The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP028548	Klebsiella pneumoniae subsp. pneumoniae strain SCKP020143 chromosome, complete genome	5492984	449876	519290	5492984	portal,tail,terminase,capsid,head,tRNA,integrase,protease	uncultured_Caudovirales_phage(61.11%)	75	467484:467501	483479:483496
AVZ87858.1|449876_450824_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	37.2	2.2e-07
AVZ87859.1|450838_451348_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	40.3	2.6e-18
AVZ87860.1|451476_452601_+	DNA-protecting protein DprA	NA	NA	NA	NA	NA
AVZ87861.1|452572_453046_+	DUF494 domain-containing protein	NA	NA	NA	NA	NA
AVZ87862.1|453071_453614_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ87863.1|453618_454191_+	L-threonylcarbamoyladenylate synthase type 1 TsaC	NA	NA	NA	NA	NA
AVZ87864.1|454194_455013_+	shikimate dehydrogenase	NA	NA	NA	NA	NA
AVZ87865.1|455009_455267_+	DUF1488 domain-containing protein	NA	NA	NA	NA	NA
AVZ92535.1|455242_455797_-	gamma carbonic anhydrase family protein	NA	NA	NA	NA	NA
AVZ87866.1|461592_461814_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ87867.1|462107_465218_-	multidrug efflux RND transporter permease subunit	NA	NA	NA	NA	NA
AVZ87868.1|465230_466370_-	MexX family efflux pump subunit	NA	NA	NA	NA	NA
AVZ87869.1|466748_467399_+	acrEF/envCD operon transcriptional regulator	NA	NA	NA	NA	NA
467484:467501	attL	GTATCAGTTCATGCCGTA	NA	NA	NA	NA
AVZ87870.1|467674_468901_+|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	62.2	1.8e-150
AVZ87871.1|468993_469935_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ87872.1|470116_470401_+	transcriptional regulator	NA	NA	NA	NA	NA
AVZ87873.1|470411_471191_+	hypothetical protein	NA	Q8HA02	Enterobacteria_phage	51.5	6.2e-40
AVZ87874.1|471314_471509_-	toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
AVZ92536.1|471642_471912_+	host cell division inhibitor Icd-like protein	NA	A0A2H4JGW3	uncultured_Caudovirales_phage	94.4	2.4e-44
AVZ87875.1|471904_472093_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ87876.1|472085_472400_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ87877.1|472396_472765_+	hypothetical protein	NA	A0A2H4JCX7	uncultured_Caudovirales_phage	81.1	3.7e-51
AVZ87878.1|472761_473127_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ87879.1|473126_475262_+	DNA primase	NA	A0A1W6JPG0	Morganella_phage	62.4	3.4e-205
AVZ87880.1|475604_475940_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ87881.1|475988_476501_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ87882.1|476764_477931_+|capsid	phage major capsid protein	capsid	A0A2H4JED2	uncultured_Caudovirales_phage	95.9	9.8e-207
AVZ87883.1|477982_478543_+|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	95.7	1.2e-98
AVZ87884.1|478544_479786_+|portal	phage portal protein	portal	A0A2H4JFJ9	uncultured_Caudovirales_phage	96.5	1.0e-230
AVZ87885.1|479782_480118_+|head,tail	head-tail adaptor	head,tail	A0A2H4JHK5	uncultured_Caudovirales_phage	57.8	3.7e-26
AVZ87886.1|480114_480414_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2H4JD08	uncultured_Caudovirales_phage	80.8	3.4e-39
AVZ87887.1|480413_480857_+	HNH endonuclease	NA	A0A2H4JAS8	uncultured_Caudovirales_phage	91.8	2.8e-77
AVZ87888.1|480983_481175_+|terminase	terminase	terminase	NA	NA	NA	NA
AVZ87889.1|481132_481489_+|terminase	phage terminase small subunit P27 family	terminase	A0A2H4JHS3	uncultured_Caudovirales_phage	99.2	5.5e-60
AVZ87890.1|481472_483134_+|terminase	terminase large subunit	terminase	A0A2H4JB64	uncultured_Caudovirales_phage	98.0	0.0e+00
AVZ87891.1|483136_483328_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ87892.1|483481_483778_-	Fis family transcriptional regulator	NA	NA	NA	NA	NA
483479:483496	attR	GTATCAGTTCATGCCGTA	NA	NA	NA	NA
AVZ87893.1|483802_484768_-|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
AVZ87894.1|484925_485120_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ87895.1|485125_486007_-	50S ribosomal protein L11 methyltransferase	NA	NA	NA	NA	NA
AVZ87896.1|486018_487470_-	sodium/panthothenate symporter	NA	NA	NA	NA	NA
AVZ87897.1|487459_487702_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ87898.1|487812_489162_-	acetyl-CoA carboxylase biotin carboxylase subunit	NA	NA	NA	NA	NA
AVZ87899.1|489172_489640_-	acetyl-CoA carboxylase biotin carboxyl carrier protein	NA	NA	NA	NA	NA
AVZ87900.1|489662_490115_-	type II 3-dehydroquinate dehydratase	NA	NA	NA	NA	NA
AVZ87901.1|490338_490947_-	protein-methionine-sulfoxide reductase heme-binding subunit MsrQ	NA	NA	NA	NA	NA
AVZ87902.1|490946_491948_-	protein-methionine-sulfoxide reductase catalytic subunit MsrP	NA	NA	NA	NA	NA
AVZ87903.1|492176_492368_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ87904.1|492447_494388_+	RNase E specificity factor CsrD	NA	NA	NA	NA	NA
AVZ87905.1|494509_494716_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ87906.1|494693_495737_+	rod shape-determining protein	NA	F2Y0P3	Organic_Lake_phycodnavirus	22.3	6.7e-05
AVZ87907.1|495807_496800_+	rod shape-determining protein MreC	NA	NA	NA	NA	NA
AVZ87908.1|496799_497288_+	rod shape-determining protein MreD	NA	NA	NA	NA	NA
AVZ87909.1|497295_497877_+	septum formation inhibitor Maf	NA	NA	NA	NA	NA
AVZ87910.1|497879_499349_+	ribonuclease G	NA	NA	NA	NA	NA
AVZ87911.1|499386_503184_+	AsmA2 domain-containing protein	NA	NA	NA	NA	NA
AVZ87912.1|503272_504754_+|protease	metalloprotease TldD	protease	NA	NA	NA	NA
AVZ87913.1|504789_505719_-	HTH-type transcriptional activator AaeR	NA	NA	NA	NA	NA
AVZ87914.1|505850_506054_+	protein AaeX	NA	NA	NA	NA	NA
AVZ87915.1|506061_506994_+	p-hydroxybenzoic acid efflux pump subunit AaeA	NA	NA	NA	NA	NA
AVZ87916.1|506999_508967_+	p-hydroxybenzoic acid efflux pump subunit AaeB	NA	NA	NA	NA	NA
AVZ87917.1|509046_509322_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ87918.1|509372_509639_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
AVZ87919.1|509737_510001_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
AVZ87920.1|510376_510847_-	arginine repressor	NA	NA	NA	NA	NA
AVZ87921.1|511261_512200_+	malate dehydrogenase	NA	NA	NA	NA	NA
AVZ87922.1|512336_513395_-|protease	serine endoprotease DegS	protease	NA	NA	NA	NA
AVZ87923.1|513482_514850_-|protease	serine endoprotease DegQ	protease	A0A1B1IT49	uncultured_Mediterranean_phage	25.3	6.0e-22
AVZ87924.1|515023_515422_-	DUF1043 domain-containing protein	NA	NA	NA	NA	NA
AVZ87925.1|515612_516740_+	cell division protein ZapE	NA	NA	NA	NA	NA
AVZ87926.1|517005_517434_+	50S ribosomal protein L13	NA	NA	NA	NA	NA
AVZ87927.1|517449_517842_+	30S ribosomal protein S9	NA	NA	NA	NA	NA
AVZ87928.1|517951_518155_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ87929.1|518153_518792_+	stringent starvation protein A	NA	NA	NA	NA	NA
AVZ87930.1|518795_519290_+|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	54.8	1.5e-26
>prophage 2
CP028548	Klebsiella pneumoniae subsp. pneumoniae strain SCKP020143 chromosome, complete genome	5492984	1199727	1276831	5492984	portal,tail,capsid,head,tRNA,transposase,integrase,plate,lysis,coat	Salmonella_phage(76.09%)	90	1199581:1199640	1262405:1263600
1199581:1199640	attL	GGAAGGTGCGAATAAGCAGGTCATTTCTTCCCAAGCTGACTCGCTGATTAAAATTTCGCG	NA	NA	NA	NA
AVZ88598.1|1199727_1200708_-|transposase	IS5-like element ISKpn26 family transposase	transposase	Q38213	Escherichia_phage	99.1	8.9e-185
AVZ88599.1|1201080_1201530_-	L-alanine exporter AlaE	NA	NA	NA	NA	NA
AVZ92555.1|1201648_1201834_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ92556.1|1202258_1202660_+	DNA-binding protein StpA	NA	NA	NA	NA	NA
AVZ88600.1|1202732_1202912_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ88601.1|1203117_1204020_+	lipid A hydroxylase LpxO	NA	H8ZJK8	Ostreococcus_tauri_virus	40.2	2.6e-37
AVZ88602.1|1204000_1204546_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ88603.1|1204553_1204853_-	transcriptional regulator	NA	NA	NA	NA	NA
AVZ88604.1|1204928_1205534_-	FMN-dependent NADH-azoreductase	NA	NA	NA	NA	NA
AVZ88605.1|1205637_1206546_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AVZ88606.1|1206628_1208416_-	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
AVZ88607.1|1208679_1210200_+	aldehyde dehydrogenase	NA	NA	NA	NA	NA
AVZ88608.1|1210901_1211483_+	fimbrial protein	NA	NA	NA	NA	NA
AVZ88609.1|1211677_1212340_+	molecular chaperone	NA	NA	NA	NA	NA
AVZ92557.1|1212376_1214932_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
AVZ88610.1|1214939_1216034_+	fimbrial protein	NA	NA	NA	NA	NA
AVZ88611.1|1216046_1217075_-	fimbrial protein	NA	NA	NA	NA	NA
AVZ88612.1|1217077_1219615_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
AVZ88613.1|1219644_1220313_-	molecular chaperone	NA	NA	NA	NA	NA
AVZ88614.1|1220354_1220903_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
AVZ88615.1|1221006_1221624_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
AVZ92558.1|1222063_1222825_+	amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AVZ88616.1|1222880_1223501_-	transporter	NA	NA	NA	NA	NA
AVZ88617.1|1223656_1224451_-	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
AVZ88618.1|1224511_1225444_-	glyoxylate/hydroxypyruvate reductase A	NA	NA	NA	NA	NA
AVZ88619.1|1225449_1226178_-	aldolase	NA	NA	NA	NA	NA
AVZ88620.1|1226178_1226430_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ88621.1|1226487_1227468_-|transposase	IS5-like element ISKpn26 family transposase	transposase	Q38213	Escherichia_phage	99.1	8.9e-185
AVZ88622.1|1227513_1228512_-|integrase	site-specific integrase	integrase	A0A1S6L016	Salmonella_phage	94.5	2.2e-183
AVZ88623.1|1228514_1229144_-	phage repressor protein	NA	A0A1S6KZZ7	Salmonella_phage	54.5	1.4e-61
AVZ88624.1|1229266_1229509_+	Rha family transcriptional regulator	NA	A0A1S6KZZ6	Salmonella_phage	98.8	4.0e-38
AVZ88625.1|1229541_1230051_+	hypothetical protein	NA	A0A1S6L008	Salmonella_phage	85.8	1.1e-77
AVZ88626.1|1230058_1230259_+	DUF2724 domain-containing protein	NA	A0A1S6L005	Salmonella_phage	68.8	4.5e-19
AVZ88627.1|1230222_1230561_+	hypothetical protein	NA	A0A218M4I7	Erwinia_phage	58.0	6.2e-29
AVZ88628.1|1230628_1230862_+	DUF2732 domain-containing protein	NA	A0A1S6L021	Salmonella_phage	90.9	6.0e-31
AVZ88629.1|1230861_1231089_+	hypothetical protein	NA	A0A1S6L007	Salmonella_phage	92.0	5.1e-35
AVZ88630.1|1231085_1231937_+	DNA adenine methylase	NA	A0A1S6L011	Salmonella_phage	75.4	2.2e-115
AVZ88631.1|1231933_1234318_+	replication endonuclease	NA	A0A1S6L028	Salmonella_phage	87.9	0.0e+00
AVZ88632.1|1234547_1234799_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ88633.1|1234798_1236283_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
AVZ88634.1|1236390_1236579_+	hypothetical protein	NA	A0A1S6L006	Salmonella_phage	90.3	2.2e-23
AVZ88635.1|1236590_1236824_+	DinI family protein	NA	A0A0M4S6H1	Salmonella_phage	96.1	2.0e-34
AVZ88636.1|1236919_1237603_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ88637.1|1237589_1238669_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ88638.1|1238668_1239670_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ92559.1|1240191_1240461_+	hypothetical protein	NA	D2IZW1	Enterococcus_phage	41.3	1.4e-15
AVZ88639.1|1240517_1241561_-|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	85.6	3.1e-172
AVZ88640.1|1241560_1243324_-	oxidoreductase	NA	A0A1S6KZW3	Salmonella_phage	91.8	0.0e+00
AVZ88641.1|1243464_1244298_+|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	77.6	4.4e-100
AVZ88642.1|1244314_1245367_+|capsid	phage major capsid protein, P2 family	capsid	A0A1S6KZZ3	Salmonella_phage	91.0	6.8e-175
AVZ88643.1|1245370_1246024_+	hypothetical protein	NA	A0A1S6KZX1	Salmonella_phage	80.0	1.9e-90
AVZ88644.1|1246119_1246584_+|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	85.7	1.5e-73
AVZ88645.1|1246583_1246787_+|tail	phage tail protein	tail	E5G6M9	Salmonella_phage	89.6	9.8e-30
AVZ92560.1|1246790_1247006_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	88.7	6.1e-30
AVZ88646.1|1246986_1247496_+	lysozyme	NA	E5G6N1	Salmonella_phage	85.2	1.6e-81
AVZ88647.1|1247500_1247884_+	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	45.4	1.9e-18
AVZ88648.1|1247880_1248309_+|lysis	LysB family phage lysis regulatory protein	lysis	A0A1S6KZX8	Salmonella_phage	82.5	7.1e-54
AVZ88649.1|1248238_1248442_+	hypothetical protein	NA	A0A1S6KZX6	Salmonella_phage	77.6	3.0e-23
AVZ88650.1|1248404_1248827_+|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	83.2	8.2e-63
AVZ88651.1|1248819_1249266_+	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	72.3	2.5e-54
AVZ88652.1|1249288_1250155_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ88653.1|1250249_1250822_+|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	70.8	1.4e-76
AVZ88654.1|1250818_1251181_+|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	85.6	8.4e-48
AVZ88655.1|1252068_1252740_+|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	58.9	3.2e-61
AVZ88656.1|1252741_1254691_+|coat	spore coat protein CotH	coat	Q6QI97	Burkholderia_phage	38.9	1.0e-06
AVZ88657.1|1254700_1255819_+	hypothetical protein	NA	A0A248XD67	Klebsiella_phage	38.0	4.4e-55
AVZ88658.1|1255870_1256944_+|tail	phage tail protein	tail	A0A1S6KZZ8	Salmonella_phage	53.6	6.6e-40
AVZ88659.1|1257092_1258265_+|tail	phage tail protein	tail	A0A1S6KZY7	Salmonella_phage	91.5	3.4e-207
AVZ88660.1|1258274_1258790_+|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	84.2	1.4e-80
AVZ88661.1|1258842_1259142_+|tail	phage tail assembly protein	tail	E5G6P9	Salmonella_phage	78.0	8.2e-33
AVZ88662.1|1259156_1259276_+|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.2e-13
AVZ88663.1|1261336_1262317_+|transposase	IS5-like element ISKpn26 family transposase	transposase	Q38213	Escherichia_phage	99.1	8.9e-185
AVZ92561.1|1262355_1262481_-	ABC transporter	NA	NA	NA	NA	NA
AVZ88664.1|1263095_1263581_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	80.1	5.2e-61
AVZ88665.1|1263577_1264672_+	phage late control D family protein	NA	E5G6Q3	Salmonella_phage	83.6	2.4e-170
1262405:1263600	attR	CGCGAAATTTTAATCAGCGAGTCAGCTTGGGAAGAAATGACCTGCTTATTCGCACCTTCCTTAGCAGCAAATGGGATGAAATTCTAAGTGATGTTGCCGCGCTGCCCGCGAAGTTTAAAGCGGTGGGCGGTGCGATCATTGACGGCATCCTGAGCGGTATCAATGAGAAGTGGGAGATGCTCAAGAGCAAGCTGGCATCGGTGAAAAGCTACCTGCCGGACTGGATGACCGGCGGCGACAAATCGCCAGGTGCACTTCAGCAGAAAGGAGCAGGCGGATTCTTTGCGGGTATGTATGACAGCGGTGGATATATTCCACGCGGGCAGGTGGGCATTGCTGGCGAGAATGGCCCGGAACTGATTAACGGCCCGGCCTATGTGACCAGCCGCCGAAGGACGGCGGCGCTGGCGTCCGTTGTCGCCGGGATGATGGGGGGAGCGATTCCGGCAGAGGCTGCGCCACTTCATCCAATGAGCCTGCCGGCAACATCCTATCGGCCTGCAGCTGAGAAGCCGGCAGGGGGGCAGCCGATCATTCATATCGAATCGAAGCCGCAATTTATTATCCAGGCATTACCGGGGCAAAGTTCGCAGGATATTGCGAAAGAGGTTGCGCGAATGTTTGCGGAGCATGAGCGGCGTTTAATGGCGAAGGCACGCAGCAACTTCAGCGATCAAGGGGGGTATGATTCATGATGATGGTTCTGGGTTTGTTTGTGTTTCAGCTGCGCACGGTGCCCTATCAGCAACTGCAGTATCAGCGGAACTGGCGGCACGTCACCAACAACCGCGTTAATCGCCGTCCGACAACGCAGTTTCTGGGGCCAGATAATGATCAGCTCACGCTATCCGGCGTCCTCATGCCGGAAGTGACCGGAGGCCGGTTGTCGCTGCTGGCGCTGGAGCTGATGGCGGAGCAGGGGAAGGCCTGGCCGCTGATCGAGGGGGGCGGGACCATCTACGGTATGTACGTGATTGAAAATCTGAGCCAGACAAAAACGGAATTTTTCGCCAGCGGTGAAGCGAGAAAAATAGAGTTTTCGCTGGGGCTAAAGCGTGTTGATGAGTCGCTGTCCGAAATGTTCGGCAGCCTGAGTGACCAGCTTAGCAGCCTGCAGGATTCCGCAGCGGCAGCGGTAGGGAATATCAAAACCACGGTAGGAGGGTTGCTGCAGTGAGCGAGATGACTGATTTACT	NA	NA	NA	NA
AVZ88666.1|1264738_1264957_+	levansucrase regulator	NA	Q53ZE7	Salmonella_virus	72.2	1.9e-26
AVZ88667.1|1264984_1265362_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ88668.1|1265965_1266448_-	SsrA-binding protein	NA	W5RAM5	Staphylococcus_phage	47.4	2.3e-29
AVZ88669.1|1266558_1267035_+	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
AVZ88670.1|1267024_1267315_+	RnfH family protein	NA	NA	NA	NA	NA
AVZ88671.1|1267381_1267723_-	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
AVZ88672.1|1267870_1269532_-	DNA repair protein RecN	NA	NA	NA	NA	NA
AVZ88673.1|1269618_1270497_-	NAD(+) kinase	NA	NA	NA	NA	NA
AVZ88674.1|1270621_1271212_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
AVZ88675.1|1271331_1272618_-	DUF21 domain-containing protein	NA	NA	NA	NA	NA
AVZ88676.1|1272637_1273429_-	inner membrane protein YpjD	NA	NA	NA	NA	NA
AVZ88677.1|1273592_1274957_+	signal recognition particle protein	NA	NA	NA	NA	NA
AVZ88678.1|1275216_1275465_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
AVZ88679.1|1275483_1276032_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
AVZ88680.1|1276063_1276831_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
>prophage 3
CP028548	Klebsiella pneumoniae subsp. pneumoniae strain SCKP020143 chromosome, complete genome	5492984	1381547	1434284	5492984	terminase,holin,transposase,tail	Salmonella_phage(40.38%)	62	NA	NA
AVZ88769.1|1381547_1383014_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	38.7	1.2e-87
AVZ88770.1|1383081_1384659_+	GMP synthase (glutamine-hydrolyzing)	NA	NA	NA	NA	NA
AVZ88771.1|1384850_1386101_+	DUF4102 domain-containing protein	NA	A0A1X9TCT6	Enterobacter_phage	84.4	5.8e-205
AVZ88772.1|1386043_1386286_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ88773.1|1386282_1386876_-	adenine methylase	NA	T1SA14	Salmonella_phage	91.9	6.3e-109
AVZ88774.1|1386872_1387535_-	hypothetical protein	NA	A0A059VF56	Pseudomonas_phage	46.6	1.2e-47
AVZ88775.1|1387531_1387690_-	DUF1317 domain-containing protein	NA	T1SAR0	Salmonella_phage	78.8	1.1e-17
AVZ88776.1|1387682_1387976_-	PerC family transcriptional regulator	NA	T1S9J5	Salmonella_phage	71.1	4.0e-32
AVZ88777.1|1388085_1388334_-	AlpA family phage regulatory protein	NA	A0A0F6TJ45	Escherichia_coli_O157_typing_phage	76.8	4.9e-31
AVZ88778.1|1388382_1389264_-	recombinase RecT	NA	T1SBJ5	Salmonella_phage	84.3	8.9e-136
AVZ88779.1|1389260_1390082_-	exodeoxyribonuclease VIII	NA	A0A193GYK2	Enterobacter_phage	80.2	1.8e-130
AVZ88780.1|1390078_1390378_-	hypothetical protein	NA	A0A0F6R7M4	Escherichia_coli_O157_typing_phage	54.5	2.1e-20
AVZ88781.1|1390744_1391326_-	XRE family transcriptional regulator	NA	Q858D7	Salmonella_phage	64.3	7.1e-65
AVZ88782.1|1391480_1391714_+	hypothetical protein	NA	T1SAR5	Salmonella_phage	66.2	9.2e-24
AVZ88783.1|1391860_1392070_+	hypothetical protein	NA	A0A193GYW4	Enterobacter_phage	78.3	1.8e-26
AVZ88784.1|1392069_1392837_+	primosomal protein	NA	A0A193GZ86	Enterobacter_phage	91.4	8.9e-140
AVZ88785.1|1392833_1393619_+	replication protein	NA	A0A193GYX1	Enterobacter_phage	87.7	3.7e-133
AVZ88786.1|1393738_1394086_+	DUF1064 domain-containing protein	NA	A0A0F6R8N5	Escherichia_coli_O157_typing_phage	82.6	6.5e-50
AVZ88787.1|1394278_1394689_+	hypothetical protein	NA	A0A2P1MXC5	Escherichia_phage	45.1	4.3e-16
AVZ88788.1|1394672_1394864_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ88789.1|1394860_1395505_+	hypothetical protein	NA	Q1MVG0	Enterobacteria_phage	79.3	8.0e-110
AVZ92564.1|1395798_1396266_+	hypothetical protein	NA	A0A2R2Z312	Escherichia_phage	51.7	1.3e-37
AVZ88790.1|1396265_1396559_+	hypothetical protein	NA	Q6UAT9	Klebsiella_phage	86.6	2.7e-44
AVZ88791.1|1396555_1397176_+	hypothetical protein	NA	Q1MVF7	Enterobacteria_phage	40.7	1.0e-29
AVZ92565.1|1397175_1397379_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ88792.1|1397371_1397710_+	hypothetical protein	NA	A0A193GYX4	Enterobacter_phage	80.0	1.8e-44
AVZ88793.1|1397806_1399291_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
AVZ88794.1|1399290_1399542_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ88795.1|1399694_1399952_+	lF-82	NA	NA	NA	NA	NA
AVZ88796.1|1400029_1400614_+|terminase	terminase small subunit	terminase	T1SBI8	Salmonella_phage	88.6	2.2e-90
AVZ88797.1|1400610_1402086_+|terminase	terminase	terminase	Q858H3	Salmonella_phage	93.1	6.4e-280
AVZ88798.1|1402129_1402501_-	hypothetical protein	NA	A0A0F6TJP2	Escherichia_coli_O157_typing_phage	91.9	3.7e-59
AVZ88799.1|1402550_1402793_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ88800.1|1403254_1403461_+	hypothetical protein	NA	T1SA67	Salmonella_phage	88.2	4.8e-08
AVZ88801.1|1403475_1405158_+|tail	phage tail protein	tail	A0A0F6TJD8	Escherichia_coli_O157_typing_phage	84.4	1.5e-264
AVZ88802.1|1405154_1405451_+	hypothetical protein	NA	T1SBI9	Salmonella_phage	70.4	1.2e-33
AVZ88803.1|1405453_1406134_+	peptidase	NA	G9L6C4	Escherichia_phage	84.0	6.1e-76
AVZ88804.1|1406148_1407135_+	hypothetical protein	NA	A0A193GZ49	Enterobacter_phage	94.2	2.5e-179
AVZ88805.1|1407188_1407626_+	hypothetical protein	NA	A0A193GYT9	Enterobacter_phage	91.7	1.3e-66
AVZ88806.1|1407636_1407978_+	hypothetical protein	NA	G9L6C7	Escherichia_phage	70.8	2.4e-36
AVZ88807.1|1408028_1408352_+	hypothetical protein	NA	G9L6C8	Escherichia_phage	85.0	5.3e-46
AVZ88808.1|1408351_1408957_+	hypothetical protein	NA	A0A0F6TJN5	Escherichia_coli_O157_typing_phage	77.0	4.0e-87
AVZ88809.1|1408956_1411434_+	hypothetical protein	NA	Q858G3	Salmonella_phage	84.4	0.0e+00
AVZ88810.1|1411433_1411898_+	hypothetical protein	NA	Q858G2	Salmonella_phage	81.2	1.5e-70
AVZ88811.1|1411897_1412437_+	hypothetical protein	NA	A0A0F6TJ56	Escherichia_coli_O157_typing_phage	80.0	8.0e-71
AVZ88812.1|1412447_1414982_+	hypothetical protein	NA	Q858G0	Salmonella_phage	84.1	0.0e+00
AVZ88813.1|1414981_1416892_+	hypothetical protein	NA	Q858F9	Salmonella_phage	82.7	5.4e-287
AVZ88814.1|1416891_1419648_+	hypothetical protein	NA	Q858F8	Salmonella_phage	95.4	0.0e+00
AVZ88815.1|1419644_1419839_+	hypothetical protein	NA	Q858F7	Salmonella_phage	67.2	6.5e-15
AVZ88816.1|1419873_1420026_-	transmembrane anchored protein	NA	G9L6D9	Escherichia_phage	83.7	2.5e-14
AVZ88817.1|1420124_1420421_-	hypothetical protein	NA	T1SA06	Salmonella_phage	63.9	6.9e-24
AVZ88818.1|1423248_1423512_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ92566.1|1424674_1424761_+	ABC transporter	NA	NA	NA	NA	NA
AVZ88819.1|1424799_1425780_-|transposase	IS5 family transposase ISKpn26	transposase	A0A077SK28	Escherichia_phage	99.4	1.0e-185
AVZ88820.1|1426648_1427911_-|transposase	IS1380 family transposase ISEc9	transposase	A0A1B0VDR3	Salmonella_phage	100.0	1.3e-39
AVZ88821.1|1428801_1428942_-	ABC transporter	NA	NA	NA	NA	NA
AVZ88822.1|1429019_1430336_+	right-handed parallel beta-helix repeat-containing protein	NA	A0A0K2FI18	Enterobacter_phage	32.3	2.3e-34
AVZ88823.1|1430422_1430827_+	hypothetical protein	NA	T1SA79	Salmonella_phage	81.1	8.7e-54
AVZ88824.1|1430813_1431119_+|holin	phage holin family protein	holin	A0A193GYK3	Enterobacter_phage	81.4	2.7e-39
AVZ88825.1|1431108_1431738_+	endolysin	NA	Q858F0	Salmonella_phage	76.9	1.8e-90
AVZ88826.1|1431734_1432235_+	DUF2514 domain-containing protein	NA	Q858E9	Salmonella_phage	76.9	1.3e-59
AVZ88827.1|1432421_1434284_-	phosphatase	NA	A0A2P0VMN7	Tetraselmis_virus	22.6	2.6e-07
>prophage 4
CP028548	Klebsiella pneumoniae subsp. pneumoniae strain SCKP020143 chromosome, complete genome	5492984	1763867	1770773	5492984		Planktothrix_phage(33.33%)	6	NA	NA
AVZ92580.1|1763867_1764731_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	27.5	5.7e-10
AVZ89113.1|1764741_1765515_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.7	3.9e-26
AVZ92581.1|1765756_1766650_-	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.8	6.1e-15
AVZ89114.1|1766895_1768257_-	U32 family peptidase	NA	Q6DW11	Phage_TP	94.8	1.8e-207
AVZ89115.1|1768575_1769298_-	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.2	8.3e-31
AVZ89116.1|1769294_1770773_-	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	28.3	8.5e-30
>prophage 5
CP028548	Klebsiella pneumoniae subsp. pneumoniae strain SCKP020143 chromosome, complete genome	5492984	1811508	1824154	5492984		Enterobacteria_phage(36.36%)	12	NA	NA
AVZ89143.1|1811508_1812915_+	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.7	3.6e-38
AVZ89144.1|1813138_1814203_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	54.7	4.4e-105
AVZ89145.1|1814216_1815086_+	glucose-1-phosphate thymidylyltransferase	NA	I7I009	Enterobacteria_phage	67.4	3.4e-111
AVZ89146.1|1815117_1816008_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	34.2	3.7e-28
AVZ89147.1|1816022_1816577_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	57.6	1.9e-51
AVZ89148.1|1816756_1817923_+	UDP-glucose 6-dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	54.7	7.0e-112
AVZ89149.1|1818871_1819876_-	NAD-dependent epimerase	NA	E3T4Y8	Cafeteria_roenbergensis_virus	29.2	4.0e-31
AVZ89150.1|1819831_1820113_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ89151.1|1820715_1821780_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	55.0	2.6e-105
AVZ89152.1|1821793_1822663_+	glucose-1-phosphate thymidylyltransferase	NA	I7I009	Enterobacteria_phage	67.0	5.7e-111
AVZ89153.1|1822694_1823585_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	34.2	3.7e-28
AVZ89154.1|1823599_1824154_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	57.6	1.9e-51
>prophage 6
CP028548	Klebsiella pneumoniae subsp. pneumoniae strain SCKP020143 chromosome, complete genome	5492984	2815288	2826176	5492984		Escherichia_phage(87.5%)	10	NA	NA
AVZ90080.1|2815288_2818396_+	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	59.6	0.0e+00
AVZ90081.1|2818450_2819716_+	MFS transporter	NA	NA	NA	NA	NA
AVZ90082.1|2819746_2820835_-	chromosome segregation protein SMC	NA	A0A077SLJ9	Escherichia_phage	100.0	8.0e-211
AVZ90083.1|2820921_2821182_-	hypothetical protein	NA	A0A077SK33	Escherichia_phage	97.7	3.5e-40
AVZ90084.1|2821479_2822340_+	class A broad-spectrum beta-lactamase SHV-11	NA	A0A077SL40	Escherichia_phage	99.3	2.2e-155
AVZ90085.1|2822360_2823122_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
AVZ90086.1|2823112_2823346_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ90087.1|2823383_2824286_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	99.7	2.6e-159
AVZ90088.1|2824297_2825563_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	99.3	1.9e-232
AVZ90089.1|2825555_2826176_+	aldolase	NA	A0A077SK32	Escherichia_phage	100.0	8.0e-115
>prophage 7
CP028548	Klebsiella pneumoniae subsp. pneumoniae strain SCKP020143 chromosome, complete genome	5492984	3043111	3116450	5492984	holin,transposase,integrase,plate,protease	Enterobacteria_phage(32.43%)	83	3045011:3045028	3124890:3124907
AVZ92629.1|3043111_3044452_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
AVZ90289.1|3044464_3046009_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
3045011:3045028	attL	ATCTTTCACCGCGCCGCC	NA	NA	NA	NA
AVZ90290.1|3046051_3046543_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
AVZ90291.1|3047012_3047993_+|transposase	IS5-like element ISKpn26 family transposase	transposase	Q38213	Escherichia_phage	99.1	8.9e-185
AVZ90292.1|3048031_3048205_-	ABC transporter	NA	NA	NA	NA	NA
AVZ90293.1|3048125_3049190_-	DUF4102 domain-containing protein	NA	A0A0M4QX09	Salmonella_phage	82.9	1.4e-175
AVZ90294.1|3049386_3049935_+|protease	protease	protease	NA	NA	NA	NA
AVZ90295.1|3050133_3051666_-	HD domain-containing protein	NA	A0A1B1ISR1	uncultured_Mediterranean_phage	30.0	1.1e-21
AVZ90296.1|3051882_3052644_-	3-oxoacyl-ACP reductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.5	2.4e-20
AVZ90297.1|3052752_3053667_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AVZ90298.1|3053967_3054156_+	cold-shock protein	NA	NA	NA	NA	NA
AVZ90299.1|3054226_3054535_-	anti-sigma regulatory factor	NA	NA	NA	NA	NA
AVZ90300.1|3054540_3054678_+	glycosyl hydrolase family 2	NA	NA	NA	NA	NA
AVZ90301.1|3054702_3055572_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	42.1	5.7e-50
AVZ90302.1|3055650_3056853_-	MFS transporter	NA	NA	NA	NA	NA
AVZ90303.1|3056925_3058062_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
AVZ90304.1|3058234_3059119_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AVZ90305.1|3059243_3060077_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ90306.1|3060307_3060694_+	glyoxalase	NA	NA	NA	NA	NA
AVZ90307.1|3060861_3062478_-	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AVZ90308.1|3062663_3063371_+	murein tripeptide amidase MpaA	NA	NA	NA	NA	NA
AVZ90309.1|3063367_3064333_-	L-Ala-D/L-Glu epimerase	NA	NA	NA	NA	NA
AVZ90310.1|3064435_3064942_+	thiol peroxidase	NA	NA	NA	NA	NA
AVZ92630.1|3065012_3066035_-	AbrB family transcriptional regulator	NA	NA	NA	NA	NA
AVZ90311.1|3066166_3067708_-	transcriptional regulator TyrR	NA	NA	NA	NA	NA
AVZ90312.1|3067880_3069194_-	6-phospho-beta-glucosidase	NA	NA	NA	NA	NA
AVZ90313.1|3069325_3070207_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AVZ90314.1|3070296_3071358_-	TIGR01620 family protein	NA	NA	NA	NA	NA
AVZ90315.1|3071354_3072752_-	YcjX family protein	NA	NA	NA	NA	NA
AVZ90316.1|3072854_3073073_-	phage shock protein D	NA	NA	NA	NA	NA
AVZ90317.1|3073101_3073461_-	envelope stress response membrane protein PspC	NA	NA	NA	NA	NA
AVZ90318.1|3073460_3073685_-	envelope stress response membrane protein PspB	NA	NA	NA	NA	NA
AVZ90319.1|3073740_3074409_-	phage shock protein PspA	NA	NA	NA	NA	NA
AVZ92631.1|3074576_3075551_+	phage shock protein operon transcriptional activator	NA	NA	NA	NA	NA
AVZ90320.1|3075541_3076933_-	MFS transporter	NA	NA	NA	NA	NA
AVZ90321.1|3076958_3078128_-	amidohydrolase	NA	NA	NA	NA	NA
AVZ90322.1|3078299_3080609_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AVZ90323.1|3080587_3081418_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AVZ90324.1|3081528_3082434_+	NAD-dependent dehydratase	NA	NA	NA	NA	NA
AVZ90325.1|3082767_3084411_+	peptide ABC transporter substrate-binding protein SapA	NA	NA	NA	NA	NA
AVZ90326.1|3084407_3085373_+	peptide ABC transporter permease SapB	NA	NA	NA	NA	NA
AVZ90327.1|3085577_3086249_+	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	59.6	4.5e-79
AVZ92632.1|3086435_3087263_+	FRG domain-containing protein	NA	A0A1S6KZX9	Salmonella_phage	30.2	8.4e-19
AVZ90328.1|3087338_3088604_-	translesion error-prone DNA polymerase V subunit UmuC	NA	I6RSM4	Salmonella_phage	82.7	9.6e-208
AVZ90329.1|3088605_3089025_-	translesion error-prone DNA polymerase V subunit UmuD	NA	A0A1W6JNS2	Morganella_phage	57.5	1.4e-35
AVZ90330.1|3089104_3090589_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
AVZ90331.1|3090588_3090840_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ90332.1|3091486_3091909_-	hypothetical protein	NA	K7P834	Enterobacteria_phage	45.3	3.6e-26
AVZ90333.1|3092501_3093206_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AVZ90334.1|3093821_3094169_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
AVZ92633.1|3094332_3095124_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA2	NA	NA	NA	NA	NA
AVZ90335.1|3095934_3096639_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AVZ90336.1|3096675_3096963_-	hypothetical protein	NA	A0A286N2Q7	Klebsiella_phage	95.4	4.4e-36
AVZ90337.1|3096959_3097499_-	hypothetical protein	NA	A0A286N2Q6	Klebsiella_phage	98.9	3.3e-101
AVZ90338.1|3097495_3097807_-|holin	holin	holin	A0A286N2Q5	Klebsiella_phage	100.0	3.8e-49
AVZ92634.1|3098444_3099134_-	antiterminator	NA	I6PDF8	Cronobacter_phage	53.1	2.1e-55
AVZ90339.1|3099133_3099274_-	YlcG family protein	NA	NA	NA	NA	NA
AVZ90340.1|3099270_3099909_-	hypothetical protein	NA	H6WRY9	Salmonella_phage	69.8	3.2e-74
AVZ90341.1|3099901_3100570_-	serine/threonine protein phosphatase	NA	K7P6H8	Enterobacteria_phage	78.7	1.4e-104
AVZ90342.1|3100566_3100734_-	NinE family protein	NA	K7P7K0	Enterobacteria_phage	62.5	4.6e-09
AVZ90343.1|3100714_3101182_-	recombination protein NinB	NA	Q8VNP6	Enterobacteria_phage	45.8	3.4e-33
AVZ90344.1|3101702_3102731_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ90345.1|3102938_3103184_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ90346.1|3103239_3103542_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
AVZ90347.1|3103538_3104387_-	ATP-binding protein	NA	K7PLU3	Enterobacteria_phage	60.1	5.1e-88
AVZ90348.1|3104383_3105244_-	replication protein	NA	K7PGT1	Enterobacteria_phage	53.3	1.0e-59
AVZ90349.1|3105329_3105551_-	transcriptional regulator	NA	G8EYH8	Enterobacteria_phage	41.7	6.9e-05
AVZ90350.1|3105591_3105819_-	transcriptional regulator	NA	Q76H55	Enterobacteria_phage	77.1	1.4e-24
AVZ92635.1|3105930_3106629_+	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	84.1	3.7e-108
AVZ92636.1|3106651_3106771_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ90351.1|3106916_3107993_+	ParA family protein	NA	H2BD62	Pseudomonas_phage	37.9	9.1e-58
AVZ90352.1|3108074_3108278_-	hypothetical protein	NA	A0A192Y6Q5	Salmonella_phage	71.6	3.9e-18
AVZ90353.1|3108706_3108901_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ90354.1|3108989_3109274_+	host nuclease inhibitor GamL	NA	G8C7T1	Escherichia_phage	79.8	1.1e-39
AVZ90355.1|3109289_3110135_+	phage recombination protein Bet	NA	A0A1I9KF88	Aeromonas_phage	59.2	1.8e-69
AVZ90356.1|3110420_3111101_+	exonuclease	NA	A0A0M3ULE0	Salmonella_phage	91.2	8.2e-121
AVZ90357.1|3111097_3111526_+	regulator	NA	M9NYX4	Enterobacteria_phage	80.3	7.5e-64
AVZ90358.1|3111522_3112185_+	DNA methyltransferase	NA	G8C7S6	Escherichia_phage	84.6	2.7e-105
AVZ90359.1|3112181_3112496_+	hypothetical protein	NA	K7PM28	Enterobacteria_phage	50.8	1.6e-10
AVZ92637.1|3112392_3113580_-|integrase	site-specific integrase	integrase	K7PGY1	Enterobacteria_phage	52.4	1.1e-120
AVZ90360.1|3113756_3114647_+	peptide ABC transporter permease SapC	NA	NA	NA	NA	NA
AVZ90361.1|3114646_3115639_+	peptide ABC transporter ATP-binding protein SapD	NA	G9BWD6	Planktothrix_phage	27.2	3.0e-07
AVZ90362.1|3115640_3116450_+	peptide ABC transporter ATP-binding protein SapF	NA	A0A2H4PQG7	Staphylococcus_phage	28.9	2.1e-14
3124890:3124907	attR	ATCTTTCACCGCGCCGCC	NA	NA	NA	NA
>prophage 8
CP028548	Klebsiella pneumoniae subsp. pneumoniae strain SCKP020143 chromosome, complete genome	5492984	3244122	3333201	5492984	portal,holin,terminase,capsid,head,integrase,tRNA,transposase,tail	Klebsiella_phage(44.44%)	98	3270925:3270939	3331012:3331026
AVZ90483.1|3244122_3244623_+|tRNA	YbaK/prolyl-tRNA synthetase associated domain-containing protein	tRNA	NA	NA	NA	NA
AVZ90484.1|3244739_3245186_+	DUF441 domain-containing protein	NA	NA	NA	NA	NA
AVZ92641.1|3245169_3245961_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AVZ90485.1|3246062_3247247_+	cyanate MFS transporter	NA	NA	NA	NA	NA
AVZ90486.1|3247278_3247971_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ90487.1|3248116_3248626_+	DUF523 domain-containing protein	NA	NA	NA	NA	NA
AVZ90488.1|3248612_3248969_+	DUF488 domain-containing protein	NA	NA	NA	NA	NA
AVZ90489.1|3248958_3249198_-	DUF333 domain-containing protein	NA	NA	NA	NA	NA
AVZ90490.1|3249498_3250512_+	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	29.0	1.4e-12
AVZ90491.1|3250569_3250671_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ92642.1|3250670_3250745_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ90492.1|3250862_3250988_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ90493.1|3251047_3251311_-	DUF2534 domain-containing protein	NA	NA	NA	NA	NA
AVZ90494.1|3251441_3252080_-	leucine efflux protein	NA	NA	NA	NA	NA
AVZ90495.1|3252169_3253084_-	kdo(2)-lipid IV(A) palmitoleoyltransferase	NA	A0A1W6JP29	Morganella_phage	50.4	1.1e-72
AVZ90496.1|3253299_3253491_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ90497.1|3253745_3254789_-	type II asparaginase	NA	NA	NA	NA	NA
AVZ90498.1|3255091_3256300_+	phosphodiesterase	NA	NA	NA	NA	NA
AVZ90499.1|3256373_3258158_+	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	36.1	5.8e-17
AVZ90500.1|3258164_3259055_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AVZ90501.1|3259175_3260684_+	3,4-dihydroxybenzoate decarboxylase	NA	NA	NA	NA	NA
AVZ90502.1|3260994_3261681_-	diguanylate phosphodiesterase	NA	NA	NA	NA	NA
AVZ90503.1|3262078_3262258_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ90504.1|3262297_3262930_-	DNA-binding protein	NA	NA	NA	NA	NA
AVZ90505.1|3263496_3263694_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ90506.1|3263809_3264820_-	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
AVZ90507.1|3264816_3266223_-	cytochrome ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
AVZ90508.1|3266278_3267166_-	manganese catalase family protein	NA	NA	NA	NA	NA
AVZ90509.1|3267182_3267689_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
AVZ90510.1|3267715_3268210_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
AVZ90511.1|3268300_3268486_-	stress-induced acidophilic repeat motif-containing protein	NA	NA	NA	NA	NA
AVZ90512.1|3269107_3270301_+	glutathione-dependent formaldehyde dehydrogenase	NA	NA	NA	NA	NA
AVZ90513.1|3270413_3270641_+	DUF1272 domain-containing protein	NA	NA	NA	NA	NA
3270925:3270939	attL	TGGCTGGCGTTCTTT	NA	NA	NA	NA
AVZ90514.1|3271077_3271401_+	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
AVZ90515.1|3271393_3271786_+	amino acid-binding protein	NA	NA	NA	NA	NA
AVZ90516.1|3271782_3272496_+	ArsR family transcriptional regulator	NA	NA	NA	NA	NA
AVZ90517.1|3272768_3272921_-	isocitrate dehydrogenase	NA	Q77Z09	Phage_21	92.0	3.8e-18
AVZ90518.1|3273075_3274572_-|tail	phage tail protein	tail	A0A0P0IDN1	Klebsiella_phage	63.7	1.4e-125
AVZ90519.1|3274640_3287345_-	DUF1983 domain-containing protein	NA	Q6UAW1	Klebsiella_phage	47.1	0.0e+00
AVZ90520.1|3287407_3288001_-|tail	tail assembly protein	tail	K7PHE5	Enterobacteria_phage	76.6	8.0e-80
AVZ90521.1|3288027_3288450_-	hypothetical protein	NA	J9Q806	Salmonella_phage	50.0	5.9e-29
AVZ90522.1|3288491_3289202_-	peptidase P60	NA	Q6UAW4	Klebsiella_phage	90.3	1.9e-136
AVZ90523.1|3289203_3289959_-|tail	phage minor tail protein L	tail	Q6UAW5	Klebsiella_phage	80.5	4.6e-125
AVZ90524.1|3289955_3290294_-|tail	phage tail protein	tail	Q6UAW6	Klebsiella_phage	88.4	1.4e-57
AVZ90525.1|3290293_3293629_-|tail	phage tail tape measure protein	tail	Q6UAW7	Klebsiella_phage	88.3	0.0e+00
AVZ90526.1|3293628_3293847_-	hypothetical protein	NA	Q6UAW9	Klebsiella_phage	90.5	5.4e-34
AVZ90527.1|3293861_3294227_-|tail	phage tail protein	tail	Q6UAW8	Klebsiella_phage	89.3	1.6e-51
AVZ90528.1|3294284_3294746_-|tail	phage tail protein	tail	Q6UAX0	Klebsiella_phage	83.7	7.8e-67
AVZ90529.1|3294777_3295179_-	hypothetical protein	NA	Q6UAX1	Klebsiella_phage	94.0	2.3e-62
AVZ90530.1|3295175_3295565_-	hypothetical protein	NA	Q6UAX2	Klebsiella_phage	86.0	9.6e-58
AVZ90531.1|3295545_3295884_-|head,tail	head-tail adaptor protein	head,tail	Q6UAX3	Klebsiella_phage	90.2	2.8e-53
AVZ90532.1|3295880_3296198_-|head,tail	phage gp6-like head-tail connector protein	head,tail	Q6UAX4	Klebsiella_phage	89.8	1.5e-45
AVZ90533.1|3296178_3296439_-	hypothetical protein	NA	Q6UAX5	Klebsiella_phage	60.5	7.4e-22
AVZ90534.1|3296497_3297784_-|capsid	phage major capsid protein	capsid	Q6UAX6	Klebsiella_phage	89.0	9.8e-216
AVZ90535.1|3297861_3298782_-	S49 family peptidase	NA	Q6UAX7	Klebsiella_phage	88.2	9.6e-149
AVZ90536.1|3298818_3300078_-|portal	phage portal protein	portal	Q6UAX8	Klebsiella_phage	89.8	1.8e-222
AVZ90537.1|3300077_3300257_-	hypothetical protein	NA	Q6UAX9	Klebsiella_phage	57.6	3.1e-11
AVZ90538.1|3300250_3301972_-|terminase	terminase large subunit	terminase	Q7Y413	Yersinia_phage	57.4	1.5e-190
AVZ90539.1|3301971_3302406_-|terminase	phage terminase small subunit P27 family	terminase	A0A1J0GV10	Halomonas_phage	61.9	9.4e-30
AVZ90540.1|3302654_3303086_-	hypothetical protein	NA	Q6UAS0	Klebsiella_phage	61.6	1.8e-41
AVZ90541.1|3303082_3303406_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ90542.1|3303357_3303720_-	HNH endonuclease	NA	Q6UAS2	Klebsiella_phage	83.3	1.2e-57
AVZ90543.1|3304046_3304271_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ90544.1|3304309_3304747_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ90545.1|3305696_3306047_-	hypothetical protein	NA	R9TPM9	Aeromonas_phage	38.1	7.9e-11
AVZ90546.1|3306043_3306541_-	lysozyme	NA	A0A1V0E5Q7	Salmonella_phage	84.6	1.1e-77
AVZ90547.1|3306540_3306756_-|holin	holin	holin	A5LH82	Enterobacteria_phage	88.7	2.7e-30
AVZ90548.1|3307078_3308059_+|transposase	IS5-like element ISKpn26 family transposase	transposase	Q38213	Escherichia_phage	99.1	8.9e-185
AVZ90549.1|3308097_3308223_-	ABC transporter	NA	NA	NA	NA	NA
AVZ90550.1|3310207_3310810_-	hypothetical protein	NA	H9C175	Pectobacterium_phage	68.6	1.1e-76
AVZ90551.1|3310826_3311858_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	49.6	4.7e-96
AVZ90552.1|3311857_3312061_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ90553.1|3312057_3312450_-	DNA-binding protein	NA	K7PHB4	Enterobacterial_phage	36.6	8.0e-12
AVZ90554.1|3312490_3312781_-	hypothetical protein	NA	H6WRY6	Salmonella_phage	56.9	8.0e-17
AVZ90555.1|3312792_3313026_-	DinI family protein	NA	K7PM44	Enterobacteria_phage	71.1	3.7e-25
AVZ90556.1|3313104_3314589_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
AVZ90557.1|3314588_3314840_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ90558.1|3315429_3316791_-	dGTPase	NA	NA	NA	NA	NA
AVZ90559.1|3316964_3317678_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ92643.1|3318029_3318899_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ90560.1|3318987_3320379_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ90561.1|3320727_3321168_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ90562.1|3321181_3321646_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	72.2	4.1e-63
AVZ92644.1|3321638_3322643_-	DNA-binding protein	NA	A0A0U2RT81	Escherichia_phage	40.0	1.0e-31
AVZ90563.1|3322702_3323257_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ90564.1|3323259_3323484_-	Cro/Cl family transcriptional regulator	NA	H6WRX5	Salmonella_phage	62.5	1.3e-19
AVZ90565.1|3323572_3324010_+	helix-turn-helix domain-containing protein	NA	H6WRX4	Salmonella_phage	62.2	1.3e-39
AVZ90566.1|3324331_3324646_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ90567.1|3324808_3325027_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ90568.1|3325036_3325231_+	DUF1482 domain-containing protein	NA	NA	NA	NA	NA
AVZ90569.1|3325273_3325618_+	transcriptional regulator	NA	NA	NA	NA	NA
AVZ90570.1|3325759_3327898_+	exonuclease	NA	S4TNL0	Salmonella_phage	42.7	5.6e-99
AVZ90571.1|3327950_3328196_+	excisionase	NA	NA	NA	NA	NA
AVZ90572.1|3328176_3329304_+|integrase	integrase	integrase	O21925	Phage_21	58.4	4.4e-119
AVZ90573.1|3329421_3330672_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	92.6	1.1e-19
AVZ90574.1|3330912_3331563_+	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
3331012:3331026	attR	AAAGAACGCCAGCCA	NA	NA	NA	NA
AVZ90575.1|3331579_3332038_+	NUDIX hydrolase	NA	NA	NA	NA	NA
AVZ92645.1|3332094_3333201_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
>prophage 9
CP028548	Klebsiella pneumoniae subsp. pneumoniae strain SCKP020143 chromosome, complete genome	5492984	3549180	3642131	5492984	portal,capsid,head,integrase,tRNA,tail,plate,lysis,protease	Salmonella_phage(56.9%)	97	3604706:3604724	3642206:3642224
AVZ90770.1|3549180_3550473_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	44.7	7.3e-94
AVZ90771.1|3550563_3551907_-	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	40.8	7.3e-81
AVZ90772.1|3551915_3552527_-	outer membrane lipoprotein carrier protein LolA	NA	NA	NA	NA	NA
AVZ90773.1|3552649_3556903_-	DNA translocase FtsK	NA	S5VNE3	Mycobacterium_phage	49.2	5.2e-88
AVZ90774.1|3557038_3557533_-	leucine-responsive regulatory protein	NA	NA	NA	NA	NA
AVZ90775.1|3558065_3559034_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.0	3.2e-62
AVZ90776.1|3559148_3560915_+	thiol reductant ABC exporter subunit CydD	NA	W8CYL7	Bacillus_phage	25.9	2.3e-21
AVZ90777.1|3560915_3562637_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	34.3	1.5e-14
AVZ90778.1|3562681_3563383_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
AVZ90779.1|3563736_3563955_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
AVZ90780.1|3564075_3566355_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.0	1.6e-165
AVZ90781.1|3566385_3566703_-|protease	ATP-dependent Clp protease adaptor ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	2.0e-13
AVZ90782.1|3567028_3567250_+	cold shock domain protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	1.3e-16
AVZ90783.1|3567204_3567387_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ90784.1|3567326_3569267_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.5	1.9e-37
AVZ90785.1|3569263_3570379_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	52.7	1.3e-06
AVZ90786.1|3570525_3572184_-	ATP-dependent endonuclease	NA	NA	NA	NA	NA
AVZ90787.1|3572603_3573299_+	aquaporin Z	NA	NA	NA	NA	NA
AVZ90788.1|3573414_3574314_+	lysine exporter LysO family protein	NA	NA	NA	NA	NA
AVZ92654.1|3574457_3576110_+	hydroxylamine reductase	NA	NA	NA	NA	NA
AVZ90789.1|3576120_3577089_+	NADH oxidoreductase	NA	NA	NA	NA	NA
AVZ90790.1|3577039_3577243_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ90791.1|3577300_3577735_-	DoxX family protein	NA	NA	NA	NA	NA
AVZ92655.1|3577886_3579605_+	ubiquinone-dependent pyruvate dehydrogenase	NA	NA	NA	NA	NA
AVZ90792.1|3579643_3580645_+	low-specificity L-threonine aldolase	NA	NA	NA	NA	NA
AVZ90793.1|3580655_3582098_+	DUF2867 domain-containing protein	NA	NA	NA	NA	NA
AVZ90794.1|3582185_3583199_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
AVZ90795.1|3583195_3584026_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1B0UZW5	Roseobacter_phage	31.6	4.1e-05
AVZ90796.1|3584057_3585197_-	GGDEF domain-containing protein	NA	NA	NA	NA	NA
AVZ90797.1|3585249_3585429_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ90798.1|3586074_3586590_+	lipoprotein	NA	NA	NA	NA	NA
AVZ90799.1|3586816_3587545_+	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	37.1	1.2e-29
AVZ92656.1|3587565_3588297_+	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AVZ90800.1|3588303_3589020_+	arginine ABC transporter permease ArtQ	NA	NA	NA	NA	NA
AVZ90801.1|3589019_3589688_+	arginine ABC transporter permease ArtM	NA	NA	NA	NA	NA
AVZ90802.1|3589871_3590603_+	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AVZ90803.1|3590645_3592118_-	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	31.8	7.9e-28
AVZ90804.1|3592114_3592831_-	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	36.9	2.1e-34
AVZ90805.1|3592909_3594037_-	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A2K5B251	Erysipelothrix_phage	25.6	1.3e-19
AVZ90806.1|3594078_3594567_-	DUF2593 domain-containing protein	NA	NA	NA	NA	NA
AVZ90807.1|3594624_3595470_-	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
AVZ90808.1|3595466_3596420_-	putrescine ABC transporter permease	NA	NA	NA	NA	NA
AVZ92657.1|3596430_3597564_-	polyamine ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	34.9	2.2e-30
AVZ90809.1|3597727_3598840_-	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
AVZ90810.1|3599188_3599668_-	YbjN domain-containing protein	NA	NA	NA	NA	NA
AVZ90811.1|3599756_3600659_-	30S ribosomal protein S6--L-glutamate ligase	NA	A0A1D7SR78	Cyanophage	35.3	2.0e-34
AVZ90812.1|3601480_3601768_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ90813.1|3601970_3602234_+	GrxA family glutaredoxin	NA	A0A2I7SAE2	Vibrio_phage	73.1	1.6e-27
AVZ90814.1|3602240_3602624_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ92658.1|3602890_3604576_+	transporter	NA	NA	NA	NA	NA
3604706:3604724	attL	ATGGGTTTTTTGTTGCCTG	NA	NA	NA	NA
AVZ90815.1|3604795_3605014_-	transcriptional regulator	NA	Q53ZE7	Salmonella_virus	69.0	7.5e-20
AVZ90816.1|3605105_3606206_-	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	87.4	4.9e-176
AVZ90817.1|3606202_3606688_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	75.6	7.2e-63
AVZ90818.1|3606684_3609312_-|tail	phage tail tape measure protein	tail	E5FFG5	Burkholderia_phage	42.0	5.6e-117
AVZ90819.1|3609304_3609424_-|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.2e-13
AVZ90820.1|3609438_3609738_-|tail	phage tail assembly protein	tail	E5G6P9	Salmonella_phage	79.0	3.7e-33
AVZ90821.1|3609790_3610306_-|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	85.4	1.3e-81
AVZ90822.1|3610315_3611488_-|tail	phage tail protein	tail	A0A1S6KZY7	Salmonella_phage	93.3	1.9e-210
AVZ90823.1|3611626_3612703_-|tail	phage tail protein	tail	Q37842	Escherichia_phage	44.8	1.2e-25
AVZ90824.1|3612732_3612936_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ90825.1|3612932_3613664_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ90826.1|3613667_3616619_-	hypothetical protein	NA	A0A2H4N7A3	Pectobacterium_phage	50.9	1.2e-06
AVZ90827.1|3616620_3617220_-|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	60.5	1.3e-58
AVZ90828.1|3617212_3618121_-|plate	baseplate assembly protein	plate	E5G6N8	Salmonella_phage	66.9	7.6e-106
AVZ90829.1|3618107_3618470_-|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	83.9	4.9e-48
AVZ90830.1|3618466_3619039_-|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	72.3	4.7e-77
AVZ90831.1|3619133_3619826_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ90832.1|3619822_3620269_-	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	71.2	2.2e-50
AVZ90833.1|3620261_3620693_-|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	82.5	9.9e-64
AVZ90834.1|3620788_3621217_-|lysis	LysB family phage lysis regulatory protein	lysis	A0A1S6KZX8	Salmonella_phage	77.9	9.6e-51
AVZ90835.1|3621213_3621597_-	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	42.0	2.1e-17
AVZ90836.1|3621601_3622111_-	lysozyme	NA	E5G6N1	Salmonella_phage	83.4	2.1e-81
AVZ90837.1|3622091_3622307_-	hypothetical protein	NA	E5G6N0	Salmonella_phage	90.1	3.6e-30
AVZ90838.1|3622310_3622514_-|tail	phage tail protein	tail	A0A1S6KZY4	Salmonella_phage	88.1	1.3e-29
AVZ90839.1|3622513_3622978_-|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	89.0	8.4e-77
AVZ90840.1|3623073_3623724_-	hypothetical protein	NA	E5G6M7	Salmonella_phage	96.3	8.7e-112
AVZ90841.1|3623727_3624786_-|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	93.1	1.1e-180
AVZ90842.1|3624802_3625636_-|capsid	capsid protein	capsid	A0A1S6KZW9	Salmonella_phage	88.8	6.3e-123
AVZ90843.1|3625778_3627545_+	oxidoreductase	NA	A0A1S6KZW3	Salmonella_phage	99.0	0.0e+00
AVZ90844.1|3627544_3628570_+|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	86.7	7.6e-171
AVZ90845.1|3628631_3630374_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ90846.1|3630649_3631327_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ90847.1|3631441_3631747_-	DinI family protein	NA	E5G6M1	Salmonella_phage	100.0	4.7e-36
AVZ92659.1|3631685_3631874_-	hypothetical protein	NA	E5G6M0	Salmonella_phage	98.4	5.5e-27
AVZ90848.1|3632027_3634442_-	replication endonuclease	NA	E5G6L9	Salmonella_phage	97.5	0.0e+00
AVZ90849.1|3634438_3635296_-	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	95.4	2.0e-156
AVZ90850.1|3635292_3635520_-	hypothetical protein	NA	E5G6L7	Salmonella_phage	98.7	6.0e-36
AVZ90851.1|3635519_3635753_-	DUF2732 domain-containing protein	NA	E5G6L6	Salmonella_phage	96.1	4.1e-32
AVZ90852.1|3635820_3636162_-	hypothetical protein	NA	E5G6L5	Salmonella_phage	99.1	4.6e-56
AVZ90853.1|3636125_3636326_-	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	97.0	1.6e-32
AVZ90854.1|3636333_3636843_-	hypothetical protein	NA	E5G6L3	Salmonella_phage	98.8	5.8e-87
AVZ90855.1|3636875_3637097_-	regulator	NA	NA	NA	NA	NA
AVZ90856.1|3637242_3638121_+	Repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	39.9	1.7e-30
AVZ90857.1|3638132_3639077_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ90858.1|3639175_3640660_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
AVZ90859.1|3640659_3640911_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ90860.1|3641078_3642131_+|integrase	integrase	integrase	A0A218M4I3	Erwinia_phage	57.0	1.0e-106
3642206:3642224	attR	ATGGGTTTTTTGTTGCCTG	NA	NA	NA	NA
>prophage 10
CP028548	Klebsiella pneumoniae subsp. pneumoniae strain SCKP020143 chromosome, complete genome	5492984	4294581	4306234	5492984	integrase	Enterobacteria_phage(70.0%)	13	4295031:4295045	4318087:4318101
AVZ91446.1|4294581_4295685_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.5	4.8e-62
4295031:4295045	attL	CAATCTCTCCGCGCT	NA	NA	NA	NA
AVZ91447.1|4295695_4296949_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	44.9	8.9e-89
AVZ91448.1|4297301_4298492_+|integrase	integrase	integrase	Q7M297	Enterobacteria_phage	62.7	6.4e-145
AVZ91449.1|4298479_4299430_+	cobyrinic acid a,c-diamide synthase	NA	A0A1X9IGI7	Lactococcus_phage	27.1	1.2e-13
AVZ91450.1|4299429_4299855_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ91451.1|4300422_4300989_-	Polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	63.8	9.7e-59
AVZ91452.1|4301006_4301252_-	hypothetical protein	NA	Q7M294	Enterobacteria_phage	56.8	5.5e-19
AVZ91453.1|4301248_4301986_-	glycoprotein 3	NA	Q7M2A2	Enterobacteria_phage	59.4	1.9e-70
AVZ91454.1|4302527_4302794_+	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	71.6	2.6e-30
AVZ91455.1|4302790_4303348_+	host cell division inhibitor Icd-like protein	NA	Q7M2A7	Enterobacteria_phage	70.4	1.8e-33
AVZ91456.1|4303344_4303572_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ91457.1|4303568_4303889_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ91458.1|4303900_4306234_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	82.2	0.0e+00
4318087:4318101	attR	CAATCTCTCCGCGCT	NA	NA	NA	NA
>prophage 11
CP028548	Klebsiella pneumoniae subsp. pneumoniae strain SCKP020143 chromosome, complete genome	5492984	4962197	5000253	5492984	transposase,integrase	Salmonella_phage(16.67%)	38	4952389:4952404	4981608:4981623
4952389:4952404	attL	CCTGGCCGGTGGCGTG	NA	NA	NA	NA
AVZ92050.1|4962197_4965083_-|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	39.9	1.1e-190
AVZ92051.1|4965785_4966550_-|transposase	IS6 family transposase IS6100	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
AVZ92052.1|4966637_4966751_+	NTP-binding protein	NA	NA	NA	NA	NA
AVZ92053.1|4967056_4967557_-	N-acetyltransferase	NA	NA	NA	NA	NA
AVZ92054.1|4967575_4967755_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ92055.1|4967684_4968524_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	NA	NA	NA	NA
AVZ92056.1|4968517_4968865_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
AVZ92057.1|4969028_4969820_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA2	NA	NA	NA	NA	NA
AVZ92720.1|4969912_4971172_-	chloramphenicol efflux MFS transporter CmlA10	NA	S4TR35	Salmonella_phage	31.3	1.1e-25
AVZ92058.1|4971426_4971960_-	aminoglycoside nucleotidyltransferase ANT(2'')-Ia	NA	NA	NA	NA	NA
AVZ92059.1|4972033_4972366_-	quaternary ammonium compound efflux SMR transporter QacL	NA	E5E3Y9	Acinetobacter_phage	34.3	3.5e-08
AVZ92060.1|4972616_4973576_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	40.5	1.7e-47
AVZ92061.1|4973466_4974171_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AVZ92062.1|4974161_4974359_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ92063.1|4974399_4975203_+	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	Q75ZG1	Hepacivirus	34.3	4.9e-24
AVZ92064.1|4975202_4976039_+	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
AVZ92065.1|4976162_4976528_-	DUF3742 domain-containing protein	NA	NA	NA	NA	NA
AVZ92066.1|4976612_4977245_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ92067.1|4977257_4977884_-|integrase	integrase	integrase	NA	NA	NA	NA
AVZ92068.1|4978203_4980048_+	relaxase	NA	NA	NA	NA	NA
AVZ92069.1|4980128_4982780_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	33.9	5.2e-155
4981608:4981623	attR	CACGCCACCGGCCAGG	NA	NA	NA	NA
AVZ92070.1|4982805_4984671_-	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	37.1	3.4e-52
AVZ92071.1|4984731_4986045_-	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	40.2	1.3e-77
AVZ92072.1|4986096_4987404_-	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
AVZ92073.1|4987422_4988253_-	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
AVZ92074.1|4988311_4989646_-	DUF3422 domain-containing protein	NA	NA	NA	NA	NA
AVZ92075.1|4989828_4990227_-	VOC family protein	NA	NA	NA	NA	NA
AVZ92076.1|4990270_4991380_-	S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase	NA	E3SJ82	Synechococcus_phage	30.4	2.9e-35
AVZ92077.1|4991439_4991715_-	regulator	NA	NA	NA	NA	NA
AVZ92078.1|4991997_4992888_-	nitrilase	NA	NA	NA	NA	NA
AVZ92079.1|4992884_4993493_-	GNAT family acetyltransferase	NA	NA	NA	NA	NA
AVZ92080.1|4993494_4993902_-	isopropylmalate/homocitrate/citramalate synthase	NA	NA	NA	NA	NA
AVZ92081.1|4994056_4994962_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AVZ92082.1|4995112_4997089_-	excinuclease ABC subunit UvrB	NA	NA	NA	NA	NA
AVZ92083.1|4997302_4997521_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ92721.1|4997464_4997896_-	DUF488 domain-containing protein	NA	NA	NA	NA	NA
AVZ92084.1|4998303_4998642_+	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
AVZ92085.1|4998702_5000253_+|transposase	IS66 family transposase	transposase	A0A218MNE7	uncultured_virus	42.0	4.5e-90
>prophage 1
CP028543	Klebsiella pneumoniae subsp. pneumoniae strain SCKP020143 plasmid p1_020143, complete sequence	159355	4961	66699	159355	protease,transposase,holin	uncultured_Caudovirales_phage(29.41%)	55	NA	NA
AVZ87058.1|4961_5885_+|transposase	IS5/IS1182 family transposase	transposase	Q9MCT5	Escherichia_phage	98.4	2.1e-175
AVZ87059.1|6557_6815_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ87060.1|7434_8871_+	diguanylate cyclase	NA	NA	NA	NA	NA
AVZ87061.1|9853_11131_-	DUF2254 domain-containing protein	NA	NA	NA	NA	NA
AVZ87062.1|11193_13197_-|holin	high-affinity choline transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	25.9	9.7e-21
AVZ87199.1|14230_15438_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	63.2	1.7e-100
AVZ87063.1|16866_17298_-	silver-binding protein SilE	NA	NA	NA	NA	NA
AVZ87064.1|17548_19024_-	Cu(+)/Ag(+) sensor histidine kinase	NA	W8CYF6	Bacillus_phage	30.1	1.0e-27
AVZ87065.1|19016_19697_-	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	35.6	2.1e-31
AVZ87066.1|19886_21272_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ87067.1|21300_21654_+	copper ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AVZ87068.1|21767_23060_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
AVZ87069.1|23070_26217_+	CusA/CzcA family heavy metal efflux RND transporter	NA	S5VTK5	Leptospira_phage	22.5	4.0e-61
AVZ87070.1|26303_26744_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ87071.1|26870_29318_+	copper-translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	35.8	7.6e-84
AVZ87072.1|29358_29556_+	DUF2933 domain-containing protein	NA	NA	NA	NA	NA
AVZ87073.1|29589_30327_-	peptidase M23	NA	A0A2H4JAF5	uncultured_Caudovirales_phage	32.5	1.2e-11
AVZ87074.1|30615_31065_-	copper resistance protein	NA	NA	NA	NA	NA
AVZ87075.1|31298_33116_+	multicopper oxidase PcoA	NA	NA	NA	NA	NA
AVZ87076.1|33115_34012_+	copper resistance protein B	NA	NA	NA	NA	NA
AVZ87077.1|34051_34432_+	copper resistance system chaperone PcoC	NA	NA	NA	NA	NA
AVZ87078.1|34436_35366_+	copper resistance protein D	NA	NA	NA	NA	NA
AVZ87079.1|35420_36101_+	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	34.4	8.7e-30
AVZ87080.1|36097_37498_+	sensor histidine kinase	NA	W8CYF6	Bacillus_phage	26.3	4.1e-18
AVZ87081.1|37714_38149_+	copper-binding protein	NA	NA	NA	NA	NA
AVZ87200.1|38380_38560_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
AVZ87082.1|40302_40812_+	porin	NA	NA	NA	NA	NA
AVZ87083.1|40861_41359_-	N-acetyltransferase	NA	NA	NA	NA	NA
AVZ87084.1|41690_42017_+	transcriptional regulator	NA	NA	NA	NA	NA
AVZ87201.1|42016_42727_+	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	77.0	2.9e-92
AVZ87085.1|42735_43281_+	RNA polymerase subunit sigma-70	NA	NA	NA	NA	NA
AVZ87086.1|43356_43719_+	arsenical resistance operon transcriptional repressor ArsD	NA	NA	NA	NA	NA
AVZ87087.1|45615_46152_+	N-acetyltransferase	NA	NA	NA	NA	NA
AVZ87088.1|46184_46610_-	arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	72.9	2.3e-52
AVZ87089.1|46622_47912_-	arsenical efflux pump membrane protein ArsB	NA	A0A2H4J144	uncultured_Caudovirales_phage	74.0	1.9e-171
AVZ87090.1|47959_49711_-	arsenical pump-driving ATPase	NA	NA	NA	NA	NA
AVZ87091.1|49728_50091_-	arsenical resistance operon transcriptional repressor ArsD	NA	NA	NA	NA	NA
AVZ87092.1|50140_50491_-	transcriptional regulator	NA	A0A2H4J145	uncultured_Caudovirales_phage	50.9	1.4e-23
AVZ87093.1|50848_51118_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ87094.1|51105_51681_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ87095.1|51711_52206_+	DNA-binding protein	NA	NA	NA	NA	NA
AVZ87096.1|52249_52618_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ87097.1|52651_52855_+	hemolysin expression modulator Hha	NA	NA	NA	NA	NA
AVZ87098.1|52903_53161_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ87099.1|53236_53491_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ87100.1|53666_53933_+	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
AVZ87101.1|53920_54403_+	N-acetyltransferase	NA	NA	NA	NA	NA
AVZ87202.1|54614_55961_+|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
AVZ87102.1|57803_58766_-|protease	Zn-dependent protease	protease	NA	NA	NA	NA
AVZ87103.1|58752_59502_-	diguanylate cyclase	NA	NA	NA	NA	NA
AVZ87104.1|59739_59937_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ87105.1|59936_62732_-	heat shock survival AAA family ATPase ClpK	NA	K4FB40	Cronobacter_phage	41.0	5.2e-129
AVZ87106.1|62846_63416_-	Hsp20/alpha crystallin family protein	NA	NA	NA	NA	NA
AVZ87203.1|63450_63732_-	DNA-binding protein	NA	A0A1B1IUF9	uncultured_Mediterranean_phage	38.2	5.2e-05
AVZ87107.1|65718_66699_+|transposase	IS5-like element ISKpn26 family transposase	transposase	Q38213	Escherichia_phage	99.1	8.9e-185
>prophage 2
CP028543	Klebsiella pneumoniae subsp. pneumoniae strain SCKP020143 plasmid p1_020143, complete sequence	159355	73168	106162	159355	integrase,transposase,bacteriocin	Escherichia_phage(45.45%)	34	83068:83127	90960:91779
AVZ87112.1|73168_73873_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
AVZ87113.1|75207_76212_+|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
AVZ87114.1|76503_77172_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	99.5	1.9e-130
AVZ87115.1|77891_78137_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ87116.1|78142_78334_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ87117.1|78815_79358_-	tunicamycin resistance protein	NA	NA	NA	NA	NA
AVZ87118.1|79370_80231_-	aminoglycoside N-acetyltransferase AAC(3)-IId	NA	NA	NA	NA	NA
AVZ87119.1|81054_82425_-|transposase	IS1182 family transposase ISCfr1	transposase	NA	NA	NA	NA
83068:83127	attL	GGCACTGTTGCAAATAGTCGGTGGTGATAAACTTATCATCCCCTTTTGCTGATGGAGCTG	NA	NA	NA	NA
AVZ87120.1|83130_83835_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AVZ87121.1|83780_84098_-|transposase	transposase	transposase	NA	NA	NA	NA
AVZ87122.1|84036_85050_-|integrase	integron integrase	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
AVZ87123.1|85194_85692_+	trimethoprim-resistant dihydrofolate reductase DfrA12	NA	A0A0A0PL85	Bacillus_phage	40.9	7.5e-23
AVZ87124.1|85803_86094_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ87125.1|86099_86891_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA2	NA	NA	NA	NA	NA
AVZ87126.1|87054_87402_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
AVZ87127.1|87395_88235_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
AVZ87128.1|88164_88344_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ87129.1|88362_88863_+	N-acetyltransferase	NA	NA	NA	NA	NA
AVZ87130.1|89168_89282_-	NTP-binding protein	NA	NA	NA	NA	NA
AVZ87131.1|89369_90134_+|transposase	IS6 family transposase IS6100	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
AVZ87132.1|90474_91011_+	recombinase family protein	NA	E5FFF9	Burkholderia_phage	60.6	6.8e-46
AVZ87133.1|91022_91727_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AVZ87134.1|91793_93191_+	HAMP domain-containing protein	NA	A0A1B0V854	Salmonella_phage	99.2	1.1e-58
90960:91779	attR	GGCACTGTTGCAAATAGTCGGTGGTGATAAACTTATCATCCCCTTTTGCTGATGGAGCTGCACATGAACCCATTCAAAGGCCGGCATTTTCAGCGTGACATCATTCTGTGGGCCGTACGCTGGTACTGCAAATACGGCATCAGTTACCGTGAGCTGCAGGAGATGCTGGCTGAACGCGGAGTGAATGTCGATCACTCCACGATTTACCGCTGGGTTCAGCGTTATGCGCCTGAAATGGAAAAACGGCTGCGCTGGTACTGGCGTAACCCTTCCGATCTTTGCCCGTGGCACATGGATGAAACCTACGTGAAGGTCAATGGCCGCTGGGCGTATCTGTACCGGGCCGTCGACAGCCGGGGCCGCACTGTCGATTTTTATCTCTCCTCCCGTCGTAACAGCAAAGCTGCATACCGGTTTCTGGGTAAAATCCTCAACAACGTGAAGAAGTGGCAGATCCCGCGATTCATCAACACGGATAAAGCGCCCGCCTATGGTCGCGCGCTTGCTCTGCTCAAACGCGAAGGCCGGTGCCCGTCTGACGTTGAACACCGACAGATTAAGTACCGGAACAACGTGATTGAATGCGATCATGGCAAACTGAAACGGATAATCGGCGCCACGCTGGGATTTAAATCCATGAAGACGGCTTACGCCACCATCAAAGGTATTGAGGTGATGCGTGCACTACGCAAAGGCCAGGCCTCAGCATTTTATTATGGTGATCCCCTGGGCGAAATGCGCCTGGTAAGCAGAGTTTTTGAAATGTAAGGCCTTTGAATAAGACAAAAGGCTGCCTCATCGCTAACTTTGCAACAGTGCC	NA	NA	NA	NA
AVZ87135.1|93729_96039_+	ATPase	NA	NA	NA	NA	NA
AVZ87136.1|96042_97359_+	ATP-binding protein	NA	NA	NA	NA	NA
AVZ87137.1|97355_99551_+	DEAD/DEAH box helicase	NA	NA	NA	NA	NA
AVZ87207.1|100172_100361_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ87138.1|100504_100693_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ87139.1|100997_101855_-	incFII family plasmid replication initiator RepA	NA	NA	NA	NA	NA
AVZ87208.1|101847_101925_-	RepA leader peptide Tap	NA	NA	NA	NA	NA
AVZ87140.1|102141_102420_-	replication protein	NA	NA	NA	NA	NA
AVZ87209.1|102740_103292_-	phospholipase D family protein	NA	A0A1B2LRT6	Wolbachia_phage	35.2	1.1e-19
AVZ87141.1|103560_103839_-|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
AVZ87142.1|103840_106162_-|bacteriocin	klebicin B-related nuclease bacteriocin	bacteriocin	NA	NA	NA	NA
>prophage 1
CP028544	Klebsiella pneumoniae subsp. pneumoniae strain SCKP020143 plasmid p2_020143, complete sequence	110562	0	110241	110562	capsid,tail,integrase,terminase	Salmonella_phage(82.52%)	115	3652:3676	20855:20879
AVZ87216.1|0_1098_+	RepB family plasmid replication initiator protein	NA	J9Q7H0	Salmonella_phage	45.1	1.7e-72
AVZ87217.1|1528_1741_-	hypothetical protein	NA	J9Q7S8	Salmonella_phage	80.0	4.3e-28
AVZ87218.1|1740_2076_-	hypothetical protein	NA	J9Q7Z5	Salmonella_phage	67.6	2.1e-37
AVZ87219.1|2072_2252_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ87220.1|2785_3862_-	recombinase	NA	J9Q736	Salmonella_phage	96.1	8.5e-197
3652:3676	attL	CGGCCGTCGCCAGGAAGGTTTTACC	NA	NA	NA	NA
AVZ87221.1|3864_4131_-	hypothetical protein	NA	J9Q7G8	Salmonella_phage	83.0	1.1e-33
AVZ87222.1|4130_5075_-	exonuclease	NA	J9Q7S6	Salmonella_phage	93.6	2.8e-172
AVZ87223.1|5135_6143_-	regulator	NA	J9Q7Z3	Salmonella_phage	88.3	2.1e-144
AVZ87224.1|6262_6694_-	hypothetical protein	NA	J9Q6I8	Salmonella_phage	91.6	1.1e-65
AVZ87225.1|6849_7149_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ87226.1|7159_7579_-	hypothetical protein	NA	A0A291AWZ9	Escherichia_phage	62.6	6.3e-47
AVZ87227.1|7779_8223_-	hypothetical protein	NA	J9Q7S4	Salmonella_phage	83.0	9.9e-59
AVZ87228.1|8219_9389_-	uracil-DNA glycosylase	NA	J9Q7Z2	Salmonella_phage	92.3	4.4e-207
AVZ87229.1|9410_10112_-	hypothetical protein	NA	S5YLC4	Mycobacterium_phage	37.1	6.4e-20
AVZ87230.1|10108_12472_-	DNA polymerase III subunit alpha	NA	J9Q7Z2	Salmonella_phage	86.6	0.0e+00
AVZ87231.1|12446_12650_-	hypothetical protein	NA	J9Q6I7	Salmonella_phage	80.6	3.3e-25
AVZ87232.1|12652_13885_-	porphyrin biosynthesis protein	NA	J9Q733	Salmonella_phage	86.4	2.2e-212
AVZ87233.1|13981_16261_-	porphyrin biosynthesis protein	NA	J9Q7G6	Salmonella_phage	63.6	7.2e-246
AVZ87234.1|16863_17244_+	transcriptional regulator	NA	NA	NA	NA	NA
AVZ87235.1|17238_18339_-|integrase	integrase	integrase	A0A1P8DTG6	Proteus_phage	28.4	1.6e-17
AVZ87236.1|18587_18998_-	toxin YafO	NA	NA	NA	NA	NA
AVZ87329.1|19007_19418_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ87237.1|19707_19953_-	GrxA family glutaredoxin	NA	A0A2I7SAE2	Vibrio_phage	47.4	5.3e-14
AVZ87238.1|19949_20336_-	hypothetical protein	NA	Q716B1	Shigella_phage	70.4	4.1e-45
AVZ87239.1|20345_21122_-	phosphate starvation-inducible protein PhoH	NA	W8D063	Erwinia_phage	65.4	8.5e-90
20855:20879	attR	CGGCCGTCGCCAGGAAGGTTTTACC	NA	NA	NA	NA
AVZ87240.1|21233_22106_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ87241.1|22895_23195_-	C-type natriuretic protein	NA	J9Q7S1	Salmonella_phage	66.3	3.6e-28
AVZ87242.1|23191_23344_-	hypothetical protein	NA	J9Q7Z1	Salmonella_phage	82.0	1.6e-16
AVZ87243.1|23588_24056_-	hypothetical protein	NA	J9Q7R9	Salmonella_phage	63.9	1.3e-48
AVZ87244.1|24135_24924_-	hypothetical protein	NA	J9Q7Z0	Salmonella_phage	51.1	1.5e-70
AVZ87245.1|25044_26160_-	DNA primase	NA	J9Q720	Salmonella_phage	91.3	8.2e-203
AVZ87246.1|26313_27654_-	DNA helicase	NA	J9Q7G4	Salmonella_phage	95.5	3.5e-240
AVZ87247.1|27718_28444_-	hypothetical protein	NA	J9Q7R8	Salmonella_phage	88.8	2.5e-128
AVZ87248.1|28616_30380_-	hypothetical protein	NA	X2KLG0	Campylobacter_phage	27.4	5.6e-12
AVZ87249.1|30376_30739_-	hypothetical protein	NA	J9Q7G3	Salmonella_phage	97.9	1.2e-43
AVZ87250.1|30738_31404_-	plasmid stability protein	NA	J9Q7R7	Salmonella_phage	83.7	2.9e-102
AVZ87251.1|31697_32282_+	hypothetical protein	NA	A0A2H4J5U3	uncultured_Caudovirales_phage	42.6	6.5e-34
AVZ87252.1|32478_32730_-	hypothetical protein	NA	J9Q7R6	Salmonella_phage	73.5	2.0e-24
AVZ87253.1|32732_33425_-	hypothetical protein	NA	J9Q7Y7	Salmonella_phage	89.1	2.7e-119
AVZ87254.1|33438_33762_-	hypothetical protein	NA	J9Q6E7	Salmonella_phage	95.3	2.3e-49
AVZ87255.1|33857_35303_-	endosialidase chaperone	NA	A0A0H4TGH1	Klebsiella_phage	37.5	4.4e-39
AVZ87256.1|35355_47526_-	DUF1983 domain-containing protein	NA	J9Q713	Salmonella_phage	58.3	1.8e-29
AVZ87257.1|47542_48154_-|tail	tail assembly protein	tail	J9Q7F8	Salmonella_phage	72.1	1.1e-76
AVZ87258.1|48141_48939_-|tail	phage tail protein	tail	J9Q7R4	Salmonella_phage	85.3	5.4e-140
AVZ87259.1|48931_49630_-|tail	phage minor tail protein L	tail	J9Q7Y5	Salmonella_phage	87.4	1.2e-122
AVZ87260.1|49716_50052_-|tail	phage tail protein	tail	J9Q6E1	Salmonella_phage	84.5	2.6e-51
AVZ87261.1|50095_54631_-|tail	phage tail tape measure protein	tail	J9Q712	Salmonella_phage	69.8	0.0e+00
AVZ87262.1|54638_54872_-	hypothetical protein	NA	J9Q7F7	Salmonella_phage	93.5	3.4e-34
AVZ87263.1|54988_55306_-	hypothetical protein	NA	J9Q7R3	Salmonella_phage	93.3	1.8e-46
AVZ87264.1|55367_56114_-	hypothetical protein	NA	J9Q7Y4	Salmonella_phage	82.6	8.1e-106
AVZ87265.1|56181_56574_-	hypothetical protein	NA	J9Q6D8	Salmonella_phage	66.7	5.0e-46
AVZ87266.1|56575_57049_-	hypothetical protein	NA	J9Q711	Salmonella_phage	93.6	1.9e-76
AVZ87267.1|57039_57384_-	hypothetical protein	NA	J9Q7F6	Salmonella_phage	92.1	7.4e-54
AVZ87268.1|57481_58315_-	hypothetical protein	NA	J9Q7R2	Salmonella_phage	83.4	4.8e-131
AVZ87269.1|58314_58749_-	hypothetical protein	NA	J9Q7Y3	Salmonella_phage	84.0	1.1e-62
AVZ87270.1|58796_59225_-	hypothetical protein	NA	J9Q6D6	Salmonella_phage	71.6	7.9e-29
AVZ87271.1|59302_60181_-|capsid	phage major capsid protein	capsid	J9Q710	Salmonella_phage	94.2	4.7e-153
AVZ87272.1|60207_61107_-	hypothetical protein	NA	J9Q7F4	Salmonella_phage	82.6	6.1e-124
AVZ87273.1|61129_62719_-	hypothetical protein	NA	J9Q7R1	Salmonella_phage	88.4	7.4e-274
AVZ87274.1|62736_63993_-|terminase	terminase	terminase	J9Q7Y2	Salmonella_phage	97.4	9.4e-248
AVZ87275.1|63995_64637_-	DNA-binding protein	NA	J9Q6D4	Salmonella_phage	88.2	5.0e-96
AVZ87276.1|64814_65081_-	hypothetical protein	NA	J9Q757	Salmonella_phage	90.9	1.3e-37
AVZ87277.1|65090_65990_-	hypothetical protein	NA	J9Q7I6	Salmonella_phage	97.0	4.2e-165
AVZ87278.1|65986_66241_-	hypothetical protein	NA	J9Q7U0	Salmonella_phage	95.2	3.4e-40
AVZ87279.1|66233_66872_-	adenylyl-sulfate kinase	NA	J9Q807	Salmonella_phage	97.6	1.4e-109
AVZ87280.1|66868_67537_-	chromosome partitioning protein ParB	NA	J9Q6L1	Salmonella_phage	92.3	3.9e-107
AVZ87281.1|67536_68217_-	chromosome partitioning protein ParB	NA	J9Q756	Salmonella_phage	89.7	3.6e-108
AVZ87282.1|68300_69860_+	ATP-dependent helicase	NA	J9Q7I4	Salmonella_phage	92.7	1.3e-278
AVZ87283.1|69862_70138_+	hypothetical protein	NA	J9Q7T9	Salmonella_phage	68.1	4.0e-26
AVZ87284.1|70188_70626_-	hypothetical protein	NA	A0A1V0E7W1	Vibrio_phage	36.4	9.5e-14
AVZ87285.1|70781_71312_+	transcriptional regulator	NA	J9Q6L0	Salmonella_phage	84.5	1.3e-70
AVZ87330.1|71444_71624_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ87286.1|71945_72596_+	hypothetical protein	NA	J9Q754	Salmonella_phage	91.7	8.4e-107
AVZ87287.1|72646_72850_+	hypothetical protein	NA	J9Q7I3	Salmonella_phage	95.5	4.1e-28
AVZ87288.1|73442_73925_-	hypothetical protein	NA	J9Q805	Salmonella_phage	77.5	2.7e-70
AVZ87289.1|74130_74412_-	ABC transporter	NA	J9Q753	Salmonella_phage	82.8	2.9e-40
AVZ87290.1|74414_74789_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ87291.1|74916_75324_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ87292.1|75443_75755_-	hypothetical protein	NA	J9Q7T7	Salmonella_phage	68.0	5.2e-30
AVZ87293.1|75891_76104_-	hypothetical protein	NA	J9Q804	Salmonella_phage	74.3	9.9e-25
AVZ87294.1|76116_76335_-	hypothetical protein	NA	J9Q6K7	Salmonella_phage	81.9	2.9e-27
AVZ87295.1|77108_77411_+	hypothetical protein	NA	J9Q7T6	Salmonella_phage	66.7	8.0e-12
AVZ87296.1|78212_80078_+	DUF262 domain-containing protein	NA	NA	NA	NA	NA
AVZ87297.1|80281_81838_+	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	42.7	1.9e-104
AVZ87298.1|81834_83019_+	restriction endonuclease subunit S	NA	A0A240FAT6	Liberibacter_phage	50.6	1.3e-41
AVZ87299.1|83140_86257_+	DEAD/DEAH box helicase	NA	A0A220A398	Liberibacter_phage	23.8	1.0e-24
AVZ87300.1|86318_86534_-	DNA modification methylase	NA	J9Q747	Salmonella_phage	69.8	1.2e-14
AVZ87301.1|86662_87241_-	hypothetical protein	NA	J9Q7H6	Salmonella_phage	57.0	5.1e-55
AVZ87302.1|87368_87524_-	DUF3927 domain-containing protein	NA	H6WZJ7	Escherichia_phage	61.2	1.7e-05
AVZ87303.1|87523_87949_-	tellurite/colicin resistance protein	NA	Q71TK7	Escherichia_phage	80.9	9.8e-56
AVZ87304.1|88051_88240_-	hypothetical protein	NA	J9Q800	Salmonella_phage	52.5	3.3e-08
AVZ87305.1|88236_88515_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ87306.1|88885_89536_-	ribonuclease HI	NA	J9Q745	Salmonella_phage	80.1	4.9e-91
AVZ87307.1|90114_90342_-	hypothetical protein	NA	J9Q7H5	Salmonella_phage	84.0	7.6e-31
AVZ87308.1|90539_91133_-	phage N-6-adenine-methyltransferase	NA	J9Q7T2	Salmonella_phage	84.8	1.7e-98
AVZ87309.1|91317_92151_-	hypothetical protein	NA	J9Q7Z9	Salmonella_phage	56.4	1.1e-63
AVZ87310.1|92276_92825_-	3'-5' exonuclease	NA	J9Q6J8	Salmonella_phage	74.4	3.2e-75
AVZ87331.1|92821_93403_-	hypothetical protein	NA	A0A1B0VMI8	Pseudomonas_phage	50.4	4.2e-33
AVZ87311.1|93625_94045_-	hypothetical protein	NA	J9Q743	Salmonella_phage	73.4	1.9e-51
AVZ87312.1|94108_94753_-	hypothetical protein	NA	J9Q7H4	Salmonella_phage	77.1	1.4e-93
AVZ87313.1|94752_95229_-	dihydrofolate reductase	NA	J9Q7T1	Salmonella_phage	80.3	1.3e-72
AVZ87314.1|95225_95639_-	hypothetical protein	NA	J9Q7Z8	Salmonella_phage	77.4	6.2e-55
AVZ87315.1|95640_96744_-	thymidylate synthase	NA	J9Q6J6	Salmonella_phage	79.8	2.5e-180
AVZ87316.1|96937_97813_-	phosphoribosyl-ATP pyrophosphohydrolase	NA	J9Q742	Salmonella_phage	84.4	1.3e-139
AVZ87317.1|97890_99033_-	ribonucleotide-diphosphate reductase subunit beta	NA	J9Q7H3	Salmonella_phage	95.5	4.4e-212
AVZ87318.1|99163_101467_-	ribonucleoside-diphosphate reductase subunit alpha	NA	J9Q7T0	Salmonella_phage	90.9	0.0e+00
AVZ87319.1|101542_102112_-	hypothetical protein	NA	J9Q7Z7	Salmonella_phage	89.9	1.1e-94
AVZ87320.1|102121_102868_-	hypothetical protein	NA	J9Q6J5	Salmonella_phage	62.1	7.7e-80
AVZ87321.1|102857_104774_-	exonuclease	NA	J9Q741	Salmonella_phage	84.5	2.1e-299
AVZ87322.1|104770_105004_-	hypothetical protein	NA	J9Q7H1	Salmonella_phage	66.1	4.4e-18
AVZ87323.1|105003_106089_-	exonuclease	NA	J9Q7S9	Salmonella_phage	84.8	1.8e-183
AVZ87324.1|106515_106728_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AVZ87325.1|106724_107591_+	hypothetical protein	NA	A0A2I6UHT9	Bacillus_phage	55.8	1.1e-05
AVZ87326.1|107621_109082_-	hypothetical protein	NA	A0A2I6UHU5	Bacillus_phage	33.3	5.0e-59
AVZ87327.1|109596_110241_-	hypothetical protein	NA	J9Q739	Salmonella_phage	80.7	1.1e-98
>prophage 1
CP028547	Klebsiella pneumoniae subsp. pneumoniae strain SCKP020143 plasmid pKPC2_020143, complete sequence	73791	1796	51815	73791	transposase,integrase,protease	Escherichia_phage(33.33%)	56	8127:8186	59256:60078
AVZ87353.1|1796_2450_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
AVZ87354.1|2669_3134_+	mRNA interferase PemK	NA	NA	NA	NA	NA
AVZ87355.1|3130_3235_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ87356.1|4444_5149_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AVZ87357.1|5617_6175_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ87429.1|6302_6653_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ87358.1|6700_7405_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AVZ87359.1|7395_7590_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ87360.1|7691_8066_+	hypothetical protein	NA	A0A248SL90	Klebsiella_phage	62.7	2.2e-27
8127:8186	attL	ACGGCACTGTTGCAAATAGTCGGTGGTGATAAACTTATCATCCCCTTTTGCTGATGGAGC	NA	NA	NA	NA
AVZ87361.1|8191_8896_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AVZ87362.1|8961_9150_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ87430.1|9241_9778_+	recombinase	NA	Q1MVP4	Enterobacteria_phage	100.0	2.8e-84
AVZ87363.1|9960_10821_+	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
AVZ87364.1|10990_11746_+	16S rRNA (guanine(1405)-N(7))-methyltransferase RmtB1	NA	NA	NA	NA	NA
AVZ87365.1|12195_12900_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AVZ87366.1|14101_14359_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ87367.1|14404_15184_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	92.0	5.4e-52
AVZ87368.1|15367_16372_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ87369.1|16401_16605_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ87370.1|16650_17172_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ87431.1|17229_17580_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ87371.1|17658_18603_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ87432.1|18763_19198_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ87372.1|19181_19412_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
AVZ87373.1|19408_19825_+	PIN domain nuclease	NA	NA	NA	NA	NA
AVZ87374.1|19898_21461_+	ATP-dependent endonuclease	NA	NA	NA	NA	NA
AVZ87375.1|21445_22468_+	DNA helicase UvrD	NA	NA	NA	NA	NA
AVZ87376.1|23746_24628_+	carbapenem-hydrolyzing class A beta-lactamase KPC-2	NA	A0A1B0VBP7	Salmonella_phage	52.2	2.2e-73
AVZ87377.1|25862_26159_-	transcriptional repressor protein KorC	NA	NA	NA	NA	NA
AVZ87378.1|26487_26913_-	antirestriction protein	NA	A0A2D0W8Z5	Bordetella_virus	37.3	5.3e-17
AVZ87379.1|27023_27302_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ87380.1|28844_29405_+|transposase	transposase	transposase	A0A1B0V7I5	Salmonella_phage	100.0	1.1e-59
AVZ87381.1|29408_32375_+|transposase	Tn3-like element TnAs1 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	100.0	0.0e+00
AVZ87382.1|32615_33476_+	class A extended-spectrum beta-lactamase SHV-12	NA	A0A077SL40	Escherichia_phage	99.3	2.2e-155
AVZ87383.1|33496_34258_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
AVZ87384.1|34248_34482_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ87385.1|34519_35422_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	99.7	2.6e-159
AVZ87386.1|37055_37760_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AVZ87387.1|38009_38990_-|transposase	IS5-like element ISKpn26 family transposase	transposase	Q38213	Escherichia_phage	99.1	8.9e-185
AVZ87433.1|39503_39899_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ87388.1|39895_40507_+	DUF2913 domain-containing protein	NA	NA	NA	NA	NA
AVZ87389.1|40503_41454_-|transposase	ISNCY family transposase	transposase	Q2A0A7	Sodalis_phage	55.6	6.6e-76
AVZ87390.1|41600_41801_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ87391.1|41854_42487_-	LacI family DNA-binding transcriptional regulator	NA	A0A1V0E035	Clostridioides_phage	31.9	2.5e-07
AVZ87392.1|42849_44055_+	ParA family protein	NA	Q1MVJ3	Enterobacteria_phage	89.2	1.1e-205
AVZ87393.1|44051_45023_+	ParB/RepB/Spo0J family partition protein	NA	Q1MVJ4	Enterobacteria_phage	68.9	1.4e-113
AVZ87394.1|45158_46430_-	translesion error-prone DNA polymerase V subunit UmuC	NA	F1C5A5	Cronobacter_phage	63.0	6.1e-154
AVZ87395.1|46429_46852_-	peptidase	NA	A0A1W6JNS2	Morganella_phage	51.5	3.1e-30
AVZ87396.1|47031_47703_-	DNA breaking-rejoining protein	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	61.7	5.1e-83
AVZ87397.1|48061_48739_+	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	36.9	1.6e-28
AVZ87398.1|48738_48960_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ87399.1|48970_49390_+	DUF1380 domain-containing protein	NA	NA	NA	NA	NA
AVZ87400.1|49443_50223_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ87401.1|50627_51134_+	antirestriction protein	NA	A0A1I9S7Y0	Rhodococcus_phage	31.8	4.8e-09
AVZ87402.1|51176_51368_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ87403.1|51554_51815_+	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	46.2	4.1e-12
59256:60078	attR	ACGGCACTGTTGCAAATAGTCGGTGGTGATAAACTTATCATCCCCTTTTGCTGATGGAGCTGCACATGAACCCATTCAAAGGCCGGCATTTTCAGCGTGACATCATTCTGTGGGCCGTACGCTGGTACTGCAAATACGGCATCAGTTACCGTGAGCTGCAGGAGATGCTGGCTGAACGCGGAGTGAATGTCGATCACTCCACGATTTACCGCTGGGTTCAGCGTTATGCGCCTGAAATGGAAAAACGGCTGCGCTGGTACTGGCGTAACCCTTCCGATCTTTGCCCGTGGCACATGGATGAAACCTACGTGAAGGTCAATGGCCGCTGGGCGTATCTGTACCGGGCCGTCGACAGCCGGGGCCGCACTGTCGATTTTTATCTCTCCTCCCGTCGTAACAGCAAAGCTGCATACCGGTTTCTGGGTAAAATCCTCAACAACGTGAAGAAGTGGCAGATCCCGCGATTCATCAACACGGATAAAGCGCCCGCCTATGGTCGCGCGCTTGCTCTGCTCAAACGCGAAGGCCGGTGCCCGTCTGACGTTGAACACCGACAGATTAAGTACCGGAACAACGTGATTGAATGCGATCATGGCAAACTGAAACGGATAATCGGCGCCACGCTGGGATTTAAATCCATGAAGACGGCTTACGCCACCATCAAAGGTATTGAGGTGATGCGTGCACTACGCAAAGGCCAGGCCTCAGCATTTTATTATGGTGATCCCCTGGGCGAAATGCGCCTGGTAAGCAGAGTTTTTGAAATGTAAGGCCTTTGAATAAGACAAAAGGCTGCCTCATCGCTAACTTTGCAACAGTGCCA	NA	NA	NA	NA
