NA	NA	NA	NA
AUJ75577.1|277486_279028_+	UDP-glucose--hexose-1-phosphate uridylyltransferase	NA	NA	NA	NA	NA
AUJ75578.1|279044_279290_-	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
AUJ79259.1|279792_280758_+	cytochrome aa3 quinol oxidase subunit II	NA	NA	NA	NA	NA
AUJ75579.1|280785_282735_+	cytochrome aa3 quinol oxidase subunit I	NA	NA	NA	NA	NA
AUJ75580.1|282749_283364_+	cytochrome aa3 quinol oxidase subunit III	NA	NA	NA	NA	NA
AUJ75581.1|283365_283734_+	cytochrome aa3 quinol oxidase subunit IV	NA	NA	NA	NA	NA
AUJ75582.1|283777_284038_-	spore gernimation protein	NA	NA	NA	NA	NA
AUJ79260.1|284402_284792_+	N-acetyltransferase	NA	NA	NA	NA	NA
AUJ75583.1|284985_286173_+	FtsW/RodA/SpoVE family cell cycle protein	NA	NA	NA	NA	NA
AUJ75584.1|286275_287025_+	oxygen-insensitive NADPH nitroreductase	NA	NA	NA	NA	NA
AUJ75585.1|287186_288188_+	LLM class flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
AUJ75586.1|288229_290641_-	peptidase S8	NA	A0A217EQY2	Bacillus_phage	36.8	2.9e-19
AUJ75587.1|291164_291479_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ75588.1|291502_292333_+	transcription antiterminator	NA	NA	NA	NA	NA
AUJ75589.1|292552_293935_+	PTS sucrose transporter subunit IIBC	NA	NA	NA	NA	NA
AUJ75590.1|293931_295371_+	sucrose-6-phosphate hydrolase	NA	F8WPR5	Bacillus_phage	25.5	1.1e-21
AUJ75591.1|295470_295710_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ75592.1|295741_296554_-	hydroxymethylpyrimidine/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
AUJ75593.1|296703_297042_+	PadR family transcriptional regulator	NA	NA	NA	NA	NA
AUJ75594.1|297034_297670_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ75595.1|297714_298242_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ79261.1|298326_299133_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
AUJ75596.1|299147_299831_+	uracil-DNA glycosylase	NA	A0A0B5IW78	Pandoravirus	48.8	2.4e-48
AUJ75597.1|299889_300312_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ75598.1|300330_301650_+	purine permease	NA	NA	NA	NA	NA
AUJ75599.1|301712_302084_+	DUF423 domain-containing protein	NA	NA	NA	NA	NA
AUJ75600.1|302130_302673_-|coat	spore coat protein GerQ	coat	NA	NA	NA	NA
AUJ75601.1|302953_303724_+	glycosyltransferase family 2 protein	NA	A0A0F7L2F7	uncultured_marine_virus	27.7	7.6e-06
AUJ75602.1|303728_305153_+	CDP-glycerol glycerophosphotransferase family protein	NA	NA	NA	NA	NA
AUJ75603.1|305175_306345_+	DegT/DnrJ/EryC1/StrS family aminotransferase	NA	NA	NA	NA	NA
AUJ75604.1|306345_307209_+	N-acetyltransferase	NA	NA	NA	NA	NA
AUJ75605.1|307208_308330_+|coat	spore coat protein	coat	NA	NA	NA	NA
AUJ75606.1|308319_309063_+|coat	spore coat protein	coat	NA	NA	NA	NA
AUJ75607.1|309064_310069_+|coat	spore coat protein	coat	NA	NA	NA	NA
>prophage 2
CP025001	Bacillus siamensis strain SCSIO 05746 chromosome, complete genome	4268316	1360398	1597985	4268316	holin,head,terminase,tRNA,portal,protease,capsid,integrase,tail	Bacillus_phage(58.29%)	299	1403790:1403823	1572872:1572905
AUJ76591.1|1360398_1360842_+|tRNA	D-aminoacyl-tRNA deacylase	tRNA	NA	NA	NA	NA
AUJ76592.1|1360867_1362430_-	N-acetylmuramoyl-L-alanine amidase	NA	E5DV68	Deep-sea_thermophilic_phage	33.3	1.5e-13
AUJ76593.1|1363087_1364362_+|tRNA	histidine--tRNA ligase	tRNA	NA	NA	NA	NA
AUJ76594.1|1364376_1366155_+|tRNA	aspartate--tRNA ligase	tRNA	A0A1V0SIS0	Klosneuvirus	29.1	8.7e-13
AUJ76595.1|1366481_1367246_+|tRNA	tRNA threonylcarbamoyladenosine dehydratase	tRNA	A0A291ATS8	Pandoravirus	32.5	9.1e-20
AUJ76596.1|1367364_1368630_-	replication-associated recombination protein A	NA	A0A127AWE7	Bacillus_phage	52.3	3.8e-111
AUJ76597.1|1368824_1369241_+	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
AUJ76598.1|1369260_1370400_+	cysteine desulfurase	NA	NA	NA	NA	NA
AUJ76599.1|1370436_1371552_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
AUJ79314.1|1371639_1372260_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ76600.1|1372278_1374657_+	ATP-dependent RecD-like DNA helicase	NA	A0A0K2FLP8	Brevibacillus_phage	29.4	2.2e-80
AUJ76601.1|1374775_1375234_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ76602.1|1375246_1375438_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ76603.1|1375459_1375591_+	DUF3918 domain-containing protein	NA	NA	NA	NA	NA
AUJ76604.1|1375625_1376282_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
AUJ76605.1|1376300_1376951_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
AUJ76606.1|1377008_1377836_-	amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUJ76607.1|1377856_1378585_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	41.4	6.6e-36
AUJ76608.1|1378803_1379865_+	AI-2E family transporter	NA	NA	NA	NA	NA
AUJ76609.1|1380196_1382833_+|tRNA	alanine--tRNA ligase	tRNA	A0A2K9L3D8	Tupanvirus	34.1	3.1e-67
AUJ76610.1|1382917_1383184_+	DUF965 domain-containing protein	NA	NA	NA	NA	NA
AUJ76611.1|1383192_1383609_+	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
AUJ76612.1|1383621_1383903_+	DUF1292 domain-containing protein	NA	NA	NA	NA	NA
AUJ76613.1|1384013_1385105_+	endolytic transglycosylase MltG	NA	NA	NA	NA	NA
AUJ76614.1|1385255_1385909_+	O-methyltransferase	NA	NA	NA	NA	NA
AUJ79315.1|1385915_1386845_+|protease	collagenase-like protease	protease	NA	NA	NA	NA
AUJ76615.1|1386862_1388131_+|protease	collagenase-like protease	protease	Q6DW11	Phage_TP	32.1	7.3e-38
AUJ76616.1|1388136_1388769_+	uridine kinase	NA	A0A1V0SAA3	Catovirus	39.2	4.1e-34
AUJ76617.1|1388833_1389994_-|integrase	site-specific integrase	integrase	S6C485	Thermus_phage	36.6	5.8e-66
AUJ76618.1|1390301_1391483_+	transcriptional regulator	NA	A0A288WGA2	Bacillus_phage	25.6	1.7e-09
AUJ79316.1|1391854_1392244_-	XRE family transcriptional regulator	NA	A0A0U4B088	Bacillus_phage	30.6	2.2e-06
AUJ76619.1|1392414_1392606_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AUJ76620.1|1392646_1392964_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ76621.1|1392977_1393862_+	DNA replication protein DnaD	NA	A0A0U3TZZ4	Bacillus_phage	48.7	1.9e-61
AUJ79317.1|1393845_1394676_+	DNA replication protein	NA	A0A0U3U1U1	Bacillus_phage	35.1	1.4e-34
AUJ76622.1|1394991_1395540_+	hypothetical protein	NA	A0A0K2CYJ0	Paenibacillus_phage	36.5	2.7e-05
AUJ76623.1|1396036_1396240_+	hypothetical protein	NA	A0A2H4J4M6	uncultured_Caudovirales_phage	53.8	1.7e-13
AUJ76624.1|1396380_1396761_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ76625.1|1396757_1397165_+	hypothetical protein	NA	W8CYU3	Bacillus_phage	44.3	7.2e-24
AUJ76626.1|1397161_1397419_+	hypothetical protein	NA	F8WQ54	Bacillus_phage	40.0	1.1e-06
AUJ76627.1|1397422_1398247_+	DNA methyltransferase	NA	U5P0W8	Brevibacillus_phage	58.3	1.5e-89
AUJ76628.1|1398356_1398680_+	hypothetical protein	NA	M5ABU9	Bacillus_phage	33.7	7.8e-05
AUJ76629.1|1398676_1399360_+	dUTPase	NA	R9TQ23	Paenibacillus_phage	43.3	5.6e-37
AUJ76630.1|1399359_1399761_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ76631.1|1399757_1400030_+	hypothetical protein	NA	F8WQ59	Bacillus_phage	48.9	4.8e-16
AUJ76632.1|1400026_1400335_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ76633.1|1400331_1400577_+	hypothetical protein	NA	A0A217ERB6	Bacillus_phage	46.2	9.4e-11
AUJ76634.1|1400579_1401014_+	hypothetical protein	NA	A0A2H4J8A0	uncultured_Caudovirales_phage	70.7	1.2e-48
AUJ79318.1|1401694_1402147_+	ArpU family transcriptional regulator	NA	S6AVV9	Thermus_phage	55.9	2.2e-37
AUJ76635.1|1402143_1402686_+|integrase	site-specific integrase	integrase	D2XR58	Bacillus_phage	65.6	1.2e-61
AUJ76636.1|1403173_1403386_+	cell division protein FtsK	NA	A0A0K2CPG8	Brevibacillus_phage	54.1	5.1e-05
AUJ76637.1|1403452_1403650_+	hypothetical protein	NA	NA	NA	NA	NA
1403790:1403823	attL	CCAATCGGGAGGGCGCTTTTTCTATTGGAGGGAT	NA	NA	NA	NA
AUJ76638.1|1404144_1404426_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ76639.1|1404422_1404737_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ76640.1|1404784_1405153_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ76641.1|1405142_1405508_+	HNH endonuclease	NA	A0A1U7Q1S7	Geobacillus_virus	55.0	2.1e-30
AUJ79319.1|1405529_1405727_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ76642.1|1405736_1406252_+|terminase	phage terminase small subunit P27 family	terminase	A6M947	Geobacillus_virus	44.6	9.8e-34
AUJ76643.1|1406248_1407958_+|terminase	terminase large subunit	terminase	A0A0S2GLF0	Bacillus_phage	62.6	2.1e-205
AUJ76644.1|1408146_1409427_+|portal	phage portal protein	portal	D6R3Y6	Bacillus_phage	63.3	2.6e-152
AUJ76645.1|1409389_1410016_+|head,protease	HK97 family phage prohead protease	head,protease	Q9ZXF7	Bacillus_phage	79.1	1.5e-84
AUJ76646.1|1410053_1411346_+|capsid	phage major capsid protein	capsid	A0A0A7RTL2	Clostridium_phage	47.6	9.8e-91
AUJ76647.1|1411373_1411772_+	collagen-like protein	NA	D6R3Z0	Bacillus_phage	43.6	1.4e-11
AUJ76648.1|1411789_1412092_+	DNA-packaging protein	NA	A0A0S2GLH6	Bacillus_phage	40.5	2.6e-10
AUJ76649.1|1412081_1412399_+|head,tail	head-tail adaptor protein	head,tail	A0A2H4JCB1	uncultured_Caudovirales_phage	36.3	1.1e-11
AUJ76650.1|1412395_1412794_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ76651.1|1412790_1413174_+	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
AUJ76652.1|1413188_1413803_+|tail	phage tail protein	tail	A0A2H4J8F3	uncultured_Caudovirales_phage	33.9	1.1e-23
AUJ76653.1|1413861_1414230_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ76654.1|1414435_1418923_+|tail	phage tail tape measure protein	tail	A0A1Q1PVX7	Staphylococcus_phage	42.3	1.1e-64
AUJ76655.1|1418916_1419756_+|tail	phage tail family protein	tail	D6R3Z9	Bacillus_phage	58.6	1.6e-94
AUJ76656.1|1419770_1421474_+	alkaline phosphatase	NA	D6R400	Bacillus_phage	56.7	3.6e-181
AUJ76657.1|1421524_1424089_+	peptidase G2	NA	D6R401	Bacillus_phage	57.0	6.5e-288
AUJ76658.1|1424101_1425379_+	hypothetical protein	NA	D6R402	Bacillus_phage	79.1	1.8e-145
AUJ76659.1|1425375_1425738_+	hypothetical protein	NA	Q9ZXE0	Bacillus_phage	92.5	6.4e-56
AUJ76660.1|1425734_1425923_+	XkdX family protein	NA	Q9ZXD9	Bacillus_phage	96.8	5.3e-30
AUJ76661.1|1425972_1426395_+|holin	holin	holin	D6R405	Bacillus_phage	87.9	2.7e-58
AUJ76662.1|1426436_1427450_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A1J0MS59	Bacillus_phage	96.1	3.1e-185
AUJ76663.1|1427556_1428249_-	hypothetical protein	NA	Q9AZW5	Lactococcus_phage	32.6	1.1e-11
AUJ76664.1|1428424_1428634_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ76665.1|1428666_1429299_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ76666.1|1429742_1430174_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ76667.1|1430151_1430775_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ76668.1|1431267_1432428_-|integrase	site-specific integrase	integrase	S6C485	Thermus_phage	36.6	5.8e-66
AUJ76669.1|1432735_1433917_+	transcriptional regulator	NA	A0A288WGA2	Bacillus_phage	25.6	1.7e-09
AUJ79320.1|1434288_1434678_-	XRE family transcriptional regulator	NA	A0A0U4B088	Bacillus_phage	30.6	2.2e-06
AUJ76670.1|1434848_1435040_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AUJ76671.1|1435080_1435398_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ76672.1|1435411_1436296_+	DNA replication protein DnaD	NA	A0A0U3TZZ4	Bacillus_phage	48.7	1.9e-61
AUJ79321.1|1436279_1437110_+	DNA replication protein	NA	A0A0U3U1U1	Bacillus_phage	35.1	1.4e-34
AUJ76673.1|1437425_1437974_+	hypothetical protein	NA	A0A0K2CYJ0	Paenibacillus_phage	36.5	2.7e-05
AUJ76674.1|1438470_1438674_+	hypothetical protein	NA	A0A2H4J4M6	uncultured_Caudovirales_phage	53.8	1.7e-13
AUJ76675.1|1438814_1439195_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ76676.1|1439191_1439599_+	hypothetical protein	NA	W8CYU3	Bacillus_phage	44.3	7.2e-24
AUJ76677.1|1439595_1439853_+	hypothetical protein	NA	F8WQ54	Bacillus_phage	40.0	1.1e-06
AUJ76678.1|1439856_1440681_+	DNA methyltransferase	NA	U5P0W8	Brevibacillus_phage	58.3	1.5e-89
AUJ76679.1|1440790_1441114_+	hypothetical protein	NA	M5ABU9	Bacillus_phage	33.7	7.8e-05
AUJ76680.1|1441110_1441794_+	dUTPase	NA	R9TQ23	Paenibacillus_phage	43.3	5.6e-37
AUJ76681.1|1441793_1442195_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ76682.1|1442191_1442464_+	hypothetical protein	NA	F8WQ59	Bacillus_phage	48.9	4.8e-16
AUJ76683.1|1442460_1442769_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ76684.1|1442765_1443011_+	hypothetical protein	NA	A0A217ERB6	Bacillus_phage	46.2	9.4e-11
AUJ76685.1|1443013_1443448_+	hypothetical protein	NA	A0A2H4J8A0	uncultured_Caudovirales_phage	70.7	1.2e-48
AUJ79322.1|1444128_1444581_+	ArpU family transcriptional regulator	NA	S6AVV9	Thermus_phage	55.9	2.2e-37
AUJ76686.1|1444577_1445120_+|integrase	site-specific integrase	integrase	D2XR58	Bacillus_phage	65.6	1.2e-61
AUJ76687.1|1445607_1445820_+	cell division protein FtsK	NA	A0A0K2CPG8	Brevibacillus_phage	54.1	5.1e-05
AUJ76688.1|1445886_1446084_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ76689.1|1446578_1446860_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ76690.1|1446856_1447171_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ76691.1|1447218_1447587_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ76692.1|1447576_1447942_+	HNH endonuclease	NA	A0A1U7Q1S7	Geobacillus_virus	55.0	2.1e-30
AUJ79323.1|1447963_1448161_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ76693.1|1448170_1448686_+|terminase	phage terminase small subunit P27 family	terminase	A6M947	Geobacillus_virus	44.6	9.8e-34
AUJ76694.1|1448682_1450392_+|terminase	terminase large subunit	terminase	A0A0S2GLF0	Bacillus_phage	62.6	2.1e-205
AUJ76695.1|1450580_1451861_+|portal	phage portal protein	portal	D6R3Y6	Bacillus_phage	63.3	2.6e-152
AUJ76696.1|1451823_1452450_+|head,protease	HK97 family phage prohead protease	head,protease	Q9ZXF7	Bacillus_phage	79.1	1.5e-84
AUJ76697.1|1452487_1453780_+|capsid	phage major capsid protein	capsid	A0A0A7RTL2	Clostridium_phage	47.6	9.8e-91
AUJ76698.1|1453807_1454206_+	collagen-like protein	NA	D6R3Z0	Bacillus_phage	43.6	1.4e-11
AUJ76699.1|1454223_1454526_+	DNA-packaging protein	NA	A0A0S2GLH6	Bacillus_phage	40.5	2.6e-10
AUJ76700.1|1454515_1454833_+|head,tail	head-tail adaptor protein	head,tail	A0A2H4JCB1	uncultured_Caudovirales_phage	36.3	1.1e-11
AUJ76701.1|1454829_1455228_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ76702.1|1455224_1455608_+	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
AUJ76703.1|1455622_1456237_+|tail	phage tail protein	tail	A0A2H4J8F3	uncultured_Caudovirales_phage	33.9	1.1e-23
AUJ76704.1|1456295_1456664_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ76705.1|1456869_1461357_+|tail	phage tail tape measure protein	tail	A0A1Q1PVX7	Staphylococcus_phage	42.3	1.1e-64
AUJ76706.1|1461350_1462190_+|tail	phage tail family protein	tail	D6R3Z9	Bacillus_phage	58.6	1.6e-94
AUJ76707.1|1462204_1463908_+	alkaline phosphatase	NA	D6R400	Bacillus_phage	56.7	3.6e-181
AUJ76708.1|1463958_1466523_+	peptidase G2	NA	D6R401	Bacillus_phage	57.0	6.5e-288
AUJ76709.1|1466535_1467813_+	hypothetical protein	NA	D6R402	Bacillus_phage	79.1	1.8e-145
AUJ76710.1|1467809_1468172_+	hypothetical protein	NA	Q9ZXE0	Bacillus_phage	92.5	6.4e-56
AUJ76711.1|1468168_1468357_+	XkdX family protein	NA	Q9ZXD9	Bacillus_phage	96.8	5.3e-30
AUJ76712.1|1468406_1468829_+|holin	holin	holin	D6R405	Bacillus_phage	87.9	2.7e-58
AUJ76713.1|1468870_1469884_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A1J0MS59	Bacillus_phage	96.1	3.1e-185
AUJ76714.1|1469990_1470683_-	hypothetical protein	NA	Q9AZW5	Lactococcus_phage	32.6	1.1e-11
AUJ76715.1|1470858_1471068_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ76716.1|1471100_1471733_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ76717.1|1472176_1472608_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ76718.1|1472585_1473209_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ76719.1|1473701_1474862_-|integrase	site-specific integrase	integrase	S6C485	Thermus_phage	36.6	5.8e-66
AUJ76720.1|1475169_1476351_+	transcriptional regulator	NA	A0A288WGA2	Bacillus_phage	25.6	1.7e-09
AUJ79324.1|1476722_1477112_-	XRE family transcriptional regulator	NA	A0A0U4B088	Bacillus_phage	30.6	2.2e-06
AUJ76721.1|1477282_1477474_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AUJ76722.1|1477514_1477832_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ76723.1|1477845_1478730_+	DNA replication protein DnaD	NA	A0A0U3TZZ4	Bacillus_phage	48.7	1.9e-61
AUJ79325.1|1478713_1479544_+	DNA replication protein	NA	A0A0U3U1U1	Bacillus_phage	35.1	1.4e-34
AUJ76724.1|1479859_1480408_+	hypothetical protein	NA	A0A0K2CYJ0	Paenibacillus_phage	36.5	2.7e-05
AUJ76725.1|1480904_1481108_+	hypothetical protein	NA	A0A2H4J4M6	uncultured_Caudovirales_phage	53.8	1.7e-13
AUJ76726.1|1481248_1481629_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ76727.1|1481625_1482033_+	hypothetical protein	NA	W8CYU3	Bacillus_phage	44.3	7.2e-24
AUJ76728.1|1482029_1482287_+	hypothetical protein	NA	F8WQ54	Bacillus_phage	40.0	1.1e-06
AUJ76729.1|1482290_1483115_+	DNA methyltransferase	NA	U5P0W8	Brevibacillus_phage	58.3	1.5e-89
AUJ76730.1|1483224_1483548_+	hypothetical protein	NA	M5ABU9	Bacillus_phage	33.7	7.8e-05
AUJ76731.1|1483544_1484228_+	dUTPase	NA	R9TQ23	Paenibacillus_phage	43.3	5.6e-37
AUJ76732.1|1484227_1484629_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ76733.1|1484625_1484898_+	hypothetical protein	NA	F8WQ59	Bacillus_phage	48.9	4.8e-16
AUJ76734.1|1484894_1485203_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ76735.1|1485199_1485445_+	hypothetical protein	NA	A0A217ERB6	Bacillus_phage	46.2	9.4e-11
AUJ76736.1|1485447_1485882_+	hypothetical protein	NA	A0A2H4J8A0	uncultured_Caudovirales_phage	70.7	1.2e-48
AUJ79326.1|1486562_1487015_+	ArpU family transcriptional regulator	NA	S6AVV9	Thermus_phage	55.9	2.2e-37
AUJ76737.1|1487011_1487554_+|integrase	site-specific integrase	integrase	D2XR58	Bacillus_phage	65.6	1.2e-61
AUJ76738.1|1488041_1488254_+	cell division protein FtsK	NA	A0A0K2CPG8	Brevibacillus_phage	54.1	5.1e-05
AUJ76739.1|1488320_1488518_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ76740.1|1489012_1489294_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ76741.1|1489290_1489605_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ76742.1|1489652_1490021_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ76743.1|1490010_1490376_+	HNH endonuclease	NA	A0A1U7Q1S7	Geobacillus_virus	55.0	2.1e-30
AUJ79327.1|1490397_1490595_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ76744.1|1490604_1491120_+|terminase	phage terminase small subunit P27 family	terminase	A6M947	Geobacillus_virus	44.6	9.8e-34
AUJ76745.1|1491116_1492826_+|terminase	terminase large subunit	terminase	A0A0S2GLF0	Bacillus_phage	62.6	2.1e-205
AUJ76746.1|1493014_1494295_+|portal	phage portal protein	portal	D6R3Y6	Bacillus_phage	63.3	2.6e-152
AUJ76747.1|1494257_1494884_+|head,protease	HK97 family phage prohead protease	head,protease	Q9ZXF7	Bacillus_phage	79.1	1.5e-84
AUJ76748.1|1494921_1496214_+|capsid	phage major capsid protein	capsid	A0A0A7RTL2	Clostridium_phage	47.6	9.8e-91
AUJ76749.1|1496241_1496640_+	collagen-like protein	NA	D6R3Z0	Bacillus_phage	43.6	1.4e-11
AUJ76750.1|1496657_1496960_+	DNA-packaging protein	NA	A0A0S2GLH6	Bacillus_phage	40.5	2.6e-10
AUJ76751.1|1496949_1497267_+|head,tail	head-tail adaptor protein	head,tail	A0A2H4JCB1	uncultured_Caudovirales_phage	36.3	1.1e-11
AUJ76752.1|1497263_1497662_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ76753.1|1497658_1498042_+	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
AUJ76754.1|1498056_1498671_+|tail	phage tail protein	tail	A0A2H4J8F3	uncultured_Caudovirales_phage	33.9	1.1e-23
AUJ76755.1|1498729_1499098_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ76756.1|1499303_1503791_+|tail	phage tail tape measure protein	tail	A0A1Q1PVX7	Staphylococcus_phage	42.3	1.1e-64
AUJ76757.1|1503784_1504624_+|tail	phage tail family protein	tail	D6R3Z9	Bacillus_phage	58.6	1.6e-94
AUJ76758.1|1504638_1506342_+	alkaline phosphatase	NA	D6R400	Bacillus_phage	56.7	3.6e-181
AUJ76759.1|1506392_1508957_+	peptidase G2	NA	D6R401	Bacillus_phage	57.0	6.5e-288
AUJ76760.1|1508969_1510247_+	hypothetical protein	NA	D6R402	Bacillus_phage	79.1	1.8e-145
AUJ76761.1|1510243_1510606_+	hypothetical protein	NA	Q9ZXE0	Bacillus_phage	92.5	6.4e-56
AUJ76762.1|1510602_1510791_+	XkdX family protein	NA	Q9ZXD9	Bacillus_phage	96.8	5.3e-30
AUJ76763.1|1510840_1511263_+|holin	holin	holin	D6R405	Bacillus_phage	87.9	2.7e-58
AUJ76764.1|1511304_1512318_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A1J0MS59	Bacillus_phage	96.1	3.1e-185
AUJ76765.1|1512424_1513117_-	hypothetical protein	NA	Q9AZW5	Lactococcus_phage	32.6	1.1e-11
AUJ76766.1|1513292_1513502_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ76767.1|1513534_1514167_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ76768.1|1514610_1515042_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ76769.1|1515019_1515643_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ76770.1|1516135_1517296_-|integrase	site-specific integrase	integrase	S6C485	Thermus_phage	36.6	5.8e-66
AUJ76771.1|1517603_1518785_+	transcriptional regulator	NA	A0A288WGA2	Bacillus_phage	25.6	1.7e-09
AUJ79328.1|1519156_1519546_-	XRE family transcriptional regulator	NA	A0A0U4B088	Bacillus_phage	30.6	2.2e-06
AUJ76772.1|1519716_1519908_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AUJ76773.1|1519948_1520266_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ76774.1|1520279_1521164_+	DNA replication protein DnaD	NA	A0A0U3TZZ4	Bacillus_phage	48.7	1.9e-61
AUJ79329.1|1521147_1521978_+	DNA replication protein	NA	A0A0U3U1U1	Bacillus_phage	35.1	1.4e-34
AUJ76775.1|1522293_1522842_+	hypothetical protein	NA	A0A0K2CYJ0	Paenibacillus_phage	36.5	2.7e-05
AUJ76776.1|1523338_1523542_+	hypothetical protein	NA	A0A2H4J4M6	uncultured_Caudovirales_phage	53.8	1.7e-13
AUJ76777.1|1523682_1524063_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ76778.1|1524059_1524467_+	hypothetical protein	NA	W8CYU3	Bacillus_phage	44.3	7.2e-24
AUJ76779.1|1524463_1524721_+	hypothetical protein	NA	F8WQ54	Bacillus_phage	40.0	1.1e-06
AUJ76780.1|1524724_1525549_+	DNA methyltransferase	NA	U5P0W8	Brevibacillus_phage	58.3	1.5e-89
AUJ76781.1|1525658_1525982_+	hypothetical protein	NA	M5ABU9	Bacillus_phage	33.7	7.8e-05
AUJ76782.1|1525978_1526662_+	dUTPase	NA	R9TQ23	Paenibacillus_phage	43.3	5.6e-37
AUJ76783.1|1526661_1527063_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ76784.1|1527059_1527332_+	hypothetical protein	NA	F8WQ59	Bacillus_phage	48.9	4.8e-16
AUJ76785.1|1527328_1527637_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ76786.1|1527633_1527879_+	hypothetical protein	NA	A0A217ERB6	Bacillus_phage	46.2	9.4e-11
AUJ76787.1|1527881_1528316_+	hypothetical protein	NA	A0A2H4J8A0	uncultured_Caudovirales_phage	70.7	1.2e-48
AUJ79330.1|1528996_1529449_+	ArpU family transcriptional regulator	NA	S6AVV9	Thermus_phage	55.9	2.2e-37
AUJ76788.1|1529445_1529988_+|integrase	site-specific integrase	integrase	D2XR58	Bacillus_phage	65.6	1.2e-61
AUJ76789.1|1530475_1530688_+	cell division protein FtsK	NA	A0A0K2CPG8	Brevibacillus_phage	54.1	5.1e-05
AUJ76790.1|1530754_1530952_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ76791.1|1531446_1531728_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ76792.1|1531724_1532039_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ76793.1|1532086_1532455_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ76794.1|1532444_1532810_+	HNH endonuclease	NA	A0A1U7Q1S7	Geobacillus_virus	55.0	2.1e-30
AUJ79331.1|1532831_1533029_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ76795.1|1533038_1533554_+|terminase	phage terminase small subunit P27 family	terminase	A6M947	Geobacillus_virus	44.6	9.8e-34
AUJ76796.1|1533550_1535260_+|terminase	terminase large subunit	terminase	A0A0S2GLF0	Bacillus_phage	62.6	2.1e-205
AUJ76797.1|1535448_1536729_+|portal	phage portal protein	portal	D6R3Y6	Bacillus_phage	63.3	2.6e-152
AUJ76798.1|1536691_1537318_+|head,protease	HK97 family phage prohead protease	head,protease	Q9ZXF7	Bacillus_phage	79.1	1.5e-84
AUJ76799.1|1537355_1538648_+|capsid	phage major capsid protein	capsid	A0A0A7RTL2	Clostridium_phage	47.6	9.8e-91
AUJ76800.1|1538675_1539074_+	collagen-like protein	NA	D6R3Z0	Bacillus_phage	43.6	1.4e-11
AUJ76801.1|1539091_1539394_+	DNA-packaging protein	NA	A0A0S2GLH6	Bacillus_phage	40.5	2.6e-10
AUJ76802.1|1539383_1539701_+|head,tail	head-tail adaptor protein	head,tail	A0A2H4JCB1	uncultured_Caudovirales_phage	36.3	1.1e-11
AUJ76803.1|1539697_1540096_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ76804.1|1540092_1540476_+	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
AUJ76805.1|1540490_1541105_+|tail	phage tail protein	tail	A0A2H4J8F3	uncultured_Caudovirales_phage	33.9	1.1e-23
AUJ76806.1|1541163_1541532_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ76807.1|1541737_1546225_+|tail	phage tail tape measure protein	tail	A0A1Q1PVX7	Staphylococcus_phage	42.3	1.1e-64
AUJ76808.1|1546218_1547058_+|tail	phage tail family protein	tail	D6R3Z9	Bacillus_phage	58.6	1.6e-94
AUJ76809.1|1547072_1548776_+	alkaline phosphatase	NA	D6R400	Bacillus_phage	56.7	3.6e-181
AUJ76810.1|1548826_1551391_+	peptidase G2	NA	D6R401	Bacillus_phage	57.0	6.5e-288
AUJ76811.1|1551403_1552681_+	hypothetical protein	NA	D6R402	Bacillus_phage	79.1	1.8e-145
AUJ76812.1|1552677_1553040_+	hypothetical protein	NA	Q9ZXE0	Bacillus_phage	92.5	6.4e-56
AUJ76813.1|1553036_1553225_+	XkdX family protein	NA	Q9ZXD9	Bacillus_phage	96.8	5.3e-30
AUJ76814.1|1553274_1553697_+|holin	holin	holin	D6R405	Bacillus_phage	87.9	2.7e-58
AUJ76815.1|1553738_1554752_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A1J0MS59	Bacillus_phage	96.1	3.1e-185
AUJ76816.1|1554858_1555551_-	hypothetical protein	NA	Q9AZW5	Lactococcus_phage	32.6	1.1e-11
AUJ76817.1|1555726_1555936_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ76818.1|1555968_1556601_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ76819.1|1557044_1557476_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ76820.1|1557453_1558077_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ76821.1|1558569_1559730_-|integrase	site-specific integrase	integrase	S6C485	Thermus_phage	36.6	5.8e-66
AUJ76822.1|1560037_1561219_+	transcriptional regulator	NA	A0A288WGA2	Bacillus_phage	25.6	1.7e-09
AUJ79332.1|1561590_1561980_-	XRE family transcriptional regulator	NA	A0A0U4B088	Bacillus_phage	30.6	2.2e-06
AUJ76823.1|1562150_1562342_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AUJ76824.1|1562382_1562700_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ76825.1|1562713_1563598_+	DNA replication protein DnaD	NA	A0A0U3TZZ4	Bacillus_phage	48.7	1.9e-61
AUJ79333.1|1563581_1564412_+	DNA replication protein	NA	A0A0U3U1U1	Bacillus_phage	35.1	1.4e-34
AUJ76826.1|1564727_1565276_+	hypothetical protein	NA	A0A0K2CYJ0	Paenibacillus_phage	36.5	2.7e-05
AUJ76827.1|1565772_1565976_+	hypothetical protein	NA	A0A2H4J4M6	uncultured_Caudovirales_phage	53.8	1.7e-13
AUJ76828.1|1566116_1566497_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ76829.1|1566493_1566901_+	hypothetical protein	NA	W8CYU3	Bacillus_phage	44.3	7.2e-24
AUJ76830.1|1566897_1567155_+	hypothetical protein	NA	F8WQ54	Bacillus_phage	40.0	1.1e-06
AUJ76831.1|1567158_1567983_+	DNA methyltransferase	NA	U5P0W8	Brevibacillus_phage	58.3	1.5e-89
AUJ76832.1|1568092_1568416_+	hypothetical protein	NA	M5ABU9	Bacillus_phage	33.7	7.8e-05
AUJ76833.1|1568412_1569096_+	dUTPase	NA	R9TQ23	Paenibacillus_phage	43.3	5.6e-37
AUJ76834.1|1569095_1569497_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ76835.1|1569493_1569766_+	hypothetical protein	NA	F8WQ59	Bacillus_phage	48.9	4.8e-16
AUJ76836.1|1569762_1570071_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ76837.1|1570067_1570313_+	hypothetical protein	NA	A0A217ERB6	Bacillus_phage	46.2	9.4e-11
AUJ76838.1|1570315_1570750_+	hypothetical protein	NA	A0A2H4J8A0	uncultured_Caudovirales_phage	70.7	1.2e-48
AUJ79334.1|1571430_1571883_+	ArpU family transcriptional regulator	NA	S6AVV9	Thermus_phage	55.9	2.2e-37
AUJ76839.1|1571879_1572422_+|integrase	site-specific integrase	integrase	D2XR58	Bacillus_phage	65.6	1.2e-61
AUJ76840.1|1572909_1573122_+	cell division protein FtsK	NA	A0A0K2CPG8	Brevibacillus_phage	54.1	5.1e-05
1572872:1572905	attR	CCAATCGGGAGGGCGCTTTTTCTATTGGAGGGAT	NA	NA	NA	NA
AUJ76841.1|1573188_1573386_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ76842.1|1573880_1574162_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ76843.1|1574158_1574473_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ76844.1|1574520_1574889_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ76845.1|1574878_1575244_+	HNH endonuclease	NA	A0A1U7Q1S7	Geobacillus_virus	55.0	2.1e-30
AUJ79335.1|1575265_1575463_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ76846.1|1575472_1575988_+|terminase	phage terminase small subunit P27 family	terminase	A6M947	Geobacillus_virus	44.6	9.8e-34
AUJ76847.1|1575984_1577694_+|terminase	terminase large subunit	terminase	A0A0S2GLF0	Bacillus_phage	62.6	2.1e-205
AUJ76848.1|1577882_1579163_+|portal	phage portal protein	portal	D6R3Y6	Bacillus_phage	63.3	2.6e-152
AUJ76849.1|1579125_1579752_+|head,protease	HK97 family phage prohead protease	head,protease	Q9ZXF7	Bacillus_phage	79.1	1.5e-84
AUJ76850.1|1579789_1581082_+|capsid	phage major capsid protein	capsid	A0A0A7RTL2	Clostridium_phage	47.6	9.8e-91
AUJ76851.1|1581109_1581508_+	collagen-like protein	NA	D6R3Z0	Bacillus_phage	43.6	1.4e-11
AUJ76852.1|1581525_1581828_+	DNA-packaging protein	NA	A0A0S2GLH6	Bacillus_phage	40.5	2.6e-10
AUJ76853.1|1581817_1582135_+|head,tail	head-tail adaptor protein	head,tail	A0A2H4JCB1	uncultured_Caudovirales_phage	36.3	1.1e-11
AUJ76854.1|1582131_1582530_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ76855.1|1582526_1582910_+	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
AUJ76856.1|1582924_1583539_+|tail	phage tail protein	tail	A0A2H4J8F3	uncultured_Caudovirales_phage	33.9	1.1e-23
AUJ76857.1|1583597_1583966_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ76858.1|1584171_1588659_+|tail	phage tail tape measure protein	tail	A0A1Q1PVX7	Staphylococcus_phage	42.3	1.1e-64
AUJ76859.1|1588652_1589492_+|tail	phage tail family protein	tail	D6R3Z9	Bacillus_phage	58.6	1.6e-94
AUJ76860.1|1589506_1591210_+	alkaline phosphatase	NA	D6R400	Bacillus_phage	56.7	3.6e-181
AUJ76861.1|1591260_1593825_+	peptidase G2	NA	D6R401	Bacillus_phage	57.0	6.5e-288
AUJ76862.1|1593837_1595115_+	hypothetical protein	NA	D6R402	Bacillus_phage	79.1	1.8e-145
AUJ76863.1|1595111_1595474_+	hypothetical protein	NA	Q9ZXE0	Bacillus_phage	92.5	6.4e-56
AUJ76864.1|1595470_1595659_+	XkdX family protein	NA	Q9ZXD9	Bacillus_phage	96.8	5.3e-30
AUJ76865.1|1595708_1596131_+|holin	holin	holin	D6R405	Bacillus_phage	87.9	2.7e-58
AUJ76866.1|1596172_1597186_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A1J0MS59	Bacillus_phage	96.1	3.1e-185
AUJ76867.1|1597292_1597985_-	hypothetical protein	NA	Q9AZW5	Lactococcus_phage	32.6	1.1e-11
>prophage 3
CP025001	Bacillus siamensis strain SCSIO 05746 chromosome, complete genome	4268316	1927679	1933930	4268316		Staphylococcus_phage(66.67%)	9	NA	NA
AUJ77162.1|1927679_1928795_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	35.4	7.0e-53
AUJ77163.1|1928775_1929423_+	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	44.3	2.6e-39
AUJ77164.1|1929437_1930634_+	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	54.2	3.1e-115
AUJ77165.1|1930666_1931131_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	66.0	9.4e-44
AUJ77166.1|1931247_1931622_+	N-acetyltransferase	NA	NA	NA	NA	NA
AUJ77167.1|1931686_1932208_-	DUF309 domain-containing protein	NA	NA	NA	NA	NA
AUJ77168.1|1932294_1932384_-	YjcZ family sporulation protein	NA	NA	NA	NA	NA
AUJ77169.1|1932591_1933347_+	segregation/condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	29.4	1.9e-09
AUJ77170.1|1933336_1933930_+	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	36.6	2.0e-14
>prophage 4
CP025001	Bacillus siamensis strain SCSIO 05746 chromosome, complete genome	4268316	2362725	2418977	4268316	holin,head,terminase,tRNA,portal,protease,capsid,integrase,tail	Bacillus_phage(57.78%)	70	2347657:2347676	2468153:2468172
2347657:2347676	attL	GGGAATCGGTGCCGTTTTAT	NA	NA	NA	NA
AUJ77533.1|2362725_2362893_-	hypothetical protein	NA	F8WPX5	Bacillus_phage	71.9	1.2e-06
AUJ77534.1|2364376_2364739_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ77535.1|2364754_2365234_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ77536.1|2365397_2366411_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1J0MS59	Bacillus_phage	92.9	4.0e-180
AUJ77537.1|2366466_2366730_-|holin	phage holin	holin	A0A2H4J6M0	uncultured_Caudovirales_phage	67.8	1.9e-25
AUJ77538.1|2366744_2366957_-	hypothetical protein	NA	A0A290GDY2	Caldibacillus_phage	59.4	1.4e-15
AUJ77539.1|2367007_2367196_-	XkdX family protein	NA	Q9ZXD9	Bacillus_phage	96.8	5.3e-30
AUJ77540.1|2367192_2367555_-	hypothetical protein	NA	Q9ZXE0	Bacillus_phage	88.3	2.3e-53
AUJ77541.1|2367551_2368688_-	hypothetical protein	NA	D6R402	Bacillus_phage	75.6	6.3e-134
AUJ77542.1|2368700_2371265_-	peptidase G2	NA	D6R401	Bacillus_phage	56.8	1.4e-285
AUJ77543.1|2371297_2373016_-	alkaline phosphatase	NA	D6R400	Bacillus_phage	68.7	1.7e-223
AUJ77544.1|2373028_2373865_-|tail	phage tail family protein	tail	D6R3Z9	Bacillus_phage	68.6	1.4e-109
AUJ77545.1|2373879_2377626_-	hypothetical protein	NA	A0A2H4JA91	uncultured_Caudovirales_phage	64.2	5.7e-107
AUJ77546.1|2377686_2377869_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ77547.1|2377880_2378243_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ77548.1|2378300_2378879_-|tail	major tail protein	tail	J7KKC8	Streptococcus_phage	39.9	9.6e-30
AUJ77549.1|2378898_2379291_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ77550.1|2379287_2379677_-|tail	phage tail protein	tail	I7A9A4	Enterococcus_phage	36.7	2.6e-10
AUJ77551.1|2379676_2380003_-|head,tail	head-tail adaptor protein	head,tail	NA	NA	NA	NA
AUJ77552.1|2379992_2380286_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2H4JB77	uncultured_Caudovirales_phage	39.6	8.6e-11
AUJ77553.1|2380337_2380748_-	collagen-like protein	NA	D6R3Z0	Bacillus_phage	50.3	3.8e-12
AUJ77554.1|2380775_2381975_-|capsid	phage major capsid protein	capsid	A0A2H4J3W9	uncultured_Caudovirales_phage	50.5	1.7e-76
AUJ77555.1|2382023_2382620_-|head,protease	HK97 family phage prohead protease	head,protease	A0A1J0MFL1	Staphylococcus_phage	52.2	3.1e-47
AUJ77556.1|2382612_2383839_-|portal	phage portal protein	portal	A0A2H4J331	uncultured_Caudovirales_phage	38.0	1.6e-66
AUJ77557.1|2383843_2384050_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ77558.1|2384066_2385773_-|terminase	terminase large subunit	terminase	A0A2H4JC16	uncultured_Caudovirales_phage	42.2	1.7e-119
AUJ77559.1|2385765_2386260_-|terminase	phage terminase small subunit P27 family	terminase	A0A1Q1PVW3	Staphylococcus_phage	35.5	9.1e-21
AUJ77560.1|2386505_2386901_-	HNH endonuclease	NA	D2JLE2	Staphylococcus_phage	34.7	1.4e-08
AUJ77561.1|2386982_2387198_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ77562.1|2387350_2388316_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ77563.1|2388711_2389089_-	ArpU family transcriptional regulator	NA	Q9ZXB9	Bacillus_phage	99.2	9.0e-61
AUJ77564.1|2389226_2389427_-	hypothetical protein	NA	Q38589	Bacillus_phage	81.8	3.9e-23
AUJ77565.1|2389602_2390118_-	hypothetical protein	NA	D6R425	Bacillus_phage	99.4	2.8e-97
AUJ77566.1|2390147_2390687_-	nuclease	NA	Q9ZXC2	Bacillus_phage	99.4	1.9e-96
AUJ77567.1|2390683_2391121_-	hypothetical protein	NA	Q9ZXC3	Bacillus_phage	90.3	9.1e-73
AUJ77568.1|2391318_2393736_-	DNA primase	NA	D6R422	Bacillus_phage	93.1	0.0e+00
AUJ77569.1|2393796_2394234_-	hypothetical protein	NA	Q9ZXC5	Bacillus_phage	97.9	2.0e-80
AUJ77570.1|2394254_2394569_-	hypothetical protein	NA	Q9ZXC6	Bacillus_phage	100.0	1.2e-53
AUJ77571.1|2394558_2395494_-	hypothetical protein	NA	Q9ZXC7	Bacillus_phage	97.4	8.2e-172
AUJ77572.1|2395497_2396052_-	hypothetical protein	NA	Q9ZXC8	Bacillus_phage	95.7	1.3e-92
AUJ77573.1|2396252_2396522_-	hypothetical protein	NA	Q9ZXC9	Bacillus_phage	96.6	4.2e-44
AUJ77574.1|2396811_2397114_-	DNA-binding protein	NA	NA	NA	NA	NA
AUJ77575.1|2397128_2397893_-	Rha family transcriptional regulator	NA	A8ATN0	Listeria_phage	49.1	6.9e-52
AUJ77576.1|2398014_2398233_-	XRE family transcriptional regulator	NA	A0A0K2CZL1	Paenibacillus_phage	62.5	5.4e-18
AUJ77577.1|2398361_2398748_+	XRE family transcriptional regulator	NA	A0A0K2CZS1	Paenibacillus_phage	35.8	6.0e-12
AUJ77578.1|2398731_2399793_+	hypothetical protein	NA	A0A0F6N3H6	Staphylococcus_phage	24.0	1.6e-06
AUJ77579.1|2399833_2400988_+|integrase	site-specific integrase	integrase	A0A0M5M609	Bacillus_phage	38.9	1.1e-64
AUJ77580.1|2401100_2402435_-	type I glutamate--ammonia ligase	NA	NA	NA	NA	NA
AUJ77581.1|2402492_2402897_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
AUJ77582.1|2403006_2404272_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ77583.1|2404288_2405551_-	GTPase HflX	NA	NA	NA	NA	NA
AUJ77584.1|2405680_2406649_-	stage V sporulation protein K	NA	G3MAX6	Bacillus_virus	41.7	1.0e-52
AUJ77585.1|2406716_2406923_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ77586.1|2406956_2407715_+	N-acetylmuramoyl-L-alanine amidase	NA	E5DV68	Deep-sea_thermophilic_phage	50.0	1.5e-51
AUJ77587.1|2407763_2408384_-	hypothetical protein	NA	A0A127AYS1	Bacillus_phage	47.9	1.2e-46
AUJ77588.1|2408432_2409422_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	F8WQ21	Bacillus_phage	83.3	3.9e-156
AUJ77589.1|2409439_2411542_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	U5PY35	Bacillus_phage	85.7	0.0e+00
AUJ77590.1|2411501_2411894_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	G3MBF1	Bacillus_virus	60.0	6.5e-30
AUJ77591.1|2412153_2412369_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ77592.1|2412451_2412727_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ77593.1|2412822_2413044_-	RNA-binding protein Hfq	NA	NA	NA	NA	NA
AUJ77594.1|2413083_2414028_-|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
AUJ77595.1|2414126_2414531_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ77596.1|2414632_2414938_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ77597.1|2415076_2415391_+	QacE family quaternary ammonium compound efflux SMR transporter	NA	NA	NA	NA	NA
AUJ77598.1|2415408_2415762_+	QacE family quaternary ammonium compound efflux SMR transporter	NA	NA	NA	NA	NA
AUJ77599.1|2415775_2416228_-	OsmC family peroxiredoxin	NA	NA	NA	NA	NA
AUJ77600.1|2416287_2416995_-	hypothetical protein	NA	F8WQ53	Bacillus_phage	53.1	1.0e-49
AUJ77601.1|2417250_2417484_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ77602.1|2417648_2418977_+|protease	serine protease	protease	A0A1B0T6A2	Bacillus_phage	34.2	3.8e-29
2468153:2468172	attR	ATAAAACGGCACCGATTCCC	NA	NA	NA	NA
>prophage 5
CP025001	Bacillus siamensis strain SCSIO 05746 chromosome, complete genome	4268316	2932333	3005526	4268316	holin,terminase,portal,protease,capsid,tail	Bacillus_phage(22.5%)	79	NA	NA
AUJ77995.1|2932333_2933293_+|protease	serine protease	protease	A0A127AWU5	Bacillus_phage	50.9	1.5e-72
AUJ77996.1|2933671_2935960_+	5-methyltetrahydropteroyltriglutamate-- homocysteine S-methyltransferase	NA	NA	NA	NA	NA
AUJ77997.1|2936759_2937944_+	MFS transporter	NA	NA	NA	NA	NA
AUJ77998.1|2938064_2938535_+	nucleoside deaminase	NA	A0A0B5J096	Pandoravirus	38.8	1.1e-20
AUJ77999.1|2938718_2939573_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ78000.1|2939588_2940716_-	glycosyltransferase	NA	NA	NA	NA	NA
AUJ79384.1|2940720_2941185_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ78001.1|2941190_2941805_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ78002.1|2941945_2942356_-	organic hydroperoxide resistance protein	NA	NA	NA	NA	NA
AUJ78003.1|2942492_2942939_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
AUJ78004.1|2942966_2943392_-	organic hydroperoxide resistance protein	NA	NA	NA	NA	NA
AUJ78005.1|2943505_2944753_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	50.6	2.1e-98
AUJ78006.1|2944749_2945862_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	43.1	1.6e-73
AUJ78007.1|2946230_2947133_-	formyltetrahydrofolate deformylase	NA	NA	NA	NA	NA
AUJ78008.1|2947206_2947521_-	QacE family quaternary ammonium compound efflux SMR transporter	NA	NA	NA	NA	NA
AUJ78009.1|2947520_2947859_-	QacE family quaternary ammonium compound efflux SMR transporter	NA	NA	NA	NA	NA
AUJ78010.1|2948046_2948592_-	N-acetyltransferase	NA	NA	NA	NA	NA
AUJ78011.1|2948695_2949214_-	acyl-CoA thioesterase	NA	NA	NA	NA	NA
AUJ78012.1|2949395_2950256_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ78013.1|2950325_2951375_+	6-phosphogluconolactonase	NA	NA	NA	NA	NA
AUJ78014.1|2951401_2952373_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	35.0	2.3e-20
AUJ78015.1|2952375_2953275_-	NlpC/P60 family protein	NA	A0A0A8WIF2	Clostridium_phage	44.7	4.8e-20
AUJ78016.1|2953271_2954369_-	dipeptide epimerase	NA	NA	NA	NA	NA
AUJ79385.1|2954375_2955311_-	LD-carboxypeptidase	NA	NA	NA	NA	NA
AUJ78017.1|2955401_2957021_-	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUJ78018.1|2957017_2958049_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.5	2.6e-17
AUJ78019.1|2958054_2959002_-	ABC transporter permease	NA	NA	NA	NA	NA
AUJ78020.1|2959001_2959934_-	ABC transporter permease	NA	NA	NA	NA	NA
AUJ78021.1|2959947_2960772_-	aminopeptidase	NA	NA	NA	NA	NA
AUJ78022.1|2960927_2962487_-	MFS transporter	NA	NA	NA	NA	NA
AUJ78023.1|2962769_2964122_+|protease	serine protease	protease	A0A1B1IT49	uncultured_Mediterranean_phage	33.0	3.5e-22
AUJ78024.1|2964489_2965461_-	glycosyltransferase	NA	A0A2H5BFL1	Salmonella_phage	41.6	5.9e-64
AUJ78025.1|2965472_2967587_-	mannosyltransferase	NA	NA	NA	NA	NA
AUJ78026.1|2967769_2968720_-	ring-cleaving dioxygenase	NA	NA	NA	NA	NA
AUJ78027.1|2969042_2970359_+	amino acid permease	NA	NA	NA	NA	NA
AUJ78028.1|2970643_2971261_+	DUF47 domain-containing protein	NA	NA	NA	NA	NA
AUJ78029.1|2971273_2972272_+	inorganic phosphate transporter	NA	NA	NA	NA	NA
AUJ78030.1|2972379_2973132_+	type II toxin-antitoxin system SpoIISA family toxin	NA	NA	NA	NA	NA
AUJ78031.1|2973131_2973302_+	stage II sporulation protein SB	NA	NA	NA	NA	NA
AUJ78032.1|2973560_2974439_-	N-acetylmuramoyl-L-alanine amidase	NA	Q9ZXD7	Bacillus_phage	60.2	4.8e-81
AUJ78033.1|2974452_2974716_-|holin	phage holin	holin	A0A2H4J6M0	uncultured_Caudovirales_phage	66.7	1.4e-23
AUJ78034.1|2974729_2974993_-	protein xhlA	NA	A0A2H4JD40	uncultured_Caudovirales_phage	63.1	8.8e-23
AUJ79386.1|2975044_2975842_-|portal	phage portal protein	portal	NA	NA	NA	NA
AUJ78035.1|2975896_2976061_-	XkdX family protein	NA	A0A2H4JAA1	uncultured_Caudovirales_phage	64.2	1.2e-14
AUJ78036.1|2976060_2976393_-|portal	phage portal protein	portal	A0A0N9S7V6	Paenibacillus_phage	34.5	4.7e-05
AUJ78037.1|2976413_2978147_-|terminase	terminase	terminase	A0A2H4J4R1	uncultured_Caudovirales_phage	28.6	3.4e-14
AUJ78038.1|2978149_2978422_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ78039.1|2978418_2978997_-	DUF2313 domain-containing protein	NA	A0A0A7RTT8	Clostridium_phage	29.3	4.8e-13
AUJ78040.1|2978980_2980027_-|portal	phage portal protein	portal	S6AVU3	Thermus_phage	43.5	2.3e-69
AUJ78041.1|2980019_2980445_-	DUF2634 domain-containing protein	NA	A0A2H4J6K5	uncultured_Caudovirales_phage	35.9	1.9e-11
AUJ78042.1|2980588_2980855_-	DUF2577 domain-containing protein	NA	S6C459	Thermus_phage	38.6	8.9e-07
AUJ78043.1|2980854_2981832_-|portal	phage portal protein	portal	A0A1L6BY20	Clostridium_phage	31.2	9.9e-35
AUJ78044.1|2981845_2982505_-	LysM peptidoglycan-binding domain-containing protein	NA	A0A090DBR9	Clostridium_phage	34.0	3.4e-23
AUJ78045.1|2982497_2987621_-|portal	phage portal protein	portal	A0A1L2JY60	Aeribacillus_phage	47.0	6.7e-42
AUJ78046.1|2987608_2987761_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ78047.1|2987802_2988249_-|portal	phage portal protein	portal	A0A0A7RTY8	Clostridium_phage	35.8	1.0e-10
AUJ78048.1|2988324_2988768_-|portal	phage portal protein	portal	A0A0K2CNG3	Brevibacillus_phage	45.2	8.4e-26
AUJ78049.1|2988769_2990167_-|tail	phage tail sheath protein	tail	A0A0A7RTT5	Clostridium_phage	40.8	1.1e-82
AUJ78050.1|2990166_2990376_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ78051.1|2990372_2990819_-|portal	phage portal protein	portal	NA	NA	NA	NA
AUJ78052.1|2990815_2991319_-|portal	phage portal protein	portal	A0A249XXA4	Clostridium_phage	41.1	2.3e-35
AUJ78053.1|2991315_2991672_-	DUF3599 domain-containing protein	NA	NA	NA	NA	NA
AUJ78054.1|2991668_2992052_-	DUF3199 domain-containing protein	NA	NA	NA	NA	NA
AUJ78055.1|2992068_2993004_-|capsid	phage major capsid protein	capsid	A0A1B1P7E3	Bacillus_phage	62.8	3.3e-104
AUJ78056.1|2993030_2993876_-|portal	phage portal protein	portal	A0A1B1P7E4	Bacillus_phage	57.6	4.3e-55
AUJ78057.1|2993895_2995332_-|portal	phage portal protein	portal	A0A1B1P7C8	Bacillus_phage	54.0	4.1e-138
AUJ78058.1|2995335_2996634_-|terminase	PBSX family phage terminase large subunit	terminase	M4ZRM5	Bacillus_phage	59.8	2.1e-149
AUJ78059.1|2996630_2997428_-|terminase	terminase	terminase	A0A0S2MVB6	Bacillus_phage	50.2	1.2e-59
AUJ78060.1|2997542_2998052_-	Fis family transcriptional regulator	NA	A0A0K2CNQ1	Brevibacillus_phage	41.4	3.6e-20
AUJ78061.1|2998164_2998368_-	hypothetical protein	NA	A0A2H4J4M6	uncultured_Caudovirales_phage	48.5	1.9e-12
AUJ78062.1|2998357_2998699_-|portal	phage portal protein	portal	NA	NA	NA	NA
AUJ78063.1|2998963_2999764_-	ATP-binding protein	NA	A0A0K2CPA5	Brevibacillus_phage	49.5	4.0e-58
AUJ78064.1|2999663_3000491_-|portal	phage portal protein	portal	S6BFM4	Thermus_phage	47.1	1.3e-19
AUJ78065.1|3000480_3000660_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ78066.1|3000850_3001189_+	XRE family transcriptional regulator	NA	A0A2H4J6F9	uncultured_Caudovirales_phage	46.6	6.4e-18
AUJ78067.1|3001336_3001927_+	ImmA/IrrE family metallo-endopeptidase	NA	A0A2H4JA43	uncultured_Caudovirales_phage	52.3	1.8e-39
AUJ78068.1|3002067_3002673_-	hypothetical protein	NA	A0A0Y0AJU6	Bacillus_phage	48.8	4.2e-44
AUJ78069.1|3002782_3003160_+	PH domain-containing protein	NA	A5GYQ0	Lactococcus_phage	38.5	6.7e-16
AUJ78070.1|3004392_3005526_-	aspartate phosphatase	NA	A0A1P8CWN8	Bacillus_phage	48.8	2.3e-96
>prophage 6
CP025001	Bacillus siamensis strain SCSIO 05746 chromosome, complete genome	4268316	3057769	3112993	4268316	holin,head,terminase,portal,capsid,coat,integrase,tail	uncultured_Caudovirales_phage(34.88%)	84	3057519:3057566	3098803:3098850
3057519:3057566	attL	ATGATTCCGACTGGGCTCGAACCAGCGACCTCTACCCTGTCAAGGTAG	NA	NA	NA	NA
AUJ78120.1|3057769_3057958_+	hypothetical protein	NA	A0A2H4J4T3	uncultured_Caudovirales_phage	71.0	4.7e-18
AUJ78121.1|3058080_3058950_+	Abi family protein	NA	A3QSC6	Clostridium_virus	35.0	1.0e-43
AUJ78122.1|3058977_3060135_-	N-acetylmuramoyl-L-alanine amidase	NA	O64040	Bacillus_phage	48.5	5.2e-67
AUJ78123.1|3060180_3060603_-|holin	holin	holin	D6R405	Bacillus_phage	85.7	1.4e-57
AUJ78124.1|3060637_3060859_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ78125.1|3060872_3061040_-	XkdX family protein	NA	NA	NA	NA	NA
AUJ78126.1|3061177_3061570_-	hypothetical protein	NA	O48465	Bacillus_phage	50.8	1.0e-27
AUJ78127.1|3061585_3064942_-	hypothetical protein	NA	Q5YA57	Bacillus_phage	46.5	4.2e-133
AUJ78128.1|3064954_3065719_-|tail	phage tail protein	tail	NA	NA	NA	NA
AUJ78129.1|3065711_3070790_-	hypothetical protein	NA	M9NRJ5	Staphylococcus_phage	25.8	1.4e-34
AUJ79388.1|3070794_3071103_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ78130.1|3071150_3071657_-	hypothetical protein	NA	I6T7F0	Staphylococcus_virus	32.7	1.5e-10
AUJ79389.1|3071713_3071956_-	fibronectin type III domain-containing protein	NA	NA	NA	NA	NA
AUJ78131.1|3071969_3072284_-	alkaline phosphatase	NA	Q0PDK9	Bacillus_phage	74.1	1.5e-24
AUJ78132.1|3072225_3072738_-|tail	phage major tail protein, TP901-1 family	tail	NA	NA	NA	NA
AUJ78133.1|3072751_3073150_-	DUF3168 domain-containing protein	NA	W8EK61	Geobacillus_phage	44.6	4.9e-25
AUJ78134.1|3073168_3073585_-	hypothetical protein	NA	O48447	Bacillus_phage	54.2	7.4e-32
AUJ78135.1|3073577_3073916_-|head,tail	head-tail adaptor protein	head,tail	NA	NA	NA	NA
AUJ78136.1|3073912_3074221_-	hypothetical protein	NA	R4IFL8	Staphylococcus_phage	39.6	4.8e-12
AUJ78137.1|3074229_3074502_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ78138.1|3074503_3074839_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ78139.1|3074843_3075761_-|capsid	phage major capsid protein	capsid	A0A2H4JCG0	uncultured_Caudovirales_phage	68.5	9.0e-115
AUJ78140.1|3075775_3076357_-	DUF4355 domain-containing protein	NA	A0A2H4J4P4	uncultured_Caudovirales_phage	53.7	1.8e-52
AUJ78141.1|3076447_3076729_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ78142.1|3076735_3077656_-|head	phage head morphogenesis protein	head	A0A1Q1PVS0	Bacillus_phage	51.2	5.0e-81
AUJ78143.1|3077642_3079046_-|portal	phage portal protein	portal	A0A2H4J4Q7	uncultured_Caudovirales_phage	59.6	8.3e-152
AUJ79390.1|3079045_3080254_-|terminase	PBSX family phage terminase large subunit	terminase	A0A2H4J8B0	uncultured_Caudovirales_phage	86.0	5.4e-208
AUJ78144.1|3080240_3081002_-	hypothetical protein	NA	A0A2H4J4R0	uncultured_Caudovirales_phage	58.1	4.8e-69
AUJ78145.1|3081047_3081278_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ78146.1|3081723_3082131_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ78147.1|3082227_3082440_-	DNA-binding protein	NA	A0A1Z1LZP5	Bacillus_phage	52.9	9.6e-12
AUJ78148.1|3082447_3082639_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ78149.1|3082982_3083498_-	Fis family transcriptional regulator	NA	A0A1L2JY33	Aeribacillus_phage	43.2	1.4e-27
AUJ78150.1|3083889_3084069_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ78151.1|3084079_3084514_-	hypothetical protein	NA	A0A2H4J8A0	uncultured_Caudovirales_phage	70.9	6.3e-50
AUJ78152.1|3084742_3084925_-	hypothetical protein	NA	A0A1P8CWX9	Bacillus_phage	52.2	1.7e-09
AUJ78153.1|3085197_3085380_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ78154.1|3085336_3085657_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ78155.1|3085744_3086005_-	hypothetical protein	NA	F8WQ54	Bacillus_phage	42.0	5.7e-06
AUJ78156.1|3086001_3086232_-	hypothetical protein	NA	J9PL10	Bacillus_phage	44.4	7.2e-13
AUJ78157.1|3086228_3086702_-	hypothetical protein	NA	E8ZDA7	Streptococcus_phage	31.8	2.3e-05
AUJ78158.1|3086698_3087082_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ78159.1|3087223_3087427_-	hypothetical protein	NA	A0A2H4J4M6	uncultured_Caudovirales_phage	76.2	1.3e-21
AUJ78160.1|3087780_3088239_-	hypothetical protein	NA	A0A2H4J891	uncultured_Caudovirales_phage	79.3	7.8e-59
AUJ78161.1|3088225_3088630_-	hypothetical protein	NA	S5MAA0	Brevibacillus_phage	32.6	6.8e-06
AUJ78162.1|3088631_3088811_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ78163.1|3089092_3089887_-	ATP-binding protein	NA	A6XMI1	Bacillus_virus	50.0	4.5e-62
AUJ78164.1|3089804_3090530_-	DNA-binding protein	NA	A0A2H4J6G9	uncultured_Caudovirales_phage	42.4	5.8e-40
AUJ78165.1|3090537_3090726_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ78166.1|3090725_3091463_-	hypothetical protein	NA	A0A0A7RUC1	Clostridium_phage	44.9	1.1e-51
AUJ78167.1|3091482_3092400_-	hypothetical protein	NA	A0A0A7RUE9	Clostridium_phage	62.1	9.4e-88
AUJ78168.1|3092396_3092585_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ78169.1|3092687_3092885_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ78170.1|3092844_3093063_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ78171.1|3093059_3093317_-	hypothetical protein	NA	A0A2H4J4M9	uncultured_Caudovirales_phage	41.0	3.2e-09
AUJ78172.1|3093313_3093886_-	transcriptional regulator	NA	A0A2H4J884	uncultured_Caudovirales_phage	55.6	4.4e-59
AUJ78173.1|3093943_3094672_-	phage regulatory protein	NA	A0A2H4J4N4	uncultured_Caudovirales_phage	63.3	1.8e-86
AUJ78174.1|3094668_3094863_-	DNA-binding protein	NA	NA	NA	NA	NA
AUJ79391.1|3094893_3095043_-	hypothetical protein	NA	A8ATX6	Listeria_phage	64.6	4.4e-11
AUJ78175.1|3095278_3095671_+	transcriptional regulator	NA	A0A2H4J6F9	uncultured_Caudovirales_phage	39.5	3.7e-17
AUJ78176.1|3095965_3096487_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ78177.1|3096498_3096846_+	hypothetical protein	NA	A0A0S2MVJ2	Bacillus_phage	69.1	3.0e-18
AUJ78178.1|3096918_3097440_+|portal	phage portal protein	portal	A0A2H4JA43	uncultured_Caudovirales_phage	65.0	2.0e-55
AUJ78179.1|3097444_3098674_+|integrase	site-specific integrase	integrase	A0A0K2CZ62	Paenibacillus_phage	49.8	1.6e-106
AUJ78180.1|3099015_3100191_-	cystathionine gamma-synthase	NA	NA	NA	NA	NA
3098803:3098850	attR	ATGATTCCGACTGGGCTCGAACCAGCGACCTCTACCCTGTCAAGGTAG	NA	NA	NA	NA
AUJ78181.1|3100183_3101305_-	cystathionine gamma-synthase	NA	A0A0B5JD48	Pandoravirus	25.9	1.6e-17
AUJ78182.1|3101673_3102396_+	esterase family protein	NA	NA	NA	NA	NA
AUJ78183.1|3102420_3102936_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ78184.1|3102940_3103372_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AUJ78185.1|3103532_3103766_+	AbrB family transcriptional regulator	NA	NA	NA	NA	NA
AUJ78186.1|3103766_3104504_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	33.3	3.3e-27
AUJ78187.1|3104496_3105219_+	ABC transporter permease	NA	NA	NA	NA	NA
AUJ78188.1|3105386_3105641_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ78189.1|3105761_3108047_+	ATP-dependent helicase	NA	A0A068EQC7	Bacillus_phage	33.6	5.2e-87
AUJ78190.1|3108113_3108368_-	sporulation protein	NA	NA	NA	NA	NA
AUJ78191.1|3108534_3108690_-	YjcZ family sporulation protein	NA	NA	NA	NA	NA
AUJ78192.1|3108782_3108980_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ78193.1|3109268_3109625_-	DUF1360 domain-containing protein	NA	NA	NA	NA	NA
AUJ78194.1|3109795_3110182_+|coat	spore coat protein	coat	NA	NA	NA	NA
AUJ78195.1|3110222_3110537_+|coat	spore coat protein	coat	NA	NA	NA	NA
AUJ78196.1|3110629_3111130_+|coat	spore coat protein	coat	NA	NA	NA	NA
AUJ78197.1|3111280_3111763_+|coat	spore coat protein	coat	NA	NA	NA	NA
AUJ78198.1|3111910_3112354_+|coat	spore coat protein	coat	NA	NA	NA	NA
AUJ78199.1|3112411_3112993_-|coat	spore coat protein	coat	NA	NA	NA	NA
>prophage 7
CP025001	Bacillus siamensis strain SCSIO 05746 chromosome, complete genome	4268316	3359213	3471829	4268316	transposase,holin,head,terminase,integrase,portal,protease,capsid,tRNA,tail	Bacillus_phage(19.05%)	114	3423479:3423496	3474457:3474474
AUJ78434.1|3359213_3359696_-|tRNA	tRNA (uridine(34)/cytosine(34)/5- carboxymethylaminomethyluridine(34)-2'-O)- methyltransferase TrmL	tRNA	NA	NA	NA	NA
AUJ78435.1|3359732_3360644_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ78436.1|3360720_3361881_-|tRNA	tRNA epoxyqueuosine(34) reductase QueG	tRNA	NA	NA	NA	NA
AUJ78437.1|3361965_3362589_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ79408.1|3362943_3363147_+	transcriptional regulator	NA	NA	NA	NA	NA
AUJ78438.1|3363143_3363611_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ78439.1|3363631_3363901_-	30S ribosomal protein S14	NA	NA	NA	NA	NA
AUJ79409.1|3363997_3364306_-	sulfur oxidation protein	NA	NA	NA	NA	NA
AUJ78440.1|3364646_3365783_-	alkanesulfonate monooxygenase, FMNH(2)-dependent	NA	NA	NA	NA	NA
AUJ78441.1|3365808_3366645_-	ABC transporter permease	NA	NA	NA	NA	NA
AUJ78442.1|3366641_3367631_-	aliphatic sulfonate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUJ78443.1|3367646_3368414_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	36.8	4.7e-32
AUJ78444.1|3368638_3369568_-	2-amino-3-carboxymuconate-6-semialdehyde decarboxylase	NA	NA	NA	NA	NA
AUJ78445.1|3369823_3371269_+	catalase	NA	A0A2K9L0T1	Tupanvirus	41.1	3.4e-108
AUJ78446.1|3371340_3372306_-	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	30.7	7.8e-08
AUJ78447.1|3372298_3373285_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.2	8.8e-15
AUJ78448.1|3373281_3374187_-	ABC transporter permease	NA	NA	NA	NA	NA
AUJ78449.1|3374199_3375156_-	ABC transporter permease	NA	NA	NA	NA	NA
AUJ78450.1|3375222_3376950_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUJ78451.1|3376946_3377132_-	FbpB family small basic protein	NA	NA	NA	NA	NA
AUJ78452.1|3377386_3378742_+	FAD-binding oxidoreductase	NA	S4VRT3	Pandoravirus	39.3	2.3e-42
AUJ78453.1|3378785_3380558_-	phosphomethylpyrimidine synthase ThiC	NA	NA	NA	NA	NA
AUJ79410.1|3380859_3381552_-	peptidase E	NA	NA	NA	NA	NA
AUJ78454.1|3385852_3386560_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ78455.1|3386507_3387929_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ78456.1|3387904_3389227_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ78457.1|3389835_3390444_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ78458.1|3397534_3398419_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ78459.1|3398621_3398975_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ78460.1|3399009_3399447_-	transcriptional repressor	NA	NA	NA	NA	NA
AUJ78461.1|3399571_3400045_-	thioredoxin-dependent thiol peroxidase	NA	NA	NA	NA	NA
AUJ78462.1|3400201_3401491_+	glutamate-1-semialdehyde 2,1-aminomutase	NA	NA	NA	NA	NA
AUJ78463.1|3401700_3402768_+	aromatic acid exporter family protein	NA	NA	NA	NA	NA
AUJ79411.1|3402843_3404565_-	multidrug ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	28.2	4.7e-48
AUJ78464.1|3404667_3405198_-	DUF402 domain-containing protein	NA	NA	NA	NA	NA
AUJ78465.1|3405333_3405600_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ78466.1|3405760_3405931_-	gamma-type small acid-soluble spore protein	NA	NA	NA	NA	NA
AUJ78467.1|3405997_3406750_-	enoyl-[acyl-carrier-protein] reductase FabL	NA	NA	NA	NA	NA
AUJ78468.1|3406832_3407057_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ78469.1|3407063_3408161_-	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
AUJ78470.1|3408645_3409758_-	aspartate phosphatase	NA	D6R410	Bacillus_phage	95.7	8.2e-203
AUJ78471.1|3410199_3410853_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ78472.1|3411003_3412161_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1P8CWN6	Bacillus_phage	50.3	9.5e-69
AUJ78473.1|3412217_3412484_-|holin	phage holin	holin	A0A2H4J6M0	uncultured_Caudovirales_phage	66.3	7.5e-22
AUJ78474.1|3412495_3412711_-	hypothetical protein	NA	A0A290GDY2	Caldibacillus_phage	53.6	2.0e-12
AUJ78475.1|3412745_3412991_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ78476.1|3412997_3413333_-	DUF2977 domain-containing protein	NA	NA	NA	NA	NA
AUJ78477.1|3413333_3414620_-	DUF2479 domain-containing protein	NA	A0A1J0MFQ3	Staphylococcus_phage	38.4	9.2e-81
AUJ79412.1|3414636_3415368_-	SGNH/GDSL hydrolase family protein	NA	Q4ZE16	Staphylococcus_virus	49.8	2.4e-57
AUJ78478.1|3415666_3416848_-	hydrolase	NA	G3MB53	Bacillus_virus	51.3	2.4e-96
AUJ78479.1|3416840_3417995_-	hypothetical protein	NA	A0A2H4JB19	uncultured_Caudovirales_phage	26.5	4.6e-07
AUJ78480.1|3418003_3418843_-|tail	phage tail family protein	tail	A0A060AFE1	Staphylococcus_phage	30.0	1.7e-30
AUJ78481.1|3418839_3424602_-|tail	phage tail tape measure protein	tail	A8ATV9	Listeria_phage	33.1	7.2e-16
3423479:3423496	attL	AAAAATTGCTCCATGACG	NA	NA	NA	NA
AUJ78482.1|3424784_3425105_-	hypothetical protein	NA	A0A0M4R2F4	Enterococcus_phage	36.0	3.0e-09
AUJ78483.1|3425180_3425756_-|tail	phage tail protein	tail	A0A1I9KKC4	Lactobacillus_phage	36.4	2.7e-24
AUJ78484.1|3425814_3426204_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ78485.1|3426200_3426629_-|head,tail	head-tail adaptor protein	head,tail	A0A0M5M1E5	Enterococcus_phage	44.3	2.0e-08
AUJ78486.1|3426625_3426955_-|head,tail	head-tail adaptor protein	head,tail	NA	NA	NA	NA
AUJ78487.1|3426961_3427276_-	hypothetical protein	NA	H9A116	Staphylococcus_phage	36.5	1.5e-08
AUJ78488.1|3427289_3428495_-|capsid	phage major capsid protein	capsid	E9LUQ3	Lactobacillus_phage	47.5	1.3e-97
AUJ78489.1|3428491_3429214_-|protease	Clp protease ClpP	protease	A0A0C5AJ10	Paenibacillus_phage	65.7	5.0e-68
AUJ78490.1|3429188_3430409_-|portal	phage portal protein	portal	A0A2I7SCY4	Paenibacillus_phage	37.4	5.5e-67
AUJ78491.1|3430421_3432212_-|terminase	terminase large subunit	terminase	F8J1B1	Lactobacillus_phage	60.9	7.7e-211
AUJ79413.1|3432201_3432687_-|terminase	phage terminase small subunit P27 family	terminase	A6M947	Geobacillus_virus	39.4	3.2e-26
AUJ78492.1|3432886_3433201_-	HNH endonuclease	NA	A0A0C5AEM7	Paenibacillus_phage	46.6	4.3e-16
AUJ78493.1|3433232_3433433_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ78494.1|3433544_3434249_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ78495.1|3434387_3434612_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ78496.1|3434754_3435057_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ78497.1|3435244_3435430_+	addiction module toxin, HicA family	NA	D6R431	Bacillus_phage	71.2	7.1e-19
AUJ78498.1|3435456_3435873_+	pilus assembly protein HicB	NA	A0A0K2CYJ8	Paenibacillus_phage	55.7	9.0e-38
AUJ78499.1|3435887_3436403_-	Fis family transcriptional regulator	NA	A0A0A7AQW8	Bacillus_phage	35.2	1.6e-23
AUJ78500.1|3436630_3436831_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ78501.1|3437211_3438540_-	replicative DNA helicase	NA	W8EEZ1	Geobacillus_phage	56.4	1.6e-136
AUJ78502.1|3438541_3438898_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ78503.1|3438890_3439664_-	Replication protein O	NA	A0A2P1JTY8	Anoxybacillus_phage	50.7	3.0e-34
AUJ79414.1|3439675_3440044_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ78504.1|3440205_3441051_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ78505.1|3441063_3441711_-	DNA-binding protein	NA	A0A288WFT2	Bacillus_phage	40.7	4.8e-38
AUJ78506.1|3441701_3442010_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ78507.1|3441996_3442278_-	hypothetical protein	NA	Q9ZXC9	Bacillus_phage	39.5	4.0e-13
AUJ78508.1|3442473_3442746_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ78509.1|3442732_3442939_-	XRE family transcriptional regulator	NA	A0A0M3ULF9	Bacillus_phage	66.7	2.2e-13
AUJ78510.1|3443207_3443513_+	XRE family transcriptional regulator	NA	A0A141E189	Streptococcus_phage	54.3	1.2e-15
AUJ78511.1|3443527_3443992_+	ImmA/IrrE family metallo-endopeptidase	NA	A0A2I7SC21	Paenibacillus_phage	51.6	5.3e-39
AUJ78512.1|3444059_3445208_+|integrase	site-specific integrase	integrase	A0A1S5S7K9	Streptococcus_phage	33.2	3.0e-35
AUJ78513.1|3445221_3445401_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ78514.1|3445428_3446412_+	metal-dependent hydrolase	NA	NA	NA	NA	NA
AUJ78515.1|3446408_3448994_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ78516.1|3449030_3450011_-	glycosyltransferase	NA	A8CG95	Salmonella_phage	39.7	3.4e-59
AUJ78517.1|3450228_3451089_-	alpha/beta hydrolase	NA	A0A0S2MV32	Mycobacterium_phage	26.4	3.8e-06
AUJ78518.1|3451085_3451418_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ78519.1|3451503_3452031_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ78520.1|3452160_3452430_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ78521.1|3452553_3452706_+	small, acid-soluble spore protein K	NA	NA	NA	NA	NA
AUJ79415.1|3452876_3454070_-	MFS transporter	NA	NA	NA	NA	NA
AUJ78522.1|3454211_3454526_-	DUF1811 domain-containing protein	NA	NA	NA	NA	NA
AUJ78523.1|3454532_3455324_-	recombination regulator RecX	NA	NA	NA	NA	NA
AUJ78524.1|3455415_3456315_+	TIGR01777 family protein	NA	NA	NA	NA	NA
AUJ78525.1|3456372_3456483_+	YfhE family protein	NA	NA	NA	NA	NA
AUJ78526.1|3456552_3456744_+	YfhD family protein	NA	NA	NA	NA	NA
AUJ78527.1|3456782_3457367_-	nitroreductase	NA	NA	NA	NA	NA
AUJ78528.1|3457443_3458328_-	isomerase	NA	NA	NA	NA	NA
AUJ78529.1|3458426_3460997_-	phosphatidylglycerol lysyltransferase	NA	NA	NA	NA	NA
AUJ78530.1|3461165_3461648_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
AUJ78531.1|3461754_3463347_+	MFS transporter	NA	A0A0M3UL24	Mycobacterium_phage	24.2	6.6e-20
AUJ78532.1|3463306_3463849_-	metal-dependent hydrolase	NA	D0R7I3	Paenibacillus_phage	43.0	1.0e-17
AUJ78533.1|3463874_3464147_-	barnase inhibitor	NA	NA	NA	NA	NA
AUJ78534.1|3464169_3466581_-	phosphoenolpyruvate synthase	NA	NA	NA	NA	NA
AUJ78535.1|3466912_3468004_-	acyltransferase	NA	NA	NA	NA	NA
AUJ78536.1|3467994_3468597_-	NADPH dehydrogenase	NA	NA	NA	NA	NA
AUJ78537.1|3468818_3469370_+	PadR family transcriptional regulator	NA	NA	NA	NA	NA
AUJ78538.1|3469409_3470357_-	protoheme IX farnesyltransferase	NA	NA	NA	NA	NA
AUJ78539.1|3470678_3471829_-|transposase	IS3 family transposase	transposase	A0A0N9SIX5	Staphylococcus_phage	60.7	3.0e-38
3474457:3474474	attR	AAAAATTGCTCCATGACG	NA	NA	NA	NA
>prophage 8
CP025001	Bacillus siamensis strain SCSIO 05746 chromosome, complete genome	4268316	3618444	3628334	4268316		Synechococcus_phage(50.0%)	9	NA	NA
AUJ78668.1|3618444_3619983_-	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	49.8	3.3e-77
AUJ78669.1|3619979_3620567_-	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	38.8	2.9e-26
AUJ78670.1|3620563_3621604_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3F760	Synechococcus_phage	41.6	3.7e-64
AUJ78671.1|3621694_3623125_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	32.7	1.4e-53
AUJ78672.1|3623100_3625329_-	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	40.9	3.2e-158
AUJ78673.1|3625312_3625996_-	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
AUJ78674.1|3625992_3626247_-	phosphoribosylformylglycinamidine synthase, purS protein	NA	M4QPE7	Synechococcus_phage	33.3	4.7e-05
AUJ78675.1|3626234_3626966_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3FUQ7	Synechococcus_phage	43.4	1.1e-46
AUJ78676.1|3627041_3628334_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	27.3	4.5e-19
