The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP025251	Escherichia coli strain BH100 chromosome, complete genome	5131212	229459	292285	5131212	plate,transposase,tRNA	Planktothrix_phage(11.11%)	57	NA	NA
AUF89258.1|229459_230773_+|tRNA	tRNA(Ile)-lysidine synthetase	tRNA	NA	NA	NA	NA
AUF89259.1|230806_231061_-	Rho-binding antiterminator	NA	NA	NA	NA	NA
AUF89260.1|231053_231254_-	hypothetical protein	NA	NA	NA	NA	NA
AUF89261.1|231419_231965_+	hypothetical protein	NA	NA	NA	NA	NA
AUF89262.1|231961_232384_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
AUF89263.1|232397_233108_+	copper homeostasis/adhesion lipoprotein NlpE	NA	NA	NA	NA	NA
AUF89264.1|233263_234088_-	hypothetical protein	NA	NA	NA	NA	NA
AUF89265.1|234140_235859_-|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
AUF89266.1|235969_236677_-|tRNA	tRNA(N6-threonylcarbamoyladenosine(37)-N6)- methyltransferaseTrmO	tRNA	NA	NA	NA	NA
AUF89267.1|236673_237078_-	Rcs stress response system protein RcsF	NA	NA	NA	NA	NA
AUF89268.1|237195_238011_-	methionine ABC transporter substrate-bindingprotein MetQ	NA	NA	NA	NA	NA
AUF89269.1|238050_238704_-	methionine ABC transporter	NA	NA	NA	NA	NA
AUF89270.1|238696_239728_-	methionine import ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	40.2	7.2e-36
AUF89271.1|239915_240488_+	D-glycero-beta-D-manno-heptose 1,7-bisphosphate7-phosphatase	NA	NA	NA	NA	NA
AUF89272.1|246157_246961_+	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	35.8	6.0e-38
AUF89273.1|246957_247872_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUF89274.1|248112_248913_+	EEP domain-containing protein	NA	NA	NA	NA	NA
AUF89275.1|248990_249761_+	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AUF89276.1|249809_251168_-	murein transglycosylase D	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	36.0	5.8e-09
AUF89277.1|251239_251995_-	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
AUF89278.1|252028_252751_+	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AUF89279.1|252747_253215_-	ribonuclease H	NA	J9Q745	Salmonella_phage	58.7	8.0e-51
AUF89280.1|253279_254011_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	38.6	5.8e-40
AUF89281.1|254548_255334_+	hypothetical protein	NA	NA	NA	NA	NA
AUF89282.1|255673_256153_-	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
AUF89283.1|256170_257529_-	hypothetical protein	NA	NA	NA	NA	NA
AUF89284.1|257539_261067_-	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
AUF89285.1|261086_262595_-	type VI secretion system protein TssA	NA	NA	NA	NA	NA
AUF89286.1|262533_263277_-	type VI secretion system-associated proteinTagO	NA	NA	NA	NA	NA
AUF89287.1|263273_266036_-	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	31.1	3.6e-82
AUF89288.1|266045_266810_-	membrane protein	NA	NA	NA	NA	NA
AUF89289.1|266814_268161_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
AUF89290.1|268163_268688_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
AUF89291.1|268684_269965_-	type VI secretion system-associated FHA domainprotein TagH	NA	NA	NA	NA	NA
AUF89292.1|269981_271031_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
AUF89293.1|270994_272854_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
AUF89294.1|272841_273267_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
AUF89295.1|273271_274756_-	type VI secretion system contractile sheathlarge subunit	NA	NA	NA	NA	NA
AUF89296.1|274778_275282_-	type VI secretion system contractile sheathsmall subunit	NA	NA	NA	NA	NA
AUF89297.1|275987_276506_+	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
AUF89298.1|276591_276711_+	hypothetical protein	NA	NA	NA	NA	NA
AUF89299.1|276726_278709_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.8	2.5e-24
AUF89300.1|278815_279862_+	DUF2169 domain-containing protein	NA	NA	NA	NA	NA
AUF89301.1|279854_281294_+	peptidase C39	NA	NA	NA	NA	NA
AUF89302.1|281268_281559_+	hypothetical protein	NA	NA	NA	NA	NA
AUF89303.1|281816_281996_+	Mobile element protein	NA	NA	NA	NA	NA
AUF89304.1|282809_283313_+	hypothetical protein	NA	NA	NA	NA	NA
AUF89305.1|283382_283895_+	integrating conjugative element protein	NA	NA	NA	NA	NA
AUF89306.1|283971_284268_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
AUF89307.1|284165_284936_-	amidohydrolase	NA	NA	NA	NA	NA
AUF89308.1|285089_285563_+	hypothetical protein	NA	NA	NA	NA	NA
AUF89309.1|285605_288050_-	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
AUF89310.1|288289_288868_+	phosphoheptose isomerase	NA	A0A067XQR2	Caulobacter_phage	32.0	1.1e-14
AUF89311.1|289072_289840_+	class II glutamine amidotransferase	NA	NA	NA	NA	NA
AUF89312.1|289810_290551_-	transpeptidase	NA	NA	NA	NA	NA
AUF89313.1|290862_291612_+	putative lipoprotein yafL precursor	NA	A0A1V0DZX6	Clostridioides_phage	37.7	1.5e-19
AUF89314.1|291787_292285_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 2
CP025251	Escherichia coli strain BH100 chromosome, complete genome	5131212	317099	365724	5131212	protease,transposase,tRNA	Escherichia_phage(33.33%)	52	NA	NA
AUF89339.1|317099_318122_+|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	99.4	6.0e-200
AUF89340.1|318124_318901_+	Mobile element protein	NA	A0A2L1IVB6	Escherichia_phage	99.6	9.9e-139
AUF89341.1|318951_320703_-	NTPase	NA	NA	NA	NA	NA
AUF89342.1|322002_322200_+	hypothetical protein	NA	NA	NA	NA	NA
AUF89343.1|322223_323258_+	3-deoxy-7-phosphoheptulonate synthase	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	43.4	1.4e-71
AUF89344.1|323387_323567_+	hypothetical protein	NA	NA	NA	NA	NA
AUF89345.1|323743_323860_+	hypothetical protein	NA	NA	NA	NA	NA
AUF89346.1|325381_326437_+	Colicin V secretion ATP-binding protein cvaB	NA	W8CYL7	Bacillus_phage	34.3	3.1e-34
AUF89347.1|326543_326765_+	hypothetical protein	NA	NA	NA	NA	NA
AUF89348.1|326761_327040_+	hypothetical protein	NA	NA	NA	NA	NA
AUF89349.1|327216_327903_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
AUF89350.1|327997_328456_-	hypothetical protein	NA	NA	NA	NA	NA
AUF89351.1|328520_328712_+	hypothetical protein	NA	NA	NA	NA	NA
AUF89352.1|329667_330237_+	hypothetical protein	NA	NA	NA	NA	NA
AUF89353.1|330511_330733_-	Major pilus subunit operon regulatory protein	NA	NA	NA	NA	NA
AUF89354.1|331151_331481_+	major pilus subunit operon regulatory proteinPapB	NA	NA	NA	NA	NA
AUF89355.1|331854_332400_+	S-fimbrial protein subunit SfaA	NA	NA	NA	NA	NA
AUF89356.1|332485_333010_+	type 1 fimbrial protein	NA	NA	NA	NA	NA
AUF89357.1|333050_333746_+	molecular chaperone FimC	NA	NA	NA	NA	NA
AUF89358.1|333816_336447_+	fimbrial biogenesis outer membrane usherprotein	NA	NA	NA	NA	NA
AUF89359.1|336459_336987_+	S-fimbrial protein subunit SfaG	NA	NA	NA	NA	NA
AUF89360.1|337008_337500_+	S-fimbrial adhesin protein SfaS	NA	NA	NA	NA	NA
AUF89361.1|337492_338461_+	fimbrial protein	NA	NA	NA	NA	NA
AUF89362.1|338516_338645_+	hypothetical protein	NA	NA	NA	NA	NA
AUF89363.1|338764_339505_+	EAL domain-containing protein	NA	NA	NA	NA	NA
AUF89364.1|339651_340203_+	transcriptional regulator	NA	NA	NA	NA	NA
AUF89365.1|340696_342874_+	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
AUF89366.1|342918_343875_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
AUF89367.1|343959_345189_-	esterase family protein	NA	NA	NA	NA	NA
AUF89368.1|345292_348952_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	29.9	6.1e-45
AUF89369.1|349091_350207_-	glycosyl transferase	NA	NA	NA	NA	NA
AUF89370.1|350744_351044_+	hypothetical protein	NA	NA	NA	NA	NA
AUF89371.1|351054_351459_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
AUF89372.1|351474_351630_-	hypothetical protein	NA	NA	NA	NA	NA
AUF89373.1|352222_352336_+	hypothetical protein	NA	NA	NA	NA	NA
AUF89374.1|352328_352607_+	hypothetical protein	NA	NA	NA	NA	NA
AUF89375.1|353223_353340_+	hypothetical protein	NA	NA	NA	NA	NA
AUF89376.1|353327_353672_-	Mobile element protein	NA	NA	NA	NA	NA
AUF89377.1|353797_354691_-	Mobile element protein	NA	NA	NA	NA	NA
AUF89378.1|354732_354951_+	hypothetical protein	NA	NA	NA	NA	NA
AUF89379.1|355036_357007_+	ligand-gated channel	NA	NA	NA	NA	NA
AUF89380.1|357025_357817_+	DUF4198 domain-containing protein	NA	NA	NA	NA	NA
AUF89381.1|358080_359280_+	hypothetical protein	NA	NA	NA	NA	NA
AUF89382.1|359386_359569_-|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	67.2	1.1e-19
AUF89383.1|359734_360334_+	Mobile element protein	NA	A0A2L1IVA1	Escherichia_phage	98.9	5.2e-111
AUF89384.1|360330_361113_+|transposase	transposase	transposase	A0A2L1IVB6	Escherichia_phage	99.6	5.9e-139
AUF89385.1|361163_361781_-|transposase	IS66 family transposase	transposase	S5VLC8	Leptospira_phage	30.1	1.1e-07
AUF89386.1|361800_362148_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZDM8	Stx2-converting_phage	75.7	1.3e-45
AUF89387.1|362144_362507_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	71.1	1.4e-23
AUF89388.1|362641_362827_-	hypothetical protein	NA	NA	NA	NA	NA
AUF89389.1|363293_364181_-	ArgP/LysG family DNA-binding transcriptionalregulator	NA	NA	NA	NA	NA
AUF89390.1|364227_365724_-|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	37.1	2.4e-88
>prophage 3
CP025251	Escherichia coli strain BH100 chromosome, complete genome	5131212	965149	972872	5131212	integrase	uncultured_Caudovirales_phage(50.0%)	10	959136:959150	971476:971490
959136:959150	attL	GCTCACGGGCCAGAT	NA	NA	NA	NA
AUF89975.1|965149_967096_+	macrolide ABC transporter permease/ATP-bindingprotein MacB	NA	G9BWD6	Planktothrix_phage	40.1	1.1e-37
AUF89976.1|967168_967393_-	cold-shock protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	2.3e-16
AUF89977.1|967797_969036_+|integrase	integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	52.2	2.0e-125
AUF89978.1|969445_969655_+	AlpA family phage regulatory protein	NA	A0A2H4JB58	uncultured_Caudovirales_phage	67.9	2.2e-16
AUF89979.1|969793_969973_-	hypothetical protein	NA	A0A2H4JB52	uncultured_Caudovirales_phage	58.6	1.2e-10
AUF89980.1|970106_970304_+	hypothetical protein	NA	NA	NA	NA	NA
AUF89981.1|970296_970608_+	hypothetical protein	NA	NA	NA	NA	NA
AUF89982.1|970600_970828_+	hypothetical protein	NA	NA	NA	NA	NA
AUF89983.1|970833_971121_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
AUF89984.1|971117_972872_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	40.8	2.2e-93
971476:971490	attR	ATCTGGCCCGTGAGC	NA	NA	NA	NA
>prophage 4
CP025251	Escherichia coli strain BH100 chromosome, complete genome	5131212	1228337	1273440	5131212	tRNA,portal,lysis,capsid,tail,terminase,head,integrase	Enterobacteria_phage(55.77%)	63	1220972:1220987	1280617:1280632
1220972:1220987	attL	TAGCTTTGGAAAACAG	NA	NA	NA	NA
AUF90239.1|1228337_1229444_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
AUF90240.1|1229497_1229959_-	NUDIX hydrolase	NA	NA	NA	NA	NA
AUF90241.1|1229968_1230622_-	23S rRNA pseudouridine synthase E	NA	NA	NA	NA	NA
AUF90242.1|1230709_1230823_-	hypothetical protein	NA	NA	NA	NA	NA
AUF90243.1|1230793_1232044_+	isocitrate dehydrogenase (NADP(+))	NA	Q77Z09	Phage_21	100.0	3.8e-23
AUF90244.1|1232157_1233300_-|integrase	integrase	integrase	Q77Z02	Phage_21	99.4	3.1e-205
AUF90245.1|1233289_1233526_-	excisionase	NA	NA	NA	NA	NA
AUF90246.1|1233665_1233905_-	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	94.9	3.9e-38
AUF90247.1|1233952_1234171_-	conjugal transfer protein TraR	NA	M1FQT7	Enterobacteria_phage	95.8	1.8e-34
AUF90248.1|1234269_1234551_-	hypothetical protein	NA	A0A0P0ZE02	Stx2-converting_phage	97.8	1.2e-46
AUF90249.1|1234561_1234753_-	hypothetical protein	NA	A0A0P0ZC67	Stx2-converting_phage	98.4	2.1e-26
AUF90250.1|1234725_1234908_-	DUF1317 domain-containing protein	NA	A0A0N7CHV0	Escherichia_phage	98.3	1.3e-28
AUF90251.1|1234904_1235585_-	exonuclease	NA	B6DZ61	Enterobacteria_phage	98.2	5.1e-131
AUF90252.1|1235581_1236367_-	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
AUF90253.1|1236372_1236669_-	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	99.0	3.6e-49
AUF90254.1|1236743_1236950_-	phage encoded cell division inhibitor protein	NA	K7P6H3	Enterobacteria_phage	85.3	3.2e-28
AUF90255.1|1237425_1237803_-	hypothetical protein	NA	Q6SE87	Lactobacillus_prophage	49.2	1.3e-30
AUF90256.1|1237780_1238842_-	hypothetical protein	NA	Q6SE88	Lactobacillus_prophage	42.0	2.9e-64
AUF90257.1|1238922_1239615_-	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	86.1	1.5e-109
AUF90258.1|1239725_1239953_+	transcriptional regulator	NA	Q76H55	Enterobacteria_phage	69.0	3.8e-22
AUF90259.1|1239983_1240523_+	hypothetical protein	NA	M9NZI6	Enterobacteria_phage	66.7	8.9e-62
AUF90260.1|1240519_1241539_+	hypothetical protein	NA	A0A0M5M7Y1	Salmonella_phage	64.7	6.1e-112
AUF90261.1|1241535_1242249_+	hypothetical protein	NA	G8C7U6	Escherichia_phage	83.4	9.8e-109
AUF90262.1|1242327_1242756_-	hypothetical protein	NA	NA	NA	NA	NA
AUF90263.1|1242752_1243130_-	hypothetical protein	NA	NA	NA	NA	NA
AUF90264.1|1243397_1243853_+	hypothetical protein	NA	I6PD71	Cronobacter_phage	66.2	7.0e-60
AUF90265.1|1243852_1244023_+	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	67.9	2.0e-12
AUF90266.1|1244015_1244306_+	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	92.7	9.6e-47
AUF90267.1|1244302_1244665_+	Crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	96.5	4.3e-60
AUF90268.1|1244664_1244802_+	hypothetical protein	NA	K7PHH3	Enterobacteria_phage	70.7	2.4e-08
AUF90269.1|1244887_1245271_+	antitermination protein	NA	A0A088CD47	Shigella_phage	83.3	1.5e-55
AUF90270.1|1245459_1246542_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	80.1	1.6e-166
AUF90271.1|1247130_1247346_+|lysis	lysis protein S	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
AUF90272.1|1247345_1247843_+	lysozyme	NA	M1FJA0	Enterobacteria_phage	96.4	2.1e-89
AUF90273.1|1247839_1248301_+|lysis	lysis protein	lysis	A0A0K2FJD0	Enterobacteria_phage	98.7	1.2e-75
AUF90274.1|1248332_1248626_-	hypothetical protein	NA	K7PL54	Enterobacteria_phage	92.8	7.0e-45
AUF90275.1|1249052_1249433_+	cell envelope biogenesis protein TonB	NA	H6WZK5	Escherichia_phage	72.2	2.6e-39
AUF90276.1|1249639_1249822_+	hypothetical protein	NA	NA	NA	NA	NA
AUF90277.1|1249796_1250117_-	hypothetical protein	NA	NA	NA	NA	NA
AUF90278.1|1250051_1250396_+	DNA-packaging protein	NA	NA	NA	NA	NA
AUF90279.1|1250385_1250934_+|terminase	phage terminase small subunit	terminase	A0A0U2S671	Escherichia_phage	84.2	1.0e-57
AUF90280.1|1250905_1252834_+|terminase	terminase	terminase	A0A0K2FJ14	Enterobacteria_phage	66.7	3.3e-260
AUF90281.1|1252817_1253024_+|head	phage head-stabilizing protein	head	K7PM10	Enterobacteria_phage	55.4	3.0e-10
AUF90282.1|1253020_1254613_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	61.1	6.5e-185
AUF90283.1|1254602_1256108_+	scaffold protein	NA	A0A0K2FI53	Enterobacteria_phage	53.2	1.3e-99
AUF90284.1|1256144_1256492_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	58.1	2.6e-22
AUF90285.1|1256549_1257578_+|capsid	minor capsid protein E	capsid	C6ZCY2	Enterobacteria_phage	61.6	2.7e-115
AUF90286.1|1257581_1258004_+	hypothetical protein	NA	NA	NA	NA	NA
AUF90287.1|1257996_1258350_+|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	65.0	3.4e-38
AUF90288.1|1258361_1258940_+|tail	tail protein	tail	A0A2R9YJK4	Escherichia_phage	92.2	1.7e-79
AUF90289.1|1258936_1259332_+|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	98.5	5.0e-70
AUF90290.1|1259339_1260080_+|tail	major tail protein V	tail	A0A0K2FJ05	Enterobacteria_phage	98.0	6.1e-130
AUF90291.1|1260095_1260518_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	95.7	2.4e-70
AUF90292.1|1260499_1260934_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	97.5	6.5e-63
AUF90293.1|1260926_1263488_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	90.0	0.0e+00
AUF90294.1|1263484_1263814_+|tail	tail protein	tail	A0A2R9YJM0	Escherichia_phage	98.2	2.8e-58
AUF90295.1|1263813_1264512_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	98.7	6.2e-132
AUF90296.1|1264516_1265260_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.2	7.7e-149
AUF90297.1|1265256_1265829_+|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.5	3.0e-84
AUF90298.1|1265889_1269288_+	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	90.8	0.0e+00
AUF90299.1|1269354_1269954_+	hypothetical protein	NA	A0A0P0ZCF6	Stx2-converting_phage	99.5	2.3e-111
AUF90300.1|1270018_1272859_+	membrane protein	NA	A0A0K2FIZ6	Escherichia_phage	92.3	2.5e-54
AUF90301.1|1272858_1273440_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	93.8	1.6e-101
1280617:1280632	attR	TAGCTTTGGAAAACAG	NA	NA	NA	NA
>prophage 5
CP025251	Escherichia coli strain BH100 chromosome, complete genome	5131212	2445731	2456014	5131212		Pseudomonas_phage(33.33%)	7	NA	NA
AUF91457.1|2445731_2449490_-	AIDA-I family autotransporter YfaL	NA	A0A2L1IV18	Escherichia_phage	27.7	1.3e-21
AUF91458.1|2449913_2450126_-	hypothetical protein	NA	Q1MVF2	Enterobacteria_phage	77.5	6.2e-11
AUF91459.1|2450171_2452457_+	ribonucleoside-diphosphate reductase subunitalpha	NA	A0A2D1GNB1	Pseudoalteromonas_phage	63.6	1.9e-283
AUF91460.1|2452646_2453777_+	ribonucleotide-diphosphate reductase subunitbeta	NA	G9IAA3	Pseudomonas_phage	78.9	2.5e-175
AUF91461.1|2453776_2454031_+	ferredoxin	NA	G9IAA2	Pseudomonas_phage	73.1	2.6e-24
AUF91462.1|2454084_2454735_-	hypothetical protein	NA	NA	NA	NA	NA
AUF91463.1|2454937_2456014_-	glycerophosphodiester phosphodiesterase	NA	A0A220BYK6	Staphylococcus_phage	46.0	5.1e-08
>prophage 6
CP025251	Escherichia coli strain BH100 chromosome, complete genome	5131212	2774639	2817155	5131212	holin,tail,terminase,head	Salmonella_phage(54.17%)	58	NA	NA
AUF91760.1|2774639_2774906_+	hypothetical protein	NA	A0A0M3ULK3	Salmonella_phage	80.7	1.7e-34
AUF91761.1|2774964_2775612_+	hypothetical protein	NA	NA	NA	NA	NA
AUF91762.1|2775692_2776247_-	recombinase family protein	NA	A0A1S6L009	Salmonella_phage	87.3	3.7e-87
AUF91763.1|2776276_2776771_+	hypothetical protein	NA	K7PH60	Enterobacterial_phage	92.8	1.1e-79
AUF91764.1|2776770_2777364_+|tail	tail assembly protein	tail	Q9MCR5	Enterobacteria_phage	64.9	4.5e-59
AUF91765.1|2777335_2777776_-|tail	tail assembly chaperone	tail	A0A0F7LDZ0	Escherichia_phage	69.7	5.6e-54
AUF91766.1|2777802_2778492_-	hypothetical protein	NA	A0A0M3ULD8	Salmonella_phage	70.0	3.7e-28
AUF91767.1|2778491_2779172_-	DUF2612 domain-containing protein	NA	A0A0M5M1K4	Salmonella_phage	78.8	3.4e-103
AUF91768.1|2779168_2780368_-	hypothetical protein	NA	A0A0M4RD32	Salmonella_phage	83.9	1.7e-185
AUF91769.1|2780367_2780721_-	hypothetical protein	NA	A0A0M4R339	Salmonella_phage	88.9	1.5e-54
AUF91770.1|2780720_2781473_-	hypothetical protein	NA	A0A0M5M1K7	Salmonella_phage	65.9	2.5e-86
AUF91771.1|2781532_2781928_-	hypothetical protein	NA	NA	NA	NA	NA
AUF91772.1|2781914_2782688_-	hypothetical protein	NA	NA	NA	NA	NA
AUF91773.1|2782783_2783116_-	hypothetical protein	NA	A0A0M4RTY3	Salmonella_phage	70.5	1.1e-22
AUF91774.1|2783115_2784180_-	hypothetical protein	NA	A0A0M4QX01	Salmonella_phage	81.1	3.2e-156
AUF91775.1|2784182_2784485_-	hypothetical protein	NA	A0A0M4R5B7	Salmonella_phage	91.0	6.3e-49
AUF91776.1|2784484_2785072_-	hypothetical protein	NA	A0A0M3ULD5	Salmonella_phage	88.0	3.4e-83
AUF91777.1|2785071_2787057_-	hypothetical protein	NA	A0A0M4REK7	Salmonella_phage	53.3	3.8e-174
AUF91778.1|2787234_2787687_-	hypothetical protein	NA	A0A0M4S6U8	Salmonella_phage	72.7	6.1e-56
AUF91779.1|2787690_2788131_-	DUF3277 domain-containing protein	NA	A0A2H4J619	uncultured_Caudovirales_phage	75.3	7.0e-57
AUF91780.1|2788141_2789287_-	DUF3383 domain-containing protein	NA	A0A2H4J8G4	uncultured_Caudovirales_phage	73.2	5.2e-160
AUF91781.1|2789290_2789854_-	hypothetical protein	NA	A0A0M4R331	Salmonella_phage	75.7	1.3e-79
AUF91782.1|2789828_2790218_-	hypothetical protein	NA	A0A0M3ULK0	Salmonella_phage	95.3	5.6e-66
AUF91783.1|2790204_2790759_-	hypothetical protein	NA	A0A0M4S631	Salmonella_phage	83.2	1.7e-79
AUF91784.1|2790755_2791163_-	DUF4054 domain-containing protein	NA	A0A0M5M3S2	Salmonella_phage	94.8	4.3e-69
AUF91785.1|2791128_2791350_-	hypothetical protein	NA	A0A0M4RTX5	Salmonella_phage	68.6	7.7e-12
AUF91786.1|2791391_2792333_-	DUF2184 domain-containing protein	NA	A0A0M3ULD3	Salmonella_phage	86.3	3.2e-155
AUF91787.1|2792344_2792851_-	hypothetical protein	NA	A0A0M4QWZ6	Salmonella_phage	79.3	1.1e-69
AUF91788.1|2792854_2794075_-	DUF2213 domain-containing protein	NA	A0A0M4R5A6	Salmonella_phage	88.0	3.2e-200
AUF91789.1|2794089_2794527_-|head	phage head morphogenesis protein	head	A0A0M4REK0	Salmonella_phage	89.7	5.0e-71
AUF91790.1|2794714_2796181_-	hypothetical protein	NA	A0A0M4S6U1	Salmonella_phage	91.8	6.7e-261
AUF91791.1|2796180_2797803_-	hypothetical protein	NA	A0A0M5M1R6	Salmonella_phage	95.4	0.0e+00
AUF91792.1|2797805_2798378_-|terminase	terminase small subunit	terminase	A0A2H4J480	uncultured_Caudovirales_phage	69.6	6.1e-61
AUF91793.1|2798439_2798964_-	hypothetical protein	NA	K7P6W1	Enterobacteria_phage	66.9	4.5e-42
AUF91794.1|2798947_2799424_-	lysozyme	NA	Q8SBE0	Shigella_phage	96.2	2.1e-86
AUF91795.1|2799427_2799769_-|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	91.9	2.8e-53
AUF91796.1|2800214_2800556_-	hypothetical protein	NA	NA	NA	NA	NA
AUF91797.1|2800587_2801010_-	antitermination protein	NA	Q8W638	Enterobacteria_phage	63.3	8.8e-41
AUF91798.1|2801291_2803484_-	replication protein	NA	B6SCY1	Bacteriophage	71.3	1.2e-173
AUF91799.1|2803487_2803700_-	XRE family transcriptional regulator	NA	A0A0R6PHL1	Moraxella_phage	42.9	7.9e-06
AUF91800.1|2803820_2804444_+	DNA-binding protein	NA	A0A1I9KG86	Aeromonas_phage	44.8	3.3e-36
AUF91801.1|2805077_2805227_+	hypothetical protein	NA	NA	NA	NA	NA
AUF91802.1|2805223_2806126_+	hypothetical protein	NA	Q3LZP9	Bacteriophage	54.4	6.1e-07
AUF91803.1|2806128_2807430_+	DUF2800 domain-containing protein	NA	B6SCX9	Bacteriophage	56.4	7.2e-134
AUF91804.1|2807445_2807994_+	DUF2815 domain-containing protein	NA	Q775A5	Bordetella_phage	65.9	1.6e-66
AUF91805.1|2808045_2808684_+	hypothetical protein	NA	H6WRY3	Salmonella_phage	68.8	3.9e-72
AUF91806.1|2808751_2809021_-	hypothetical protein	NA	NA	NA	NA	NA
AUF91807.1|2809077_2811141_+	DNA polymerase	NA	Q775A3	Bordetella_phage	67.8	8.7e-275
AUF91808.1|2811146_2811350_+	hypothetical protein	NA	K7PLX1	Enterobacteria_phage	55.4	3.2e-12
AUF91809.1|2811355_2811577_+	hypothetical protein	NA	NA	NA	NA	NA
AUF91810.1|2811566_2812049_+	class I SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	79.6	3.6e-70
AUF91811.1|2812048_2812342_+	VRR-NUC domain-containing protein	NA	B6SD64	Bacteriophage	68.2	5.0e-27
AUF91812.1|2812314_2813343_+	DNA cytosine methyltransferase	NA	Q858D4	Salmonella_phage	52.9	7.1e-100
AUF91813.1|2813339_2813660_-	hypothetical protein	NA	NA	NA	NA	NA
AUF91814.1|2813694_2815089_+	ATP-dependent helicase	NA	Q3LZN8	Bacteriophage	74.7	7.3e-217
AUF91815.1|2815085_2815286_+	DNA-binding protein	NA	NA	NA	NA	NA
AUF91816.1|2815282_2816680_-	recombinase	NA	NA	NA	NA	NA
AUF91817.1|2816894_2817155_+	ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	54.7	1.7e-18
>prophage 7
CP025251	Escherichia coli strain BH100 chromosome, complete genome	5131212	2963480	2970619	5131212		Escherichia_phage(83.33%)	6	NA	NA
AUF91980.1|2963480_2966042_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.8	1.6e-31
AUF91981.1|2966147_2966678_+	Serine/threonine protein phosphatase 2	NA	A0A077SLQ6	Escherichia_phage	46.5	2.7e-39
AUF91982.1|2966853_2967621_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	57.4	2.2e-69
AUF91983.1|2967816_2968725_+	oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.5	1.5e-117
AUF91984.1|2968721_2969984_+	3-oxo-tetronate kinase	NA	A0A077SLJ7	Escherichia_phage	61.4	2.2e-135
AUF91985.1|2969980_2970619_+	class II aldolase	NA	A0A077SK32	Escherichia_phage	75.0	3.7e-83
>prophage 8
CP025251	Escherichia coli strain BH100 chromosome, complete genome	5131212	4120302	4131864	5131212	integrase	Enterobacteria_phage(88.89%)	15	4120120:4120142	4130754:4130776
4120120:4120142	attL	GACTCCTGTGATCTTCCGCCAAA	NA	NA	NA	NA
AUF93126.1|4120302_4121490_+|integrase	integrase	integrase	Q7M297	Enterobacteria_phage	91.2	1.5e-207
AUF93127.1|4121536_4122064_-	hypothetical protein	NA	NA	NA	NA	NA
AUF93128.1|4122070_4123156_-	hypothetical protein	NA	NA	NA	NA	NA
AUF93129.1|4123452_4124025_-	Polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	96.8	5.0e-95
AUF93130.1|4124098_4124599_-	transactivation protein	NA	NA	NA	NA	NA
AUF93131.1|4124595_4125330_-	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	96.3	1.1e-126
AUF93132.1|4125882_4126149_+	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	100.0	4.9e-45
AUF93133.1|4126145_4126736_+	hypothetical protein	NA	Q7M2A7	Enterobacteria_phage	89.6	2.0e-59
AUF93134.1|4126728_4127016_+	hypothetical protein	NA	Q7M2A0	Enterobacteria_phage	97.9	8.6e-48
AUF93135.1|4127008_4127464_+	hypothetical protein	NA	Q7M298	Enterobacteria_phage	99.1	1.6e-64
AUF93136.1|4127599_4127920_+	hypothetical protein	NA	NA	NA	NA	NA
AUF93137.1|4127934_4130268_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	99.0	0.0e+00
AUF93138.1|4130245_4130455_+	hypothetical protein	NA	NA	NA	NA	NA
AUF93139.1|4130500_4130629_+	Phage protein	NA	NA	NA	NA	NA
AUF93140.1|4130826_4131864_+	2-hydroxyacid dehydrogenase	NA	Q9JMN3	Wolbachia_phage	43.6	7.4e-73
4130754:4130776	attR	GACTCCTGTGATCTTCCGCCAAA	NA	NA	NA	NA
>prophage 9
CP025251	Escherichia coli strain BH100 chromosome, complete genome	5131212	5062244	5103166	5131212	portal,lysis,holin,tail,integrase	Enterobacteria_phage(51.06%)	53	5061995:5062014	5107119:5107138
5061995:5062014	attL	TTTGCCATTATTTCTCACCC	NA	NA	NA	NA
AUF94042.1|5062244_5063459_+|integrase	site-specific integrase	integrase	A0A291AWU1	Escherichia_phage	99.3	1.6e-236
AUF94043.1|5063834_5064830_-	hypothetical protein	NA	NA	NA	NA	NA
AUF94044.1|5065203_5065398_-	DNA-binding protein	NA	A5LH59	Enterobacteria_phage	93.8	2.5e-30
AUF94045.1|5065397_5066018_-	DUF551 domain-containing protein	NA	A5LH60	Enterobacteria_phage	95.6	1.2e-118
AUF94046.1|5066017_5066380_-	hypothetical protein	NA	U5P092	Shigella_phage	95.8	1.3e-64
AUF94047.1|5066370_5066907_-	HD family hydrolase	NA	S5MW55	Escherichia_phage	100.0	7.4e-101
AUF94048.1|5067034_5067859_-	DUF2303 domain-containing protein	NA	U5P439	Shigella_phage	99.3	6.6e-149
AUF94049.1|5067924_5068287_-	hypothetical protein	NA	Q8SBF8	Shigella_phage	100.0	8.6e-61
AUF94050.1|5068359_5068584_+	hypothetical protein	NA	A0A291AWX8	Escherichia_phage	66.2	4.9e-14
AUF94051.1|5068755_5069268_+	hypothetical protein	NA	NA	NA	NA	NA
AUF94052.1|5069583_5070276_-	helix-turn-helix transcriptional regulator	NA	S5FUZ3	Shigella_phage	99.1	7.3e-125
AUF94053.1|5070373_5070634_+	XRE family transcriptional regulator	NA	S5FKP1	Shigella_phage	98.8	9.3e-41
AUF94054.1|5070626_5071178_+	hypothetical protein	NA	K7PGU3	Enterobacteria_phage	97.8	1.1e-99
AUF94055.1|5071174_5072011_+	hypothetical protein	NA	Q8SBF3	Shigella_phage	92.4	1.1e-138
AUF94056.1|5072015_5072240_+	hypothetical protein	NA	A0A291AX25	Escherichia_phage	97.3	9.1e-37
AUF94057.1|5072236_5073055_+	helix-turn-helix domain-containing protein	NA	A0A291AWW0	Escherichia_phage	99.6	4.7e-123
AUF94058.1|5073051_5073546_+	PerC family transcriptional regulator	NA	A0A291AWV6	Escherichia_phage	97.5	8.1e-86
AUF94059.1|5073545_5074199_+	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	99.5	1.9e-127
AUF94060.1|5074195_5074522_+	LexA family transcriptional regulator	NA	K7PLX6	Enterobacteria_phage	99.1	2.0e-53
AUF94061.1|5074518_5074908_+	RusA family crossover junctionendodeoxyribonuclease	NA	A0A0P0ZD39	Stx2-converting_phage	100.0	7.1e-69
AUF94062.1|5074927_5075770_+	hypothetical protein	NA	S5MC03	Escherichia_phage	91.8	5.7e-140
AUF94063.1|5075777_5076767_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	99.1	8.1e-194
AUF94064.1|5076784_5077126_+	antitermination protein	NA	A0A0P0ZCW0	Stx2-converting_phage	90.3	4.2e-57
AUF94065.1|5077138_5077687_-	hypothetical protein	NA	NA	NA	NA	NA
AUF94066.1|5077673_5078600_-	hypothetical protein	NA	NA	NA	NA	NA
AUF94067.1|5078686_5078821_+	hypothetical protein	NA	NA	NA	NA	NA
AUF94068.1|5078864_5079068_+	hypothetical protein	NA	A0A291AWX6	Escherichia_phage	98.5	3.0e-31
AUF94069.1|5079218_5080271_+	site-specific DNA-methyltransferase	NA	A5LH81	Enterobacteria_phage	98.9	2.6e-206
AUF94070.1|5080347_5080674_+|holin	phage holin, lambda family	holin	U5P0K7	Shigella_phage	98.1	2.6e-56
AUF94071.1|5080677_5081154_+	lysozyme	NA	K7PKV2	Enterobacteria_phage	95.6	2.5e-84
AUF94072.1|5081150_5081594_+|lysis	lysis protein	lysis	M1FJ79	Enterobacteria_phage	93.9	1.5e-70
AUF94073.1|5081632_5082007_+	hypothetical protein	NA	M1FPD9	Enterobacteria_phage	87.9	2.5e-55
AUF94074.1|5082105_5082288_-	hypothetical protein	NA	NA	NA	NA	NA
AUF94075.1|5082286_5082487_+	hypothetical protein	NA	K7PJR7	Enterobacteria_phage	93.9	2.3e-31
AUF94076.1|5082645_5083140_+	DUF1441 domain-containing protein	NA	A0A291AWV8	Escherichia_phage	99.4	3.8e-83
AUF94077.1|5083139_5085242_+	DNA packaging protein	NA	K7PH40	Enterobacteria_phage	99.6	0.0e+00
AUF94078.1|5085238_5085451_+	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
AUF94079.1|5085450_5086959_+|portal	phage portal protein	portal	K7PJP3	Enterobacteria_phage	99.8	1.6e-289
AUF94080.1|5086903_5088931_+	peptidase S14	NA	A5LH30	Enterobacteria_phage	99.5	0.0e+00
AUF94081.1|5088972_5089341_+	DUF2190 domain-containing protein	NA	A0A291AWX2	Escherichia_phage	100.0	9.7e-52
AUF94082.1|5089333_5089609_+	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	100.0	2.3e-45
AUF94083.1|5089620_5090199_+|tail	tail protein	tail	A5LH33	Enterobacteria_phage	99.5	2.1e-101
AUF94084.1|5090195_5090597_+|tail	tail protein	tail	A5LH34	Enterobacteria_phage	98.5	1.6e-71
AUF94085.1|5090607_5091351_+|tail	tail protein	tail	A0A291AWU6	Escherichia_phage	98.0	1.6e-130
AUF94086.1|5091411_5091798_+|tail	phage minor tail protein G	tail	K7PLV8	Enterobacteria_phage	100.0	3.3e-66
AUF94087.1|5091806_5092136_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
AUF94088.1|5092107_5095173_+|tail	Phage tail length tape-measure protein 1	tail	A0A291AWX1	Escherichia_phage	98.8	0.0e+00
AUF94089.1|5095172_5095502_+|tail	tail protein	tail	A5LH39	Enterobacteria_phage	99.1	5.1e-60
AUF94090.1|5095511_5096210_+|tail	Phage minor tail protein	tail	A5LH40	Enterobacteria_phage	99.1	1.9e-133
AUF94091.1|5096215_5096959_+|tail	Phage tail assembly protein	tail	K7PLW1	Enterobacteria_phage	98.8	2.2e-151
AUF94092.1|5096955_5097504_+|tail	Phage tail assembly protein I	tail	K7PH50	Enterobacteria_phage	98.9	4.0e-94
AUF94093.1|5097564_5101047_+|tail	Phage tail fiber protein	tail	A0A291AWT4	Escherichia_phage	89.5	0.0e+00
AUF94094.1|5101105_5103166_+	hypothetical protein	NA	A0A0E3M194	Enterobacteria_phage	54.9	5.7e-125
5107119:5107138	attR	TTTGCCATTATTTCTCACCC	NA	NA	NA	NA
>prophage 1
CP025253	Escherichia coli strain BH100 plasmid pBH100-1, complete sequence	105801	33	42997	105801	integrase,transposase	Escherichia_phage(42.11%)	58	3416:3430	38149:38163
AUF94159.1|33_1713_+|transposase	TniA putative transposase	transposase	NA	NA	NA	NA
AUF94160.1|1715_2576_+	transposition protein TniB	NA	NA	NA	NA	NA
AUF94161.1|2626_4171_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	34.6	1.0e-38
3416:3430	attL	GCGCGCCAGCTTCAG	NA	NA	NA	NA
AUF94162.1|4293_5817_+|transposase	IS21 family transposase IS1326	transposase	A0A2L1IVA1	Escherichia_phage	24.2	1.2e-15
AUF94163.1|5806_6589_+	ATP-binding protein	NA	A0A2L1IVB6	Escherichia_phage	35.0	2.5e-33
AUF94164.1|6764_7265_-	N-acetyltransferase	NA	NA	NA	NA	NA
AUF94165.1|7283_7463_+	hypothetical protein	NA	NA	NA	NA	NA
AUF94166.1|7392_8232_-	sulfonamide-resistant dihydropteroate synthaseSul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
AUF94167.1|8225_8573_-	quaternary ammonium compound efflux SMRtransporter QacE delta 1	NA	NA	NA	NA	NA
AUF94168.1|8736_9528_-	ANT(3'')-Ia family aminoglycosidenucleotidyltransferase AadA1	NA	NA	NA	NA	NA
AUF94169.1|9676_10690_+|integrase	integron integrase	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
AUF94170.1|10628_11243_+	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
AUF94171.1|11368_11929_+|transposase	transposase	transposase	A0A1B0V7I5	Salmonella_phage	86.2	4.0e-49
AUF94172.1|11931_14898_+|transposase	Tn3 family transposase TnAs3	transposase	A0A1B0V7H9	Salmonella_phage	73.6	0.0e+00
AUF94173.1|14964_15342_+	N-acetyltransferase	NA	NA	NA	NA	NA
AUF94174.1|15542_16202_-	type A-1 chloramphenicol O-acetyltransferase	NA	G3CFL0	Escherichia_phage	100.0	8.4e-131
AUF94175.1|16255_16447_+	hypothetical protein	NA	NA	NA	NA	NA
AUF94176.1|16480_16756_+	Mobile element protein	NA	Q71TE9	Escherichia_phage	100.0	3.1e-47
AUF94177.1|16800_17178_+	Mobile element protein	NA	Q71TF0	Escherichia_phage	100.0	1.3e-67
AUF94178.1|18583_18727_-	hypothetical protein	NA	NA	NA	NA	NA
AUF94179.1|18723_18960_-	hypothetical protein	NA	NA	NA	NA	NA
AUF94180.1|18988_19270_+	hypothetical protein	NA	NA	NA	NA	NA
AUF94181.1|19392_19743_-	protein stbB	NA	NA	NA	NA	NA
AUF94182.1|19745_20708_-	plasmid segregation protein ParM	NA	A0A222YXF2	Escherichia_phage	53.9	4.1e-94
AUF94183.1|20854_21148_+	hypothetical protein	NA	NA	NA	NA	NA
AUF94184.1|21088_21268_-	hypothetical protein	NA	NA	NA	NA	NA
AUF94185.1|21224_21908_+	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	37.4	5.6e-29
AUF94186.1|21908_22130_+	hypothetical protein	NA	NA	NA	NA	NA
AUF94187.1|22143_22578_+	DUF1380 domain-containing protein	NA	NA	NA	NA	NA
AUF94188.1|22577_23405_+	hypothetical protein	NA	NA	NA	NA	NA
AUF94189.1|23379_23850_+	DUF1472 domain-containing protein	NA	NA	NA	NA	NA
AUF94190.1|23822_24248_+	Putative antirestriction protein	NA	NA	NA	NA	NA
AUF94191.1|24294_24717_+	DUF1380 domain-containing protein	NA	NA	NA	NA	NA
AUF94192.1|24713_24905_+	hypothetical protein	NA	NA	NA	NA	NA
AUF94193.1|25177_25426_-	hypothetical protein	NA	NA	NA	NA	NA
AUF94194.1|25422_25680_-	hypothetical protein	NA	NA	NA	NA	NA
AUF94195.1|25771_25921_-	hypothetical protein	NA	NA	NA	NA	NA
AUF94196.1|25942_26173_+	hypothetical protein	NA	NA	NA	NA	NA
AUF94197.1|26224_27586_+	DUF3560 domain-containing protein	NA	NA	NA	NA	NA
AUF94198.1|27632_28196_+	class I SAM-dependent methyltransferase	NA	A8HNV9	Thalassomonas_phage	37.3	4.7e-21
AUF94199.1|28281_28749_-	hypothetical protein	NA	NA	NA	NA	NA
AUF94200.1|28896_29025_+	Single-stranded DNA-binding protein	NA	NA	NA	NA	NA
AUF94201.1|29011_29578_+	single-stranded DNA-binding protein	NA	I3PGW4	Xanthomonas_phage	74.4	8.5e-47
AUF94202.1|29635_29869_+	DUF905 domain-containing protein	NA	NA	NA	NA	NA
AUF94203.1|29929_31351_+	chromosome partitioning protein ParB	NA	G8DH78	Emiliania_huxleyi_virus	29.2	1.2e-20
AUF94204.1|31420_32629_+|transposase	IS4 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	100.0	1.8e-235
AUF94205.1|32638_32764_-	LysR family transcriptional regulator YeiE	NA	NA	NA	NA	NA
AUF94206.1|32994_34200_-	sodium/glutamate symporter	NA	NA	NA	NA	NA
AUF94207.1|34643_34964_+	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
AUF94208.1|35149_36130_-	Mobile element protein	NA	A0A077SK28	Escherichia_phage	98.8	1.7e-183
AUF94209.1|36175_36457_-	glutamine ABC transporter substrate-bindingprotein GlnH	NA	NA	NA	NA	NA
AUF94210.1|36589_37141_-	hypothetical protein	NA	NA	NA	NA	NA
AUF94211.1|37137_38481_-	aspartate aminotransferase family protein	NA	NA	NA	NA	NA
38149:38163	attR	GCGCGCCAGCTTCAG	NA	NA	NA	NA
AUF94212.1|38613_39471_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
AUF94213.1|39800_40241_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AUF94214.1|40314_40767_-	L-serine ammonia-lyase	NA	NA	NA	NA	NA
AUF94215.1|40871_41687_+	aminoglycoside O-phosphotransferase APH(3')-Ia	NA	A0A193DTG4	Autographa_californica_nuclear_polyhedrosis_virus	98.5	4.3e-161
AUF94216.1|42016_42997_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	98.8	1.7e-183
