The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP015572	Pasteurella multocida strain USDA-ARS-USMARC-60381 chromosome, complete genome	2344125	338131	396033	2344125	integrase,holin,coat,terminase,head,transposase,tail	Mannheimia_phage(37.5%)	72	337630:337680	390104:390154
337630:337680	attL	AATTAATGGCACGCCCTATTGGATTCGAACCAATGACCTACGGCTTAGAAG	NA	NA	NA	NA
AUK55269.1|338131_338548_-|transposase	transposase	transposase	A0A1S5RHE3	Helicobacter_phage	63.5	3.3e-48
AUK55270.1|338594_339731_+|transposase	transposase	transposase	A0A1B0VCD8	Salmonella_phage	58.0	3.8e-123
AUK55271.1|339870_340197_-	hypothetical protein	NA	NA	NA	NA	NA
AUK55272.1|346142_346733_-|tail	phage tail protein	tail	A0A0M3LQC4	Mannheimia_phage	57.1	3.1e-52
AUK55273.1|346675_347416_-|tail	phage tail protein	tail	A0A0M3LQI5	Mannheimia_phage	60.0	1.3e-84
AUK55274.1|347418_348123_-|tail	phage minor tail protein L	tail	A0A0M3LPR8	Mannheimia_phage	64.1	1.6e-82
AUK55275.1|348119_350834_-	hypothetical protein	NA	A0A0M3LS69	Mannheimia_phage	39.1	5.1e-174
AUK55276.1|350956_351652_-	hypothetical protein	NA	NA	NA	NA	NA
AUK57013.1|351956_352286_-|tail	phage tail protein	tail	A0A0M3LQW6	Mannheimia_phage	49.1	4.8e-26
AUK55277.1|352326_352668_-	hypothetical protein	NA	A0A0M3LQT0	Mannheimia_phage	53.8	2.7e-24
AUK55278.1|352655_353072_-	hypothetical protein	NA	NA	NA	NA	NA
AUK55279.1|353144_354161_-	hypothetical protein	NA	A0A0M3LQ19	Mannheimia_phage	69.9	7.6e-131
AUK55280.1|354173_354566_-	hypothetical protein	NA	A0A0M3LQB6	Mannheimia_phage	46.2	5.5e-29
AUK57014.1|354565_354967_-	hypothetical protein	NA	A0A0M3LPJ5	Mannheimia_phage	61.4	2.1e-39
AUK55281.1|354968_355343_-	hypothetical protein	NA	NA	NA	NA	NA
AUK55282.1|355344_355812_-	hypothetical protein	NA	A0A0M3LSP7	Mannheimia_phage	55.7	1.4e-34
AUK55283.1|355828_356065_-	hypothetical protein	NA	NA	NA	NA	NA
AUK55284.1|356121_357279_-|coat	P22 coat - protein 5 family protein	coat	G8C7P7	Escherichia_phage	43.3	8.3e-81
AUK55285.1|357296_358067_-	hypothetical protein	NA	A0A1V0DY60	Dinoroseobacter_phage	36.2	1.5e-25
AUK55286.1|358402_358837_-	guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	D0UIJ3	Aggregatibacter_phage	61.2	3.1e-41
AUK55287.1|358811_359030_-	hypothetical protein	NA	NA	NA	NA	NA
AUK57015.1|359032_360634_-|head	phage head morphogenesis protein	head	A0A0M3LQ07	Mannheimia_phage	52.1	3.3e-152
AUK55288.1|360623_362027_-	hypothetical protein	NA	A0A0M3LQA1	Mannheimia_phage	59.6	4.4e-153
AUK55289.1|362036_363308_-|terminase	terminase	terminase	A0A1B1P9C9	Acinetobacter_phage	61.7	8.6e-148
AUK57016.1|363310_363832_-	hypothetical protein	NA	A0A2H4J1J5	uncultured_Caudovirales_phage	38.6	9.0e-19
AUK55290.1|364216_364645_-	hypothetical protein	NA	NA	NA	NA	NA
AUK55291.1|364631_365333_-	phosphoadenosine phosphosulfate reductase	NA	NA	NA	NA	NA
AUK55292.1|365471_365852_+	hypothetical protein	NA	NA	NA	NA	NA
AUK55293.1|365839_366094_+	hypothetical protein	NA	NA	NA	NA	NA
AUK55294.1|366223_366580_-	hypothetical protein	NA	NA	NA	NA	NA
AUK55295.1|366858_367182_-	hypothetical protein	NA	NA	NA	NA	NA
AUK55296.1|367184_367769_-	hypothetical protein	NA	Q7Y5V0	Haemophilus_phage	55.3	6.5e-58
AUK55297.1|367740_368106_-|holin	phage holin, lambda family	holin	NA	NA	NA	NA
AUK55298.1|368694_369060_-	hypothetical protein	NA	A0A0M3LR87	Mannheimia_phage	27.3	3.5e-09
AUK55299.1|369059_369662_-	recombinase NinG	NA	H6WRY9	Salmonella_phage	38.2	6.3e-32
AUK55300.1|369749_369962_-	hypothetical protein	NA	NA	NA	NA	NA
AUK55301.1|370035_370494_-	NinB protein	NA	Q7Y5V7	Haemophilus_phage	53.4	5.8e-38
AUK57017.1|370483_371014_-	phage N-6-adenine-methyltransferase	NA	A0A0M3LNW2	Mannheimia_phage	58.9	1.0e-54
AUK55302.1|371023_371713_-	replication protein P	NA	D0UIL4	Aggregatibacter_phage	34.1	1.4e-32
AUK55303.1|371712_372615_-	hypothetical protein	NA	A0A0U4JX08	Bacillus_phage	37.7	5.5e-32
AUK55304.1|372616_372970_-	hypothetical protein	NA	A0A1C9LVX4	Vibrio_phage	33.6	1.3e-08
AUK55305.1|372966_373668_-	DNA-binding protein	NA	A0A2I7RHG4	Vibrio_phage	55.8	7.1e-35
AUK55306.1|373725_374001_-	hypothetical protein	NA	NA	NA	NA	NA
AUK55307.1|374021_374231_-	transcriptional regulator	NA	A0A077K9X2	Edwardsiella_phage	52.3	5.5e-12
AUK55308.1|374358_375048_+	transcriptional regulator	NA	Q7Y5W5	Haemophilus_phage	58.2	1.7e-73
AUK55309.1|375193_375457_+	hexulose-6-phosphate synthase	NA	NA	NA	NA	NA
AUK55310.1|375459_375939_+	HicB	NA	K7PJX6	Enterobacterial_phage	47.1	8.3e-19
AUK55311.1|375935_376319_+	hypothetical protein	NA	NA	NA	NA	NA
AUK55312.1|376937_377168_+	hypothetical protein	NA	A0A0M3LNV4	Mannheimia_phage	52.8	3.4e-10
AUK55313.1|377759_378305_+|integrase	integrase	integrase	NA	NA	NA	NA
AUK55314.1|378570_379218_+	antirepressor	NA	Q7Y5V4	Haemophilus_phage	64.2	3.5e-36
AUK55315.1|379279_379591_-	hypothetical protein	NA	NA	NA	NA	NA
AUK55316.1|379657_379942_+	hypothetical protein	NA	NA	NA	NA	NA
AUK55317.1|379928_380165_+	hypothetical protein	NA	NA	NA	NA	NA
AUK55318.1|380342_381323_+	hypothetical protein	NA	A0A0M3LR66	Mannheimia_phage	40.1	3.4e-51
AUK55319.1|381326_382178_+	phage recombination protein Bet	NA	A0A2H4JAQ4	uncultured_Caudovirales_phage	63.9	4.8e-62
AUK55320.1|382170_382782_+	exonuclease	NA	A0A0M3LPU0	Mannheimia_phage	76.4	6.3e-88
AUK55321.1|382785_383250_+	single-stranded DNA-binding protein	NA	A0A2I7RK19	Vibrio_phage	69.0	6.1e-35
AUK55322.1|383261_383453_+	hypothetical protein	NA	NA	NA	NA	NA
AUK55323.1|383495_383849_+	hypothetical protein	NA	I6XKT1	Burkholderia_virus	31.8	1.7e-05
AUK55324.1|383920_384709_+	hypothetical protein	NA	C5IHK3	Burkholderia_virus	29.2	3.2e-20
AUK55325.1|384759_385359_+	hypothetical protein	NA	A0A218KC93	Bacillus_phage	34.2	3.9e-18
AUK55326.1|385355_385721_+	hypothetical protein	NA	NA	NA	NA	NA
AUK55327.1|385932_386421_+	hypothetical protein	NA	A0A0M3LS47	Mannheimia_phage	51.2	3.2e-34
AUK55328.1|386524_387433_+	hypothetical protein	NA	A0A0M4S6X1	Salmonella_phage	36.1	2.5e-40
AUK55329.1|387677_387899_+	hypothetical protein	NA	NA	NA	NA	NA
AUK55330.1|387909_388632_+	DNA-binding protein	NA	G0ZND1	Cronobacter_phage	52.5	3.3e-35
AUK55331.1|389021_390077_+|integrase	integrase	integrase	A0A077KGX2	Edwardsiella_phage	37.9	1.6e-62
AUK55332.1|390451_391306_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase	NA	A0A249XZQ2	Enterococcus_phage	40.3	5.8e-31
390104:390154	attR	AATTAATGGCACGCCCTATTGGATTCGAACCAATGACCTACGGCTTAGAAG	NA	NA	NA	NA
AUK55333.1|391882_392347_-|transposase	transposase	transposase	A0A0A8WIU6	Clostridium_phage	36.1	2.3e-13
AUK55334.1|392529_393030_-	single-stranded DNA-binding protein	NA	I3PUY5	Vibrio_phage	55.6	4.0e-40
AUK55335.1|393201_396033_+	excinuclease ABC subunit A	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	57.3	0.0e+00
>prophage 2
CP015572	Pasteurella multocida strain USDA-ARS-USMARC-60381 chromosome, complete genome	2344125	747052	756410	2344125	tRNA	Planktothrix_phage(16.67%)	9	NA	NA
AUK55634.1|747052_748051_+	dipeptide ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.4	2.3e-15
AUK55635.1|748067_749048_+	dipeptide ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	26.4	1.3e-15
AUK55636.1|749124_749910_-	high-affinity zinc transporter membrane component	NA	NA	NA	NA	NA
AUK55637.1|749918_750710_-	zinc ABC transporter ATP-binding protein ZnuC	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	29.7	4.4e-17
AUK55638.1|750944_752498_+	peptidase M23	NA	A0A2K9VGT1	Pontimonas_phage	49.6	8.4e-20
AUK55639.1|752573_753521_-	ribose-phosphate pyrophosphokinase	NA	A0A2K9L2G2	Tupanvirus	38.7	1.9e-43
AUK55640.1|753590_754478_-	4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase	NA	NA	NA	NA	NA
AUK55641.1|754477_755095_-	lipoprotein localization factor LolB	NA	NA	NA	NA	NA
AUK55642.1|755135_756410_-|tRNA	multifunctional CCA tRNA nucleotidyl transferase/2'3'-cyclic phosphodiesterase/2'nucleotidase/phosphatase	tRNA	A0A0F6YPT7	Sinorhizobium_phage	49.5	1.8e-92
>prophage 3
CP015572	Pasteurella multocida strain USDA-ARS-USMARC-60381 chromosome, complete genome	2344125	1720181	1823277	2344125	tRNA,integrase,terminase,transposase,tail	Mannheimia_phage(42.37%)	109	1777292:1777337	1823382:1823427
AUK56419.1|1720181_1720646_-|transposase	transposase	transposase	A0A0A8WIU6	Clostridium_phage	36.1	2.3e-13
AUK56420.1|1720827_1721556_-	hypothetical protein	NA	A0A0R6PEZ3	Moraxella_phage	38.1	4.9e-31
AUK56421.1|1721621_1722290_-	DNA mismatch repair endonuclease MutH	NA	NA	NA	NA	NA
AUK56422.1|1722299_1722842_-	cysteine methyltransferase	NA	M1PFU9	Streptococcus_phage	45.7	4.8e-23
AUK56423.1|1722904_1724215_-	hypothetical protein	NA	NA	NA	NA	NA
AUK56424.1|1724459_1724750_+	hypothetical protein	NA	NA	NA	NA	NA
AUK56425.1|1724797_1726459_-	transporter	NA	NA	NA	NA	NA
AUK56426.1|1728548_1729103_+	hypothetical protein	NA	NA	NA	NA	NA
AUK56427.1|1729320_1730976_+	alpha-D-phosphohexomutase	NA	A0A1X9I671	Streptococcus_phage	34.9	7.4e-83
AUK56428.1|1731065_1732145_-	endonuclease	NA	NA	NA	NA	NA
AUK56429.1|1732625_1733180_+	hypothetical protein	NA	NA	NA	NA	NA
AUK56430.1|1733487_1734276_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUK56431.1|1734288_1735233_+	ABC transporter permease	NA	NA	NA	NA	NA
AUK56432.1|1735244_1735982_+	ferrichrome ABC transporter ATP-binding protein	NA	M1HP82	Acanthocystis_turfacea_Chlorella_virus	32.5	1.5e-14
AUK56433.1|1736127_1738557_-	TonB-dependent receptor	NA	NA	NA	NA	NA
AUK56434.1|1739021_1740047_-	hypothetical protein	NA	NA	NA	NA	NA
AUK56435.1|1741064_1742303_+	hypothetical protein	NA	A0A0R6PKN1	Moraxella_phage	25.6	1.0e-12
AUK56436.1|1742316_1742889_+	hypothetical protein	NA	NA	NA	NA	NA
AUK56437.1|1743304_1747198_-	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	53.4	1.7e-114
AUK56438.1|1747422_1747722_-	Fis family transcriptional regulator	NA	NA	NA	NA	NA
AUK56439.1|1747702_1748707_-|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
AUK56440.1|1748983_1749865_-	ribosomal protein L11 methyltransferase	NA	NA	NA	NA	NA
AUK56441.1|1750007_1751441_-	sodium/panthothenate symporter	NA	NA	NA	NA	NA
AUK56442.1|1751430_1751682_-	hypothetical protein	NA	NA	NA	NA	NA
AUK56443.1|1751764_1753111_-	acetyl-CoA carboxylase biotin carboxylase subunit	NA	NA	NA	NA	NA
AUK56444.1|1753212_1753674_-	acetyl-CoA carboxylase, biotin carboxyl carrier protein	NA	NA	NA	NA	NA
AUK56445.1|1753828_1754275_-	type II 3-dehydroquinate dehydratase	NA	NA	NA	NA	NA
AUK56446.1|1754345_1755359_-	o-succinylbenzoate synthase	NA	NA	NA	NA	NA
AUK56447.1|1755611_1756469_-	1,4-dihydroxy-2-naphthoyl-CoA synthase	NA	NA	NA	NA	NA
AUK56448.1|1756579_1757833_-	hypothetical protein	NA	NA	NA	NA	NA
AUK56449.1|1758114_1759017_+|tRNA	glycine--tRNA ligase subunit alpha	tRNA	NA	NA	NA	NA
AUK56450.1|1759047_1759311_+	hypothetical protein	NA	NA	NA	NA	NA
AUK56451.1|1759328_1759952_+	glutathione S-transferase	NA	NA	NA	NA	NA
AUK56452.1|1760082_1760463_+	hypothetical protein	NA	NA	NA	NA	NA
AUK56453.1|1760492_1762562_+|tRNA	glycine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
AUK56454.1|1762697_1764116_-	aspartate ammonia-lyase	NA	NA	NA	NA	NA
AUK56455.1|1764444_1766016_+	aminobenzoyl-glutamate transporter	NA	NA	NA	NA	NA
AUK56456.1|1766146_1766617_+	membrane protein FxsA	NA	NA	NA	NA	NA
AUK56457.1|1766705_1766996_+	co-chaperone GroES	NA	A0A221S322	uncultured_virus	40.0	4.5e-12
AUK56458.1|1767091_1768726_+	chaperonin GroL	NA	A0A2I7SAK5	Vibrio_phage	68.6	1.7e-188
AUK56459.1|1769578_1770376_+	ABC transporter	NA	NA	NA	NA	NA
AUK56460.1|1770377_1770977_+	iron ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	33.5	9.7e-17
AUK56461.1|1770994_1771843_+	ModD protein	NA	NA	NA	NA	NA
AUK56462.1|1771942_1773775_-	DEAD/DEAH family ATP-dependent RNA helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.7	1.8e-53
AUK56463.1|1773882_1774779_-	lipoprotein NlpI-like protein	NA	NA	NA	NA	NA
AUK56464.1|1774862_1777007_-	polyribonucleotide nucleotidyltransferase	NA	NA	NA	NA	NA
1777292:1777337	attL	TGGTGGAGATAATCGGGATCGAACCGACGACCTCTTGCATGCCATG	NA	NA	NA	NA
AUK56465.1|1777758_1778175_-|transposase	transposase	transposase	A0A1S5RHE3	Helicobacter_phage	63.5	3.3e-48
AUK56466.1|1778221_1779358_+|transposase	transposase	transposase	A0A1B0VCD8	Salmonella_phage	58.0	3.8e-123
AUK56467.1|1779497_1779824_-	hypothetical protein	NA	NA	NA	NA	NA
AUK56468.1|1779871_1784875_-	host specificity protein	NA	A0A0M3LQ61	Mannheimia_phage	38.8	6.2e-250
AUK56469.1|1784878_1785499_-|tail	phage tail protein	tail	A0A0M3LQC4	Mannheimia_phage	57.4	1.1e-52
AUK56470.1|1785441_1786185_-|tail	phage tail protein	tail	A0A0M3LQI5	Mannheimia_phage	59.6	7.4e-83
AUK56471.1|1786189_1786903_-|tail	phage minor tail protein L	tail	A0A0M3LPR8	Mannheimia_phage	63.9	2.1e-82
AUK56472.1|1786992_1787322_-	hypothetical protein	NA	S5MW28	Escherichia_phage	37.1	3.2e-14
AUK57052.1|1787324_1789769_-|tail	tail length tape measure protein	tail	A0A0M3LSE2	Mannheimia_phage	57.0	1.6e-150
AUK56473.1|1789827_1790223_-	hypothetical protein	NA	A0A0M3LR23	Mannheimia_phage	83.2	7.7e-55
AUK56474.1|1790290_1790755_-	hypothetical protein	NA	A0A0M3LR40	Mannheimia_phage	50.0	5.2e-34
AUK56475.1|1790785_1791457_-	hypothetical protein	NA	A0A0M3LPR4	Mannheimia_phage	42.9	1.5e-42
AUK56476.1|1791510_1791993_-|tail	phage tail protein	tail	A0A0M3LPR0	Mannheimia_phage	62.0	2.0e-44
AUK56477.1|1792004_1792376_-	hypothetical protein	NA	NA	NA	NA	NA
AUK56478.1|1792372_1792744_-	hypothetical protein	NA	F1C5E3	Cronobacter_phage	51.2	1.3e-24
AUK56479.1|1792748_1793093_-	hypothetical protein	NA	A0A0M3LSC9	Mannheimia_phage	57.9	3.0e-31
AUK56480.1|1793095_1793464_-	hypothetical protein	NA	A0A0M3LQS8	Mannheimia_phage	42.1	4.7e-22
AUK56481.1|1793444_1793831_-	hypothetical protein	NA	A0A0M3LR32	Mannheimia_phage	73.9	4.2e-13
AUK56482.1|1793841_1794840_-	encapsulating for peroxidase	NA	A0A0M3LQZ1	Mannheimia_phage	74.7	9.1e-145
AUK56483.1|1794851_1795286_-	hypothetical protein	NA	A0A0M3LPQ2	Mannheimia_phage	75.7	1.1e-54
AUK56484.1|1795285_1796632_-	hypothetical protein	NA	A0A0M3LQ78	Mannheimia_phage	55.3	4.0e-127
AUK56485.1|1796646_1797618_-	hypothetical protein	NA	F1C5D8	Cronobacter_phage	41.0	1.6e-53
AUK56486.1|1797571_1799017_-	hypothetical protein	NA	A0A0M3LPQ5	Mannheimia_phage	58.6	2.4e-146
AUK56487.1|1799031_1800258_-|terminase	terminase	terminase	A0A0M3LTA2	Mannheimia_phage	77.0	9.4e-192
AUK56488.1|1800241_1800739_-|terminase	terminase	terminase	C7U0W1	Enterobacteria_phage	70.7	7.4e-47
AUK56489.1|1801032_1801467_+	CopG family transcriptional regulator	NA	A0A0R6PJ17	Moraxella_phage	38.0	1.0e-20
AUK56490.1|1801688_1802012_-	hypothetical protein	NA	NA	NA	NA	NA
AUK56491.1|1801984_1802515_-	glycoside hydrolase	NA	A0A0M3LPQ1	Mannheimia_phage	50.9	9.7e-45
AUK57053.1|1802511_1802766_-	hypothetical protein	NA	NA	NA	NA	NA
AUK56492.1|1803360_1803726_-	hypothetical protein	NA	A0A0M3LR87	Mannheimia_phage	27.3	3.5e-09
AUK56493.1|1803725_1804328_-	recombinase NinG	NA	H6WRY9	Salmonella_phage	38.2	6.3e-32
AUK56494.1|1804415_1804628_-	hypothetical protein	NA	NA	NA	NA	NA
AUK56495.1|1804701_1805160_-	NinB protein	NA	Q7Y5V7	Haemophilus_phage	53.4	5.8e-38
AUK57054.1|1805149_1805680_-	phage N-6-adenine-methyltransferase	NA	A0A0M3LNW2	Mannheimia_phage	58.9	1.0e-54
AUK56496.1|1805689_1806379_-	replication protein P	NA	D0UIL4	Aggregatibacter_phage	34.1	1.4e-32
AUK56497.1|1806378_1807281_-	hypothetical protein	NA	A0A0U4JX08	Bacillus_phage	37.7	5.5e-32
AUK56498.1|1807282_1807636_-	hypothetical protein	NA	A0A1C9LVX4	Vibrio_phage	33.6	1.3e-08
AUK56499.1|1807632_1808334_-	DNA-binding protein	NA	A0A2I7RHG4	Vibrio_phage	55.8	7.1e-35
AUK56500.1|1808391_1808667_-	hypothetical protein	NA	NA	NA	NA	NA
AUK56501.1|1808687_1808897_-	transcriptional regulator	NA	A0A077K9X2	Edwardsiella_phage	52.3	5.5e-12
AUK56502.1|1809024_1809714_+	transcriptional regulator	NA	Q7Y5W5	Haemophilus_phage	58.2	1.7e-73
AUK56503.1|1809859_1810123_+	hexulose-6-phosphate synthase	NA	NA	NA	NA	NA
AUK56504.1|1810125_1810605_+	HicB	NA	K7PJX6	Enterobacterial_phage	47.1	8.3e-19
AUK56505.1|1810601_1810985_+	hypothetical protein	NA	NA	NA	NA	NA
AUK56506.1|1811603_1811834_+	hypothetical protein	NA	A0A0M3LNV4	Mannheimia_phage	52.8	3.4e-10
AUK56507.1|1812058_1812322_+	hypothetical protein	NA	NA	NA	NA	NA
AUK56508.1|1812409_1812943_+	hypothetical protein	NA	NA	NA	NA	NA
AUK56509.1|1813404_1814040_+	antirepressor	NA	A6XMM0	Bacillus_virus	53.3	2.1e-22
AUK56510.1|1814101_1814413_-	hypothetical protein	NA	NA	NA	NA	NA
AUK56511.1|1814479_1814764_+	hypothetical protein	NA	NA	NA	NA	NA
AUK56512.1|1814750_1814987_+	hypothetical protein	NA	NA	NA	NA	NA
AUK56513.1|1815164_1816145_+	hypothetical protein	NA	A0A0M3LR66	Mannheimia_phage	40.1	3.4e-51
AUK56514.1|1816148_1817000_+	phage recombination protein Bet	NA	A0A2H4JAQ4	uncultured_Caudovirales_phage	63.9	4.8e-62
AUK56515.1|1816992_1817604_+	exonuclease	NA	A0A0M3LPU0	Mannheimia_phage	76.4	6.3e-88
AUK56516.1|1817607_1818072_+	single-stranded DNA-binding protein	NA	A0A2I7RK19	Vibrio_phage	69.0	6.1e-35
AUK56517.1|1818083_1818275_+	hypothetical protein	NA	NA	NA	NA	NA
AUK56518.1|1818317_1818671_+	hypothetical protein	NA	I6XKT1	Burkholderia_virus	31.8	1.7e-05
AUK56519.1|1818742_1819531_+	hypothetical protein	NA	C5IHK3	Burkholderia_virus	29.2	3.2e-20
AUK56520.1|1819581_1820181_+	hypothetical protein	NA	A0A218KC93	Bacillus_phage	34.2	3.0e-18
AUK56521.1|1820315_1820849_+	hypothetical protein	NA	A0A0M3LS47	Mannheimia_phage	36.6	1.3e-20
AUK56522.1|1820858_1821158_+	hypothetical protein	NA	NA	NA	NA	NA
AUK56523.1|1821243_1821729_+	hypothetical protein	NA	A0A0M3LQA6	Mannheimia_phage	40.2	1.2e-20
AUK56524.1|1822104_1823277_+|integrase	integrase	integrase	A0A059VF45	Pseudomonas_phage	52.9	5.9e-111
1823382:1823427	attR	TGGTGGAGATAATCGGGATCGAACCGACGACCTCTTGCATGCCATG	NA	NA	NA	NA
