The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP029384	Klebsiella pneumoniae subsp. pneumoniae strain SCKP020079 chromosome, complete genome	5468182	450003	520581	5468182	tRNA,protease,terminase,integrase,tail,capsid,transposase,portal,head	uncultured_Caudovirales_phage(57.89%)	76	468811:468828	484806:484823
AWL44011.1|450003_450951_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	37.2	2.2e-07
AWL44012.1|450965_451475_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	40.3	2.6e-18
AWL44013.1|451603_452728_+	DNA-protecting protein DprA	NA	NA	NA	NA	NA
AWL44014.1|452699_453173_+	DUF494 domain-containing protein	NA	NA	NA	NA	NA
AWL44015.1|453198_453741_+	hypothetical protein	NA	NA	NA	NA	NA
AWL44016.1|453745_454318_+	L-threonylcarbamoyladenylate synthase type 1 TsaC	NA	NA	NA	NA	NA
AWL44017.1|454321_455140_+	shikimate dehydrogenase	NA	NA	NA	NA	NA
AWL44018.1|455136_455394_+	DUF1488 domain-containing protein	NA	NA	NA	NA	NA
AWL48678.1|455369_455924_-	gamma carbonic anhydrase family protein	NA	NA	NA	NA	NA
AWL44019.1|461719_461941_-	hypothetical protein	NA	NA	NA	NA	NA
AWL44020.1|462234_465345_-	multidrug efflux RND transporter permease subunit	NA	NA	NA	NA	NA
AWL44021.1|465357_466497_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
AWL44022.1|467122_468103_+|transposase	IS5-like element ISKpn26 family transposase	transposase	Q38213	Escherichia_phage	99.1	8.9e-185
AWL48679.1|468141_468267_-	ABC transporter	NA	NA	NA	NA	NA
468811:468828	attL	GTATCAGTTCATGCCGTA	NA	NA	NA	NA
AWL44023.1|469001_470228_+|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	62.2	1.8e-150
AWL44024.1|470320_471262_+	hypothetical protein	NA	NA	NA	NA	NA
AWL44025.1|471443_471728_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
AWL44026.1|471738_472518_+	hypothetical protein	NA	Q8HA02	Enterobacteria_phage	51.5	6.2e-40
AWL44027.1|472641_472836_-	toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
AWL48680.1|472969_473239_+	host cell division inhibitor Icd-like protein	NA	A0A2H4JGW3	uncultured_Caudovirales_phage	94.4	2.4e-44
AWL44028.1|473231_473420_+	hypothetical protein	NA	NA	NA	NA	NA
AWL44029.1|473412_473727_+	hypothetical protein	NA	NA	NA	NA	NA
AWL44030.1|473723_474092_+	hypothetical protein	NA	A0A2H4JCX7	uncultured_Caudovirales_phage	81.1	3.7e-51
AWL44031.1|474088_474454_+	hypothetical protein	NA	NA	NA	NA	NA
AWL44032.1|474453_476589_+	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	62.4	3.4e-205
AWL44033.1|476931_477267_+	hypothetical protein	NA	NA	NA	NA	NA
AWL44034.1|477315_477828_-	hypothetical protein	NA	NA	NA	NA	NA
AWL44035.1|478091_479258_+|capsid	phage major capsid protein	capsid	A0A2H4JED2	uncultured_Caudovirales_phage	95.9	9.8e-207
AWL44036.1|479309_479870_+|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	95.7	1.2e-98
AWL44037.1|479871_481113_+|portal	phage portal protein	portal	A0A2H4JFJ9	uncultured_Caudovirales_phage	96.5	1.0e-230
AWL44038.1|481109_481445_+|head,tail	head-tail adaptor	head,tail	A0A2H4JHK5	uncultured_Caudovirales_phage	57.8	3.7e-26
AWL44039.1|481441_481741_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2H4JD08	uncultured_Caudovirales_phage	80.8	3.4e-39
AWL44040.1|481740_482184_+	HNH endonuclease	NA	A0A2H4JAS8	uncultured_Caudovirales_phage	91.8	2.8e-77
AWL44041.1|482310_482502_+|terminase	terminase	terminase	NA	NA	NA	NA
AWL44042.1|482459_482816_+|terminase	phage terminase small subunit P27 family	terminase	A0A2H4JHS3	uncultured_Caudovirales_phage	99.2	5.5e-60
AWL44043.1|482799_484461_+|terminase	terminase large subunit	terminase	A0A2H4JB64	uncultured_Caudovirales_phage	98.0	0.0e+00
AWL44044.1|484463_484655_+	hypothetical protein	NA	NA	NA	NA	NA
AWL44045.1|484808_485105_-	Fis family transcriptional regulator	NA	NA	NA	NA	NA
484806:484823	attR	GTATCAGTTCATGCCGTA	NA	NA	NA	NA
AWL44046.1|485129_486095_-|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
AWL44047.1|486252_486447_-	hypothetical protein	NA	NA	NA	NA	NA
AWL44048.1|486452_487334_-	50S ribosomal protein L11 methyltransferase	NA	NA	NA	NA	NA
AWL44049.1|487345_488797_-	sodium/panthothenate symporter	NA	NA	NA	NA	NA
AWL44050.1|488786_489029_-	DUF997 domain-containing protein	NA	NA	NA	NA	NA
AWL44051.1|489139_490489_-	acetyl-CoA carboxylase biotin carboxylase subunit	NA	NA	NA	NA	NA
AWL44052.1|490499_490967_-	acetyl-CoA carboxylase biotin carboxyl carrier protein	NA	NA	NA	NA	NA
AWL44053.1|490989_491442_-	type II 3-dehydroquinate dehydratase	NA	NA	NA	NA	NA
AWL44054.1|491665_492274_-	protein-methionine-sulfoxide reductase heme-binding subunit MsrQ	NA	NA	NA	NA	NA
AWL44055.1|492273_493275_-	protein-methionine-sulfoxide reductase catalytic subunit MsrP	NA	NA	NA	NA	NA
AWL44056.1|493503_493695_+	hypothetical protein	NA	NA	NA	NA	NA
AWL44057.1|493774_495715_+	RNase E specificity factor CsrD	NA	NA	NA	NA	NA
AWL44058.1|495836_496043_-	hypothetical protein	NA	NA	NA	NA	NA
AWL44059.1|496020_497064_+	rod shape-determining protein	NA	F2Y0P3	Organic_Lake_phycodnavirus	22.3	6.7e-05
AWL44060.1|497134_498127_+	rod shape-determining protein MreC	NA	NA	NA	NA	NA
AWL44061.1|498126_498615_+	rod shape-determining protein MreD	NA	NA	NA	NA	NA
AWL44062.1|498622_499204_+	septum formation inhibitor Maf	NA	NA	NA	NA	NA
AWL44063.1|499206_500676_+	ribonuclease G	NA	NA	NA	NA	NA
AWL44064.1|500713_504511_+	AsmA2 domain-containing protein	NA	NA	NA	NA	NA
AWL44065.1|504599_506045_+|protease	metalloprotease TldD	protease	NA	NA	NA	NA
AWL44066.1|506080_507010_-	HTH-type transcriptional activator AaeR	NA	NA	NA	NA	NA
AWL44067.1|507141_507345_+	protein AaeX	NA	NA	NA	NA	NA
AWL44068.1|507352_508285_+	p-hydroxybenzoic acid efflux pump subunit AaeA	NA	NA	NA	NA	NA
AWL44069.1|508290_510258_+	p-hydroxybenzoic acid efflux pump subunit AaeB	NA	NA	NA	NA	NA
AWL44070.1|510337_510613_+	hypothetical protein	NA	NA	NA	NA	NA
AWL44071.1|510663_510930_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
AWL44072.1|511028_511292_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
AWL44073.1|511667_512138_-	arginine repressor	NA	NA	NA	NA	NA
AWL44074.1|512552_513491_+	malate dehydrogenase	NA	NA	NA	NA	NA
AWL44075.1|513627_514686_-|protease	serine endoprotease DegS	protease	NA	NA	NA	NA
AWL44076.1|514773_516141_-|protease	serine endoprotease DegQ	protease	A0A1B1IT49	uncultured_Mediterranean_phage	25.3	6.0e-22
AWL44077.1|516314_516713_-	DUF1043 domain-containing protein	NA	NA	NA	NA	NA
AWL44078.1|516903_518031_+	cell division protein ZapE	NA	NA	NA	NA	NA
AWL44079.1|518296_518725_+	50S ribosomal protein L13	NA	NA	NA	NA	NA
AWL44080.1|518740_519133_+	30S ribosomal protein S9	NA	NA	NA	NA	NA
AWL44081.1|519242_519446_-	hypothetical protein	NA	NA	NA	NA	NA
AWL44082.1|519444_520083_+	stringent starvation protein A	NA	NA	NA	NA	NA
AWL44083.1|520086_520581_+|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	54.8	1.5e-26
>prophage 2
CP029384	Klebsiella pneumoniae subsp. pneumoniae strain SCKP020079 chromosome, complete genome	5468182	1211316	1260460	5468182	plate,tRNA,integrase,tail,lysis,capsid,coat,transposase,portal,head	Salmonella_phage(80.0%)	63	1209721:1209738	1239994:1240011
1209721:1209738	attL	CGGCAAAGAGGCGGGCGA	NA	NA	NA	NA
AWL44760.1|1211316_1212297_-|transposase	IS5-like element ISKpn26 family transposase	transposase	Q38213	Escherichia_phage	99.1	8.9e-185
AWL44761.1|1212342_1213341_-|integrase	site-specific integrase	integrase	A0A1S6L016	Salmonella_phage	94.5	2.2e-183
AWL44762.1|1213343_1213973_-	phage repressor protein	NA	A0A1S6KZZ7	Salmonella_phage	54.5	1.4e-61
AWL44763.1|1214095_1214338_+	Rha family transcriptional regulator	NA	A0A1S6KZZ6	Salmonella_phage	98.8	4.0e-38
AWL44764.1|1214370_1214880_+	hypothetical protein	NA	A0A1S6L008	Salmonella_phage	85.8	1.1e-77
AWL44765.1|1214887_1215088_+	DUF2724 domain-containing protein	NA	A0A1S6L005	Salmonella_phage	68.8	4.5e-19
AWL44766.1|1215051_1215390_+	hypothetical protein	NA	A0A218M4I7	Erwinia_phage	58.0	6.2e-29
AWL44767.1|1215457_1215691_+	DUF2732 domain-containing protein	NA	A0A1S6L021	Salmonella_phage	90.9	6.0e-31
AWL44768.1|1215690_1215918_+	TraR/DksA family transcriptional regulator	NA	A0A1S6L007	Salmonella_phage	92.0	5.1e-35
AWL44769.1|1215914_1216766_+	DNA adenine methylase	NA	A0A1S6L011	Salmonella_phage	75.4	2.2e-115
AWL44770.1|1216762_1219147_+	replication endonuclease	NA	A0A1S6L028	Salmonella_phage	87.9	0.0e+00
AWL44771.1|1219376_1219628_+	hypothetical protein	NA	NA	NA	NA	NA
AWL44772.1|1219627_1221112_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
AWL44773.1|1221219_1221408_+	hypothetical protein	NA	A0A1S6L006	Salmonella_phage	90.3	2.2e-23
AWL44774.1|1221419_1221653_+	DinI family protein	NA	A0A0M4S6H1	Salmonella_phage	96.1	2.0e-34
AWL44775.1|1221748_1222432_-	hypothetical protein	NA	NA	NA	NA	NA
AWL44776.1|1222418_1223498_-	hypothetical protein	NA	NA	NA	NA	NA
AWL44777.1|1223497_1224499_-	hypothetical protein	NA	NA	NA	NA	NA
AWL48701.1|1225020_1225290_+	hypothetical protein	NA	D2IZW1	Enterococcus_phage	41.3	1.4e-15
AWL44778.1|1225346_1226390_-|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	85.6	3.1e-172
AWL44779.1|1226389_1228153_-	oxidoreductase	NA	A0A1S6KZW3	Salmonella_phage	91.8	0.0e+00
AWL44780.1|1228293_1229127_+|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	77.6	4.4e-100
AWL44781.1|1229143_1230196_+|capsid	phage major capsid protein, P2 family	capsid	A0A1S6KZZ3	Salmonella_phage	91.0	6.8e-175
AWL44782.1|1230199_1230853_+	hypothetical protein	NA	A0A1S6KZX1	Salmonella_phage	80.0	1.9e-90
AWL44783.1|1230948_1231413_+|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	85.7	1.5e-73
AWL44784.1|1231412_1231616_+|tail	phage tail protein	tail	E5G6M9	Salmonella_phage	89.6	9.8e-30
AWL48702.1|1231619_1231835_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	88.7	6.1e-30
AWL44785.1|1231815_1232325_+	lysozyme	NA	E5G6N1	Salmonella_phage	85.2	1.6e-81
AWL44786.1|1232329_1232713_+	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	45.4	1.9e-18
AWL44787.1|1232709_1233138_+|lysis	LysB family phage lysis regulatory protein	lysis	A0A1S6KZX8	Salmonella_phage	82.5	7.1e-54
AWL44788.1|1233067_1233271_+	hypothetical protein	NA	A0A1S6KZX6	Salmonella_phage	77.6	3.0e-23
AWL44789.1|1233233_1233656_+|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	83.2	8.2e-63
AWL44790.1|1233648_1234095_+	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	72.3	2.5e-54
AWL44791.1|1234117_1234984_-	hypothetical protein	NA	NA	NA	NA	NA
AWL44792.1|1235078_1235651_+|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	70.8	1.4e-76
AWL44793.1|1235647_1236010_+|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	85.6	8.4e-48
AWL44794.1|1235996_1236905_+|plate	baseplate assembly protein	plate	E5G6N8	Salmonella_phage	68.9	1.9e-109
AWL48703.1|1236897_1237569_+|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	58.9	3.2e-61
AWL44795.1|1237570_1239520_+|coat	spore coat protein CotH	coat	Q6QI97	Burkholderia_phage	38.9	1.0e-06
AWL44796.1|1239529_1240648_+	hypothetical protein	NA	A0A248XD67	Klebsiella_phage	38.0	4.4e-55
1239994:1240011	attR	CGGCAAAGAGGCGGGCGA	NA	NA	NA	NA
AWL44797.1|1240699_1241773_+|tail	phage tail protein	tail	A0A1S6KZZ8	Salmonella_phage	53.6	6.6e-40
AWL44798.1|1241921_1243094_+|tail	phage tail protein	tail	A0A1S6KZY7	Salmonella_phage	91.5	3.4e-207
AWL44799.1|1243103_1243619_+|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	84.2	1.4e-80
AWL44800.1|1243671_1243971_+|tail	phage tail assembly protein	tail	E5G6P9	Salmonella_phage	78.0	8.2e-33
AWL44801.1|1243985_1244105_+|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.2e-13
AWL44802.1|1244097_1246728_+|tail	phage tail tape measure protein	tail	E5FFG5	Burkholderia_phage	41.9	8.9e-115
AWL44803.1|1246724_1247210_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	80.1	5.2e-61
AWL44804.1|1247206_1248301_+	phage late control D family protein	NA	E5G6Q3	Salmonella_phage	83.6	2.4e-170
AWL44805.1|1248367_1248586_+	levansucrase regulator	NA	Q53ZE7	Salmonella_virus	72.2	1.9e-26
AWL44806.1|1248613_1248991_-	hypothetical protein	NA	NA	NA	NA	NA
AWL44807.1|1249594_1250077_-	SsrA-binding protein	NA	W5RAM5	Staphylococcus_phage	47.4	2.3e-29
AWL44808.1|1250187_1250664_+	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
AWL44809.1|1250653_1250944_+	RnfH family protein	NA	NA	NA	NA	NA
AWL44810.1|1251010_1251352_-	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
AWL44811.1|1251499_1253161_-	DNA repair protein RecN	NA	NA	NA	NA	NA
AWL44812.1|1253247_1254126_-	NAD(+) kinase	NA	NA	NA	NA	NA
AWL44813.1|1254250_1254841_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
AWL44814.1|1254960_1256247_-	DUF21 domain-containing protein	NA	NA	NA	NA	NA
AWL44815.1|1256266_1257058_-	inner membrane protein YpjD	NA	NA	NA	NA	NA
AWL44816.1|1257221_1258586_+	signal recognition particle protein	NA	NA	NA	NA	NA
AWL44817.1|1258845_1259094_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
AWL44818.1|1259112_1259661_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
AWL44819.1|1259692_1260460_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
>prophage 3
CP029384	Klebsiella pneumoniae subsp. pneumoniae strain SCKP020079 chromosome, complete genome	5468182	1366482	1420425	5468182	transposase,terminase,holin,tail	Salmonella_phage(38.46%)	64	NA	NA
AWL44909.1|1366482_1367949_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	38.7	1.2e-87
AWL44910.1|1368016_1369594_+	GMP synthase (glutamine-hydrolyzing)	NA	NA	NA	NA	NA
AWL44911.1|1369785_1371036_+	DUF4102 domain-containing protein	NA	A0A1X9TCT6	Enterobacter_phage	84.4	5.8e-205
AWL44912.1|1370978_1371221_-	hypothetical protein	NA	NA	NA	NA	NA
AWL44913.1|1371217_1371811_-	adenine methylase	NA	T1SA14	Salmonella_phage	91.9	6.3e-109
AWL44914.1|1371807_1372470_-	hypothetical protein	NA	A0A059VF56	Pseudomonas_phage	46.6	1.2e-47
AWL44915.1|1372466_1372625_-	DUF1317 domain-containing protein	NA	T1SAR0	Salmonella_phage	78.8	1.1e-17
AWL44916.1|1372617_1372911_-	PerC family transcriptional regulator	NA	T1S9J5	Salmonella_phage	71.1	4.0e-32
AWL44917.1|1373020_1373269_-	AlpA family phage regulatory protein	NA	A0A0F6TJ45	Escherichia_coli_O157_typing_phage	76.8	4.9e-31
AWL44918.1|1373317_1374199_-	recombinase RecT	NA	T1SBJ5	Salmonella_phage	84.3	8.9e-136
AWL44919.1|1374195_1375017_-	exodeoxyribonuclease VIII	NA	A0A193GYK2	Enterobacter_phage	80.2	1.8e-130
AWL44920.1|1375013_1375313_-	hypothetical protein	NA	A0A0F6R7M4	Escherichia_coli_O157_typing_phage	54.5	2.1e-20
AWL44921.1|1375679_1376261_-	XRE family transcriptional regulator	NA	Q858D7	Salmonella_phage	64.3	7.1e-65
AWL44922.1|1376415_1376649_+	hypothetical protein	NA	T1SAR5	Salmonella_phage	66.2	9.2e-24
AWL44923.1|1376795_1377005_+	hypothetical protein	NA	A0A193GYW4	Enterobacter_phage	78.3	1.8e-26
AWL44924.1|1377004_1377772_+	primosomal protein	NA	A0A193GZ86	Enterobacter_phage	91.4	8.9e-140
AWL44925.1|1377768_1378554_+	replication protein	NA	A0A193GYX1	Enterobacter_phage	87.7	3.7e-133
AWL44926.1|1378673_1379021_+	DUF1064 domain-containing protein	NA	A0A0F6R8N5	Escherichia_coli_O157_typing_phage	82.6	6.5e-50
AWL44927.1|1379213_1379624_+	hypothetical protein	NA	A0A2P1MXC5	Escherichia_phage	45.1	4.3e-16
AWL44928.1|1379607_1379799_+	hypothetical protein	NA	NA	NA	NA	NA
AWL44929.1|1379795_1380440_+	hypothetical protein	NA	Q1MVG0	Enterobacteria_phage	79.3	8.0e-110
AWL48706.1|1380733_1381201_+	hypothetical protein	NA	A0A2R2Z312	Escherichia_phage	51.7	1.3e-37
AWL44930.1|1381200_1381494_+	hypothetical protein	NA	Q6UAT9	Klebsiella_phage	86.6	2.7e-44
AWL44931.1|1381490_1382111_+	hypothetical protein	NA	Q1MVF7	Enterobacteria_phage	40.7	1.0e-29
AWL48708.1|1382110_1382314_+	hypothetical protein	NA	NA	NA	NA	NA
AWL44932.1|1382306_1382645_+	hypothetical protein	NA	A0A193GYX4	Enterobacter_phage	80.0	1.8e-44
AWL44933.1|1382741_1384226_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
AWL44934.1|1384225_1384477_-	hypothetical protein	NA	NA	NA	NA	NA
AWL48707.1|1384629_1384887_+	lF-82	NA	NA	NA	NA	NA
AWL44935.1|1384964_1385549_+|terminase	terminase small subunit	terminase	T1SBI8	Salmonella_phage	88.6	2.2e-90
AWL44936.1|1385545_1387021_+|terminase	terminase	terminase	Q858H3	Salmonella_phage	93.1	6.4e-280
AWL44937.1|1387064_1387436_-	hypothetical protein	NA	A0A0F6TJP2	Escherichia_coli_O157_typing_phage	91.9	3.7e-59
AWL44938.1|1387485_1387728_+	hypothetical protein	NA	NA	NA	NA	NA
AWL44939.1|1388189_1388396_+	hypothetical protein	NA	T1SA67	Salmonella_phage	88.2	4.8e-08
AWL44940.1|1388410_1390093_+|tail	phage tail protein	tail	A0A0F6TJD8	Escherichia_coli_O157_typing_phage	84.4	1.5e-264
AWL44941.1|1390089_1390386_+	hypothetical protein	NA	T1SBI9	Salmonella_phage	70.4	1.2e-33
AWL44942.1|1390388_1391069_+	peptidase	NA	G9L6C4	Escherichia_phage	84.0	6.1e-76
AWL44943.1|1391083_1392070_+	hypothetical protein	NA	A0A193GZ49	Enterobacter_phage	94.2	2.5e-179
AWL44944.1|1392123_1392561_+	hypothetical protein	NA	A0A193GYT9	Enterobacter_phage	91.7	1.3e-66
AWL44945.1|1392571_1392913_+	hypothetical protein	NA	G9L6C7	Escherichia_phage	70.8	2.4e-36
AWL44946.1|1392963_1393287_+	hypothetical protein	NA	G9L6C8	Escherichia_phage	85.0	5.3e-46
AWL44947.1|1393286_1393892_+	hypothetical protein	NA	A0A0F6TJN5	Escherichia_coli_O157_typing_phage	77.0	4.0e-87
AWL44948.1|1393891_1396369_+	hypothetical protein	NA	Q858G3	Salmonella_phage	84.4	0.0e+00
AWL44949.1|1396368_1396833_+	hypothetical protein	NA	Q858G2	Salmonella_phage	81.2	1.5e-70
AWL44950.1|1396832_1397372_+	hypothetical protein	NA	A0A0F6TJ56	Escherichia_coli_O157_typing_phage	80.0	8.0e-71
AWL44951.1|1397382_1399917_+	hypothetical protein	NA	Q858G0	Salmonella_phage	84.1	0.0e+00
AWL44952.1|1399916_1401827_+	hypothetical protein	NA	Q858F9	Salmonella_phage	82.7	5.4e-287
AWL44953.1|1401826_1404583_+	hypothetical protein	NA	Q858F8	Salmonella_phage	95.4	0.0e+00
AWL44954.1|1404579_1404774_+	hypothetical protein	NA	Q858F7	Salmonella_phage	67.2	6.5e-15
AWL44955.1|1404808_1404961_-	transmembrane anchored protein	NA	G9L6D9	Escherichia_phage	83.7	2.5e-14
AWL44956.1|1405059_1405356_-	hypothetical protein	NA	T1SA06	Salmonella_phage	63.9	6.9e-24
AWL44957.1|1408183_1408447_+	hypothetical protein	NA	NA	NA	NA	NA
AWL44958.1|1408487_1409621_-	hypothetical protein	NA	NA	NA	NA	NA
AWL48709.1|1409609_1409696_+	ABC transporter	NA	NA	NA	NA	NA
AWL44959.1|1409734_1410715_-|transposase	IS5 family transposase ISKpn26	transposase	A0A077SK28	Escherichia_phage	99.4	1.0e-185
AWL44960.1|1412716_1413697_+|transposase	IS5 family transposase ISKpn26	transposase	A0A077SK28	Escherichia_phage	99.4	1.0e-185
AWL48710.1|1413735_1413822_-	ABC transporter	NA	NA	NA	NA	NA
AWL44961.1|1414936_1415077_-	ABC transporter	NA	NA	NA	NA	NA
AWL44962.1|1415154_1416471_+	right-handed parallel beta-helix repeat-containing protein	NA	A0A0K2FI18	Enterobacter_phage	32.3	2.3e-34
AWL44963.1|1416557_1416962_+	hypothetical protein	NA	T1SA79	Salmonella_phage	81.1	8.7e-54
AWL44964.1|1416948_1417254_+|holin	phage holin family protein	holin	A0A193GYK3	Enterobacter_phage	81.4	2.7e-39
AWL44965.1|1417243_1417873_+	glycoside hydrolase family 19 protein	NA	Q858F0	Salmonella_phage	76.9	1.8e-90
AWL44966.1|1417869_1418370_+	DUF2514 domain-containing protein	NA	Q858E9	Salmonella_phage	76.9	1.3e-59
AWL44967.1|1418556_1420425_-	phosphatase	NA	A0A2P0VMN7	Tetraselmis_virus	22.6	2.6e-07
>prophage 4
CP029384	Klebsiella pneumoniae subsp. pneumoniae strain SCKP020079 chromosome, complete genome	5468182	1759038	1765943	5468182		Planktothrix_phage(33.33%)	6	NA	NA
AWL48726.1|1759038_1759902_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	27.5	7.4e-10
AWL45259.1|1759912_1760686_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.7	5.1e-26
AWL48727.1|1760926_1761820_-	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.8	6.1e-15
AWL45260.1|1762065_1763427_-	U32 family peptidase	NA	Q6DW11	Phage_TP	94.8	1.8e-207
AWL45261.1|1763745_1764468_-	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.2	8.3e-31
AWL45262.1|1764464_1765943_-	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	28.3	1.9e-29
>prophage 5
CP029384	Klebsiella pneumoniae subsp. pneumoniae strain SCKP020079 chromosome, complete genome	5468182	1809288	1820312	5468182	transposase	Escherichia_phage(33.33%)	10	NA	NA
AWL45291.1|1809288_1810695_+	phosphogluconate dehydrogenase (NADP(+)-dependent, decarboxylating)	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.7	4.7e-38
AWL45292.1|1810921_1812337_+	mannose-1-phosphate guanylyltransferase	NA	A0A1V0SH58	Hokovirus	31.0	1.4e-53
AWL45293.1|1812358_1813729_+	phosphomannomutase	NA	A0A127AWJ1	Bacillus_phage	25.9	6.4e-32
AWL48730.1|1813883_1814948_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	54.7	9.8e-105
AWL45294.1|1814961_1815831_+	glucose-1-phosphate thymidylyltransferase	NA	I7I009	Enterobacteria_phage	66.7	1.7e-110
AWL45295.1|1815862_1816753_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	34.2	2.8e-28
AWL45296.1|1816767_1817322_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	58.2	2.9e-52
AWL45297.1|1817501_1818668_+	UDP-glucose 6-dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	54.7	9.1e-112
AWL48731.1|1819170_1819293_+	ABC transporter	NA	NA	NA	NA	NA
AWL45298.1|1819331_1820312_-|transposase	IS5 family transposase ISKpn26	transposase	A0A077SK28	Escherichia_phage	99.4	1.0e-185
>prophage 6
CP029384	Klebsiella pneumoniae subsp. pneumoniae strain SCKP020079 chromosome, complete genome	5468182	2812660	2823548	5468182		Escherichia_phage(87.5%)	10	NA	NA
AWL46224.1|2812660_2815768_+	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	59.6	0.0e+00
AWL46225.1|2815822_2817088_+	MFS transporter	NA	NA	NA	NA	NA
AWL46226.1|2817118_2818207_-	chromosome segregation protein SMC	NA	A0A077SLJ9	Escherichia_phage	100.0	8.0e-211
AWL46227.1|2818293_2818554_-	hypothetical protein	NA	A0A077SK33	Escherichia_phage	97.7	3.5e-40
AWL46228.1|2818851_2819712_+	class A broad-spectrum beta-lactamase SHV-11	NA	A0A077SL40	Escherichia_phage	99.3	2.2e-155
AWL46229.1|2819732_2820494_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
AWL46230.1|2820484_2820718_+	hypothetical protein	NA	NA	NA	NA	NA
AWL46231.1|2820755_2821658_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	99.7	2.6e-159
AWL46232.1|2821669_2822935_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	99.5	1.3e-233
AWL46233.1|2822927_2823548_+	aldolase	NA	A0A077SK32	Escherichia_phage	100.0	8.0e-115
>prophage 7
CP029384	Klebsiella pneumoniae subsp. pneumoniae strain SCKP020079 chromosome, complete genome	5468182	3016813	3089510	5468182	plate,protease,terminase,tail,lysis,transposase,head	uncultured_Caudovirales_phage(33.33%)	84	NA	NA
AWL46416.1|3016813_3017899_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
AWL46417.1|3017862_3019617_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
AWL46418.1|3021288_3024714_-	type VI secretion protein VasK	NA	NA	NA	NA	NA
AWL46419.1|3024697_3025837_-	hypothetical protein	NA	NA	NA	NA	NA
AWL46420.1|3025833_3026091_-	PAAR domain-containing protein	NA	NA	NA	NA	NA
AWL46421.1|3026135_3028553_-	DUF2235 domain-containing protein	NA	NA	NA	NA	NA
AWL46422.1|3028540_3029071_-	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
AWL46423.1|3029138_3029669_-	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
AWL46424.1|3029737_3030268_-	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
AWL46425.1|3030335_3030866_-	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
AWL46426.1|3030934_3031465_-	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
AWL46427.1|3031528_3032308_-	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
AWL46428.1|3032308_3034687_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	33.8	9.2e-18
AWL46429.1|3034679_3037334_-	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	33.4	2.5e-96
AWL46430.1|3037598_3038090_-	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
AWL46431.1|3038094_3039801_-	OmpA family protein	NA	NA	NA	NA	NA
AWL46432.1|3039797_3040487_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
AWL48782.1|3040483_3041824_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
AWL46433.1|3041836_3043381_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
AWL46434.1|3043423_3043915_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
AWL46435.1|3044384_3045365_+|transposase	IS5-like element ISKpn26 family transposase	transposase	Q38213	Escherichia_phage	99.1	8.9e-185
AWL46436.1|3045403_3045547_-	ABC transporter	NA	NA	NA	NA	NA
AWL46437.1|3045960_3046209_+	damage-inducible protein DinI	NA	S5MQI1	Escherichia_phage	70.4	1.4e-25
AWL46438.1|3046431_3046716_-	hypothetical protein	NA	NA	NA	NA	NA
AWL46439.1|3046820_3047030_-	hypothetical protein	NA	NA	NA	NA	NA
AWL46440.1|3047026_3047758_-	hypothetical protein	NA	NA	NA	NA	NA
AWL48783.1|3047768_3048497_-	hypothetical protein	NA	NA	NA	NA	NA
AWL46441.1|3050847_3051045_-	hypothetical protein	NA	NA	NA	NA	NA
AWL46442.1|3051044_3051911_-	hypothetical protein	NA	A0A2H4IYR0	uncultured_Caudovirales_phage	64.5	1.9e-34
AWL46443.1|3051910_3052684_-	DUF2612 domain-containing protein	NA	A0A2H4J1A9	uncultured_Caudovirales_phage	54.4	2.8e-77
AWL46444.1|3052680_3053877_-	hypothetical protein	NA	A0A0M4RD32	Salmonella_phage	72.9	3.9e-158
AWL46445.1|3053876_3054230_-	hypothetical protein	NA	A0A2H4J629	uncultured_Caudovirales_phage	80.3	2.3e-50
AWL46446.1|3054231_3054885_-	hypothetical protein	NA	A0A2H4J8H6	uncultured_Caudovirales_phage	63.5	1.0e-59
AWL46447.1|3054938_3055505_-	hypothetical protein	NA	NA	NA	NA	NA
AWL46448.1|3055541_3055727_+	hypothetical protein	NA	NA	NA	NA	NA
AWL46449.1|3055779_3056121_-	hypothetical protein	NA	A0A2H4J1A5	uncultured_Caudovirales_phage	46.6	1.8e-23
AWL46450.1|3056120_3057143_-	hypothetical protein	NA	A0A2H4J1B2	uncultured_Caudovirales_phage	54.2	9.2e-100
AWL46451.1|3057145_3057448_-	hypothetical protein	NA	A0A2H4J495	uncultured_Caudovirales_phage	55.2	2.0e-26
AWL46452.1|3057448_3058048_-	hypothetical protein	NA	A0A2H4J1B3	uncultured_Caudovirales_phage	57.6	9.9e-54
AWL46453.1|3058047_3060051_-	lytic transglycosylase domain-containing protein	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	63.6	1.2e-247
AWL46454.1|3060040_3060193_-	NTP pyrophosphohydrolase	NA	A0A2H4J1A2	uncultured_Caudovirales_phage	88.0	7.6e-19
AWL46455.1|3060228_3060654_-	hypothetical protein	NA	A0A2H4J2V6	uncultured_Caudovirales_phage	63.4	2.6e-40
AWL46456.1|3060657_3061098_-	DUF3277 domain-containing protein	NA	A0A0M5M1K6	Salmonella_phage	80.1	3.3e-62
AWL46457.1|3061108_3062254_-	DUF3383 domain-containing protein	NA	A0A2H4J8G4	uncultured_Caudovirales_phage	76.9	6.3e-166
AWL46458.1|3062257_3062698_-	hypothetical protein	NA	A0A2H4J1A0	uncultured_Caudovirales_phage	51.7	1.6e-40
AWL46459.1|3062792_3063179_-|head,tail	head-tail adaptor	head,tail	A0A2H4J1A4	uncultured_Caudovirales_phage	78.2	1.1e-48
AWL46460.1|3063178_3063685_-	hypothetical protein	NA	NA	NA	NA	NA
AWL46461.1|3063681_3064101_-	DUF4054 domain-containing protein	NA	A0A0M5M3S2	Salmonella_phage	60.7	3.3e-40
AWL46462.1|3064069_3064351_-	hypothetical protein	NA	NA	NA	NA	NA
AWL46463.1|3064390_3065332_-	DUF2184 domain-containing protein	NA	A0A2H4J191	uncultured_Caudovirales_phage	77.1	1.7e-137
AWL46464.1|3065343_3065838_-	hypothetical protein	NA	A0A2H4JHM9	uncultured_Caudovirales_phage	62.7	4.2e-50
AWL46465.1|3065841_3067044_-	DUF2213 domain-containing protein	NA	A0A0M4R5A6	Salmonella_phage	54.1	2.6e-106
AWL46466.1|3067095_3067644_-	hypothetical protein	NA	A0A0M4REK0	Salmonella_phage	56.3	3.0e-49
AWL46467.1|3067699_3069151_-	DUF1073 domain-containing protein	NA	A0A0M4S6U1	Salmonella_phage	68.8	3.8e-192
AWL46468.1|3069388_3070789_-|terminase	PBSX family phage terminase large subunit	terminase	A0A077KAW0	Edwardsiella_phage	69.0	9.4e-188
AWL46469.1|3070739_3071492_-	hypothetical protein	NA	A0A077KBY7	Edwardsiella_phage	66.0	4.0e-12
AWL46470.1|3071593_3071914_-	negative regulator GrlR	NA	NA	NA	NA	NA
AWL46471.1|3072148_3072538_-	lipase chaperone	NA	A0A192Y6H8	Salmonella_phage	49.2	9.4e-21
AWL46472.1|3072534_3073065_-	lysozyme	NA	K7PLY1	Enterobacteria_phage	77.1	2.7e-79
AWL46473.1|3073067_3073316_-|lysis	lysis protein	lysis	NA	NA	NA	NA
AWL46474.1|3073721_3074504_-	antitermination protein	NA	F1C595	Cronobacter_phage	76.8	7.2e-113
AWL46475.1|3074500_3074977_-	hypothetical protein	NA	A0A286N2Q1	Klebsiella_phage	100.0	1.8e-90
AWL46476.1|3074973_3075936_-	DNA primase	NA	A0A286N2Q0	Klebsiella_phage	99.4	4.8e-183
AWL46477.1|3075937_3077596_-	helicase	NA	A0A286N2P9	Klebsiella_phage	96.0	0.0e+00
AWL46478.1|3077904_3078198_-	hypothetical protein	NA	A0A286S2B5	Klebsiella_phage	97.6	2.8e-38
AWL46479.1|3078172_3078394_-	XRE family transcriptional regulator	NA	A0A286S2C1	Klebsiella_phage	100.0	3.0e-32
AWL46480.1|3078491_3079160_+	helix-turn-helix domain-containing protein	NA	A0A286S2B2	Klebsiella_phage	99.5	2.4e-125
AWL46481.1|3079330_3079645_+	hypothetical protein	NA	A0A286S1T9	Klebsiella_phage	100.0	1.0e-49
AWL46482.1|3079637_3079826_+	hypothetical protein	NA	A0A286S1P8	Klebsiella_phage	100.0	4.6e-26
AWL46483.1|3079995_3080361_+	hypothetical protein	NA	A0A286S1Q6	Klebsiella_phage	99.2	6.9e-58
AWL46484.1|3080353_3080608_+	hypothetical protein	NA	A0A286SGR4	Klebsiella_phage	97.6	3.1e-41
AWL46485.1|3080794_3081220_+	hypothetical protein	NA	A0A286S1S2	Klebsiella_phage	77.9	3.5e-53
AWL46486.1|3081216_3081411_+	hypothetical protein	NA	NA	NA	NA	NA
AWL46487.1|3081407_3082235_+|protease	serine protease	protease	Q8W654	Enterobacteria_phage	84.0	5.5e-111
AWL46488.1|3082339_3082858_+	hypothetical protein	NA	A0A286S1S7	Klebsiella_phage	98.8	1.7e-94
AWL46489.1|3082863_3083574_+	DNA-binding protein	NA	A0A286S260	Klebsiella_phage	88.3	2.1e-111
AWL46490.1|3083563_3083788_+	hypothetical protein	NA	A0A286S2B3	Klebsiella_phage	89.2	3.1e-29
AWL46491.1|3083784_3083997_+	hypothetical protein	NA	A0A286S2B6	Klebsiella_phage	98.6	3.4e-33
AWL46492.1|3083993_3084473_+	hypothetical protein	NA	NA	NA	NA	NA
AWL46493.1|3084651_3084894_+	AlpA family transcriptional regulator	NA	A0A0M4RTZ2	Salmonella_phage	73.8	2.2e-20
AWL46494.1|3084874_3086056_-	DUF4102 domain-containing protein	NA	A0A0M4QX09	Salmonella_phage	84.2	5.6e-202
AWL46495.1|3086252_3086801_+	DJ-1/PfpI family protein	NA	NA	NA	NA	NA
AWL46496.1|3086999_3088532_-	HD domain-containing protein	NA	A0A1B1ISR1	uncultured_Mediterranean_phage	30.0	1.1e-21
AWL46497.1|3088748_3089510_-	KR domain-containing protein	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.5	2.4e-20
>prophage 8
CP029384	Klebsiella pneumoniae subsp. pneumoniae strain SCKP020079 chromosome, complete genome	5468182	3122443	3176536	5468182	transposase,integrase,protease,holin	Enterobacteria_phage(33.33%)	64	3122225:3122240	3151894:3151909
3122225:3122240	attL	TATGCCCTACGATAGC	NA	NA	NA	NA
AWL46528.1|3122443_3123115_+	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	59.6	4.5e-79
AWL48786.1|3123301_3124129_+	FRG domain-containing protein	NA	A0A1S6KZX9	Salmonella_phage	30.2	8.4e-19
AWL46529.1|3124204_3125470_-	translesion error-prone DNA polymerase V subunit UmuC	NA	I6RSM4	Salmonella_phage	82.7	9.6e-208
AWL46530.1|3125471_3125891_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	57.5	1.4e-35
AWL46531.1|3125970_3127455_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
AWL46532.1|3127454_3127706_-	hypothetical protein	NA	NA	NA	NA	NA
AWL46533.1|3128352_3128775_-	hypothetical protein	NA	K7P834	Enterobacteria_phage	45.3	3.6e-26
AWL46534.1|3129367_3130072_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AWL46535.1|3130687_3131035_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
AWL48787.1|3131198_3131990_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA2	NA	NA	NA	NA	NA
AWL46536.1|3132971_3133676_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AWL46537.1|3133712_3134000_-	hypothetical protein	NA	A0A286N2Q7	Klebsiella_phage	95.4	4.4e-36
AWL46538.1|3133996_3134536_-	hypothetical protein	NA	A0A286N2Q6	Klebsiella_phage	98.9	3.3e-101
AWL46539.1|3134532_3134844_-|holin	holin	holin	A0A286N2Q5	Klebsiella_phage	100.0	3.8e-49
AWL46540.1|3135310_3136357_-|transposase	IS481-like element ISKpn28 family transposase	transposase	A0A0M3LR35	Mannheimia_phage	21.9	1.3e-05
AWL48788.1|3136582_3137272_-	antiterminator	NA	I6PDF8	Cronobacter_phage	53.1	2.1e-55
AWL46541.1|3137271_3137412_-	YlcG family protein	NA	NA	NA	NA	NA
AWL46542.1|3137408_3138047_-	hypothetical protein	NA	H6WRY9	Salmonella_phage	69.8	3.2e-74
AWL46543.1|3138039_3138708_-	serine/threonine protein phosphatase	NA	K7P6H8	Enterobacteria_phage	78.7	1.4e-104
AWL46544.1|3138704_3138872_-	NinE family protein	NA	K7P7K0	Enterobacteria_phage	62.5	4.6e-09
AWL46545.1|3138852_3139320_-	recombination protein NinB	NA	Q8VNP6	Enterobacteria_phage	45.8	3.4e-33
AWL46546.1|3139840_3140869_+	hypothetical protein	NA	NA	NA	NA	NA
AWL46547.1|3141076_3141322_-	hypothetical protein	NA	NA	NA	NA	NA
AWL46548.1|3141377_3141680_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
AWL46549.1|3141676_3142525_-	ATP-binding protein	NA	K7PLU3	Enterobacteria_phage	60.1	5.1e-88
AWL46550.1|3142521_3143382_-	replication protein	NA	K7PGT1	Enterobacteria_phage	53.3	1.0e-59
AWL46551.1|3143467_3143689_-	transcriptional regulator	NA	G8EYH8	Enterobacteria_phage	41.7	6.9e-05
AWL46552.1|3143729_3143957_-	transcriptional regulator	NA	Q76H55	Enterobacteria_phage	77.1	1.4e-24
AWL46553.1|3144068_3144767_+	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	84.1	3.7e-108
AWL48789.1|3144789_3144909_+	hypothetical protein	NA	NA	NA	NA	NA
AWL46554.1|3145054_3146131_+	ParA family protein	NA	H2BD62	Pseudomonas_phage	37.9	9.1e-58
AWL46555.1|3146212_3146416_-	hypothetical protein	NA	A0A192Y6Q5	Salmonella_phage	71.6	3.9e-18
AWL46556.1|3146844_3147039_+	hypothetical protein	NA	NA	NA	NA	NA
AWL46557.1|3147127_3147412_+	host nuclease inhibitor GamL	NA	G8C7T1	Escherichia_phage	79.8	1.1e-39
AWL46558.1|3147427_3148273_+	phage recombination protein Bet	NA	A0A1I9KF88	Aeromonas_phage	59.2	1.8e-69
AWL46559.1|3148558_3149239_+	exonuclease	NA	A0A0M3ULE0	Salmonella_phage	91.2	8.2e-121
AWL46560.1|3149235_3149664_+	regulator	NA	M9NYX4	Enterobacteria_phage	80.3	7.5e-64
AWL46561.1|3149660_3150323_+	DNA methyltransferase	NA	G8C7S6	Escherichia_phage	84.6	2.7e-105
AWL46562.1|3150319_3150634_+	hypothetical protein	NA	K7PM28	Enterobacteria_phage	50.8	1.6e-10
AWL48790.1|3150530_3151718_-|integrase	site-specific integrase	integrase	K7PGY1	Enterobacteria_phage	52.4	1.1e-120
AWL46563.1|3151894_3152785_+	peptide ABC transporter permease SapC	NA	NA	NA	NA	NA
3151894:3151909	attR	TATGCCCTACGATAGC	NA	NA	NA	NA
AWL46564.1|3152784_3153777_+	peptide ABC transporter ATP-binding protein SapD	NA	G9BWD6	Planktothrix_phage	27.2	3.0e-07
AWL46565.1|3153778_3154588_+	peptide ABC transporter ATP-binding protein SapF	NA	A0A2H4PQG7	Staphylococcus_phage	28.9	2.1e-14
AWL46566.1|3154632_3156063_-	cytosine permease	NA	NA	NA	NA	NA
AWL48791.1|3156259_3156802_+	HutD family protein	NA	NA	NA	NA	NA
AWL46567.1|3157000_3157789_+	enoyl-ACP reductase FabI	NA	NA	NA	NA	NA
AWL46568.1|3157979_3159137_+	hypothetical protein	NA	NA	NA	NA	NA
AWL46569.1|3159218_3161153_+	exoribonuclease 2	NA	A0A2H4UVB7	Bodo_saltans_virus	24.6	7.0e-08
AWL46570.1|3161311_3161491_+	hypothetical protein	NA	NA	NA	NA	NA
AWL46571.1|3161562_3162312_+	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
AWL46572.1|3162584_3162806_+	osmotically-inducible lipoprotein OsmB	NA	NA	NA	NA	NA
AWL46573.1|3162937_3163264_-	stress response translation initiation inhibitor YciH	NA	NA	NA	NA	NA
AWL46574.1|3163263_3164001_-	orotidine-5'-phosphate decarboxylase	NA	NA	NA	NA	NA
AWL46575.1|3164192_3165362_-	lipopolysaccharide assembly protein LapB	NA	NA	NA	NA	NA
AWL46576.1|3165368_3165677_-	DUF1049 domain-containing protein	NA	NA	NA	NA	NA
AWL46577.1|3165812_3166580_-	phosphatidylglycerophosphatase B	NA	NA	NA	NA	NA
AWL46578.1|3166743_3167346_+	GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	49.5	1.2e-43
AWL46579.1|3167392_3170065_-	aconitate hydratase AcnA	NA	NA	NA	NA	NA
AWL46580.1|3170075_3170282_-	hypothetical protein	NA	NA	NA	NA	NA
AWL46581.1|3170453_3170621_-	YmiA family putative membrane protein	NA	NA	NA	NA	NA
AWL46582.1|3170866_3171841_-	LysR family transcriptional regulator CysB	NA	NA	NA	NA	NA
AWL46583.1|3172186_3174784_-	type I DNA topoisomerase	NA	A0A2K9L5F8	Tupanvirus	35.6	2.9e-89
AWL46584.1|3175190_3175442_+	DUF2498 domain-containing protein	NA	NA	NA	NA	NA
AWL46585.1|3175489_3176536_-|protease	protease SohB	protease	NA	NA	NA	NA
>prophage 9
CP029384	Klebsiella pneumoniae subsp. pneumoniae strain SCKP020079 chromosome, complete genome	5468182	3282260	3414249	5468182	holin,tRNA,protease,terminase,tail,integrase,capsid,head,transposase,portal	Klebsiella_phage(31.18%)	152	3309063:3309077	3412060:3412074
AWL46685.1|3282260_3282761_+|tRNA	YbaK/prolyl-tRNA synthetase associated domain-containing protein	tRNA	NA	NA	NA	NA
AWL46686.1|3282877_3283324_+	DUF441 domain-containing protein	NA	NA	NA	NA	NA
AWL48795.1|3283307_3284099_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AWL46687.1|3284200_3285385_+	cyanate MFS transporter	NA	NA	NA	NA	NA
AWL46688.1|3285416_3286109_-	hypothetical protein	NA	NA	NA	NA	NA
AWL46689.1|3286254_3286764_+	DUF523 domain-containing protein	NA	NA	NA	NA	NA
AWL46690.1|3286750_3287107_+	DUF488 domain-containing protein	NA	NA	NA	NA	NA
AWL46691.1|3287096_3287336_-	DUF333 domain-containing protein	NA	NA	NA	NA	NA
AWL46692.1|3287636_3288650_+	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	29.0	1.4e-12
AWL46693.1|3288707_3288809_+	hypothetical protein	NA	NA	NA	NA	NA
AWL48796.1|3288808_3288883_+	hypothetical protein	NA	NA	NA	NA	NA
AWL46694.1|3289000_3289126_+	hypothetical protein	NA	NA	NA	NA	NA
AWL46695.1|3289185_3289449_-	DUF2534 domain-containing protein	NA	NA	NA	NA	NA
AWL46696.1|3289579_3290218_-	leucine efflux protein	NA	NA	NA	NA	NA
AWL46697.1|3290307_3291222_-	kdo(2)-lipid IV(A) palmitoleoyltransferase	NA	A0A1W6JP29	Morganella_phage	50.4	1.1e-72
AWL46698.1|3291437_3291629_+	hypothetical protein	NA	NA	NA	NA	NA
AWL46699.1|3291883_3292927_-	type II asparaginase	NA	NA	NA	NA	NA
AWL46700.1|3293229_3294438_+	HD domain-containing protein	NA	NA	NA	NA	NA
AWL46701.1|3294511_3296296_+	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	36.1	5.8e-17
AWL46702.1|3296302_3297193_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AWL46703.1|3297313_3298822_+	UbiD family decarboxylase	NA	NA	NA	NA	NA
AWL46704.1|3299132_3299819_-	diguanylate phosphodiesterase	NA	NA	NA	NA	NA
AWL46705.1|3300216_3300396_-	hypothetical protein	NA	NA	NA	NA	NA
AWL46706.1|3300435_3301068_-	DNA-binding protein	NA	NA	NA	NA	NA
AWL46707.1|3301634_3301832_+	hypothetical protein	NA	NA	NA	NA	NA
AWL46708.1|3301947_3302958_-	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
AWL46709.1|3302954_3304361_-	cytochrome ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
AWL46710.1|3304416_3305304_-	manganese catalase family protein	NA	NA	NA	NA	NA
AWL46711.1|3305320_3305827_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
AWL46712.1|3305853_3306348_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
AWL46713.1|3306438_3306624_-	stress-induced acidophilic repeat motif-containing protein	NA	NA	NA	NA	NA
AWL46714.1|3307245_3308439_+	glutathione-dependent formaldehyde dehydrogenase	NA	NA	NA	NA	NA
AWL46715.1|3308551_3308779_+	DUF1272 domain-containing protein	NA	NA	NA	NA	NA
3309063:3309077	attL	TGGCTGGCGTTCTTT	NA	NA	NA	NA
AWL46716.1|3309215_3309539_+	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
AWL46717.1|3309531_3309924_+	amino acid-binding protein	NA	NA	NA	NA	NA
AWL46718.1|3309920_3310634_+	ArsR family transcriptional regulator	NA	NA	NA	NA	NA
AWL46719.1|3310906_3311059_-	isocitrate dehydrogenase	NA	Q77Z09	Phage_21	92.0	3.8e-18
AWL46720.1|3311213_3312710_-|tail	tail fiber domain-containing protein	tail	A0A0P0IDN1	Klebsiella_phage	63.7	1.4e-125
AWL46721.1|3312778_3325483_-	DUF1983 domain-containing protein	NA	Q6UAW1	Klebsiella_phage	47.1	0.0e+00
AWL46722.1|3325545_3326139_-|tail	tail assembly protein	tail	K7PHE5	Enterobacteria_phage	76.6	8.0e-80
AWL46723.1|3326165_3326588_-	hypothetical protein	NA	J9Q806	Salmonella_phage	50.0	5.9e-29
AWL46724.1|3326629_3327340_-	peptidase P60	NA	Q6UAW4	Klebsiella_phage	90.3	1.9e-136
AWL46725.1|3327341_3328097_-|tail	phage minor tail protein L	tail	Q6UAW5	Klebsiella_phage	80.5	4.6e-125
AWL46726.1|3328093_3328432_-|tail	phage tail protein	tail	Q6UAW6	Klebsiella_phage	88.4	1.4e-57
AWL46727.1|3328431_3331767_-|tail	phage tail tape measure protein	tail	Q6UAW7	Klebsiella_phage	88.3	0.0e+00
AWL46728.1|3331766_3331985_-	hypothetical protein	NA	Q6UAW9	Klebsiella_phage	90.5	5.4e-34
AWL46729.1|3331999_3332365_-|tail	phage tail protein	tail	Q6UAW8	Klebsiella_phage	89.3	1.6e-51
AWL46730.1|3332422_3332884_-|tail	phage tail protein	tail	Q6UAX0	Klebsiella_phage	83.7	7.8e-67
AWL46731.1|3332915_3333317_-	hypothetical protein	NA	Q6UAX1	Klebsiella_phage	94.0	2.3e-62
AWL46732.1|3333313_3333703_-	hypothetical protein	NA	Q6UAX2	Klebsiella_phage	86.0	9.6e-58
AWL46733.1|3333683_3334022_-|head,tail	head-tail adaptor protein	head,tail	Q6UAX3	Klebsiella_phage	90.2	2.8e-53
AWL46734.1|3334018_3334336_-|head,tail	phage gp6-like head-tail connector protein	head,tail	Q6UAX4	Klebsiella_phage	89.8	1.5e-45
AWL46735.1|3334316_3334577_-	hypothetical protein	NA	Q6UAX5	Klebsiella_phage	60.5	7.4e-22
AWL46736.1|3334635_3335922_-|capsid	phage major capsid protein	capsid	Q6UAX6	Klebsiella_phage	89.0	9.8e-216
AWL46737.1|3335999_3336920_-	S49 family peptidase	NA	Q6UAX7	Klebsiella_phage	88.2	9.6e-149
AWL46738.1|3336956_3338216_-|portal	phage portal protein	portal	Q6UAX8	Klebsiella_phage	89.8	1.8e-222
AWL46739.1|3338215_3338395_-	hypothetical protein	NA	Q6UAX9	Klebsiella_phage	57.6	3.1e-11
AWL46740.1|3338388_3340110_-|terminase	terminase large subunit	terminase	Q7Y413	Yersinia_phage	57.4	1.5e-190
AWL46741.1|3340109_3340544_-|terminase	phage terminase small subunit P27 family	terminase	A0A1J0GV10	Halomonas_phage	61.9	9.4e-30
AWL46742.1|3340792_3341224_-	hypothetical protein	NA	Q6UAS0	Klebsiella_phage	61.6	1.8e-41
AWL46743.1|3341220_3341544_-	hypothetical protein	NA	NA	NA	NA	NA
AWL46744.1|3341495_3341858_-	HNH endonuclease	NA	Q6UAS2	Klebsiella_phage	83.3	1.2e-57
AWL46745.1|3342184_3342409_+	hypothetical protein	NA	NA	NA	NA	NA
AWL46746.1|3342447_3342900_-	hypothetical protein	NA	NA	NA	NA	NA
AWL46747.1|3343834_3344185_-	hypothetical protein	NA	R9TPM9	Aeromonas_phage	38.1	7.9e-11
AWL46748.1|3344181_3344679_-	lysozyme	NA	A0A1V0E5Q7	Salmonella_phage	84.6	1.1e-77
AWL46749.1|3344678_3344894_-|holin	holin	holin	A5LH82	Enterobacteria_phage	88.7	2.7e-30
AWL46750.1|3347145_3347748_-	hypothetical protein	NA	H9C175	Pectobacterium_phage	68.6	1.1e-76
AWL46751.1|3347764_3348796_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	49.6	4.7e-96
AWL46752.1|3348795_3348999_-	hypothetical protein	NA	NA	NA	NA	NA
AWL46753.1|3348995_3349388_-	DNA-binding protein	NA	K7PHB4	Enterobacterial_phage	36.6	8.0e-12
AWL46754.1|3349428_3349719_-	hypothetical protein	NA	H6WRY6	Salmonella_phage	56.9	8.0e-17
AWL46755.1|3349730_3349964_-	DinI family protein	NA	K7PM44	Enterobacteria_phage	71.1	3.7e-25
AWL46756.1|3350042_3351527_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
AWL46757.1|3351526_3351778_-	hypothetical protein	NA	NA	NA	NA	NA
AWL46758.1|3352367_3353729_-	dNTP triphosphohydrolase	NA	NA	NA	NA	NA
AWL46759.1|3353902_3354616_-	hypothetical protein	NA	NA	NA	NA	NA
AWL48797.1|3355155_3355242_+	ABC transporter	NA	NA	NA	NA	NA
AWL46760.1|3355280_3356261_-|transposase	IS5 family transposase ISKpn26	transposase	A0A077SK28	Escherichia_phage	99.4	1.0e-185
AWL46761.1|3358633_3359614_-|transposase	IS5 family transposase ISKpn26	transposase	A0A077SK28	Escherichia_phage	99.4	1.0e-185
AWL46762.1|3360065_3360506_-	hypothetical protein	NA	NA	NA	NA	NA
AWL46763.1|3360519_3360984_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	72.2	4.1e-63
AWL48798.1|3360976_3361981_-	DNA-binding protein	NA	A0A0U2RT81	Escherichia_phage	40.0	1.0e-31
AWL46764.1|3362040_3362595_-	hypothetical protein	NA	NA	NA	NA	NA
AWL46765.1|3362597_3362822_-	Cro/Cl family transcriptional regulator	NA	H6WRX5	Salmonella_phage	62.5	1.3e-19
AWL46766.1|3362910_3363348_+	helix-turn-helix domain-containing protein	NA	H6WRX4	Salmonella_phage	62.2	1.3e-39
AWL46767.1|3363669_3363984_-	hypothetical protein	NA	NA	NA	NA	NA
AWL46768.1|3364146_3364365_+	hypothetical protein	NA	NA	NA	NA	NA
AWL46769.1|3364374_3364569_+	DUF1482 domain-containing protein	NA	NA	NA	NA	NA
AWL46770.1|3364611_3364956_+	transcriptional regulator	NA	NA	NA	NA	NA
AWL46771.1|3365097_3367236_+	exonuclease	NA	S4TNL0	Salmonella_phage	42.7	5.6e-99
AWL46772.1|3367288_3367534_+	excisionase	NA	NA	NA	NA	NA
AWL46773.1|3367514_3368642_+|integrase	integrase	integrase	O21925	Phage_21	58.4	4.4e-119
AWL46774.1|3368759_3368942_-	isocitrate dehydrogenase	NA	Q77Z09	Phage_21	90.7	3.7e-20
AWL46775.1|3369323_3370085_-	hypothetical protein	NA	Q6J1W3	Lactobacillus_phage	29.4	2.5e-09
AWL46776.1|3371119_3371845_-	hypothetical protein	NA	NA	NA	NA	NA
AWL46777.1|3371896_3373162_-	translesion error-prone DNA polymerase V subunit UmuC	NA	I6RSM4	Salmonella_phage	82.9	8.1e-207
AWL46778.1|3373164_3373584_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	56.7	1.2e-34
AWL46779.1|3373662_3373905_+	DinI family protein	NA	Q6UAW0	Klebsiella_phage	81.0	1.6e-31
AWL46780.1|3373904_3374147_+	hypothetical protein	NA	NA	NA	NA	NA
AWL46781.1|3374922_3375675_-	hypothetical protein	NA	NA	NA	NA	NA
AWL46782.1|3375685_3377854_-	hypothetical protein	NA	B5TAB2	Burkholderia_phage	45.1	6.7e-100
AWL46783.1|3377931_3381000_-	kinase	NA	A0A286S259	Klebsiella_phage	66.3	0.0e+00
AWL46784.1|3380996_3381383_-	nitrite transporter	NA	H2BD94	Pseudomonas_phage	35.7	4.0e-16
AWL46785.1|3381390_3381873_-	DUF1833 domain-containing protein	NA	A0A286S2B1	Klebsiella_phage	67.7	8.5e-56
AWL46786.1|3381859_3382333_-	hypothetical protein	NA	A0A286S298	Klebsiella_phage	63.5	3.9e-53
AWL46787.1|3382332_3385029_-|tail	phage tail tape measure protein	tail	K7PKR0	Enterobacteria_phage	62.4	4.9e-201
AWL46788.1|3385009_3385327_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	51.5	1.4e-19
AWL46789.1|3385347_3385743_-|tail	phage tail protein	tail	M9NZD7	Enterobacteria_phage	27.5	1.9e-08
AWL46790.1|3385785_3386268_-|tail	phage tail protein	tail	M9NYX0	Enterobacteria_phage	68.6	5.7e-60
AWL46791.1|3386275_3386674_-|tail	phage tail protein	tail	K7PHM6	Enterobacterial_phage	57.8	3.2e-40
AWL46792.1|3386670_3387222_-|tail	phage tail protein	tail	K7P7A8	Enterobacteria_phage	67.3	1.6e-53
AWL46793.1|3387211_3387505_-	ATP-binding protein	NA	NA	NA	NA	NA
AWL46794.1|3387497_3387824_-	DUF2190 domain-containing protein	NA	K7PJY3	Enterobacterial_phage	66.4	4.0e-33
AWL46795.1|3387904_3389920_-|protease	Clp protease ClpP	protease	K7PKX4	Enterobacterial_phage	84.2	0.0e+00
AWL46796.1|3389864_3391364_-|portal	phage portal protein	portal	K7PHM5	Enterobacterial_phage	83.6	1.1e-247
AWL46797.1|3391360_3391576_-	hypothetical protein	NA	A5LH28	Enterobacteria_phage	75.7	6.5e-24
AWL46798.1|3391572_3393681_-|terminase	phage terminase large subunit family protein	terminase	K7PH52	Enterobacterial_phage	83.5	0.0e+00
AWL46799.1|3393680_3394172_-	DUF1441 domain-containing protein	NA	K7PJY2	Enterobacterial_phage	84.0	6.4e-67
AWL46800.1|3394492_3394678_-	hypothetical protein	NA	Q8W634	Enterobacteria_phage	61.1	2.4e-11
AWL48799.1|3394745_3395006_-	hypothetical protein	NA	NA	NA	NA	NA
AWL46801.1|3395232_3395478_-	DUF2560 domain-containing protein	NA	A0A286N2R1	Klebsiella_phage	96.3	3.0e-33
AWL46802.1|3395867_3396017_-	hypothetical protein	NA	A0A286SGR9	Klebsiella_phage	89.1	4.5e-16
AWL46803.1|3396006_3396282_-	hypothetical protein	NA	G8C7W1	Escherichia_phage	46.7	8.6e-13
AWL46804.1|3396278_3396626_-	hypothetical protein	NA	A0A286N2Q7	Klebsiella_phage	78.3	3.0e-39
AWL46805.1|3396622_3397162_-	hypothetical protein	NA	A0A286N2Q6	Klebsiella_phage	98.3	5.7e-101
AWL46806.1|3397158_3397470_-|holin	holin	holin	A0A286N2Q5	Klebsiella_phage	83.5	1.1e-40
AWL46807.1|3397627_3397867_-	hypothetical protein	NA	NA	NA	NA	NA
AWL46808.1|3398017_3398596_-	DUF1133 domain-containing protein	NA	A0A0U2S606	Escherichia_phage	56.7	2.2e-50
AWL46809.1|3398609_3399590_-	DUF968 domain-containing protein	NA	A0A1C9IHZ5	Salmonella_phage	67.5	2.7e-133
AWL46810.1|3399602_3399980_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A1C9IIA0	Salmonella_phage	73.6	3.9e-48
AWL46811.1|3399989_3400799_-	DNA methylase	NA	A0A1C9II58	Salmonella_phage	68.9	5.9e-110
AWL46812.1|3400795_3401710_-	transcriptional regulator	NA	H2DE83	Erwinia_phage	60.6	1.8e-30
AWL46813.1|3401666_3401879_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	72.7	2.2e-16
AWL46814.1|3402116_3402578_-	hypothetical protein	NA	K7PJS5	Enterobacterial_phage	88.2	1.7e-69
AWL46815.1|3402603_3402813_-	cell division protein	NA	NA	NA	NA	NA
AWL46816.1|3402907_3403552_+	helix-turn-helix domain-containing protein	NA	A0A1I9KG86	Aeromonas_phage	40.7	8.2e-38
AWL46817.1|3403851_3404775_+	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	62.9	1.5e-104
AWL46818.1|3404860_3405160_+	hypothetical protein	NA	K7PJS4	Enterobacterial_phage	47.8	1.0e-14
AWL46819.1|3405159_3405945_+	hypothetical protein	NA	A4JX52	Burkholderia_virus	50.6	1.3e-61
AWL46820.1|3406072_3406564_+	Eae protein	NA	E7C9P6	Salmonella_phage	53.4	5.1e-32
AWL46821.1|3406560_3406824_+	DUF4752 domain-containing protein	NA	T1S9K2	Salmonella_phage	78.0	1.1e-30
AWL46822.1|3406816_3407461_+	hypothetical protein	NA	A0A2R2Z312	Escherichia_phage	42.8	1.1e-39
AWL46823.1|3407460_3407673_+	hypothetical protein	NA	A0A0F6TJE4	Escherichia_coli_O157_typing_phage	45.5	8.1e-11
AWL46824.1|3408468_3408687_+	hypothetical protein	NA	G8C7S3	Escherichia_phage	51.7	3.0e-08
AWL46825.1|3408686_3408959_+	hypothetical protein	NA	K7PKM4	Enterobacterial_phage	40.4	4.4e-09
AWL46826.1|3408987_3409224_+	excisionase	NA	NA	NA	NA	NA
AWL46827.1|3409213_3410356_+|integrase	integrase	integrase	Q77Z02	Phage_21	82.2	9.1e-173
AWL46828.1|3410469_3411720_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	92.6	6.7e-20
AWL46829.1|3411960_3412611_+	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
3412060:3412074	attR	AAAGAACGCCAGCCA	NA	NA	NA	NA
AWL46830.1|3412627_3413086_+	NUDIX hydrolase	NA	NA	NA	NA	NA
AWL48800.1|3413142_3414249_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
>prophage 10
CP029384	Klebsiella pneumoniae subsp. pneumoniae strain SCKP020079 chromosome, complete genome	5468182	3630228	3723179	5468182	plate,tRNA,protease,tail,integrase,lysis,capsid,head,portal	Salmonella_phage(56.9%)	97	3685754:3685772	3723254:3723272
AWL47022.1|3630228_3631521_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	44.7	7.3e-94
AWL47023.1|3631611_3632955_-	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	40.8	7.3e-81
AWL47024.1|3632963_3633575_-	outer membrane lipoprotein carrier protein LolA	NA	NA	NA	NA	NA
AWL47025.1|3633697_3637951_-	DNA translocase FtsK	NA	S5VNE3	Mycobacterium_phage	49.2	5.2e-88
AWL47026.1|3638086_3638581_-	leucine-responsive regulatory protein	NA	NA	NA	NA	NA
AWL47027.1|3639113_3640082_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.0	3.2e-62
AWL47028.1|3640196_3641963_+	thiol reductant ABC exporter subunit CydD	NA	W8CYL7	Bacillus_phage	25.9	2.3e-21
AWL47029.1|3641963_3643685_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	34.3	1.5e-14
AWL47030.1|3643729_3644431_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
AWL47031.1|3644784_3645003_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
AWL47032.1|3645123_3647403_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.0	1.6e-165
AWL47033.1|3647433_3647751_-|protease	ATP-dependent Clp protease adaptor ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	2.0e-13
AWL47034.1|3648076_3648298_+	cold shock domain protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	1.3e-16
AWL47035.1|3648252_3648435_-	hypothetical protein	NA	NA	NA	NA	NA
AWL47036.1|3648374_3650315_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.5	1.9e-37
AWL47037.1|3650311_3651427_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	52.7	1.3e-06
AWL47038.1|3651573_3653232_-	ATP-dependent endonuclease	NA	NA	NA	NA	NA
AWL47039.1|3653651_3654347_+	aquaporin Z	NA	NA	NA	NA	NA
AWL47040.1|3654462_3655362_+	lysine exporter LysO family protein	NA	NA	NA	NA	NA
AWL48811.1|3655505_3657158_+	hydroxylamine reductase	NA	NA	NA	NA	NA
AWL47041.1|3657168_3658137_+	NADH oxidoreductase	NA	NA	NA	NA	NA
AWL47042.1|3658087_3658291_+	hypothetical protein	NA	NA	NA	NA	NA
AWL47043.1|3658348_3658783_-	DoxX family protein	NA	NA	NA	NA	NA
AWL48812.1|3658934_3660653_+	ubiquinone-dependent pyruvate dehydrogenase	NA	NA	NA	NA	NA
AWL47044.1|3660691_3661693_+	low-specificity L-threonine aldolase	NA	NA	NA	NA	NA
AWL47045.1|3661703_3663146_+	DUF2867 domain-containing protein	NA	NA	NA	NA	NA
AWL47046.1|3663233_3664247_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
AWL47047.1|3664243_3665074_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1B0UZW5	Roseobacter_phage	31.6	4.1e-05
AWL47048.1|3665105_3666245_-	GGDEF domain-containing protein	NA	NA	NA	NA	NA
AWL47049.1|3666297_3666477_+	hypothetical protein	NA	NA	NA	NA	NA
AWL47050.1|3667122_3667638_+	lipoprotein	NA	NA	NA	NA	NA
AWL47051.1|3667864_3668593_+	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	37.1	1.2e-29
AWL48813.1|3668613_3669345_+	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AWL47052.1|3669351_3670068_+	arginine ABC transporter permease ArtQ	NA	NA	NA	NA	NA
AWL47053.1|3670067_3670736_+	arginine ABC transporter permease ArtM	NA	NA	NA	NA	NA
AWL47054.1|3670919_3671651_+	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AWL47055.1|3671693_3673166_-	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	31.8	7.9e-28
AWL47056.1|3673162_3673879_-	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	36.9	2.1e-34
AWL47057.1|3673957_3675085_-	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A2K5B251	Erysipelothrix_phage	25.6	1.3e-19
AWL47058.1|3675126_3675615_-	DUF2593 domain-containing protein	NA	NA	NA	NA	NA
AWL47059.1|3675672_3676518_-	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
AWL47060.1|3676514_3677468_-	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
AWL48814.1|3677478_3678612_-	polyamine ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	34.9	2.2e-30
AWL47061.1|3678775_3679888_-	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
AWL47062.1|3680236_3680716_-	YbjN domain-containing protein	NA	NA	NA	NA	NA
AWL47063.1|3680804_3681707_-	30S ribosomal protein S6--L-glutamate ligase	NA	A0A1D7SR78	Cyanophage	35.3	2.0e-34
AWL47064.1|3682528_3682816_-	DUF1418 domain-containing protein	NA	NA	NA	NA	NA
AWL47065.1|3683018_3683282_+	GrxA family glutaredoxin	NA	A0A2I7SAE2	Vibrio_phage	73.1	1.6e-27
AWL47066.1|3683288_3683672_-	hypothetical protein	NA	NA	NA	NA	NA
AWL48815.1|3683938_3685624_+	transporter	NA	NA	NA	NA	NA
3685754:3685772	attL	ATGGGTTTTTTGTTGCCTG	NA	NA	NA	NA
AWL47067.1|3685843_3686062_-	transcriptional regulator	NA	Q53ZE7	Salmonella_virus	69.0	7.5e-20
AWL47068.1|3686153_3687254_-	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	87.4	4.9e-176
AWL47069.1|3687250_3687736_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	75.6	7.2e-63
AWL47070.1|3687732_3690360_-|tail	phage tail tape measure protein	tail	E5FFG5	Burkholderia_phage	42.0	5.6e-117
AWL47071.1|3690352_3690472_-|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.2e-13
AWL47072.1|3690486_3690786_-|tail	phage tail assembly protein	tail	E5G6P9	Salmonella_phage	79.0	3.7e-33
AWL47073.1|3690838_3691354_-|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	85.4	1.3e-81
AWL47074.1|3691363_3692536_-|tail	phage tail protein	tail	A0A1S6KZY7	Salmonella_phage	93.3	1.9e-210
AWL47075.1|3692674_3693751_-|tail	phage tail protein	tail	Q37842	Escherichia_phage	44.8	1.2e-25
AWL47076.1|3693780_3693984_-	hypothetical protein	NA	NA	NA	NA	NA
AWL47077.1|3693980_3694712_-	hypothetical protein	NA	NA	NA	NA	NA
AWL47078.1|3694715_3697667_-	hypothetical protein	NA	A0A2H4N7A3	Pectobacterium_phage	50.9	1.2e-06
AWL48816.1|3697668_3698268_-|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	60.5	1.3e-58
AWL47079.1|3698260_3699169_-|plate	baseplate assembly protein	plate	E5G6N8	Salmonella_phage	66.9	7.6e-106
AWL47080.1|3699155_3699518_-|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	83.9	4.9e-48
AWL47081.1|3699514_3700087_-|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	72.3	4.7e-77
AWL47082.1|3700181_3700874_+	hypothetical protein	NA	NA	NA	NA	NA
AWL47083.1|3700870_3701317_-	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	71.2	2.2e-50
AWL47084.1|3701309_3701741_-|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	82.5	9.9e-64
AWL47085.1|3701836_3702265_-|lysis	LysB family phage lysis regulatory protein	lysis	A0A1S6KZX8	Salmonella_phage	77.9	9.6e-51
AWL47086.1|3702261_3702645_-	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	42.0	2.1e-17
AWL47087.1|3702649_3703159_-	lysozyme	NA	E5G6N1	Salmonella_phage	83.4	2.1e-81
AWL47088.1|3703139_3703355_-	hypothetical protein	NA	E5G6N0	Salmonella_phage	90.1	3.6e-30
AWL47089.1|3703358_3703562_-|tail	phage tail protein	tail	A0A1S6KZY4	Salmonella_phage	88.1	1.3e-29
AWL47090.1|3703561_3704026_-|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	89.0	8.4e-77
AWL47091.1|3704121_3704772_-	hypothetical protein	NA	E5G6M7	Salmonella_phage	96.3	8.7e-112
AWL47092.1|3704775_3705834_-|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	93.1	1.1e-180
AWL47093.1|3705850_3706684_-|capsid	capsid protein	capsid	A0A1S6KZW9	Salmonella_phage	88.8	6.3e-123
AWL47094.1|3706826_3708593_+	oxidoreductase	NA	A0A1S6KZW3	Salmonella_phage	99.0	0.0e+00
AWL47095.1|3708592_3709618_+|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	86.7	7.6e-171
AWL47096.1|3709679_3711422_-	hypothetical protein	NA	NA	NA	NA	NA
AWL47097.1|3711697_3712375_-	hypothetical protein	NA	NA	NA	NA	NA
AWL47098.1|3712489_3712795_-	DinI family protein	NA	E5G6M1	Salmonella_phage	100.0	4.7e-36
AWL48817.1|3712733_3712922_-	hypothetical protein	NA	E5G6M0	Salmonella_phage	98.4	5.5e-27
AWL47099.1|3713075_3715490_-	replication endonuclease	NA	E5G6L9	Salmonella_phage	97.5	0.0e+00
AWL47100.1|3715486_3716344_-	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	95.4	2.0e-156
AWL47101.1|3716340_3716568_-	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	98.7	6.0e-36
AWL47102.1|3716567_3716801_-	DUF2732 domain-containing protein	NA	E5G6L6	Salmonella_phage	96.1	4.1e-32
AWL47103.1|3716868_3717210_-	hypothetical protein	NA	E5G6L5	Salmonella_phage	99.1	4.6e-56
AWL47104.1|3717173_3717374_-	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	97.0	1.6e-32
AWL47105.1|3717381_3717891_-	hypothetical protein	NA	E5G6L3	Salmonella_phage	98.8	5.8e-87
AWL47106.1|3717923_3718145_-	regulator	NA	NA	NA	NA	NA
AWL47107.1|3718290_3719169_+	Repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	39.9	1.7e-30
AWL47108.1|3719180_3720125_+	hypothetical protein	NA	NA	NA	NA	NA
AWL47109.1|3720223_3721708_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
AWL47110.1|3721707_3721959_-	hypothetical protein	NA	NA	NA	NA	NA
AWL47111.1|3722126_3723179_+|integrase	integrase	integrase	A0A218M4I3	Erwinia_phage	57.0	1.0e-106
3723254:3723272	attR	ATGGGTTTTTTGTTGCCTG	NA	NA	NA	NA
>prophage 11
CP029384	Klebsiella pneumoniae subsp. pneumoniae strain SCKP020079 chromosome, complete genome	5468182	4358866	4370519	5468182		Enterobacteria_phage(70.0%)	13	NA	NA
AWL47681.1|4358866_4359970_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.5	4.8e-62
AWL47682.1|4359980_4361234_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	44.9	8.9e-89
AWL47683.1|4361586_4362777_+	DUF4102 domain-containing protein	NA	Q7M297	Enterobacteria_phage	62.7	6.4e-145
AWL47684.1|4362764_4363715_+	cobyrinic acid a,c-diamide synthase	NA	A0A1X9IGI7	Lactococcus_phage	27.1	1.2e-13
AWL47685.1|4363714_4364140_+	hypothetical protein	NA	NA	NA	NA	NA
AWL47686.1|4364707_4365274_-	Polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	63.8	9.7e-59
AWL47687.1|4365291_4365537_-	hypothetical protein	NA	Q7M294	Enterobacteria_phage	56.8	5.5e-19
AWL47688.1|4365533_4366271_-	glycoprotein 3	NA	Q7M2A2	Enterobacteria_phage	59.4	1.9e-70
AWL47689.1|4366812_4367079_+	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	71.6	2.6e-30
AWL47690.1|4367075_4367633_+	host cell division inhibitor Icd-like protein	NA	Q7M2A7	Enterobacteria_phage	70.4	1.8e-33
AWL47691.1|4367629_4367857_+	hypothetical protein	NA	NA	NA	NA	NA
AWL47692.1|4367853_4368174_+	hypothetical protein	NA	NA	NA	NA	NA
AWL47693.1|4368185_4370519_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	82.2	0.0e+00
>prophage 1
CP029381	Klebsiella pneumoniae subsp. pneumoniae strain SCKP020079 plasmid pKPC2_020079, complete sequence	146790	1796	16424	146790	protease,transposase	Escherichia_phage(62.5%)	13	NA	NA
AWL43163.1|1796_2450_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
AWL43164.1|2669_3134_+	mRNA interferase PemK	NA	NA	NA	NA	NA
AWL43165.1|3130_3235_+	hypothetical protein	NA	NA	NA	NA	NA
AWL43166.1|4444_5149_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AWL43167.1|5659_6535_+	class A extended-spectrum beta-lactamase CTX-M-65	NA	A0A1B0VBP7	Salmonella_phage	98.9	6.8e-152
AWL43168.1|6614_7538_+|transposase	IS5 family transposase	transposase	Q9MCT5	Escherichia_phage	99.7	2.2e-177
AWL43169.1|9288_9993_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AWL43170.1|11103_11808_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AWL43171.1|12485_12674_-	hypothetical protein	NA	NA	NA	NA	NA
AWL43330.1|12765_13302_+	recombinase	NA	Q1MVP4	Enterobacteria_phage	100.0	2.8e-84
AWL43172.1|13484_14345_+	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
AWL43173.1|14514_15270_+	16S rRNA (guanine(1405)-N(7))-methyltransferase RmtB1	NA	NA	NA	NA	NA
AWL43174.1|15719_16424_-|transposase	IS6 family transposase IS15DI	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
>prophage 2
CP029381	Klebsiella pneumoniae subsp. pneumoniae strain SCKP020079 plasmid pKPC2_020079, complete sequence	146790	67156	114609	146790	integrase,transposase	Escherichia_phage(47.83%)	47	81715:81729	103995:104009
AWL43235.1|67156_67861_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AWL43236.1|68274_68979_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AWL43237.1|69849_70872_+	DNA helicase UvrD	NA	NA	NA	NA	NA
AWL43238.1|72405_73410_-|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
AWL43239.1|73488_73923_-	mercuric resistance operon regulatory protein	NA	NA	NA	NA	NA
AWL43240.1|73994_74345_+	mercuric ion transporter MerT	NA	NA	NA	NA	NA
AWL43241.1|74358_74634_+	mercury resistance system periplasmic binding protein MerP	NA	NA	NA	NA	NA
AWL43336.1|74669_75092_+	mercury transport protein MerC	NA	NA	NA	NA	NA
AWL43242.1|75143_76838_+	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.6	8.8e-39
AWL43243.1|76855_77218_+	transcriptional regulator	NA	NA	NA	NA	NA
AWL43244.1|77214_77451_+	mercury resistance protein	NA	NA	NA	NA	NA
AWL43245.1|77447_78155_+	EAL domain-containing protein	NA	NA	NA	NA	NA
AWL43246.1|79466_80171_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AWL43247.1|80210_80684_+	recombinase	NA	Q1MVP4	Enterobacteria_phage	99.3	3.3e-76
AWL43248.1|80806_81787_+|transposase	IS481 family transposase ISKpn27	transposase	A8RHK4	Spiroplasma_virus	27.4	2.9e-10
81715:81729	attL	CAAGGAATGGCATGA	NA	NA	NA	NA
AWL43249.1|82062_82944_+	carbapenem-hydrolyzing class A beta-lactamase KPC-2	NA	A0A1B0VBP7	Salmonella_phage	52.2	2.2e-73
AWL43250.1|84178_84475_-	transcriptional repressor protein KorC	NA	NA	NA	NA	NA
AWL43251.1|84803_85229_-	antirestriction protein	NA	A0A2D0W8Z5	Bordetella_virus	37.3	5.3e-17
AWL43252.1|85339_85618_-	hypothetical protein	NA	NA	NA	NA	NA
AWL43253.1|87160_87721_+|transposase	transposase	transposase	A0A1B0V7I5	Salmonella_phage	100.0	1.1e-59
AWL43254.1|87724_90691_+|transposase	Tn3-like element TnAs1 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	100.0	0.0e+00
AWL43255.1|90931_91792_+	class A extended-spectrum beta-lactamase SHV-12	NA	A0A077SL40	Escherichia_phage	99.3	2.2e-155
AWL43256.1|91812_92574_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
AWL43257.1|92564_92798_+	hypothetical protein	NA	NA	NA	NA	NA
AWL43258.1|92835_93738_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	99.7	2.6e-159
AWL43259.1|95371_96076_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AWL43260.1|96949_97366_-	PIN domain nuclease	NA	NA	NA	NA	NA
AWL43261.1|97362_97593_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
AWL43262.1|97576_98011_+	hypothetical protein	NA	NA	NA	NA	NA
AWL43263.1|98171_99116_+	hypothetical protein	NA	NA	NA	NA	NA
AWL43337.1|99194_99545_+	hypothetical protein	NA	NA	NA	NA	NA
AWL43264.1|99602_100124_+	hypothetical protein	NA	NA	NA	NA	NA
AWL43265.1|100169_100373_+	hypothetical protein	NA	NA	NA	NA	NA
AWL43266.1|100402_101407_+	hypothetical protein	NA	NA	NA	NA	NA
AWL43267.1|101590_102370_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	92.0	5.4e-52
AWL43268.1|102415_102673_-	hypothetical protein	NA	NA	NA	NA	NA
AWL43269.1|103450_104317_+	RepB family plasmid replication initiator protein	NA	A0A222YYK1	Escherichia_phage	31.1	1.5e-23
103995:104009	attR	TCATGCCATTCCTTG	NA	NA	NA	NA
AWL43270.1|105426_106632_+	ParA family protein	NA	A0A077SL49	Escherichia_phage	69.3	5.3e-163
AWL43271.1|106628_107606_+	ParB/RepB/Spo0J family partition protein	NA	Q38420	Escherichia_phage	53.8	1.4e-86
AWL43272.1|107687_108959_-	translesion error-prone DNA polymerase V subunit UmuC	NA	F1C5A5	Cronobacter_phage	63.7	7.5e-152
AWL43273.1|108958_109390_-	peptidase	NA	A0A1W6JNS2	Morganella_phage	53.3	2.1e-29
AWL43274.1|109548_109800_+	hypothetical protein	NA	NA	NA	NA	NA
AWL43275.1|109799_111284_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
AWL43276.1|111532_112504_+	StbA family protein	NA	A0A222YXF2	Escherichia_phage	46.8	1.1e-73
AWL43277.1|112506_113178_+	Mediator of plasmid stability	NA	NA	NA	NA	NA
AWL43278.1|113240_113471_+	hypothetical protein	NA	NA	NA	NA	NA
AWL43279.1|113907_114609_+	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	36.2	1.6e-26
>prophage 1
CP029382	Klebsiella pneumoniae subsp. pneumoniae strain SCKP020079 plasmid pQnrS1_020079, complete sequence	85185	0	17012	85185	transposase,integrase	Escherichia_phage(27.27%)	20	799:858	14085:14906
AWL43424.1|283_784_-	hypothetical protein	NA	NA	NA	NA	NA
799:858	attL	AGGGCACTGTTGCAAATAGTCGGTGGTGATAAACTTATCATCCCCTTTTGCTGATGGAGC	NA	NA	NA	NA
AWL43342.1|863_1568_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AWL43343.1|1601_2093_-	hypothetical protein	NA	NA	NA	NA	NA
AWL43344.1|2199_2937_+	resolvase	NA	NA	NA	NA	NA
AWL43345.1|2933_3158_+	hypothetical protein	NA	NA	NA	NA	NA
AWL43346.1|3368_4862_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
AWL43347.1|4892_5144_+	hypothetical protein	NA	NA	NA	NA	NA
AWL43348.1|5037_5340_-	phosphoglucosamine mutase	NA	NA	NA	NA	NA
AWL43349.1|5426_6242_-	sulfonamide-resistant dihydropteroate synthase Sul2	NA	A0A0B5J4J5	Pandoravirus	27.6	5.9e-09
AWL43350.1|6571_6748_+	DUF4102 domain-containing protein	NA	T1S9J3	Salmonella_phage	68.6	1.0e-06
AWL43351.1|6929_7934_-|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
AWL43352.1|9830_10535_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AWL43353.1|10781_11255_-	trimethoprim-resistant dihydrofolate reductase DfrA14	NA	G3MBI7	Bacillus_virus	28.9	8.4e-16
AWL43354.1|11410_12424_+|integrase	integron integrase	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
AWL43355.1|12362_12677_+|transposase	transposase	transposase	NA	NA	NA	NA
AWL43356.1|12816_13341_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	48.4	1.2e-31
AWL43357.1|13374_14079_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AWL43425.1|14103_15660_+	PAS domain S-box protein	NA	A0A1B0V854	Salmonella_phage	99.4	1.1e-83
14085:14906	attR	GCTCCATCAGCAAAAGGGGATGATAAGTTTATCACCACCGACTATTTGCAACAGTGCCCTTTCGACTACCTCCCCTCAAAGCCATATCACGTACGTTAATCCTGACTTCATTAAAATCAGTGGTTTCACTGAGGAAGAACTATTAGGCCAGCCTCACAACATCGTAAGACACCCAGATATGCCGCCTGCTGCATTTGAGCATATGTGGAGTACATTAAAATCTGGCCGCTCATGGATGGGGCTAGTAAAAAATCGCTGTAAAAATGGCGACCACTATTGGGTAAGTGCTTATGTAACGCCAATAGCTAAGAATGGTTCGATTGTTGAATACCAGTCTGTAAGGACCAAGCCTGAACCTGAGCAGGTTTTGGCTGCGGAAAAATTATATGCTCAATTGAGAAGCGGGAAGGCCGCGAGGCCGAAATTGGCTGCTAGCTTTTCCGTGAAAATACTCTTGCTCATATGGGGTAGTATTATATCAAGCGCAATGGCTGCCGGCATGCTTACTGATACATCAATAAGCAGCTTATTGTTAGCCACTTTAATGTCAGGAAGCTTAAGCTCTGTTAGTGTTTTGGCTATTCTCTCTCCTCTTGGAAGACTGGTTGAAAGAGCCAGGAATATTTCCAATAACCCATTAAGTCAATCCCTCTACACTGGGCGCACCGATGAGTTTGGCCAAATAGAGTTTGCTTTACGAATGATGCAAGCTGAAACAGGCGCCATAGTAGGTCGCATAGGTGATGCATCAAATCGGCTTAGCGAACACACCCGAGGCCTACTAAAGGATATTGAGTCAAGCAATGTACTTACAGTTGAGCA	NA	NA	NA	NA
AWL43358.1|15807_16587_-	DNA polymerase V subunit UmuC	NA	F1C5A5	Cronobacter_phage	51.0	3.7e-69
AWL43359.1|16586_17012_-	peptidase	NA	A0A1W6JNS2	Morganella_phage	49.3	3.7e-31
>prophage 2
CP029382	Klebsiella pneumoniae subsp. pneumoniae strain SCKP020079 plasmid pQnrS1_020079, complete sequence	85185	20066	20600	85185		Wolbachia_phage(100.0%)	1	NA	NA
AWL43361.1|20066_20600_-	phospholipase D family protein	NA	A0A1B2LRT6	Wolbachia_phage	34.6	7.0e-19
>prophage 3
CP029382	Klebsiella pneumoniae subsp. pneumoniae strain SCKP020079 plasmid pQnrS1_020079, complete sequence	85185	39095	42509	85185		Alteromonas_phage(100.0%)	1	NA	NA
AWL43377.1|39095_42509_-	hypothetical protein	NA	A0A1J0GWC9	Alteromonas_phage	44.2	2.5e-16
>prophage 4
CP029382	Klebsiella pneumoniae subsp. pneumoniae strain SCKP020079 plasmid pQnrS1_020079, complete sequence	85185	49622	51317	85185		Hokovirus(100.0%)	1	NA	NA
AWL43385.1|49622_51317_+	hybrid sensor histidine kinase/response regulator	NA	A0A1V0SGX0	Hokovirus	27.9	2.1e-24
>prophage 5
CP029382	Klebsiella pneumoniae subsp. pneumoniae strain SCKP020079 plasmid pQnrS1_020079, complete sequence	85185	58825	59686	85185		Marinomonas_phage(100.0%)	1	NA	NA
AWL43397.1|58825_59686_-	DUF4942 domain-containing protein	NA	I6RTT5	Marinomonas_phage	29.9	2.8e-17
>prophage 6
CP029382	Klebsiella pneumoniae subsp. pneumoniae strain SCKP020079 plasmid pQnrS1_020079, complete sequence	85185	63081	65922	85185		Enterobacteria_phage(33.33%)	4	NA	NA
AWL43403.1|63081_64056_-	recombinase	NA	A0A0A7NPX4	Enterobacteria_phage	51.7	7.2e-86
AWL43431.1|64296_64974_-	resolvase	NA	I3WFA4	Macacine_betaherpesvirus	51.6	8.7e-22
AWL43404.1|65103_65589_-	hypothetical protein	NA	NA	NA	NA	NA
AWL43405.1|65673_65922_-	XRE family transcriptional regulator	NA	A0A248SLB9	Klebsiella_phage	51.5	1.6e-10
>prophage 7
CP029382	Klebsiella pneumoniae subsp. pneumoniae strain SCKP020079 plasmid pQnrS1_020079, complete sequence	85185	69339	72003	85185		Shigella_phage(25.0%)	5	NA	NA
AWL43410.1|69339_69669_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A088CBP5	Shigella_phage	44.2	2.4e-09
AWL43411.1|69649_69931_+	XRE family transcriptional regulator	NA	A0A2I6TC97	Escherichia_phage	38.0	1.3e-08
AWL43412.1|70077_70653_-	DUF4113 domain-containing protein	NA	F1C5A5	Cronobacter_phage	59.3	1.6e-45
AWL43413.1|70703_71294_+	plasmid pRiA4b ORF-3 family protein	NA	NA	NA	NA	NA
AWL43414.1|71430_72003_+	recombinase family protein	NA	M9Q1K0	Clostridium_phage	39.4	3.4e-19
>prophage 8
CP029382	Klebsiella pneumoniae subsp. pneumoniae strain SCKP020079 plasmid pQnrS1_020079, complete sequence	85185	76463	77321	85185		Enterobacteria_phage(100.0%)	1	NA	NA
AWL43417.1|76463_77321_-	class A beta-lactamase LAP-2	NA	Q1MVP3	Enterobacteria_phage	61.1	2.0e-92
>prophage 9
CP029382	Klebsiella pneumoniae subsp. pneumoniae strain SCKP020079 plasmid pQnrS1_020079, complete sequence	85185	83829	84534	85185	transposase	Escherichia_phage(100.0%)	1	NA	NA
AWL43423.1|83829_84534_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
>prophage 1
CP029383	Klebsiella pneumoniae subsp. pneumoniae strain SCKP020079 plasmid pVir_020079, complete sequence	178871	6617	66699	178871	transposase,integrase	Escherichia_phage(27.27%)	54	NA	NA
AWL43435.1|6617_7400_+|transposase	transposase	transposase	A0A2L1IVB6	Escherichia_phage	96.1	3.0e-135
AWL43436.1|9746_10184_-	hypothetical protein	NA	NA	NA	NA	NA
AWL43437.1|10183_11215_-	ParB/RepB/Spo0J family partition protein	NA	S5WII0	Leptospira_phage	26.1	2.9e-08
AWL43438.1|11214_12081_-	ParA family protein	NA	NA	NA	NA	NA
AWL43439.1|12604_12850_-	molecular chaperone DnaJ	NA	NA	NA	NA	NA
AWL43440.1|14765_14924_-	hypothetical protein	NA	A0A0U2RK18	Escherichia_phage	69.7	2.2e-05
AWL43581.1|15236_16166_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	52.4	5.6e-72
AWL43441.1|16310_17090_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	89.4	6.0e-51
AWL43582.1|17086_17899_-	hypothetical protein	NA	NA	NA	NA	NA
AWL43442.1|18879_19086_+	hypothetical protein	NA	NA	NA	NA	NA
AWL43443.1|19075_19369_-	korC	NA	NA	NA	NA	NA
AWL43444.1|19384_20518_-	hypothetical protein	NA	NA	NA	NA	NA
AWL43445.1|21125_21356_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
AWL43446.1|21352_21796_+	PIN domain-containing protein	NA	NA	NA	NA	NA
AWL43447.1|23575_23758_+	hypothetical protein	NA	NA	NA	NA	NA
AWL43448.1|24089_24365_-	hypothetical protein	NA	NA	NA	NA	NA
AWL43449.1|24292_24496_-	hypothetical protein	NA	NA	NA	NA	NA
AWL43450.1|24586_25507_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
AWL43451.1|25555_26047_-	hypothetical protein	NA	NA	NA	NA	NA
AWL43452.1|26109_26385_-	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
AWL43453.1|26468_26897_-	DUF417 domain-containing protein	NA	NA	NA	NA	NA
AWL43454.1|26934_27495_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
AWL43455.1|27536_27797_-	DUF1471 domain-containing protein	NA	A0A1B2IE60	Erwinia_phage	51.0	1.1e-06
AWL43456.1|28073_28355_+	hypothetical protein	NA	NA	NA	NA	NA
AWL43457.1|28463_30665_-	ferric aerobactin receptor	NA	NA	NA	NA	NA
AWL43458.1|30746_32024_-	lysine 6-monooxygenase	NA	NA	NA	NA	NA
AWL43459.1|32027_33761_-	IucA/IucC family siderophore biosynthesis protein	NA	NA	NA	NA	NA
AWL43460.1|33760_34708_-	N-acetyltransferase	NA	NA	NA	NA	NA
AWL43461.1|34708_36496_-	aerobactin synthase IucA	NA	NA	NA	NA	NA
AWL43462.1|36589_37789_+	MFS transporter	NA	NA	NA	NA	NA
AWL43463.1|38138_38345_+	hypothetical protein	NA	NA	NA	NA	NA
AWL43464.1|38486_38681_+	hypothetical protein	NA	NA	NA	NA	NA
AWL43465.1|39541_40051_+	peptide deformylase	NA	E3SLL2	Synechococcus_phage	41.9	8.8e-19
AWL43466.1|40600_40918_-	lysozyme	NA	NA	NA	NA	NA
AWL43467.1|41154_41541_-	transcriptional repressor	NA	NA	NA	NA	NA
AWL43468.1|41638_42838_+	cobalamin biosynthesis protein CobW	NA	NA	NA	NA	NA
AWL43469.1|43284_43992_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AWL43583.1|44654_45653_-	iron ABC transporter permease	NA	NA	NA	NA	NA
AWL43470.1|45658_46615_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AWL43471.1|46636_47464_-	ABC transporter ATP-binding protein	NA	M1HV27	Acanthocystis_turfacea_Chlorella_virus	28.4	2.2e-11
AWL43472.1|48208_49132_+|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	92.8	1.7e-166
AWL43473.1|49243_49810_+	type I-E CRISPR-associated protein Cas6/Cse3/CasE	NA	NA	NA	NA	NA
AWL43474.1|52425_53079_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AWL43475.1|53621_54254_+	response regulator	NA	NA	NA	NA	NA
AWL43476.1|54634_55186_+	DNA-binding response regulator	NA	NA	NA	NA	NA
AWL43477.1|55258_56161_+	EamA family transporter	NA	NA	NA	NA	NA
AWL43478.1|56303_56525_-	hypothetical protein	NA	NA	NA	NA	NA
AWL43479.1|57959_58940_+|transposase	IS5-like element ISKpn26 family transposase	transposase	Q38213	Escherichia_phage	99.1	8.9e-185
AWL43584.1|58978_59101_-	ABC transporter	NA	NA	NA	NA	NA
AWL43480.1|59749_60193_+	DUF2384 domain-containing protein	NA	NA	NA	NA	NA
AWL43481.1|60189_60660_+	RES domain-containing protein	NA	NA	NA	NA	NA
AWL43482.1|64018_64513_+	nuclease	NA	A0A0R6PHV6	Moraxella_phage	38.6	5.9e-20
AWL43483.1|64849_65248_+	DNA-binding protein H-NS-like protein	NA	NA	NA	NA	NA
AWL43484.1|65694_66699_-|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
>prophage 2
CP029383	Klebsiella pneumoniae subsp. pneumoniae strain SCKP020079 plasmid pVir_020079, complete sequence	178871	104627	153472	178871	transposase	Bacillus_phage(28.57%)	43	NA	NA
AWL43519.1|104627_105551_+|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	92.5	7.3e-165
AWL43520.1|106001_106790_-	hypothetical protein	NA	NA	NA	NA	NA
AWL43521.1|106810_107254_-	hypothetical protein	NA	NA	NA	NA	NA
AWL43522.1|108191_108485_+	hypothetical protein	NA	NA	NA	NA	NA
AWL43523.1|108797_109268_+	hypothetical protein	NA	NA	NA	NA	NA
AWL43588.1|109334_110258_+|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	92.8	1.7e-166
AWL43524.1|110491_110986_-	DNA-binding protein	NA	NA	NA	NA	NA
AWL43525.1|111271_112276_-|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
AWL43526.1|112354_115324_-|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.3	0.0e+00
AWL43527.1|115326_115884_-	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	81.3	2.6e-48
AWL43528.1|116013_117090_-	signal peptidase II	NA	NA	NA	NA	NA
AWL43529.1|117086_119492_-	copper-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	46.1	1.0e-141
AWL43530.1|119577_120012_+	Cd(II)/Pb(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
AWL43531.1|120102_121107_+|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
AWL43532.1|121634_123035_-	sensor histidine kinase	NA	W8CYF6	Bacillus_phage	26.3	4.1e-18
AWL43533.1|123031_123712_-	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	34.4	8.7e-30
AWL43534.1|123766_124696_-	copper resistance protein CopD	NA	NA	NA	NA	NA
AWL43535.1|124700_125081_-	copper resistance system chaperone PcoC	NA	NA	NA	NA	NA
AWL43536.1|125120_126017_-	copper resistance protein B	NA	NA	NA	NA	NA
AWL43537.1|126016_127834_-	multicopper oxidase PcoA	NA	NA	NA	NA	NA
AWL43538.1|128067_128535_+	copper resistance protein	NA	NA	NA	NA	NA
AWL43539.1|128801_129539_+	peptidase M23	NA	A0A2H4JAF5	uncultured_Caudovirales_phage	32.5	1.2e-11
AWL43540.1|129572_129770_-	DUF2933 domain-containing protein	NA	NA	NA	NA	NA
AWL43541.1|129810_132258_-	copper-translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	35.8	7.6e-84
AWL43542.1|132384_132825_-	hypothetical protein	NA	NA	NA	NA	NA
AWL43543.1|132911_136058_-	CusA/CzcA family heavy metal efflux RND transporter	NA	S5VTK5	Leptospira_phage	22.5	4.0e-61
AWL43544.1|136068_137361_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
AWL43545.1|137474_137837_-	copper ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AWL43546.1|137865_139251_-	Cu(I)/Ag(I) efflux RND transporter outer membrane protein	NA	NA	NA	NA	NA
AWL43547.1|139440_140121_+	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	35.7	1.3e-30
AWL43548.1|140113_141589_+	Cu(+)/Ag(+) sensor histidine kinase	NA	W8CYF6	Bacillus_phage	30.1	1.0e-27
AWL43549.1|141839_142271_+	silver-binding protein SilE	NA	NA	NA	NA	NA
AWL43550.1|142414_142765_+	DUF305 domain-containing protein	NA	A0A218MND9	uncultured_virus	53.3	3.2e-20
AWL43589.1|143151_144060_-	HNH endonuclease	NA	NA	NA	NA	NA
AWL43551.1|144696_145671_+	sensor domain-containing diguanylate cyclase	NA	NA	NA	NA	NA
AWL43552.1|145974_146265_+	hypothetical protein	NA	NA	NA	NA	NA
AWL43553.1|146254_147154_+	hypothetical protein	NA	NA	NA	NA	NA
AWL43554.1|147202_149428_-	exclusion suppressor FxsA	NA	NA	NA	NA	NA
AWL43555.1|149429_150332_-	transcriptional regulator	NA	NA	NA	NA	NA
AWL43556.1|150415_150598_+	hypothetical protein	NA	NA	NA	NA	NA
AWL43557.1|150616_151078_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
AWL43558.1|151193_152141_+	EamA family transporter	NA	NA	NA	NA	NA
AWL43559.1|152476_153472_+|transposase	IS110 family transposase	transposase	A0A1S7J231	Thermus_phage	28.7	3.1e-20
>prophage 3
CP029383	Klebsiella pneumoniae subsp. pneumoniae strain SCKP020079 plasmid pVir_020079, complete sequence	178871	170713	178142	178871	transposase	Stx2-converting_phage(28.57%)	7	NA	NA
AWL43572.1|170713_171682_+|transposase	IS110 family transposase	transposase	A0A1S7J231	Thermus_phage	28.8	7.3e-14
AWL43573.1|172009_173602_-|transposase	IS66-like element ISKox1 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	61.8	3.2e-176
AWL43574.1|173632_173983_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBY2	Stx2-converting_phage	63.8	5.2e-39
AWL43575.1|173979_174420_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	53.8	4.4e-19
AWL43576.1|174616_174799_+	DUF4113 domain-containing protein	NA	A0A1W6JNT0	Morganella_phage	57.1	9.1e-11
AWL43577.1|176004_176976_-	ParB/RepB/Spo0J family plasmid partition protein	NA	I3WF22	Macacine_betaherpesvirus	86.9	7.0e-150
AWL43578.1|176975_178142_-	plasmid-partitioning protein SopA	NA	A0A2I6B2X3	Macacine_betaherpesvirus	97.4	2.0e-223
