The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP018892	Bordetella holmesii isolate F617 chromosome, complete genome	3699592	179305	227795	3699592	transposase	Ralstonia_virus(20.0%)	46	NA	NA
AUL24848.1|179305_180526_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
AUL24849.1|180641_181385_-	hypothetical protein	NA	NA	NA	NA	NA
AUL24850.1|181554_182661_+	S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase	NA	A0A0K0KVL7	Prochlorococcus_phage	28.1	1.4e-32
AUL24851.1|182671_183511_+	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
AUL24852.1|183568_184258_+	hypothetical protein	NA	NA	NA	NA	NA
AUL24853.1|184354_184807_+	hypothetical protein	NA	NA	NA	NA	NA
AUL24854.1|184810_186031_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
AUL24855.1|186254_187142_+	RNA polymerase factor sigma-32	NA	A0A248SJA5	Salicola_phage	38.5	2.1e-39
AUL27845.1|187456_188242_-	phosphodiesterase	NA	NA	NA	NA	NA
AUL24856.1|191084_191861_-	NUDIX hydrolase	NA	NA	NA	NA	NA
AUL24857.1|192353_192614_+|transposase	transposase	transposase	NA	NA	NA	NA
AUL24858.1|193510_193780_+	cytochrome c oxidase subunit II	NA	NA	NA	NA	NA
AUL24859.1|193751_194102_+	bifunctional protein GlmU	NA	NA	NA	NA	NA
AUL24860.1|194200_195151_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
AUL24861.1|195252_196869_+	cytochrome c oxidase subunit I	NA	R9VX24	Flavobacterium_phage	38.2	1.5e-08
AUL27846.1|196934_197159_+	hypothetical protein	NA	NA	NA	NA	NA
AUL24862.1|197192_198068_+	cytochrome c oxidase subunit 3	NA	NA	NA	NA	NA
AUL24863.1|198120_198321_-	hypothetical protein	NA	NA	NA	NA	NA
AUL24864.1|198355_199114_+	hypothetical protein	NA	NA	NA	NA	NA
AUL24865.1|199122_199713_+	hypothetical protein	NA	NA	NA	NA	NA
AUL27847.1|199717_200731_+	heme A synthase	NA	NA	NA	NA	NA
AUL24866.1|200758_201655_+	protoheme IX farnesyltransferase	NA	NA	NA	NA	NA
AUL27848.1|201678_202287_+	SCO family protein	NA	NA	NA	NA	NA
AUL27849.1|202299_202527_-	hypothetical protein	NA	NA	NA	NA	NA
AUL24867.1|203238_204003_+	transcriptional regulator	NA	NA	NA	NA	NA
AUL24868.1|204068_205442_+	UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase	NA	A0A0N7G7I9	Chrysochromulina_ericina_virus	35.1	6.7e-29
AUL24869.1|205438_206833_+	MFS transporter	NA	NA	NA	NA	NA
AUL27850.1|206924_208247_+	UDP-glucose 6-dehydrogenase	NA	A0A127AXI2	Bacillus_phage	37.8	1.3e-74
AUL24870.1|208243_209299_+	glycosyl transferase	NA	NA	NA	NA	NA
AUL24871.1|209299_209821_-	AsnC family transcriptional regulator	NA	NA	NA	NA	NA
AUL24872.1|209968_211801_+	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	A7IW18	Paramecium_bursaria_Chlorella_virus	48.4	5.0e-157
AUL24873.1|211967_212165_+	serum resistance protein BrkB	NA	NA	NA	NA	NA
AUL24874.1|214740_215031_-	hypothetical protein	NA	NA	NA	NA	NA
AUL27851.1|215027_216509_-	peptidase	NA	NA	NA	NA	NA
AUL24875.1|216636_217668_-	histidine kinase	NA	NA	NA	NA	NA
AUL24876.1|217741_218332_-	RNA polymerase subunit sigma	NA	NA	NA	NA	NA
AUL24877.1|218884_219802_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUL27852.1|219945_220980_+	4-hydroxythreonine-4-phosphate dehydrogenase	NA	NA	NA	NA	NA
AUL24878.1|221009_222182_+	L-rhamnonate dehydratase	NA	Q6A202	Oenococcus_phage	29.6	1.5e-34
AUL24879.1|222178_223117_+	dihydrodipicolinate synthase family protein	NA	NA	NA	NA	NA
AUL24880.1|223341_224181_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUL24881.1|224177_225641_+	sulfatase	NA	NA	NA	NA	NA
AUL24882.1|225654_226425_+	cytochrome B	NA	NA	NA	NA	NA
AUL24883.1|226438_226918_+	gluconolactonase	NA	NA	NA	NA	NA
AUL24884.1|226941_227202_+|transposase	transposase	transposase	NA	NA	NA	NA
AUL24885.1|227294_227795_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	50.3	9.5e-42
>prophage 2
CP018892	Bordetella holmesii isolate F617 chromosome, complete genome	3699592	588464	657298	3699592	transposase,tRNA	Staphylococcus_phage(21.43%)	59	NA	NA
AUL25190.1|588464_589328_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
AUL25191.1|589411_590539_-	anhydro-N-acetylmuramic acid kinase	NA	NA	NA	NA	NA
AUL25192.1|590547_591963_-	metallopeptidase	NA	A8ATH6	Listeria_phage	42.7	6.7e-16
AUL25193.1|592242_593472_+|tRNA	tyrosine--tRNA ligase	tRNA	NA	NA	NA	NA
AUL25194.1|593510_594167_+	phospholipid-binding protein	NA	NA	NA	NA	NA
AUL25195.1|594370_595621_+	serine hydroxymethyltransferase	NA	A0A219YCZ0	Aeromonas_phage	52.2	2.8e-98
AUL25196.1|595781_596267_+	transcriptional regulator NrdR	NA	NA	NA	NA	NA
AUL25197.1|596271_597234_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AUL25198.1|597233_597794_-	hydrolase	NA	NA	NA	NA	NA
AUL25199.1|597829_599104_+	riboflavin biosynthesis protein RibD	NA	A0A2H4PQS8	Staphylococcus_phage	31.9	1.5e-38
AUL25200.1|599125_599767_+	riboflavin synthase subunit alpha	NA	A0A2H4PQS5	Staphylococcus_phage	36.1	7.2e-26
AUL25201.1|602054_603317_+	hypothetical protein	NA	NA	NA	NA	NA
AUL25202.1|603313_604834_+	SpoVR family protein	NA	NA	NA	NA	NA
AUL25203.1|604830_605667_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AUL25204.1|606904_607804_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUL25205.1|608179_608836_+	glutathione S-transferase	NA	NA	NA	NA	NA
AUL25206.1|609013_609421_-	alkylhydroperoxidase	NA	NA	NA	NA	NA
AUL25207.1|610735_611956_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.6	4.2e-184
AUL25208.1|611952_612423_+	MFS permease	NA	NA	NA	NA	NA
AUL25209.1|612432_612888_-	hypothetical protein	NA	NA	NA	NA	NA
AUL25210.1|613855_615424_-	argininosuccinate lyase	NA	NA	NA	NA	NA
AUL25211.1|615646_616084_+	universal stress protein	NA	NA	NA	NA	NA
AUL25212.1|616095_616506_-	hypothetical protein	NA	NA	NA	NA	NA
AUL25213.1|616536_617310_-	NADH pyrophosphatase	NA	NA	NA	NA	NA
AUL25214.1|617537_619640_+	dehydrogenase	NA	NA	NA	NA	NA
AUL25215.1|620148_620997_+	two-component response regulator	NA	NA	NA	NA	NA
AUL25216.1|621016_621232_-	hypothetical protein	NA	NA	NA	NA	NA
AUL25217.1|621386_622283_+	hypothetical protein	NA	NA	NA	NA	NA
AUL25218.1|622386_623277_+	nicotinate-nucleotide diphosphorylase (carboxylating)	NA	NA	NA	NA	NA
AUL25219.1|623353_624322_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUL25220.1|624322_625033_-	hypothetical protein	NA	NA	NA	NA	NA
AUL25221.1|625108_627202_-	TonB-dependent receptor	NA	NA	NA	NA	NA
AUL25222.1|627231_627540_-	hypothetical protein	NA	NA	NA	NA	NA
AUL25223.1|627726_628512_-	enoyl-[acyl-carrier-protein] reductase	NA	NA	NA	NA	NA
AUL25224.1|628570_629983_-	lytic transglycosylase	NA	A0A223LD43	Bacillus_phage	29.3	2.1e-06
AUL25225.1|629990_630800_-	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
AUL25226.1|630817_631582_+	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AUL25227.1|631650_632112_+	ribonuclease HI	NA	J9Q745	Salmonella_phage	51.5	4.5e-38
AUL25228.1|632236_633319_+	efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
AUL25229.1|633334_633532_+	hypothetical protein	NA	NA	NA	NA	NA
AUL25230.1|633494_634715_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
AUL25231.1|637724_638459_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	42.4	2.6e-40
AUL25232.1|638627_639848_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.1	1.0e-182
AUL25233.1|640222_641209_+	HlyD family secretion protein	NA	NA	NA	NA	NA
AUL25234.1|641212_643936_+	multidrug ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.2	6.6e-20
AUL25235.1|643936_645064_+	hypothetical protein	NA	NA	NA	NA	NA
AUL25236.1|645076_646489_+	RND transporter	NA	NA	NA	NA	NA
AUL25237.1|646663_647320_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AUL25238.1|647340_648387_+	glycosyltransferase	NA	F1C5B0	Cronobacter_phage	39.5	1.4e-58
AUL25239.1|648383_649973_+	dolichyl-phosphate-mannose--protein mannosyltransferase	NA	NA	NA	NA	NA
AUL25240.1|650127_651237_+	hypothetical protein	NA	NA	NA	NA	NA
AUL25241.1|651226_652123_-	alpha/beta hydrolase	NA	A0A1C9C5K3	Heterosigma_akashiwo_virus	33.1	6.5e-09
AUL25242.1|652169_652802_-	hypothetical protein	NA	NA	NA	NA	NA
AUL25243.1|652826_653711_-	EamA family transporter	NA	NA	NA	NA	NA
AUL25244.1|653838_655320_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AUL25245.1|655392_655737_+	TIGR01244 family protein	NA	NA	NA	NA	NA
AUL25246.1|655822_656287_+	universal stress protein	NA	NA	NA	NA	NA
AUL25247.1|656444_656705_+|transposase	transposase	transposase	NA	NA	NA	NA
AUL25248.1|656797_657298_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	49.7	2.8e-41
>prophage 3
CP018892	Bordetella holmesii isolate F617 chromosome, complete genome	3699592	660606	725653	3699592	transposase,tRNA	Ralstonia_virus(42.86%)	58	NA	NA
AUL25251.1|660606_661557_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
AUL25252.1|661589_662036_+|tRNA	cys-tRNA(pro)/cys-tRNA(cys) deacylase	tRNA	NA	NA	NA	NA
AUL25253.1|662084_662774_-	tol-pal system protein YbgF	NA	NA	NA	NA	NA
AUL25254.1|662861_663356_-	peptidoglycan-associated lipoprotein	NA	NA	NA	NA	NA
AUL25255.1|663387_664704_-	Tol-Pal system beta propeller repeat protein TolB	NA	NA	NA	NA	NA
AUL25256.1|664720_665641_-	protein TolA	NA	NA	NA	NA	NA
AUL25257.1|665675_666137_-	protein TolR	NA	NA	NA	NA	NA
AUL25258.1|666136_666811_-	protein TolQ	NA	NA	NA	NA	NA
AUL25259.1|666813_667236_-	tol-pal system-associated acyl-CoA thioesterase	NA	NA	NA	NA	NA
AUL25260.1|667289_669020_-|tRNA	proline--tRNA ligase	tRNA	A0A2K9L3R9	Tupanvirus	28.6	1.2e-11
AUL25261.1|669085_669655_+	RNA pyrophosphohydrolase	NA	NA	NA	NA	NA
AUL25262.1|669635_670322_+	DNA-binding response regulator	NA	NA	NA	NA	NA
AUL25263.1|670341_671847_+	sensor histidine kinase	NA	NA	NA	NA	NA
AUL25264.1|672075_672525_+	tripartite tricarboxylate transporter TctB	NA	NA	NA	NA	NA
AUL25265.1|672530_674051_+	hypothetical protein	NA	NA	NA	NA	NA
AUL25266.1|674104_675325_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
AUL25267.1|675421_676351_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUL25268.1|676509_677415_-	oxidoreductase	NA	NA	NA	NA	NA
AUL25269.1|677614_678835_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.6	4.2e-184
AUL25270.1|678890_680396_-	hypothetical protein	NA	NA	NA	NA	NA
AUL25271.1|680417_680873_-	tricarboxylate transporter	NA	NA	NA	NA	NA
AUL25272.1|681229_681802_+	hypothetical protein	NA	NA	NA	NA	NA
AUL25273.1|681801_682113_+	cell division protein ZapA	NA	NA	NA	NA	NA
AUL25274.1|682426_683188_+	hypothetical protein	NA	NA	NA	NA	NA
AUL25275.1|683156_683951_-	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
AUL25276.1|684129_684465_+	cytochrome C	NA	NA	NA	NA	NA
AUL25277.1|684481_685039_+	peptide-methionine (S)-S-oxide reductase	NA	NA	NA	NA	NA
AUL25278.1|685100_686213_-	4-hydroxyphenylpyruvate dioxygenase	NA	NA	NA	NA	NA
AUL25279.1|686353_686830_+	AsnC family transcriptional regulator	NA	NA	NA	NA	NA
AUL25280.1|693171_693366_+	hypothetical protein	NA	NA	NA	NA	NA
AUL25281.1|693493_693754_+|transposase	transposase	transposase	NA	NA	NA	NA
AUL25282.1|693846_694347_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	50.3	9.5e-42
AUL25283.1|694584_694959_+	hypothetical protein	NA	NA	NA	NA	NA
AUL27872.1|695176_695455_-	DNA topoisomerase III	NA	NA	NA	NA	NA
AUL25284.1|695603_696797_+	peptidase M20	NA	NA	NA	NA	NA
AUL25285.1|696809_697868_+	dihydroorotase	NA	NA	NA	NA	NA
AUL25286.1|697905_699714_-	ABC transporter ATP-binding protein	NA	A0A1B0RXA0	Streptococcus_phage	29.5	2.5e-44
AUL25287.1|700488_700917_+	cell division/cell wall cluster transcriptional repressor MraZ	NA	NA	NA	NA	NA
AUL25288.1|700925_701999_+	16S rRNA (cytosine(1402)-N(4))-methyltransferase	NA	NA	NA	NA	NA
AUL25289.1|701998_702286_+	cell division protein FtsL	NA	NA	NA	NA	NA
AUL25290.1|702282_704016_+	cell division protein	NA	NA	NA	NA	NA
AUL25291.1|704012_706835_+	UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D- alanine ligase	NA	NA	NA	NA	NA
AUL25292.1|706824_707994_+	phospho-N-acetylmuramoyl-pentapeptide- transferase	NA	NA	NA	NA	NA
AUL25293.1|707990_709523_+	UDP-N-acetylmuramoylalanine--D-glutamate ligase	NA	NA	NA	NA	NA
AUL25294.1|709519_710713_+	putative lipid II flippase FtsW	NA	NA	NA	NA	NA
AUL25295.1|710709_711783_+	undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase	NA	NA	NA	NA	NA
AUL25296.1|711779_713186_+	UDP-N-acetylmuramate--L-alanine ligase	NA	NA	NA	NA	NA
AUL25297.1|713182_714136_+	D-alanine--D-alanine ligase	NA	NA	NA	NA	NA
AUL25298.1|714144_714969_+	cell division protein FtsQ	NA	NA	NA	NA	NA
AUL25299.1|714973_716200_+	cell division protein FtsA	NA	NA	NA	NA	NA
AUL25300.1|716395_717580_+	cell division protein FtsZ	NA	NA	NA	NA	NA
AUL25301.1|717819_718743_+	UDP-3-O-[3-hydroxymyristoyl] N-acetylglucosamine deacetylase	NA	NA	NA	NA	NA
AUL25302.1|718833_719049_+	hypothetical protein	NA	NA	NA	NA	NA
AUL25303.1|719085_719580_-	flagellar hook-length control protein FliK	NA	NA	NA	NA	NA
AUL25304.1|719622_720606_+	peptidase M23	NA	A0A292GJG6	Xanthomonas_phage	47.7	1.2e-27
AUL25305.1|720766_723502_+	preprotein translocase subunit SecA	NA	NA	NA	NA	NA
AUL25306.1|723503_724223_+	hypothetical protein	NA	NA	NA	NA	NA
AUL25307.1|724432_725653_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
>prophage 4
CP018892	Bordetella holmesii isolate F617 chromosome, complete genome	3699592	800268	855180	3699592	holin,transposase	Ralstonia_virus(16.67%)	53	NA	NA
AUL25368.1|800268_802368_-|holin	phospholipase C, phosphocholine-specific	holin	NA	NA	NA	NA
AUL25369.1|802509_803349_-	branched chain amino acid aminotransferase	NA	NA	NA	NA	NA
AUL25370.1|804478_805366_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
AUL25371.1|805456_805591_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUL25372.1|805666_806671_-	ABC transporter permease	NA	NA	NA	NA	NA
AUL25373.1|807577_807838_-|transposase	transposase	transposase	NA	NA	NA	NA
AUL25374.1|808112_808748_-	endonuclease III	NA	NA	NA	NA	NA
AUL25375.1|808768_809407_-	ferredoxin	NA	NA	NA	NA	NA
AUL25376.1|809457_810684_-	esterase	NA	NA	NA	NA	NA
AUL25377.1|810820_811618_-	ferredoxin--NADP(+) reductase	NA	NA	NA	NA	NA
AUL25378.1|811648_811972_-	ferredoxin	NA	NA	NA	NA	NA
AUL25379.1|812136_813312_+	nicotinate phosphoribosyltransferase	NA	A0A2L0UZQ6	Agrobacterium_phage	32.5	4.2e-48
AUL25380.1|813350_813704_+	hypothetical protein	NA	NA	NA	NA	NA
AUL25381.1|813734_814154_-	hypothetical protein	NA	NA	NA	NA	NA
AUL25382.1|814246_815086_-	hypothetical protein	NA	NA	NA	NA	NA
AUL25383.1|815282_817529_+	GTP pyrophosphokinase	NA	NA	NA	NA	NA
AUL25384.1|817548_818862_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	41.0	1.5e-83
AUL25385.1|819027_820179_+	acetylornithine deacetylase (ArgE)	NA	NA	NA	NA	NA
AUL25386.1|820319_821519_+	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
AUL25387.1|821515_822379_+	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
AUL25388.1|822408_823287_+	acetyl-CoA carboxylase subunit beta	NA	NA	NA	NA	NA
AUL25389.1|823495_824041_+	hypothetical protein	NA	NA	NA	NA	NA
AUL25390.1|824211_824472_+|transposase	transposase	transposase	NA	NA	NA	NA
AUL25391.1|825420_828552_-	ribonuclease E/G	NA	NA	NA	NA	NA
AUL25392.1|829131_830037_+	RNA pseudouridine synthase	NA	NA	NA	NA	NA
AUL25393.1|830038_830695_+	HAD family hydrolase	NA	NA	NA	NA	NA
AUL25394.1|830812_831772_+	mononuclear molybdenum enzyme YedY	NA	NA	NA	NA	NA
AUL25395.1|831784_832411_+	sulfoxide reductase heme-binding subunit YedZ	NA	NA	NA	NA	NA
AUL25396.1|832391_833174_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A076YN96	Rhizobium_phage	32.4	5.0e-13
AUL27878.1|833177_833888_-	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AUL25397.1|833884_834478_-	septum formation protein Maf	NA	NA	NA	NA	NA
AUL25398.1|834695_835343_+	hypothetical protein	NA	NA	NA	NA	NA
AUL25399.1|835395_835578_+	50S ribosomal protein L32	NA	NA	NA	NA	NA
AUL25400.1|835636_836701_+	phosphate acyltransferase	NA	NA	NA	NA	NA
AUL25401.1|836700_837687_+	3-oxoacyl-ACP synthase	NA	NA	NA	NA	NA
AUL25402.1|837746_838682_+	[acyl-carrier-protein] S-malonyltransferase	NA	NA	NA	NA	NA
AUL25403.1|838684_839434_+	3-oxoacyl-ACP reductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	34.0	2.7e-16
AUL25404.1|839651_839891_+	acyl carrier protein	NA	B2ZXV3	Ralstonia_phage	48.5	1.6e-10
AUL25405.1|840062_841292_+	beta-ketoacyl-[acyl-carrier-protein] synthase II	NA	NA	NA	NA	NA
AUL25406.1|841294_841726_+	hypothetical protein	NA	NA	NA	NA	NA
AUL25407.1|841722_842322_+	RNA polymerase sigma factor RpoE	NA	A0A0F6TH34	Sinorhizobium_phage	26.9	2.6e-06
AUL25408.1|842334_842820_+	hypothetical protein	NA	NA	NA	NA	NA
AUL25409.1|842819_843854_+	siderophore-interacting protein	NA	NA	NA	NA	NA
AUL25410.1|843894_845397_+	serine peptidase	NA	A0A1B1IT49	uncultured_Mediterranean_phage	31.2	1.1e-21
AUL25411.1|845481_846702_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	74.9	5.1e-182
AUL25412.1|846888_847839_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
AUL25413.1|847906_849700_+	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	23.5	1.4e-23
AUL25414.1|849723_850608_+	S26 family signal peptidase	NA	NA	NA	NA	NA
AUL25415.1|850613_851369_+	ribonuclease III	NA	M4QNJ2	Ostreococcus_lucimarinus_virus	33.5	1.5e-19
AUL25416.1|851365_852256_+	GTPase Era	NA	NA	NA	NA	NA
AUL25417.1|852248_852836_+	DNA repair protein RecO	NA	NA	NA	NA	NA
AUL25418.1|852858_853950_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	35.9	2.1e-17
AUL25419.1|853959_855180_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
>prophage 5
CP018892	Bordetella holmesii isolate F617 chromosome, complete genome	3699592	864874	919437	3699592	transposase	Ralstonia_virus(28.57%)	52	NA	NA
AUL25428.1|864874_866095_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.1	7.9e-183
AUL25429.1|866262_866598_+	hypothetical protein	NA	NA	NA	NA	NA
AUL25430.1|866793_867459_-	hypothetical protein	NA	A0A0A8WF62	Clostridium_phage	34.5	1.6e-15
AUL25431.1|867704_869594_+	propionate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	30.7	2.4e-61
AUL25432.1|869590_869998_+	hypothetical protein	NA	NA	NA	NA	NA
AUL25433.1|870081_871308_+	MFS transporter	NA	NA	NA	NA	NA
AUL25434.1|871457_873437_+	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	43.6	6.1e-84
AUL25435.1|873502_874723_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
AUL25436.1|875750_876764_+	low-specificity L-threonine aldolase	NA	NA	NA	NA	NA
AUL25437.1|876785_877619_-	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
AUL25438.1|877668_879315_-	electron transfer flavoprotein-ubiquinone oxidoreductase	NA	NA	NA	NA	NA
AUL25439.1|879447_879894_+	thioesterase	NA	NA	NA	NA	NA
AUL25440.1|880008_880707_+	succinyl-CoA--3-ketoacid-CoA transferase	NA	NA	NA	NA	NA
AUL25441.1|880719_881373_+	succinyl-CoA--3-ketoacid-CoA transferase	NA	NA	NA	NA	NA
AUL25442.1|881573_882458_+	transcriptional regulator	NA	NA	NA	NA	NA
AUL25443.1|882454_883435_+	beta-aspartyl-peptidase	NA	NA	NA	NA	NA
AUL25444.1|883472_885353_+	glutathione ABC transporter ATP-binding protein GsiA	NA	G9BWD6	Planktothrix_phage	29.8	2.0e-20
AUL25445.1|885427_886981_+	glutathione ABC transporter substrate-binding protein GsiB	NA	NA	NA	NA	NA
AUL25446.1|887054_887975_+	glutathione ABC transporter permease GsiC	NA	NA	NA	NA	NA
AUL25447.1|887982_888876_+	glutathione ABC transporter permease GsiD	NA	NA	NA	NA	NA
AUL25448.1|888965_890033_+	aminopeptidase	NA	NA	NA	NA	NA
AUL25449.1|890043_890862_+	aminopeptidase	NA	NA	NA	NA	NA
AUL25450.1|890876_892673_+	Xaa-Pro aminopeptidase	NA	A0A0P0I8D7	Acinetobacter_phage	49.7	1.3e-165
AUL25451.1|892916_894569_+	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	53.5	1.7e-156
AUL25452.1|894740_894944_+	hypothetical protein	NA	NA	NA	NA	NA
AUL25453.1|894918_895023_+	hypothetical protein	NA	NA	NA	NA	NA
AUL25454.1|895026_896313_+	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	63.4	5.5e-150
AUL25455.1|896386_896758_+	cell division protein FtsB	NA	NA	NA	NA	NA
AUL25456.1|896776_897406_-	hypothetical protein	NA	NA	NA	NA	NA
AUL25457.1|897485_898406_-	Hsp33 family molecular chaperone	NA	NA	NA	NA	NA
AUL25458.1|898444_898966_-	gamma carbonic anhydrase family protein	NA	NA	NA	NA	NA
AUL25459.1|898988_900656_-	AMP-binding protein	NA	A0A2H4PQU7	Staphylococcus_phage	33.4	9.8e-67
AUL25460.1|900851_901691_-	UDP-2,3-diacylglucosamine hydrolase	NA	A0A218MKA7	uncultured_virus	48.1	1.9e-66
AUL25461.1|901772_902297_-	RDD family protein	NA	NA	NA	NA	NA
AUL25462.1|902619_903120_-|transposase	transposase	transposase	S5WIU1	Leptospira_phage	50.3	9.5e-42
AUL25463.1|903212_903473_-|transposase	transposase	transposase	NA	NA	NA	NA
AUL25464.1|903516_904524_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.1	4.4e-147
AUL25465.1|904720_904906_-	hypothetical protein	NA	NA	NA	NA	NA
AUL25466.1|905138_906773_-	RNA methyltransferase	NA	NA	NA	NA	NA
AUL27879.1|906797_907220_-	hypothetical protein	NA	NA	NA	NA	NA
AUL25467.1|907279_908740_-	2-methylcitrate dehydratase	NA	NA	NA	NA	NA
AUL25468.1|908795_909986_-	2-methylcitrate synthase	NA	NA	NA	NA	NA
AUL25469.1|910059_910953_-	methylisocitrate lyase	NA	NA	NA	NA	NA
AUL25470.1|911143_912133_-	malate dehydrogenase	NA	NA	NA	NA	NA
AUL25471.1|912466_913246_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AUL25472.1|913367_913781_+	succinate dehydrogenase, cytochrome b556 subunit	NA	NA	NA	NA	NA
AUL25473.1|913780_914164_+	succinate dehydrogenase, hydrophobic membrane anchor protein	NA	NA	NA	NA	NA
AUL25474.1|914167_915946_+	succinate dehydrogenase flavoprotein subunit	NA	NA	NA	NA	NA
AUL25475.1|915959_916676_+	succinate dehydrogenase iron-sulfur subunit	NA	NA	NA	NA	NA
AUL25476.1|916701_916962_+	succinate dehydrogenase assembly factor 2	NA	NA	NA	NA	NA
AUL25477.1|916982_918284_+	citrate (Si)-synthase	NA	NA	NA	NA	NA
AUL25478.1|918432_919437_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	60.8	4.4e-139
>prophage 6
CP018892	Bordetella holmesii isolate F617 chromosome, complete genome	3699592	929935	994304	3699592	transposase,tRNA	Ralstonia_virus(44.44%)	49	NA	NA
AUL25488.1|929935_931156_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.2e-183
AUL25489.1|931286_933569_-	NADP-dependent malic enzyme	NA	NA	NA	NA	NA
AUL25490.1|933742_936400_-	pyruvate dehydrogenase (acetyl-transferring), homodimeric type	NA	NA	NA	NA	NA
AUL25491.1|936635_938681_+	oligopeptide transporter, OPT family	NA	NA	NA	NA	NA
AUL25492.1|939018_941889_+	2-oxoglutarate dehydrogenase E1 component	NA	NA	NA	NA	NA
AUL25493.1|941935_943126_+	dihydrolipoamide succinyltransferase	NA	NA	NA	NA	NA
AUL25494.1|943196_944624_+	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	28.1	1.6e-41
AUL25495.1|944701_945793_+	cell division protein ZapE	NA	NA	NA	NA	NA
AUL25496.1|945931_946453_+	RNA polymerase subunit sigma	NA	NA	NA	NA	NA
AUL25497.1|946449_947361_+	transmembrane sensor protein	NA	NA	NA	NA	NA
AUL25498.1|947454_949914_+	ligand-gated channel	NA	NA	NA	NA	NA
AUL25499.1|950146_950311_+	hypothetical protein	NA	NA	NA	NA	NA
AUL25500.1|951921_952260_+	iron uptake protein	NA	NA	NA	NA	NA
AUL25501.1|952303_953626_+|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
AUL25502.1|953679_956067_-	RNA-binding transcriptional accessory protein	NA	NA	NA	NA	NA
AUL25503.1|956232_958281_+	helicase	NA	A0A127AW80	Bacillus_phage	28.0	3.2e-75
AUL25504.1|958346_959171_-	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
AUL25505.1|959247_960207_+	RNA pseudouridine synthase	NA	NA	NA	NA	NA
AUL25506.1|960194_960959_+	hypothetical protein	NA	NA	NA	NA	NA
AUL25507.1|961084_962710_+	class I poly(R)-hydroxyalkanoic acid synthase	NA	NA	NA	NA	NA
AUL25508.1|962759_963497_+	beta-ketoacyl-ACP reductase	NA	NA	NA	NA	NA
AUL25509.1|963588_964149_+	polyhydroxyalkanoate synthesis repressor PhaR	NA	NA	NA	NA	NA
AUL25510.1|964322_964862_+	hypothetical protein	NA	NA	NA	NA	NA
AUL25511.1|964864_965197_+	periplasmic lipoprotein involved in iron transport	NA	NA	NA	NA	NA
AUL25512.1|965207_966053_+	FTR1 family iron permease	NA	NA	NA	NA	NA
AUL25513.1|966074_967454_+	hypothetical protein	NA	NA	NA	NA	NA
AUL25514.1|967502_968414_+	phenazine biosynthesis protein PhzC/PhzF	NA	NA	NA	NA	NA
AUL25515.1|968580_968916_-	phospholipid-binding protein	NA	NA	NA	NA	NA
AUL25516.1|968965_970186_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
AUL25517.1|970307_970472_-	DUF1328 domain-containing protein	NA	NA	NA	NA	NA
AUL25518.1|970529_970730_-	general stress protein CsbD	NA	NA	NA	NA	NA
AUL25519.1|971034_971568_-	cytochrome B	NA	A0A0U2QLA7	Escherichia_phage	43.3	8.3e-12
AUL25520.1|977190_979467_+	ABC transporter	NA	W8CYL7	Bacillus_phage	31.3	6.6e-58
AUL25521.1|979463_979943_+	hypothetical protein	NA	NA	NA	NA	NA
AUL25522.1|979939_981073_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AUL25523.1|981125_981929_+	hypothetical protein	NA	NA	NA	NA	NA
AUL25524.1|981962_983171_+	lytic transglycosylase	NA	NA	NA	NA	NA
AUL25525.1|983252_983681_+	hypothetical protein	NA	NA	NA	NA	NA
AUL25526.1|984013_985570_+	sensor domain-containing diguanylate cyclase	NA	NA	NA	NA	NA
AUL25527.1|985606_985927_-	hypothetical protein	NA	NA	NA	NA	NA
AUL27880.1|986062_986794_+	3-ketoacyl-ACP reductase	NA	NA	NA	NA	NA
AUL25528.1|986852_987377_+	DedA family protein	NA	NA	NA	NA	NA
AUL25529.1|987428_988868_-	NAD-dependent succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
AUL25530.1|989834_990164_+	regulator	NA	NA	NA	NA	NA
AUL25531.1|990160_990667_+	toxin	NA	NA	NA	NA	NA
AUL27881.1|990888_991821_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	76.8	1.9e-136
AUL25532.1|991890_992151_+|transposase	transposase	transposase	NA	NA	NA	NA
AUL25533.1|992189_993011_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	43.7	7.2e-55
AUL25534.1|993083_994304_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
>prophage 7
CP018892	Bordetella holmesii isolate F617 chromosome, complete genome	3699592	1096087	1128249	3699592	protease,transposase	Ralstonia_virus(33.33%)	33	NA	NA
AUL25617.1|1096087_1097308_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
AUL25618.1|1097395_1097986_+	EamA family transporter	NA	NA	NA	NA	NA
AUL27889.1|1097973_1098285_+	hypothetical protein	NA	NA	NA	NA	NA
AUL25619.1|1098336_1099326_+	quinone oxidoreductase	NA	NA	NA	NA	NA
AUL25620.1|1099446_1100328_-|protease	zinc metalloprotease HtpX	protease	NA	NA	NA	NA
AUL25621.1|1100501_1101356_+	hypothetical protein	NA	NA	NA	NA	NA
AUL25622.1|1101387_1102236_+	sulfurtransferase	NA	NA	NA	NA	NA
AUL25623.1|1102363_1103584_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	74.9	1.1e-181
AUL25624.1|1103602_1104169_-	phosphohydrolase	NA	NA	NA	NA	NA
AUL25625.1|1104366_1105518_-	Rieske (2Fe-2S) protein	NA	NA	NA	NA	NA
AUL25626.1|1105656_1106661_-	hypothetical protein	NA	A0A0F6TJ51	Escherichia_coli_O157_typing_phage	25.9	3.9e-18
AUL25627.1|1106817_1107789_-	MFS transporter	NA	NA	NA	NA	NA
AUL25628.1|1107867_1108656_+	IclR family transcriptional regulator	NA	NA	NA	NA	NA
AUL25629.1|1108727_1108964_+	exodeoxyribonuclease VII small subunit	NA	NA	NA	NA	NA
AUL25630.1|1108972_1109884_+	geranyl transferase	NA	NA	NA	NA	NA
AUL25631.1|1109927_1111799_+	1-deoxy-D-xylulose-5-phosphate synthase	NA	NA	NA	NA	NA
AUL25632.1|1111959_1112757_+	GTP cyclohydrolase	NA	NA	NA	NA	NA
AUL25633.1|1112988_1113363_+	30S ribosomal protein S6	NA	NA	NA	NA	NA
AUL25634.1|1113439_1113763_+	primosomal replication protein N	NA	NA	NA	NA	NA
AUL25635.1|1113846_1114119_+	30S ribosomal protein S18	NA	NA	NA	NA	NA
AUL25636.1|1114133_1114589_+	50S ribosomal protein L9	NA	NA	NA	NA	NA
AUL25637.1|1114710_1115547_+	hypothetical protein	NA	NA	NA	NA	NA
AUL25638.1|1115543_1116917_+	replicative DNA helicase	NA	C7BGG1	Burkholderia_phage	57.7	1.1e-132
AUL25639.1|1117231_1118182_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
AUL25640.1|1119086_1120064_-	4-hydroxythreonine-4-phosphate dehydrogenase PdxA	NA	NA	NA	NA	NA
AUL25641.1|1120188_1121844_-	phosphate starvation-inducible protein PhoH	NA	A0A1L2CUJ9	Pectobacterium_phage	33.7	1.2e-69
AUL25642.1|1121892_1122357_-	peroxiredoxin	NA	NA	NA	NA	NA
AUL25643.1|1122353_1122815_-	hypothetical protein	NA	NA	NA	NA	NA
AUL25644.1|1123040_1124228_+	alanine transaminase	NA	NA	NA	NA	NA
AUL25645.1|1124224_1125529_+	homoserine dehydrogenase	NA	NA	NA	NA	NA
AUL25646.1|1125525_1126935_+	threonine synthase	NA	NA	NA	NA	NA
AUL25647.1|1127128_1127389_+|transposase	transposase	transposase	NA	NA	NA	NA
AUL25648.1|1127427_1128249_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	43.7	7.2e-55
>prophage 8
CP018892	Bordetella holmesii isolate F617 chromosome, complete genome	3699592	1133901	1194683	3699592	protease,transposase,tRNA	Leptospira_phage(23.53%)	53	NA	NA
AUL25653.1|1133901_1135362_+|protease	metalloprotease TldD	protease	NA	NA	NA	NA
AUL25654.1|1135624_1136698_+	3-deoxy-7-phosphoheptulonate synthase	NA	A0A2I6UFP9	Klebsiella_phage	46.4	7.9e-78
AUL25655.1|1136782_1138003_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.1	3.5e-183
AUL25656.1|1139760_1140582_-|transposase	transposase	transposase	S5WIU1	Leptospira_phage	44.0	1.9e-55
AUL25657.1|1140620_1140881_-|transposase	transposase	transposase	NA	NA	NA	NA
AUL27890.1|1140908_1142354_+	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
AUL25658.1|1142367_1143471_+	glycolate oxidase subunit GlcE	NA	NA	NA	NA	NA
AUL25659.1|1143475_1144726_+	glycolate oxidase iron-sulfur subunit	NA	NA	NA	NA	NA
AUL25660.1|1144722_1146168_-	NAD synthetase	NA	NA	NA	NA	NA
AUL25661.1|1146164_1146479_-	NAD(P)(+) transhydrogenase	NA	NA	NA	NA	NA
AUL25662.1|1147780_1149001_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.6	5.5e-184
AUL25663.1|1149100_1149967_-	N-formylglutamate amidohydrolase	NA	NA	NA	NA	NA
AUL25664.1|1150027_1151008_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUL25665.1|1151154_1152075_+	LysR family transcriptional regulator	NA	Q6JIH3	Burkholderia_virus	30.8	2.1e-26
AUL25666.1|1152083_1153196_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
AUL25667.1|1153277_1154099_+	hypothetical protein	NA	NA	NA	NA	NA
AUL25668.1|1154174_1154783_-	glutathione S-transferase	NA	NA	NA	NA	NA
AUL27891.1|1154920_1156297_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	46.1	7.2e-108
AUL25669.1|1156358_1156802_+	cytochrome C	NA	NA	NA	NA	NA
AUL27892.1|1156868_1157540_-	cytochrome B	NA	NA	NA	NA	NA
AUL25670.1|1157567_1157828_+|transposase	transposase	transposase	NA	NA	NA	NA
AUL25671.1|1157866_1158688_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	44.0	1.9e-55
AUL25672.1|1158856_1159138_-	hypothetical protein	NA	NA	NA	NA	NA
AUL25673.1|1159848_1160637_+	hypothetical protein	NA	NA	NA	NA	NA
AUL25674.1|1160633_1161740_+	AI-2E family transporter	NA	NA	NA	NA	NA
AUL25675.1|1162414_1163773_-	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	38.3	2.1e-19
AUL25676.1|1163887_1164085_-	gas vesicle protein	NA	NA	NA	NA	NA
AUL25677.1|1164102_1164924_-|transposase	transposase	transposase	S5WIU1	Leptospira_phage	44.0	1.9e-55
AUL25678.1|1164962_1165223_-|transposase	transposase	transposase	NA	NA	NA	NA
AUL25679.1|1165316_1165871_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	43.7	1.3e-31
AUL27893.1|1166458_1167775_-	hypothetical protein	NA	NA	NA	NA	NA
AUL25680.1|1167787_1168801_-	dimethylhistidine N-methyltransferase	NA	NA	NA	NA	NA
AUL25681.1|1170378_1170678_+	hypothetical protein	NA	NA	NA	NA	NA
AUL25682.1|1172038_1173697_-	FMN-binding glutamate synthase family protein	NA	NA	NA	NA	NA
AUL25683.1|1173845_1175066_-	hypothetical protein	NA	NA	NA	NA	NA
AUL25684.1|1175183_1176467_-	arsenical efflux pump membrane protein ArsB	NA	A0A2H4J144	uncultured_Caudovirales_phage	68.4	4.6e-157
AUL25685.1|1176470_1177412_-	transporter	NA	NA	NA	NA	NA
AUL25686.1|1177521_1177980_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AUL27894.1|1178360_1178981_+	DTW domain-containing protein	NA	NA	NA	NA	NA
AUL25687.1|1179388_1181809_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	32.1	3.9e-64
AUL25688.1|1181916_1182654_+	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
AUL25689.1|1182700_1183945_+	hypothetical protein	NA	A0A0B5JD48	Pandoravirus	27.1	1.3e-10
AUL25690.1|1184267_1184540_+	DNA-binding protein HU	NA	A4JWM7	Burkholderia_virus	56.2	4.2e-20
AUL25691.1|1185123_1185852_+	energy transducer TonB	NA	NA	NA	NA	NA
AUL25692.1|1185873_1186791_+	flagellar motor protein MotA	NA	NA	NA	NA	NA
AUL25693.1|1186790_1187300_+	biopolymer transporter ExbD	NA	NA	NA	NA	NA
AUL25694.1|1187416_1188088_+	DNA-binding response regulator	NA	NA	NA	NA	NA
AUL25695.1|1188197_1189265_+	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	27.7	2.8e-14
AUL25696.1|1189248_1191129_+	potassium transporter Kup	NA	A7K9V6	Acanthocystis_turfacea_chlorella_virus	30.0	3.5e-65
AUL25697.1|1191265_1192453_+	hypothetical protein	NA	NA	NA	NA	NA
AUL25698.1|1192753_1193539_+	hypothetical protein	NA	NA	NA	NA	NA
AUL25699.1|1193562_1193823_+|transposase	transposase	transposase	NA	NA	NA	NA
AUL25700.1|1193861_1194683_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	44.0	1.9e-55
>prophage 9
CP018892	Bordetella holmesii isolate F617 chromosome, complete genome	3699592	1202710	1265124	3699592	protease,transposase,tRNA	Ralstonia_virus(28.57%)	55	NA	NA
AUL25708.1|1202710_1203931_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
AUL25709.1|1204006_1204288_+	malate dehydrogenase	NA	NA	NA	NA	NA
AUL25710.1|1206119_1207115_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUL25711.1|1207157_1207928_+	2-dehydro-3-deoxyglucarate aldolase	NA	NA	NA	NA	NA
AUL25712.1|1208053_1208317_-	30S ribosomal protein S20	NA	NA	NA	NA	NA
AUL25713.1|1208518_1208665_-	transmembrane sensor protein	NA	NA	NA	NA	NA
AUL25714.1|1208718_1209669_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
AUL25715.1|1209750_1210230_-	transmembrane sensor protein	NA	NA	NA	NA	NA
AUL25716.1|1211123_1211384_-|transposase	transposase	transposase	NA	NA	NA	NA
AUL25717.1|1211441_1212641_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	74.9	1.2e-178
AUL25718.1|1212786_1213164_-	cytochrome c family protein	NA	NA	NA	NA	NA
AUL25719.1|1213187_1214969_-	GMC family oxidoreductase	NA	NA	NA	NA	NA
AUL25720.1|1214977_1215715_-	hypothetical protein	NA	NA	NA	NA	NA
AUL25721.1|1215999_1217559_-	murein biosynthesis integral membrane protein MurJ	NA	NA	NA	NA	NA
AUL25722.1|1217618_1218377_-	3-hydroxyacyl-CoA dehydrogenase	NA	NA	NA	NA	NA
AUL25723.1|1218473_1219130_-	adenylate kinase	NA	NA	NA	NA	NA
AUL25724.1|1219283_1220048_-	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
AUL25725.1|1220062_1220242_-	hypothetical protein	NA	NA	NA	NA	NA
AUL25726.1|1220267_1221302_-	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
AUL25727.1|1221298_1221712_-	biopolymer transporter ExbD	NA	NA	NA	NA	NA
AUL25728.1|1221708_1222293_-	flagellar motor protein MotA	NA	NA	NA	NA	NA
AUL25729.1|1222645_1224004_+	exodeoxyribonuclease VII large subunit	NA	A0A1V0SD82	Indivirus	33.6	1.0e-29
AUL25730.1|1224097_1224676_+	superoxide dismutase	NA	NA	NA	NA	NA
AUL25731.1|1224800_1225622_-|transposase	transposase	transposase	S5WIU1	Leptospira_phage	44.0	1.9e-55
AUL25732.1|1225660_1225921_-|transposase	transposase	transposase	NA	NA	NA	NA
AUL27896.1|1225948_1227250_+	chloride channel protein-related protein	NA	NA	NA	NA	NA
AUL25733.1|1227353_1228559_+	3-oxoadipyl-CoA thiolase	NA	NA	NA	NA	NA
AUL25734.1|1228622_1229072_-	hypothetical protein	NA	A0A1B1IUW8	uncultured_Mediterranean_phage	42.2	6.8e-15
AUL25735.1|1229204_1229450_-	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	75.0	6.5e-20
AUL25736.1|1229674_1229989_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	43.9	8.4e-12
AUL25737.1|1230080_1230365_-	hypothetical protein	NA	NA	NA	NA	NA
AUL25738.1|1230632_1235195_+	alpha-2-macroglobulin	NA	NA	NA	NA	NA
AUL25739.1|1235242_1237348_+	penicillin-binding protein 1C	NA	NA	NA	NA	NA
AUL25740.1|1237401_1239711_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	9.1e-164
AUL25741.1|1241064_1242732_+	paraquat-inducible protein B	NA	NA	NA	NA	NA
AUL25742.1|1242734_1243400_+	hypothetical protein	NA	NA	NA	NA	NA
AUL25743.1|1243532_1247339_+	trifunctional transcriptional regulator/proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
AUL25744.1|1247564_1248710_+	branched chain amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUL25745.1|1248828_1249758_+	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
AUL25746.1|1249754_1250831_+	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
AUL25747.1|1250827_1251634_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	23.9	7.2e-15
AUL25748.1|1251630_1252362_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.3	2.6e-16
AUL25749.1|1252565_1252748_+	hypothetical protein	NA	NA	NA	NA	NA
AUL25750.1|1252738_1253977_-	ammonia channel protein	NA	H8ZJB2	Ostreococcus_tauri_virus	28.3	6.2e-26
AUL25751.1|1254024_1254363_-	transcriptional regulator	NA	NA	NA	NA	NA
AUL25752.1|1254610_1255561_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
AUL25753.1|1255879_1256062_+	hypothetical protein	NA	NA	NA	NA	NA
AUL25754.1|1256127_1257348_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
AUL25755.1|1257441_1258662_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.6	4.2e-184
AUL25756.1|1258721_1258985_+	hypothetical protein	NA	NA	NA	NA	NA
AUL25757.1|1259106_1260606_+|protease	ATP-dependent protease	protease	NA	NA	NA	NA
AUL25758.1|1261026_1261224_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
AUL25759.1|1261239_1261599_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
AUL25760.1|1261671_1262694_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2H4UW22	Bodo_saltans_virus	38.8	6.1e-27
AUL25761.1|1262706_1265124_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
>prophage 10
CP018892	Bordetella holmesii isolate F617 chromosome, complete genome	3699592	1274471	1320845	3699592	holin,transposase,tRNA	Ralstonia_virus(20.0%)	46	NA	NA
AUL25774.1|1274471_1276433_-|holin	choline transporter	holin	A0A2I7QNT1	Vibrio_phage	29.9	2.3e-27
AUL25775.1|1276561_1276810_-	hypothetical protein	NA	NA	NA	NA	NA
AUL25776.1|1276939_1277218_-	hypothetical protein	NA	NA	NA	NA	NA
AUL25777.1|1277311_1277764_+	hypothetical protein	NA	G1JW61	Mycobacterium_phage	36.3	8.9e-07
AUL25778.1|1277760_1278231_-	ArsR family transcriptional regulator	NA	NA	NA	NA	NA
AUL25779.1|1278522_1279116_+	twin-arginine translocation pathway signal	NA	NA	NA	NA	NA
AUL25780.1|1279163_1279448_+	CsbD family protein	NA	NA	NA	NA	NA
AUL25781.1|1279504_1279687_-	hypothetical protein	NA	NA	NA	NA	NA
AUL25782.1|1279838_1280042_+	hypothetical protein	NA	NA	NA	NA	NA
AUL25783.1|1280136_1280379_+	hypothetical protein	NA	NA	NA	NA	NA
AUL25784.1|1280526_1280739_+	hypothetical protein	NA	NA	NA	NA	NA
AUL25785.1|1280866_1281949_+	N-acylglucosamine 2-epimerase	NA	NA	NA	NA	NA
AUL25786.1|1282039_1282255_+	hypothetical protein	NA	NA	NA	NA	NA
AUL25787.1|1282261_1282627_-	Rieske (2Fe-2S) protein	NA	NA	NA	NA	NA
AUL25788.1|1282680_1284480_-	metal ABC transporter permease	NA	W8CYL7	Bacillus_phage	28.4	8.7e-45
AUL25789.1|1284629_1285004_+	2,5-diketo-D-gluconic acid reductase	NA	A0A2H4PQR8	Staphylococcus_phage	42.5	1.5e-20
AUL25790.1|1285027_1285288_+|transposase	transposase	transposase	NA	NA	NA	NA
AUL25791.1|1285326_1286148_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	44.0	1.1e-55
AUL25792.1|1286631_1287618_+	alcohol dehydrogenase	NA	NA	NA	NA	NA
AUL25793.1|1287664_1287871_-	hypothetical protein	NA	NA	NA	NA	NA
AUL25794.1|1287867_1289043_-	hypothetical protein	NA	NA	NA	NA	NA
AUL25795.1|1289220_1289874_+	serine/threonine protein phosphatase	NA	A0A2H4J0P0	uncultured_Caudovirales_phage	47.7	6.3e-54
AUL25796.1|1289868_1292391_-	penicillin-binding protein	NA	NA	NA	NA	NA
AUL25797.1|1292562_1294479_-	S9 family peptidase	NA	NA	NA	NA	NA
AUL25798.1|1294611_1295058_+	hypothetical protein	NA	NA	NA	NA	NA
AUL25799.1|1295086_1295515_-	phenylacetic acid degradation protein	NA	NA	NA	NA	NA
AUL25800.1|1296142_1297363_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.1	3.5e-183
AUL25801.1|1298097_1298559_-|tRNA	glutamyl-tRNA amidotransferase	tRNA	A0A292GL36	Xanthomonas_phage	44.1	2.0e-17
AUL25802.1|1298697_1299924_+	nitric oxide dioxygenase	NA	NA	NA	NA	NA
AUL25803.1|1299945_1300383_+	BadM/Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
AUL25804.1|1300505_1301753_+	D-amino acid dehydrogenase small subunit	NA	NA	NA	NA	NA
AUL25805.1|1301760_1302594_-	class III aminotransferase	NA	NA	NA	NA	NA
AUL25806.1|1302590_1303118_-	3-hydroxyacyl-CoA dehydrogenase	NA	NA	NA	NA	NA
AUL25807.1|1303207_1304428_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
AUL25808.1|1304435_1306100_-	long-chain-fatty-acid--CoA ligase	NA	Q75ZG1	Hepacivirus	27.3	2.0e-40
AUL25809.1|1306107_1306617_-	hypothetical protein	NA	NA	NA	NA	NA
AUL25810.1|1306613_1307228_-	DUF4442 domain-containing protein	NA	NA	NA	NA	NA
AUL25811.1|1307228_1308422_-	acetyl-CoA acetyltransferase	NA	NA	NA	NA	NA
AUL25812.1|1308431_1310816_-	3-hydroxyacyl-CoA dehydrogenase	NA	NA	NA	NA	NA
AUL25813.1|1310875_1312168_-	fatty acid transporter	NA	NA	NA	NA	NA
AUL25814.1|1312189_1314148_-	enoyl-CoA hydratase	NA	NA	NA	NA	NA
AUL25815.1|1314144_1315437_-	acetyl-CoA acetyltransferase	NA	NA	NA	NA	NA
AUL25816.1|1315447_1317778_-	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
AUL25817.1|1317803_1318472_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
AUL25818.1|1318851_1319796_+	serine acetyltransferase	NA	NA	NA	NA	NA
AUL25819.1|1319894_1320845_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 11
CP018892	Bordetella holmesii isolate F617 chromosome, complete genome	3699592	1553788	1613877	3699592	transposase,tRNA	Leptospira_phage(14.29%)	48	NA	NA
AUL26026.1|1553788_1554739_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
AUL26027.1|1554882_1555776_+	LysR family transcriptional regulator	NA	Q6JIH3	Burkholderia_virus	29.7	1.3e-20
AUL26028.1|1555803_1556730_+	site-specific tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	26.2	1.7e-23
AUL26029.1|1556743_1557232_+|tRNA	aminoacyl-tRNA deacylase	tRNA	NA	NA	NA	NA
AUL26030.1|1557346_1558462_-	D-alanyl-D-alanine endopeptidase	NA	NA	NA	NA	NA
AUL27912.1|1559094_1560258_+	MFS transporter	NA	NA	NA	NA	NA
AUL26031.1|1560440_1563098_+	hypothetical protein	NA	NA	NA	NA	NA
AUL26032.1|1563101_1566491_+	nuclease	NA	NA	NA	NA	NA
AUL26033.1|1566881_1568951_+	DNA polymerase III subunit gamma/tau	NA	A0A1U9WR94	Streptococcus_virus	37.7	8.2e-47
AUL26034.1|1568989_1569316_+	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
AUL26035.1|1569330_1569939_+	recombination protein RecR	NA	NA	NA	NA	NA
AUL26036.1|1571379_1572420_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUL26037.1|1572412_1573222_+	mannosyltransferase	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	25.5	1.1e-12
AUL26038.1|1573227_1574022_+	ABC transporter permease	NA	NA	NA	NA	NA
AUL27913.1|1574085_1575042_-	transaldolase	NA	M4SPL0	Cyanophage	30.7	3.6e-13
AUL26039.1|1575265_1576420_+	carbamoyl phosphate synthase small subunit	NA	R4TGJ8	Halovirus	33.1	2.6e-50
AUL26040.1|1576430_1579670_+	carbamoyl phosphate synthase large subunit	NA	NA	NA	NA	NA
AUL26041.1|1579734_1580631_+	aspartyl beta-hydroxylase	NA	H8ZJK8	Ostreococcus_tauri_virus	38.3	2.2e-36
AUL26042.1|1580698_1581460_+	short-chain dehydrogenase	NA	NA	NA	NA	NA
AUL26043.1|1581465_1582104_-	histidine phosphatase family protein	NA	NA	NA	NA	NA
AUL26044.1|1582096_1583005_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUL26045.1|1584110_1585802_-	ABC transporter permease	NA	NA	NA	NA	NA
AUL26046.1|1585869_1587192_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUL26047.1|1587289_1587565_-	hypothetical protein	NA	NA	NA	NA	NA
AUL26048.1|1587700_1589017_+	pyrimidine utilization transport protein G	NA	Q9KX94	Enterobacteria_phage	68.0	2.9e-154
AUL26049.1|1589217_1589646_+	transcriptional regulator	NA	A0A1X9I5R1	Streptococcus_phage	30.3	4.2e-06
AUL26050.1|1589711_1590932_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
AUL26051.1|1591286_1591763_+	transcription elongation factor GreA	NA	NA	NA	NA	NA
AUL26052.1|1592021_1592630_-	hypothetical protein	NA	NA	NA	NA	NA
AUL26053.1|1592648_1593320_+	rRNA methyltransferase	NA	NA	NA	NA	NA
AUL26054.1|1593493_1595380_+	cell division protein FtsH	NA	E5ESM9	Bathycoccus_sp._RCC1105_virus	42.5	6.2e-110
AUL26055.1|1595407_1596250_+	dihydropteroate synthase	NA	A0A0B5J4J5	Pandoravirus	32.5	6.5e-27
AUL26056.1|1596246_1597590_+	phosphoglucosamine mutase	NA	A0A1X9I671	Streptococcus_phage	27.1	2.7e-06
AUL26057.1|1597774_1598590_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AUL26058.1|1598655_1600137_-	exopolyphosphatase	NA	NA	NA	NA	NA
AUL26059.1|1600335_1602408_+	polyphosphate kinase 1	NA	NA	NA	NA	NA
AUL26060.1|1602627_1603665_+	phosphate ABC transporter substrate-binding protein PstS	NA	E3SKK5	Synechococcus_phage	40.2	8.5e-53
AUL26061.1|1603786_1605709_+	hypothetical protein	NA	NA	NA	NA	NA
AUL26062.1|1605736_1606513_+	phosphate ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.7	5.6e-17
AUL26063.1|1607340_1607850_+	hypothetical protein	NA	NA	NA	NA	NA
AUL26064.1|1608091_1608796_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	36.5	1.9e-27
AUL26065.1|1608927_1609698_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	56.6	2.8e-77
AUL27914.1|1609694_1610705_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	45.9	4.4e-78
AUL27915.1|1610763_1611024_+|transposase	transposase	transposase	NA	NA	NA	NA
AUL27916.1|1611056_1611845_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	37.5	1.4e-44
AUL26066.1|1612012_1612273_+|transposase	transposase	transposase	NA	NA	NA	NA
AUL26067.1|1612311_1613133_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	44.0	1.1e-55
AUL26068.1|1613187_1613877_+	hypothetical protein	NA	A0A1B0VBP7	Salmonella_phage	47.1	1.3e-49
>prophage 12
CP018892	Bordetella holmesii isolate F617 chromosome, complete genome	3699592	1631135	1741248	3699592	transposase,tRNA	Ralstonia_virus(11.11%)	106	NA	NA
AUL26086.1|1631135_1632356_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
AUL26087.1|1632614_1633220_+	hypothetical protein	NA	NA	NA	NA	NA
AUL26088.1|1633230_1634391_+	succinate--CoA ligase subunit beta	NA	NA	NA	NA	NA
AUL26089.1|1634412_1635294_+	succinate--CoA ligase subunit alpha	NA	A0A2K9L1S3	Tupanvirus	31.4	1.1e-19
AUL26090.1|1635590_1636289_+	hypothetical protein	NA	W8EBD0	Pseudomonas_phage	33.8	8.9e-22
AUL26091.1|1636430_1637153_+	hypothetical protein	NA	A0A2R2YAT9	Pseudomonas_phage	43.8	8.0e-42
AUL26092.1|1637271_1638210_+	hydroxymethylbilane synthase	NA	NA	NA	NA	NA
AUL26093.1|1638240_1639020_+	uroporphyrinogen-III synthase	NA	NA	NA	NA	NA
AUL26094.1|1639006_1640230_+	heme biosynthesis operon protein HemX	NA	NA	NA	NA	NA
AUL26095.1|1640234_1641782_+	protoheme IX synthesis protein	NA	NA	NA	NA	NA
AUL26096.1|1641817_1642351_+	inorganic pyrophosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	55.5	1.8e-51
AUL27918.1|1642594_1643290_+	5-carboxymethyl-2-hydroxymuconate isomerase	NA	NA	NA	NA	NA
AUL26097.1|1643304_1643436_+	entericidin	NA	NA	NA	NA	NA
AUL26098.1|1643483_1644608_+	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
AUL26099.1|1644613_1646953_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	40.3	6.9e-151
AUL26100.1|1646949_1647357_-	heat-shock protein Hsp20	NA	NA	NA	NA	NA
AUL26101.1|1647618_1647879_+	hypothetical protein	NA	NA	NA	NA	NA
AUL26102.1|1648101_1649052_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
AUL26103.1|1649101_1650310_+	pilus assembly protein	NA	NA	NA	NA	NA
AUL26104.1|1650531_1651071_+	pilus assembly protein	NA	NA	NA	NA	NA
AUL26105.1|1651295_1651700_+	pilus assembly protein	NA	NA	NA	NA	NA
AUL26106.1|1651764_1652520_+	Flp pilus assembly protein CpaB	NA	NA	NA	NA	NA
AUL26107.1|1652519_1653881_+	secretion protein	NA	NA	NA	NA	NA
AUL26108.1|1653877_1654501_+	pilus assembly protein	NA	NA	NA	NA	NA
AUL26109.1|1654544_1654805_+|transposase	transposase	transposase	NA	NA	NA	NA
AUL26110.1|1655617_1656322_+	pilus assembly protein	NA	NA	NA	NA	NA
AUL26111.1|1656318_1657074_+	pilus assembly protein	NA	NA	NA	NA	NA
AUL26112.1|1657250_1658045_+	pilus assembly protein	NA	NA	NA	NA	NA
AUL26113.1|1658041_1658479_+	hypothetical protein	NA	NA	NA	NA	NA
AUL26114.1|1659163_1660132_-	homoserine kinase	NA	NA	NA	NA	NA
AUL26115.1|1660288_1661296_+|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
AUL26116.1|1661353_1661812_-	hypothetical protein	NA	NA	NA	NA	NA
AUL26117.1|1661885_1663232_-	hypothetical protein	NA	NA	NA	NA	NA
AUL26118.1|1663249_1663621_+	hypothetical protein	NA	NA	NA	NA	NA
AUL26119.1|1663620_1665090_+	hypothetical protein	NA	A0A075BSJ0	Microcystis_phage	36.1	5.8e-47
AUL26120.1|1665245_1665971_+	hypothetical protein	NA	NA	NA	NA	NA
AUL26121.1|1665984_1668699_-	histidine kinase	NA	NA	NA	NA	NA
AUL26122.1|1668950_1670315_+	diguanylate cyclase	NA	NA	NA	NA	NA
AUL26123.1|1670354_1671413_+	chorismate synthase	NA	A0A291AU41	Pandoravirus	43.7	4.9e-80
AUL26124.1|1671440_1672259_+	peptidase M48	NA	NA	NA	NA	NA
AUL27919.1|1672296_1672575_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
AUL26125.1|1673520_1673781_-|transposase	transposase	transposase	NA	NA	NA	NA
AUL26126.1|1673838_1674138_-	LuxR family transcriptional regulator	NA	NA	NA	NA	NA
AUL26127.1|1674707_1676111_+	3-isopropylmalate dehydratase large subunit	NA	NA	NA	NA	NA
AUL26128.1|1676123_1676774_+	3-isopropylmalate dehydratase small subunit	NA	NA	NA	NA	NA
AUL26129.1|1676915_1678136_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
AUL26130.1|1678166_1679243_+	3-isopropylmalate dehydrogenase	NA	NA	NA	NA	NA
AUL26131.1|1679389_1680520_+	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
AUL26132.1|1680706_1682332_+	hypothetical protein	NA	NA	NA	NA	NA
AUL26133.1|1682338_1683154_+|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
AUL27920.1|1683201_1684239_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUL26134.1|1684290_1684950_+	N-(5'-phosphoribosyl)anthranilate isomerase	NA	NA	NA	NA	NA
AUL26135.1|1685589_1686465_-|transposase	transposase	transposase	U5P429	Shigella_phage	61.3	6.2e-97
AUL26136.1|1686461_1686752_-|transposase	transposase	transposase	U5P4I9	Shigella_phage	55.7	1.4e-16
AUL26137.1|1687516_1687777_-|transposase	transposase	transposase	NA	NA	NA	NA
AUL26138.1|1688175_1688865_+	permease	NA	NA	NA	NA	NA
AUL26139.1|1688964_1689126_-	hypothetical protein	NA	NA	NA	NA	NA
AUL26140.1|1689567_1689804_-	hypothetical protein	NA	NA	NA	NA	NA
AUL26141.1|1689993_1690242_-	hypothetical protein	NA	NA	NA	NA	NA
AUL26142.1|1690355_1691726_+	oxygen-independent coproporphyrinogen III oxidase	NA	NA	NA	NA	NA
AUL26143.1|1691726_1692467_-	DNA-binding response regulator	NA	NA	NA	NA	NA
AUL26144.1|1692953_1694906_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	35.9	7.1e-125
AUL26145.1|1694926_1695475_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	29.3	3.8e-12
AUL26146.1|1695640_1696597_+	glutathione synthase	NA	NA	NA	NA	NA
AUL27921.1|1696610_1697009_+	PTS mannose transporter subunit IIA	NA	NA	NA	NA	NA
AUL27922.1|1697071_1697341_+	phosphocarrier protein HPr	NA	NA	NA	NA	NA
AUL26147.1|1697369_1699145_+	phosphoenolpyruvate--protein phosphotransferase	NA	NA	NA	NA	NA
AUL26148.1|1699192_1699402_-	hypothetical protein	NA	NA	NA	NA	NA
AUL26149.1|1699448_1699871_-	OsmC family peroxiredoxin	NA	NA	NA	NA	NA
AUL26150.1|1699990_1700968_+	ornithine cyclodeaminase	NA	NA	NA	NA	NA
AUL26151.1|1701036_1702200_+	branched-chain amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUL26152.1|1702368_1703256_+	ectoine/hydroxyectoine ABC transporter substrate-binding protein EhuB	NA	NA	NA	NA	NA
AUL26153.1|1703266_1703908_+	ectoine/hydroxyectoine ABC transporter permease subunit EhuC	NA	NA	NA	NA	NA
AUL26154.1|1703904_1704576_+	ectoine/hydroxyectoine ABC transporter permease subunit EhuD	NA	NA	NA	NA	NA
AUL26155.1|1704575_1705346_+	ectoine/hydroxyectoine ABC transporter ATP-binding protein EhuA	NA	G9BWD6	Planktothrix_phage	35.8	2.0e-27
AUL26156.1|1705396_1705846_-	deoxyuridine 5'-triphosphate nucleotidohydrolase	NA	Q2NP83	Xanthomonas_phage	62.8	2.3e-47
AUL26157.1|1705887_1706346_-	hypothetical protein	NA	NA	NA	NA	NA
AUL26158.1|1706366_1706999_-	hypothetical protein	NA	NA	NA	NA	NA
AUL26159.1|1707108_1707576_+	hydrolase	NA	NA	NA	NA	NA
AUL26160.1|1707597_1708140_+	hydrolase	NA	NA	NA	NA	NA
AUL26161.1|1708152_1708857_+	dipeptidase E	NA	NA	NA	NA	NA
AUL26162.1|1708875_1709346_-	AsnC family transcriptional regulator	NA	NA	NA	NA	NA
AUL26163.1|1709438_1710179_+	permease	NA	NA	NA	NA	NA
AUL26164.1|1710222_1710483_+|transposase	transposase	transposase	NA	NA	NA	NA
AUL26165.1|1711358_1712570_-	phosphopantothenate synthase	NA	Q9HH70	Methanothermobacter_phage	30.4	2.2e-36
AUL26166.1|1712630_1713146_-	signal peptidase II	NA	NA	NA	NA	NA
AUL26167.1|1713148_1716010_-|tRNA	isoleucine--tRNA ligase	tRNA	A0A1V0SJ93	Klosneuvirus	25.4	1.0e-71
AUL27923.1|1715999_1716965_-	riboflavin biosynthesis protein RibF	NA	NA	NA	NA	NA
AUL26168.1|1717721_1719197_+	rRNA methyltransferase	NA	NA	NA	NA	NA
AUL27924.1|1719201_1719477_-	hypothetical protein	NA	NA	NA	NA	NA
AUL26169.1|1719813_1720074_+|transposase	transposase	transposase	NA	NA	NA	NA
AUL26170.1|1721011_1721218_+	hypothetical protein	NA	NA	NA	NA	NA
AUL26171.1|1721225_1721855_-	antibiotic resistance protein	NA	NA	NA	NA	NA
AUL26172.1|1722149_1724354_-	porin	NA	NA	NA	NA	NA
AUL26173.1|1724464_1725688_-	multidrug transporter	NA	S4TR35	Salmonella_phage	29.4	9.8e-24
AUL26174.1|1725810_1726785_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AUL26175.1|1726852_1728046_-	Rieske (2Fe-2S) protein	NA	NA	NA	NA	NA
AUL26176.1|1728060_1728861_-	siderophore ferric iron reductase	NA	NA	NA	NA	NA
AUL26177.1|1728857_1730714_-	IucA/IucC family protein	NA	NA	NA	NA	NA
AUL26178.1|1730710_1731316_-	siderophore biosynthesis protein	NA	NA	NA	NA	NA
AUL26179.1|1731334_1732720_-	alcaligin biosynthesis protein	NA	NA	NA	NA	NA
AUL26180.1|1734761_1735544_+	3-hydroxybutyrate dehydrogenase	NA	NA	NA	NA	NA
AUL26181.1|1735642_1736593_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
AUL26182.1|1736619_1737393_+	peroxide stress protein YaaA	NA	NA	NA	NA	NA
AUL26183.1|1737404_1738646_+	hypothetical protein	NA	NA	NA	NA	NA
AUL26184.1|1740297_1741248_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 13
CP018892	Bordetella holmesii isolate F617 chromosome, complete genome	3699592	1751652	1845077	3699592	holin,transposase,integrase	Ralstonia_virus(23.53%)	88	1762093:1762152	1839234:1839629
AUL26196.1|1751652_1752603_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
AUL27926.1|1752677_1753187_+	threonine dehydratase	NA	NA	NA	NA	NA
AUL27925.1|1753180_1753762_-	PIN domain-containing protein	NA	NA	NA	NA	NA
AUL26197.1|1754100_1755048_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUL26198.1|1755210_1756083_+	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
AUL26199.1|1756096_1757023_+	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
AUL27927.1|1757063_1757225_+	branched-chain amino acid ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
AUL26200.1|1757184_1758135_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
AUL26201.1|1758917_1760138_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.1	4.6e-183
AUL26202.1|1760148_1760862_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.1	1.7e-12
AUL26203.1|1760899_1762021_+	transporter	NA	NA	NA	NA	NA
1762093:1762152	attL	TGGTTCATCGAGGAATACCGGGGAATGCAGACCGGATCTTGAGGAAGAAGTACTCCTGAT	NA	NA	NA	NA
AUL26204.1|1762096_1763317_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
1762093:1762152	attL	TGGTTCATCGAGGAATACCGGGGAATGCAGACCGGATCTTGAGGAAGAAGTACTCCTGAT	NA	NA	NA	NA
AUL26205.1|1763364_1763724_-	lysine transporter LysE	NA	NA	NA	NA	NA
AUL26206.1|1763804_1764353_+	hypothetical protein	NA	NA	NA	NA	NA
AUL26207.1|1764513_1765692_+	arabinose transporter	NA	NA	NA	NA	NA
AUL26208.1|1765677_1766313_-	chorismate--pyruvate lyase	NA	NA	NA	NA	NA
AUL26209.1|1766378_1767110_+	pseudouridylate synthase	NA	NA	NA	NA	NA
AUL26210.1|1767177_1768110_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUL26211.1|1768298_1769495_+	efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
AUL26212.1|1769507_1772678_+	multidrug efflux RND transporter permease	NA	NA	NA	NA	NA
AUL26213.1|1772674_1774153_+	multidrug transporter	NA	NA	NA	NA	NA
AUL26214.1|1774240_1774492_-	hypothetical protein	NA	NA	NA	NA	NA
AUL26215.1|1774591_1775212_-	SCO family protein	NA	NA	NA	NA	NA
AUL26216.1|1775569_1776085_+	methyltransferase	NA	NA	NA	NA	NA
AUL26217.1|1776081_1777032_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
AUL26218.1|1777141_1779196_-	oligopeptidase A	NA	NA	NA	NA	NA
AUL26219.1|1779315_1780170_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase	NA	A0A249XZQ2	Enterococcus_phage	37.8	1.4e-29
AUL26220.1|1780166_1780793_-	DNA-binding response regulator	NA	NA	NA	NA	NA
AUL27928.1|1780789_1782544_-	PAS domain-containing sensor histidine kinase	NA	NA	NA	NA	NA
AUL26221.1|1783089_1785801_+	pyruvate dehydrogenase (acetyl-transferring), homodimeric type	NA	NA	NA	NA	NA
AUL26222.1|1785813_1787478_+	dihydrolipoyllysine-residue acetyltransferase	NA	NA	NA	NA	NA
AUL26223.1|1787493_1789269_+	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	25.4	3.5e-38
AUL26224.1|1789682_1789895_+	hypothetical protein	NA	NA	NA	NA	NA
AUL26225.1|1790067_1791048_+	taurine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUL26226.1|1791064_1791859_+	ABC transporter permease	NA	NA	NA	NA	NA
AUL26227.1|1791883_1792360_+	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
AUL27929.1|1792976_1793630_-	short-chain dehydrogenase	NA	NA	NA	NA	NA
AUL26228.1|1793711_1794647_+	transcriptional regulator	NA	NA	NA	NA	NA
AUL26229.1|1794908_1795055_+	50S ribosomal protein L36	NA	NA	NA	NA	NA
AUL26230.1|1795145_1795547_+	hypothetical protein	NA	NA	NA	NA	NA
AUL26231.1|1795621_1796506_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AUL26232.1|1796598_1797303_+	fumarylacetoacetate hydrolase	NA	NA	NA	NA	NA
AUL26233.1|1797341_1799423_-	bifunctional diguanylate cyclase/phosphodiesterase	NA	NA	NA	NA	NA
AUL26234.1|1799555_1800467_-	3-phosphoglycerate dehydrogenase	NA	M1HBE3	Paramecium_bursaria_Chlorella_virus	30.7	3.7e-20
AUL26235.1|1800531_1800963_-	energy transducer TonB	NA	NA	NA	NA	NA
AUL26236.1|1801065_1802064_-	cointegrate resolution protein	NA	NA	NA	NA	NA
AUL27930.1|1802307_1803291_+|integrase	integrase	integrase	NA	NA	NA	NA
AUL26237.1|1803407_1803689_+	peptidylprolyl isomerase	NA	NA	NA	NA	NA
AUL26238.1|1803762_1804227_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AUL27931.1|1804446_1804716_-	hypothetical protein	NA	NA	NA	NA	NA
AUL26239.1|1804790_1805009_+	SlyX protein	NA	NA	NA	NA	NA
AUL26240.1|1805034_1805817_+	hydrolase	NA	NA	NA	NA	NA
AUL26241.1|1805855_1806353_-	osmotically inducible protein Y	NA	NA	NA	NA	NA
AUL26242.1|1806651_1807875_+	MFS transporter	NA	NA	NA	NA	NA
AUL26243.1|1807871_1808732_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUL26244.1|1808950_1810171_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
AUL26245.1|1810259_1811579_+	MFS transporter	NA	NA	NA	NA	NA
AUL26246.1|1811632_1813804_-|holin	phospholipase C, phosphocholine-specific	holin	NA	NA	NA	NA
AUL26247.1|1814031_1814844_-	nucleotide pyrophosphatase	NA	NA	NA	NA	NA
AUL26248.1|1814919_1815924_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	60.8	4.4e-139
AUL26249.1|1816989_1817811_-|transposase	transposase	transposase	S5WIU1	Leptospira_phage	43.7	7.2e-55
1815869:1816207	attR	ATCAGGAGTACTTCTTCCTCAAGATCCGGTCTGCATTCCCCGGTATTCCTCGATGAACCATAAATCAGGGTGTGCATGCCCTCGGCCTCGAAAGCCAGGGCCGAATCCACATACTCCGACGTGGTGCCTGCCACCCGCGCGATCTCGACTCCGTCGCGGCTGATGACGACGTCGCCCTGCGGCTCGCCGACGCGCACCCAACGCAGAGTCACGCTTTTGTTATCCGTGGCCGTGCGCGTCACCAGTCTGCGCACCGCCACGGGTTCTGCCAGCGACGTGCCCGCCATGTCGTACGCGCGCGGCTCGGGCAATGCGCCCATGTGGCTCAACACGGTCGGC	NA	NA	NA	NA
AUL26250.1|1817849_1818110_-|transposase	transposase	transposase	NA	NA	NA	NA
1815869:1816207	attR	ATCAGGAGTACTTCTTCCTCAAGATCCGGTCTGCATTCCCCGGTATTCCTCGATGAACCATAAATCAGGGTGTGCATGCCCTCGGCCTCGAAAGCCAGGGCCGAATCCACATACTCCGACGTGGTGCCTGCCACCCGCGCGATCTCGACTCCGTCGCGGCTGATGACGACGTCGCCCTGCGGCTCGCCGACGCGCACCCAACGCAGAGTCACGCTTTTGTTATCCGTGGCCGTGCGCGTCACCAGTCTGCGCACCGCCACGGGTTCTGCCAGCGACGTGCCCGCCATGTCGTACGCGCGCGGCTCGGGCAATGCGCCCATGTGGCTCAACACGGTCGGC	NA	NA	NA	NA
AUL26251.1|1818969_1819755_+	exodeoxyribonuclease III	NA	NA	NA	NA	NA
AUL27932.1|1820217_1821036_-|transposase	transposase	transposase	S5WIU1	Leptospira_phage	46.0	1.2e-54
AUL27933.1|1821094_1822105_+|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	45.9	4.4e-78
AUL26252.1|1822101_1822872_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	56.6	2.8e-77
AUL26253.1|1823025_1823286_-|transposase	transposase	transposase	NA	NA	NA	NA
AUL26254.1|1823364_1823625_-	hypothetical protein	NA	NA	NA	NA	NA
AUL27934.1|1823820_1824609_-|transposase	transposase	transposase	S5WIU1	Leptospira_phage	37.5	1.4e-44
AUL26255.1|1824641_1824908_-|transposase	transposase	transposase	NA	NA	NA	NA
AUL26256.1|1824947_1825268_-	hypothetical protein	NA	NA	NA	NA	NA
AUL26257.1|1825433_1825715_-|integrase	integrase	integrase	NA	NA	NA	NA
AUL26258.1|1826016_1827207_+	succinyldiaminopimelate transaminase	NA	NA	NA	NA	NA
AUL26259.1|1827231_1828053_+	2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase	NA	NA	NA	NA	NA
AUL26260.1|1828052_1829186_+	succinyl-diaminopimelate desuccinylase	NA	NA	NA	NA	NA
AUL26261.1|1829192_1830083_+	ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
AUL26262.1|1830097_1832005_+	ABC transporter	NA	A0A2K9L0W2	Tupanvirus	31.9	4.3e-66
AUL26263.1|1832268_1834650_+	TonB-dependent receptor	NA	NA	NA	NA	NA
AUL26264.1|1834660_1836943_-	DNA helicase II	NA	A7KV33	Bacillus_phage	36.2	2.5e-105
AUL26265.1|1836939_1838148_-	acyl-CoA desaturase	NA	NA	NA	NA	NA
AUL26266.1|1838448_1839270_-|transposase	transposase	transposase	S5WIU1	Leptospira_phage	44.0	1.1e-55
AUL26267.1|1839308_1839569_-|transposase	transposase	transposase	NA	NA	NA	NA
AUL27935.1|1839611_1840352_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUL26268.1|1840335_1841316_+	hydroxyacid dehydrogenase	NA	M1HUT5	Acanthocystis_turfacea_Chlorella_virus	29.2	4.3e-14
AUL26269.1|1841458_1841953_+	RNA polymerase subunit sigma-70	NA	NA	NA	NA	NA
AUL26270.1|1841954_1842872_+	iron dicitrate transport regulator FecR	NA	NA	NA	NA	NA
AUL26271.1|1842951_1844136_+	TonB-dependent receptor	NA	NA	NA	NA	NA
AUL26272.1|1844126_1845077_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 14
CP018892	Bordetella holmesii isolate F617 chromosome, complete genome	3699592	1965394	2022004	3699592	transposase,integrase	Leptospira_phage(22.22%)	46	1960078:1960093	1990239:1990254
1960078:1960093	attL	GGCTGTTGCCGGCAAG	NA	NA	NA	NA
AUL26385.1|1965394_1965655_-|transposase	transposase	transposase	NA	NA	NA	NA
AUL26386.1|1965678_1965873_-	hypothetical protein	NA	NA	NA	NA	NA
AUL26387.1|1965872_1968080_-	outer membrane receptor protein	NA	NA	NA	NA	NA
AUL26388.1|1968352_1969150_+	enterobactin-dependent positive regulator	NA	NA	NA	NA	NA
AUL26389.1|1969195_1970251_-	diguanylate cyclase	NA	NA	NA	NA	NA
AUL26390.1|1970285_1970480_-|integrase	integrase	integrase	A0A1W6JTA0	Pseudomonas_phage	52.8	1.1e-06
AUL26391.1|1970476_1971418_-	LD-carboxypeptidase	NA	NA	NA	NA	NA
AUL26392.1|1971920_1972805_+	hypothetical protein	NA	NA	NA	NA	NA
AUL26393.1|1973229_1975458_+	isocitrate dehydrogenase (NADP(+))	NA	NA	NA	NA	NA
AUL26394.1|1975742_1976207_+	hypothetical protein	NA	NA	NA	NA	NA
AUL26395.1|1976213_1977731_+	hypothetical protein	NA	NA	NA	NA	NA
AUL26396.1|1977779_1978532_-	polar amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	42.3	4.3e-30
AUL26397.1|1978539_1979193_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
AUL26398.1|1979229_1980018_-	amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUL26399.1|1980135_1980717_-	polyisoprenoid-binding protein	NA	NA	NA	NA	NA
AUL26400.1|1980999_1981383_-	hypothetical protein	NA	NA	NA	NA	NA
AUL26401.1|1981967_1982297_+	hypothetical protein	NA	NA	NA	NA	NA
AUL26402.1|1983476_1984205_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	23.1	1.8e-09
AUL27940.1|1984201_1984966_-	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	31.2	2.3e-18
AUL26403.1|1984965_1986849_-	ABC transporter permease	NA	NA	NA	NA	NA
AUL26404.1|1986861_1988067_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUL26405.1|1989783_1990518_-	hypothetical protein	NA	NA	NA	NA	NA
1990239:1990254	attR	GGCTGTTGCCGGCAAG	NA	NA	NA	NA
AUL26406.1|1990694_1991486_+	hydratase	NA	NA	NA	NA	NA
AUL26407.1|1991508_1993053_-	hypothetical protein	NA	A0A0R6PEZ3	Moraxella_phage	42.9	8.8e-38
AUL26408.1|1993797_1994997_+	diguanylate phosphodiesterase	NA	NA	NA	NA	NA
AUL26409.1|1995433_1996057_+	DNA-binding response regulator	NA	NA	NA	NA	NA
AUL26410.1|1996062_1999719_+	virulence sensor protein	NA	Q8QKV7	Ectocarpus_siliculosus_virus	32.0	6.5e-39
AUL26411.1|2001907_2003605_+	hypothetical protein	NA	NA	NA	NA	NA
AUL26412.1|2003989_2004250_+|transposase	transposase	transposase	NA	NA	NA	NA
AUL26413.1|2004288_2005110_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	44.0	1.9e-55
AUL26414.1|2005142_2005457_+	glutamate decarboxylase	NA	NA	NA	NA	NA
AUL26415.1|2005546_2007247_+	transporter	NA	NA	NA	NA	NA
AUL26416.1|2007326_2007704_+	hypothetical protein	NA	NA	NA	NA	NA
AUL26417.1|2007840_2008566_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AUL26418.1|2008698_2009685_+	C4-dicarboxylate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUL26419.1|2009687_2010161_+	TRAP transporter small permease protein	NA	NA	NA	NA	NA
AUL26420.1|2010165_2011449_+	C4-dicarboxylate ABC transporter permease	NA	NA	NA	NA	NA
AUL26421.1|2011445_2012336_+	CoA ester lyase	NA	NA	NA	NA	NA
AUL26422.1|2012332_2014030_+	thiamine pyrophosphate-binding protein	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	25.7	4.0e-31
AUL26423.1|2015354_2016854_+	aldehyde dehydrogenase PuuC	NA	NA	NA	NA	NA
AUL26424.1|2016926_2017445_+	hypothetical protein	NA	NA	NA	NA	NA
AUL26425.1|2017518_2018409_+	phosphatidylserine decarboxylase	NA	NA	NA	NA	NA
AUL26426.1|2018466_2019720_+	alpha-hydroxy-acid oxidizing enzyme	NA	NA	NA	NA	NA
AUL26427.1|2019754_2020519_-	iron ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUL26428.1|2020883_2021705_-|transposase	transposase	transposase	S5WIU1	Leptospira_phage	44.0	1.1e-55
AUL26429.1|2021743_2022004_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 15
CP018892	Bordetella holmesii isolate F617 chromosome, complete genome	3699592	2129890	2185559	3699592	protease,transposase,tRNA	uncultured_Mediterranean_phage(14.29%)	60	NA	NA
AUL26510.1|2129890_2130151_+|transposase	transposase	transposase	NA	NA	NA	NA
AUL26511.1|2130189_2131011_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	44.0	1.9e-55
AUL26512.1|2131054_2131807_-	hypothetical protein	NA	NA	NA	NA	NA
AUL26513.1|2132098_2132521_-	hypothetical protein	NA	NA	NA	NA	NA
AUL26514.1|2132790_2133570_-	3'-5' exonuclease	NA	NA	NA	NA	NA
AUL26515.1|2133566_2134430_-	peptidase	NA	A0A292GJG6	Xanthomonas_phage	40.5	8.5e-14
AUL26516.1|2134447_2135245_-	protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	47.5	9.8e-33
AUL26517.1|2135229_2135988_-	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	53.3	1.9e-70
AUL26518.1|2136152_2136791_+	glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
AUL26519.1|2136787_2137366_-	hypothetical protein	NA	NA	NA	NA	NA
AUL26520.1|2137377_2137911_-	carboxymuconolactone decarboxylase	NA	NA	NA	NA	NA
AUL26521.1|2137915_2138875_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUL26522.1|2138905_2139688_-	amidohydrolase	NA	NA	NA	NA	NA
AUL26523.1|2139797_2140790_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUL26524.1|2140791_2141829_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	53.7	5.6e-97
AUL26525.1|2141913_2143206_+	guanine permease	NA	A0A0R6PHV4	Moraxella_phage	36.7	2.9e-66
AUL26526.1|2143388_2144405_+	luciferase	NA	NA	NA	NA	NA
AUL26527.1|2144513_2144897_+	thioredoxin	NA	V9SJ74	Achromobacter_phage	26.8	1.2e-09
AUL27947.1|2144900_2145257_-	hypothetical protein	NA	NA	NA	NA	NA
AUL26528.1|2145277_2145508_-	hypothetical protein	NA	NA	NA	NA	NA
AUL26529.1|2145531_2146329_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUL26530.1|2146333_2147101_-	ABC transporter permease	NA	NA	NA	NA	NA
AUL26531.1|2147097_2148093_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUL26532.1|2148142_2148907_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	33.7	6.3e-29
AUL26533.1|2149079_2150684_-	ABC-F family ATPase	NA	A0A1V0SKJ1	Klosneuvirus	28.9	7.7e-53
AUL26534.1|2150937_2151918_-	LD-carboxypeptidase	NA	NA	NA	NA	NA
AUL26535.1|2151914_2152403_-|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	S4VYT2	Pandoravirus	39.1	1.3e-06
AUL26536.1|2152395_2153244_-	hydrolase	NA	NA	NA	NA	NA
AUL26537.1|2153335_2153833_-	hypothetical protein	NA	NA	NA	NA	NA
AUL26538.1|2153970_2154330_-	cation:proton antiporter	NA	NA	NA	NA	NA
AUL26539.1|2154326_2154608_-	K+/H+ antiporter subunit F	NA	NA	NA	NA	NA
AUL26540.1|2154607_2155090_-	Na+/H+ antiporter subunit E	NA	NA	NA	NA	NA
AUL26541.1|2155091_2156720_-	monovalent cation/H+ antiporter subunit D	NA	NA	NA	NA	NA
AUL26542.1|2156716_2157061_-	Na+/H+ antiporter subunit C	NA	NA	NA	NA	NA
AUL26543.1|2157062_2160005_-	monovalent cation/H+ antiporter subunit A	NA	NA	NA	NA	NA
AUL26544.1|2160450_2161422_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUL27948.1|2161411_2162794_-	GTP-binding protein	NA	NA	NA	NA	NA
AUL26545.1|2162936_2163887_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
AUL26546.1|2163846_2165088_-	GTP-binding protein	NA	NA	NA	NA	NA
AUL26547.1|2165084_2166206_-	DNA repair exonuclease	NA	NA	NA	NA	NA
AUL26548.1|2167697_2168165_+	transcriptional regulator	NA	NA	NA	NA	NA
AUL26549.1|2168235_2168886_+	hypothetical protein	NA	NA	NA	NA	NA
AUL26550.1|2168972_2170112_+	hypothetical protein	NA	NA	NA	NA	NA
AUL26551.1|2170280_2171285_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	60.8	4.4e-139
AUL26552.1|2171281_2172529_+	UDP-N-acetylglucosamine 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
AUL26553.1|2172881_2173748_+	DeoR family transcriptional regulator	NA	A0A077SK06	Escherichia_phage	30.0	5.9e-23
AUL26554.1|2173707_2175312_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
AUL26555.1|2175323_2176010_-	type 1 glutamine amidotransferase domain-containing protein	NA	NA	NA	NA	NA
AUL26556.1|2176006_2177047_-	NADP-dependent oxidoreductase	NA	NA	NA	NA	NA
AUL26557.1|2177162_2177834_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
AUL27949.1|2177854_2178823_+	secretion protein HlyD	NA	NA	NA	NA	NA
AUL26558.1|2178819_2179758_+	multidrug ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.4	8.6e-20
AUL26559.1|2179754_2180909_+	mannose-1-phosphate guanyltransferase	NA	NA	NA	NA	NA
AUL26560.1|2180917_2182369_+	ABC transporter permease	NA	NA	NA	NA	NA
AUL26561.1|2182399_2182882_+	hypothetical protein	NA	NA	NA	NA	NA
AUL26562.1|2182883_2183777_+	hypothetical protein	NA	Q9J5E1	Fowlpox_virus	34.8	6.5e-25
AUL26563.1|2183773_2184217_+	hypothetical protein	NA	NA	NA	NA	NA
AUL26564.1|2184229_2184607_-	hypothetical protein	NA	NA	NA	NA	NA
AUL26565.1|2184746_2185145_+|protease	membrane-associated protease	protease	NA	NA	NA	NA
AUL26566.1|2185271_2185559_+|protease	CAAX protease family protein	protease	NA	NA	NA	NA
>prophage 16
CP018892	Bordetella holmesii isolate F617 chromosome, complete genome	3699592	2283364	2341776	3699592	transposase,tRNA	Shigella_phage(22.22%)	50	NA	NA
AUL26658.1|2283364_2283625_-|transposase	transposase	transposase	NA	NA	NA	NA
AUL26659.1|2283835_2285134_+	C4-dicarboxylate ABC transporter	NA	NA	NA	NA	NA
AUL26660.1|2285176_2286205_+	C4-dicarboxylate ABC transporter	NA	NA	NA	NA	NA
AUL26661.1|2286319_2286886_-	transcription elongation factor GreB	NA	NA	NA	NA	NA
AUL26662.1|2286944_2287790_-	phosphatase	NA	NA	NA	NA	NA
AUL27955.1|2287847_2288723_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
AUL26663.1|2288974_2289589_-	hypothetical protein	NA	NA	NA	NA	NA
AUL26664.1|2289598_2290819_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
AUL26665.1|2290867_2291533_-	hypothetical protein	NA	NA	NA	NA	NA
AUL26666.1|2291580_2292576_-	hypothetical protein	NA	NA	NA	NA	NA
AUL26667.1|2295753_2296668_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUL26668.1|2296817_2297783_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUL26669.1|2297790_2298207_+	4-carboxymuconolactone decarboxylase	NA	NA	NA	NA	NA
AUL26670.1|2298203_2299121_+	oxidoreductase	NA	NA	NA	NA	NA
AUL26671.1|2299132_2299552_+	hypothetical protein	NA	NA	NA	NA	NA
AUL26672.1|2299460_2300849_+	succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
AUL27956.1|2300845_2301097_-	hypothetical protein	NA	NA	NA	NA	NA
AUL26673.1|2301267_2302224_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUL26674.1|2302206_2302419_+	hypothetical protein	NA	NA	NA	NA	NA
AUL26675.1|2302468_2303242_+	MBL fold hydrolase	NA	NA	NA	NA	NA
AUL26676.1|2303238_2304372_+	malate dehydrogenase	NA	NA	NA	NA	NA
AUL26677.1|2304381_2305332_+	D-3-phosphoglycerate dehydrogenase	NA	M1HKI4	Acanthocystis_turfacea_Chlorella_virus	28.4	4.8e-18
AUL26678.1|2305363_2306164_+	aldolase	NA	NA	NA	NA	NA
AUL26679.1|2306178_2307333_+	hypothetical protein	NA	NA	NA	NA	NA
AUL26680.1|2307160_2308036_-|transposase	transposase	transposase	U5P429	Shigella_phage	61.3	6.2e-97
AUL26681.1|2308032_2308323_-|transposase	transposase	transposase	U5P4I9	Shigella_phage	55.7	1.4e-16
AUL26682.1|2308435_2309404_+	hypothetical protein	NA	NA	NA	NA	NA
AUL26683.1|2309400_2310321_+	hypothetical protein	NA	NA	NA	NA	NA
AUL26684.1|2310417_2314896_-	hypothetical protein	NA	NA	NA	NA	NA
AUL26685.1|2315274_2319609_-	hypothetical protein	NA	NA	NA	NA	NA
AUL26686.1|2320247_2320811_-	hypothetical protein	NA	NA	NA	NA	NA
AUL26687.1|2320822_2321068_-	RNA-binding protein	NA	NA	NA	NA	NA
AUL26688.1|2321223_2321733_+	RNA polymerase subunit sigma	NA	NA	NA	NA	NA
AUL26689.1|2321778_2322759_+	iron dicitrate transport regulator FecR	NA	NA	NA	NA	NA
AUL26690.1|2322970_2325322_+	TonB-dependent receptor	NA	NA	NA	NA	NA
AUL27957.1|2325368_2326175_-	DNAase	NA	NA	NA	NA	NA
AUL26691.1|2326195_2326885_-	lipoprotein ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	40.8	3.1e-35
AUL26692.1|2326877_2328158_-	ABC transporter permease	NA	NA	NA	NA	NA
AUL26693.1|2328255_2329194_+	hypothetical protein	NA	NA	NA	NA	NA
AUL26694.1|2329175_2330882_+	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	28.1	2.2e-50
AUL26695.1|2332115_2332865_+	short-chain dehydrogenase	NA	NA	NA	NA	NA
AUL26696.1|2332871_2334386_+|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.9	8.8e-83
AUL26697.1|2334398_2334686_+	hypothetical protein	NA	NA	NA	NA	NA
AUL27958.1|2334706_2335594_-	methylglyoxal synthase	NA	NA	NA	NA	NA
AUL26698.1|2335744_2336251_+	RNA polymerase subunit sigma	NA	NA	NA	NA	NA
AUL26699.1|2336247_2337204_+	iron dicitrate transport regulator FecR	NA	NA	NA	NA	NA
AUL26700.1|2337391_2338738_+	protein FpvAIII	NA	NA	NA	NA	NA
AUL26701.1|2339683_2340454_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	56.6	2.8e-77
AUL27959.1|2340450_2341461_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	45.9	4.4e-78
AUL26702.1|2341530_2341776_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 17
CP018892	Bordetella holmesii isolate F617 chromosome, complete genome	3699592	2357686	2392869	3699592	protease,transposase	Leptospira_phage(20.0%)	34	NA	NA
AUL26720.1|2357686_2358730_+	alcohol dehydrogenase	NA	A0A2K9L339	Tupanvirus	29.2	1.4e-31
AUL27960.1|2358726_2358828_+	hypothetical protein	NA	NA	NA	NA	NA
AUL26721.1|2358919_2359180_+|transposase	transposase	transposase	NA	NA	NA	NA
AUL26722.1|2359218_2360040_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	44.0	1.9e-55
AUL26723.1|2360289_2360943_+	repressor LexA	NA	A0A2H4JG58	uncultured_Caudovirales_phage	50.7	1.9e-10
AUL26724.1|2361058_2362279_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
AUL26725.1|2362329_2364759_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	51.4	3.6e-219
AUL26726.1|2364924_2366223_-|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	54.3	3.1e-129
AUL26727.1|2366327_2366981_-	ATP-dependent Clp endopeptidase, proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	55.9	2.0e-55
AUL26728.1|2366983_2368294_-	trigger factor	NA	NA	NA	NA	NA
AUL26729.1|2368521_2369061_+	TIGR00645 family protein	NA	K4K6D8	Caulobacter_phage	35.8	4.3e-24
AUL26730.1|2369545_2369806_+|transposase	transposase	transposase	NA	NA	NA	NA
AUL27961.1|2370091_2371102_+|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	45.9	4.4e-78
AUL26731.1|2371098_2371869_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	56.6	2.8e-77
AUL26732.1|2371948_2372614_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	46.1	2.1e-49
AUL26733.1|2372581_2373073_-	SpoVR like family protein	NA	NA	NA	NA	NA
AUL26734.1|2373182_2373386_-	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	66.7	6.6e-18
AUL26735.1|2373703_2374024_-	hypothetical protein	NA	NA	NA	NA	NA
AUL26736.1|2374007_2374343_-	hypothetical protein	NA	NA	NA	NA	NA
AUL26737.1|2374397_2374610_-	autotransporter	NA	NA	NA	NA	NA
AUL26738.1|2374685_2375024_+|transposase	transposase	transposase	A0A218MNG9	uncultured_virus	50.0	3.7e-05
AUL27962.1|2375020_2375356_+|transposase	transposase	transposase	NA	NA	NA	NA
AUL26739.1|2375418_2376990_+|transposase	IS66 family transposase	transposase	A0A218MNE7	uncultured_virus	47.5	2.0e-125
AUL26740.1|2377783_2378095_+	hypothetical protein	NA	NA	NA	NA	NA
AUL26741.1|2378287_2379109_-|transposase	transposase	transposase	S5WIU1	Leptospira_phage	44.0	1.1e-55
AUL26742.1|2379147_2379408_-|transposase	transposase	transposase	NA	NA	NA	NA
AUL26743.1|2379535_2379730_-	hypothetical protein	NA	NA	NA	NA	NA
AUL27963.1|2385812_2386103_+|transposase	transposase	transposase	U5P4I9	Shigella_phage	55.7	1.4e-16
AUL26744.1|2386099_2386975_+|transposase	transposase	transposase	U5P429	Shigella_phage	61.3	6.2e-97
AUL26745.1|2387359_2388823_+	ribonuclease E/G	NA	NA	NA	NA	NA
AUL26746.1|2388955_2390506_+	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	32.9	4.1e-19
AUL26747.1|2390817_2391639_-|transposase	transposase	transposase	S5WIU1	Leptospira_phage	44.0	1.9e-55
AUL26748.1|2391677_2391938_-|transposase	transposase	transposase	NA	NA	NA	NA
AUL26749.1|2392014_2392869_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	77.8	7.3e-127
>prophage 18
CP018892	Bordetella holmesii isolate F617 chromosome, complete genome	3699592	2474866	2518694	3699592	protease,transposase,tRNA	Shigella_phage(40.0%)	35	NA	NA
AUL26820.1|2474866_2475514_-|protease	site-2 protease family protein	protease	NA	NA	NA	NA
AUL26821.1|2475598_2476225_-	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
AUL26822.1|2476289_2477135_+	hypothetical protein	NA	A0A1I9SA48	Rhodococcus_phage	35.1	2.4e-37
AUL26823.1|2477464_2478016_+	hypothetical protein	NA	NA	NA	NA	NA
AUL26824.1|2478779_2479073_-	hypothetical protein	NA	NA	NA	NA	NA
AUL26825.1|2479287_2479617_-	alkylhydroperoxidase	NA	NA	NA	NA	NA
AUL26826.1|2480200_2481661_+	cardiolipin synthase	NA	NA	NA	NA	NA
AUL26827.1|2481619_2481844_-	hypothetical protein	NA	NA	NA	NA	NA
AUL26828.1|2482220_2483540_-	MFS transporter	NA	NA	NA	NA	NA
AUL26829.1|2483582_2484056_-	hypothetical protein	NA	NA	NA	NA	NA
AUL26830.1|2484052_2485063_-	hypothetical protein	NA	NA	NA	NA	NA
AUL26831.1|2485127_2486093_-	pyridoxal-5'-phosphate-dependent protein	NA	NA	NA	NA	NA
AUL26832.1|2486217_2486478_+|transposase	transposase	transposase	NA	NA	NA	NA
AUL26833.1|2487321_2488197_-|transposase	transposase	transposase	U5P429	Shigella_phage	61.3	6.2e-97
AUL26834.1|2488193_2488484_-|transposase	transposase	transposase	U5P4I9	Shigella_phage	55.7	1.4e-16
AUL26835.1|2488753_2489671_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUL26836.1|2491026_2492313_+	phospholipase	NA	NA	NA	NA	NA
AUL26837.1|2492406_2493006_+	hypothetical protein	NA	NA	NA	NA	NA
AUL26838.1|2493230_2493752_-	hypothetical protein	NA	NA	NA	NA	NA
AUL26839.1|2494017_2494572_+	hypothetical protein	NA	NA	NA	NA	NA
AUL26840.1|2494591_2495953_-	hypothetical protein	NA	NA	NA	NA	NA
AUL26841.1|2496305_2498885_+	bifunctional diguanylate cyclase/phosphodiesterase	NA	NA	NA	NA	NA
AUL26842.1|2498931_2500038_+|tRNA	tRNA 2-selenouridine(34) synthase MnmH	tRNA	NA	NA	NA	NA
AUL26843.1|2500184_2500694_+	dehydratase	NA	NA	NA	NA	NA
AUL26844.1|2500717_2501698_+	LacI family transcriptional regulator	NA	NA	NA	NA	NA
AUL27966.1|2501703_2503119_+	2-methylcitrate dehydratase	NA	NA	NA	NA	NA
AUL26845.1|2503115_2504288_+	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
AUL26846.1|2504284_2505505_+	CoA transferase	NA	NA	NA	NA	NA
AUL26847.1|2505501_2506299_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AUL26848.1|2507107_2511787_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	A0A2L1IV18	Escherichia_phage	28.4	1.1e-27
AUL26849.1|2514935_2515898_-	iron dicitrate transport regulator FecR	NA	NA	NA	NA	NA
AUL26850.1|2515894_2516413_-	RNA polymerase subunit sigma	NA	NA	NA	NA	NA
AUL26851.1|2516567_2516888_+	amidohydrolase	NA	NA	NA	NA	NA
AUL26852.1|2517573_2517834_+|transposase	transposase	transposase	NA	NA	NA	NA
AUL26853.1|2517872_2518694_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	44.4	2.9e-56
>prophage 19
CP018892	Bordetella holmesii isolate F617 chromosome, complete genome	3699592	2557515	2658235	3699592	transposase,tRNA	Ralstonia_virus(15.79%)	97	NA	NA
AUL26889.1|2557515_2557776_-|transposase	transposase	transposase	NA	NA	NA	NA
AUL26890.1|2558785_2559301_+	hypothetical protein	NA	T1SAR8	Salmonella_phage	44.6	3.9e-06
AUL26891.1|2559573_2559888_+	virulence factor	NA	NA	NA	NA	NA
AUL26892.1|2560075_2560312_-	hypothetical protein	NA	NA	NA	NA	NA
AUL26893.1|2560602_2561958_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	47.5	2.1e-83
AUL27968.1|2562004_2563345_-	recombination factor protein RarA	NA	G3MBE0	Bacillus_virus	38.9	9.3e-76
AUL26894.1|2563446_2564079_-	outer membrane lipoprotein carrier protein LolA	NA	NA	NA	NA	NA
AUL26895.1|2564078_2566448_-	cell division protein FtsK	NA	S5VNE3	Mycobacterium_phage	47.7	2.2e-80
AUL26896.1|2566480_2567440_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	40.5	4.8e-58
AUL26897.1|2567426_2568119_+	DNA mismatch repair protein MutS	NA	NA	NA	NA	NA
AUL26898.1|2568115_2568448_+	QacE family quaternary ammonium compound efflux SMR transporter	NA	NA	NA	NA	NA
AUL26899.1|2568563_2569514_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
AUL26900.1|2569510_2571577_-	cation acetate symporter	NA	NA	NA	NA	NA
AUL26901.1|2571576_2571849_-	hypothetical protein	NA	NA	NA	NA	NA
AUL26902.1|2572543_2572633_+	potassium-transporting ATPase subunit F	NA	NA	NA	NA	NA
AUL26903.1|2572632_2574417_+	potassium-transporting ATPase subunit KdpA	NA	NA	NA	NA	NA
AUL26904.1|2574440_2576606_+	potassium-transporting ATPase subunit B	NA	M1HBF8	Paramecium_bursaria_Chlorella_virus	26.9	7.8e-24
AUL26905.1|2576616_2577216_+	potassium-transporting ATPase subunit C	NA	NA	NA	NA	NA
AUL26906.1|2579979_2580675_+	two-component system response regulator KdpE	NA	NA	NA	NA	NA
AUL26907.1|2580683_2581925_-	hypothetical protein	NA	NA	NA	NA	NA
AUL26908.1|2582074_2583055_-	hypothetical protein	NA	NA	NA	NA	NA
AUL26909.1|2583253_2584510_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	64.8	1.2e-11
AUL26910.1|2584712_2585138_+	hypothetical protein	NA	NA	NA	NA	NA
AUL26911.1|2585188_2585551_-	cytochrome	NA	NA	NA	NA	NA
AUL27969.1|2586079_2586967_+	ATP-binding protein	NA	NA	NA	NA	NA
AUL26912.1|2588163_2588406_-	N-acetyltransferase	NA	NA	NA	NA	NA
AUL26913.1|2588402_2588777_-	hypothetical protein	NA	NA	NA	NA	NA
AUL26914.1|2589109_2591860_+	peptidase M16	NA	A0A2K9LA15	Tupanvirus	28.1	1.5e-19
AUL26915.1|2592028_2593174_-	molecular chaperone DnaJ	NA	A0A1V0SBY2	Catovirus	60.8	4.0e-19
AUL26916.1|2593274_2595200_-	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	49.7	2.7e-145
AUL26917.1|2595288_2595663_-	thiol reductase thioredoxin	NA	NA	NA	NA	NA
AUL26918.1|2595684_2596215_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
AUL26919.1|2596328_2596562_-	hypothetical protein	NA	NA	NA	NA	NA
AUL26920.1|2596648_2597740_-	ferrochelatase	NA	NA	NA	NA	NA
AUL26921.1|2597772_2598777_-	heat-inducible transcriptional repressor HrcA	NA	NA	NA	NA	NA
AUL26922.1|2598886_2599786_+	NAD kinase	NA	NA	NA	NA	NA
AUL26923.1|2599807_2601463_+	DNA repair protein RecN	NA	NA	NA	NA	NA
AUL27970.1|2601567_2602311_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	73.7	2.1e-101
AUL26924.1|2603140_2603401_-|transposase	transposase	transposase	NA	NA	NA	NA
AUL26925.1|2604115_2604532_-	ferric iron uptake transcriptional regulator	NA	NA	NA	NA	NA
AUL27971.1|2604802_2605300_+	hypothetical protein	NA	NA	NA	NA	NA
AUL26926.1|2605315_2606107_+	4-hydroxy-tetrahydrodipicolinate reductase	NA	NA	NA	NA	NA
AUL27972.1|2606164_2607151_-	UDP-N-acetylenolpyruvoylglucosamine reductase	NA	NA	NA	NA	NA
AUL27973.1|2607497_2608043_-|transposase	transposase	transposase	U5P429	Shigella_phage	66.3	2.2e-68
AUL26927.1|2608085_2608346_+|transposase	transposase	transposase	NA	NA	NA	NA
AUL26928.1|2608438_2608939_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	50.3	9.5e-42
AUL26929.1|2609455_2610109_+	thiol:disulfide interchange protein DsbG	NA	NA	NA	NA	NA
AUL26930.1|2610290_2610998_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AUL26931.1|2610994_2613610_+	Fe/S-dependent 2-methylisocitrate dehydratase AcnD	NA	NA	NA	NA	NA
AUL26932.1|2613666_2614851_+	putative methylaconitate Delta-isomerase PrpF	NA	NA	NA	NA	NA
AUL26933.1|2614911_2615520_+	lysine transporter LysE	NA	NA	NA	NA	NA
AUL26934.1|2615642_2616668_-	LacI family transcriptional regulator	NA	NA	NA	NA	NA
AUL26935.1|2616731_2617262_-	short-chain dehydrogenase	NA	NA	NA	NA	NA
AUL26936.1|2617141_2617483_-	hypothetical protein	NA	NA	NA	NA	NA
AUL26937.1|2617479_2618187_-	short-chain dehydrogenase	NA	NA	NA	NA	NA
AUL26938.1|2618196_2619090_-	carboxyvinyl-carboxyphosphonate phosphorylmutase	NA	NA	NA	NA	NA
AUL26939.1|2619073_2619832_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AUL26940.1|2620123_2622799_+	aconitate hydratase 1	NA	NA	NA	NA	NA
AUL26941.1|2622815_2624177_+	dihydroorotase	NA	NA	NA	NA	NA
AUL26942.1|2624196_2624919_+	hydrolase	NA	NA	NA	NA	NA
AUL26943.1|2624923_2625922_+	cobalamin biosynthesis protein CobW	NA	NA	NA	NA	NA
AUL26944.1|2626342_2626651_+	hypothetical protein	NA	NA	NA	NA	NA
AUL26945.1|2626698_2627271_+	hypothetical protein	NA	NA	NA	NA	NA
AUL26946.1|2627248_2627653_-	hypothetical protein	NA	NA	NA	NA	NA
AUL26947.1|2627771_2628689_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUL26948.1|2628698_2629280_+	NUDIX hydrolase	NA	NA	NA	NA	NA
AUL26949.1|2629276_2630029_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
AUL26950.1|2630071_2630791_+	arginyltransferase	NA	NA	NA	NA	NA
AUL26951.1|2630833_2631889_+	dihydroorotate dehydrogenase (quinone)	NA	NA	NA	NA	NA
AUL26952.1|2631998_2632841_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	77.8	4.5e-129
AUL26953.1|2632898_2633159_+|transposase	transposase	transposase	NA	NA	NA	NA
AUL26954.1|2633197_2634019_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	44.0	1.9e-55
AUL26955.1|2634578_2635157_-	Phasin (PHA-granule associated protein)	NA	NA	NA	NA	NA
AUL26956.1|2635299_2636520_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.6	4.2e-184
AUL26957.1|2636824_2637802_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUL26958.1|2637950_2638781_-	IclR family transcriptional regulator	NA	NA	NA	NA	NA
AUL26959.1|2638894_2639710_-	competence/damage-inducible protein A	NA	NA	NA	NA	NA
AUL26960.1|2639732_2640587_-	hypothetical protein	NA	NA	NA	NA	NA
AUL26961.1|2640585_2640969_+	thiol reductase thioredoxin	NA	NA	NA	NA	NA
AUL26962.1|2641075_2642449_-	ATP-dependent RNA helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.6	1.8e-50
AUL26963.1|2642520_2643012_-	hypothetical protein	NA	NA	NA	NA	NA
AUL26964.1|2643011_2643764_-	hypothetical protein	NA	NA	NA	NA	NA
AUL26965.1|2644111_2644315_+	hypothetical protein	NA	NA	NA	NA	NA
AUL26966.1|2644344_2644767_+	DUF4440 domain-containing protein	NA	NA	NA	NA	NA
AUL26967.1|2644778_2645876_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
AUL26968.1|2645888_2647406_-	peptidase	NA	NA	NA	NA	NA
AUL26969.1|2647479_2648319_+	UTP--glucose-1-phosphate uridylyltransferase	NA	A0A127AW70	Bacillus_phage	46.2	1.6e-62
AUL26970.1|2648340_2649198_-	hypothetical protein	NA	NA	NA	NA	NA
AUL26971.1|2649270_2650389_-	porin	NA	NA	NA	NA	NA
AUL26972.1|2651019_2651841_-|transposase	transposase	transposase	S5WIU1	Leptospira_phage	43.7	7.2e-55
AUL26973.1|2651879_2652140_-|transposase	transposase	transposase	NA	NA	NA	NA
AUL26974.1|2652183_2652813_-	calcium:sodium antiporter	NA	NA	NA	NA	NA
AUL26975.1|2652970_2654314_+	Xaa-Pro aminopeptidase	NA	NA	NA	NA	NA
AUL26976.1|2654322_2654706_-	hypothetical protein	NA	NA	NA	NA	NA
AUL26977.1|2654865_2656017_+	monooxygenase	NA	NA	NA	NA	NA
AUL26978.1|2656115_2657066_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
AUL26979.1|2657209_2658235_+|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
>prophage 20
CP018892	Bordetella holmesii isolate F617 chromosome, complete genome	3699592	2939386	3039155	3699592	transposase,tRNA	Ralstonia_virus(20.0%)	82	NA	NA
AUL27213.1|2939386_2940166_+|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
AUL27214.1|2940188_2941136_+	prolyl aminopeptidase	NA	NA	NA	NA	NA
AUL27215.1|2941137_2941338_+	thiamine biosynthesis protein ThiS	NA	NA	NA	NA	NA
AUL27216.1|2941672_2941933_+|transposase	transposase	transposase	NA	NA	NA	NA
AUL27217.1|2941971_2942793_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	44.0	1.9e-55
AUL27218.1|2943113_2943830_-	phosphoserine phosphatase SerB	NA	NA	NA	NA	NA
AUL27219.1|2943826_2944720_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUL27220.1|2944883_2946104_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
AUL27221.1|2946256_2947339_+	iron ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.1	1.5e-31
AUL27222.1|2949018_2950002_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUL27223.1|2950064_2951477_-	signal recognition particle protein	NA	NA	NA	NA	NA
AUL27224.1|2951594_2952437_+	hypothetical protein	NA	NA	NA	NA	NA
AUL27225.1|2952715_2953324_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A1W6DX33	Sphingobium_phage	46.8	1.0e-05
AUL27226.1|2953339_2953960_+	glutathione S-transferase	NA	NA	NA	NA	NA
AUL27227.1|2954025_2954736_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.3	1.6e-13
AUL27228.1|2954737_2955460_-	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	28.6	1.9e-11
AUL27229.1|2955446_2955737_-	inner-membrane translocator	NA	NA	NA	NA	NA
AUL27230.1|2955812_2957033_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.1	2.1e-183
AUL27984.1|2957757_2958609_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
AUL27231.1|2958660_2959914_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUL27232.1|2960090_2960879_-	hypothetical protein	NA	NA	NA	NA	NA
AUL27233.1|2960998_2961913_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUL27234.1|2962045_2963938_-	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	37.9	4.6e-121
AUL27235.1|2964123_2965503_+	xanthine permease XanP	NA	H9YQ34	environmental_Halophage	50.7	4.1e-26
AUL27236.1|2965947_2966244_+	site-specific recombinase	NA	NA	NA	NA	NA
AUL27237.1|2966287_2966548_+|transposase	transposase	transposase	NA	NA	NA	NA
AUL27238.1|2966640_2967141_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	50.3	9.5e-42
AUL27239.1|2967154_2967379_-|transposase	transposase	transposase	NA	NA	NA	NA
AUL27240.1|2970044_2970647_-	3-methyladenine DNA glycosylase	NA	NA	NA	NA	NA
AUL27241.1|2970780_2971239_+	zinc/iron-chelating domain-containing protein	NA	NA	NA	NA	NA
AUL27242.1|2971240_2971840_-	iron transport sensor protein	NA	NA	NA	NA	NA
AUL27243.1|2971848_2972658_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AUL27244.1|2972692_2973547_+	permease	NA	NA	NA	NA	NA
AUL27245.1|2973666_2974254_+	histidine utilization protein HutD	NA	NA	NA	NA	NA
AUL27246.1|2974250_2975630_+	formimidoylglutamate deiminase	NA	NA	NA	NA	NA
AUL27247.1|2983951_2985292_+	8-amino-7-oxononanoate synthase	NA	G9E4Q1	Emiliania_huxleyi_virus	32.3	2.9e-45
AUL27248.1|2985305_2986157_+	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	40.4	4.4e-47
AUL27249.1|2986168_2987434_-	capsule biosynthesis protein CapA	NA	NA	NA	NA	NA
AUL27250.1|2987495_2989577_-	beta-3-deoxy-D-manno-oct-2-ulosonic acid transferase	NA	NA	NA	NA	NA
AUL27251.1|2990525_2990786_+|transposase	transposase	transposase	NA	NA	NA	NA
AUL27252.1|2990878_2991379_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	50.3	9.5e-42
AUL27253.1|2991375_2992230_-	sulfatase	NA	NA	NA	NA	NA
AUL27254.1|2992222_2993017_-	short-chain dehydrogenase	NA	NA	NA	NA	NA
AUL27255.1|2993232_2994183_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
AUL27256.1|2994785_2995583_-	metal ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUL27257.1|2995622_2996276_-	DL-methionine transporter permease subunit	NA	NA	NA	NA	NA
AUL27258.1|2996256_2997321_-	phosphate ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.3	6.5e-32
AUL27259.1|2997484_2999710_-	glycosyl hydrolase	NA	NA	NA	NA	NA
AUL27260.1|2999955_3001800_-	FAD-dependent cmnm(5)s(2)U34 oxidoreductase	NA	NA	NA	NA	NA
AUL27261.1|3001916_3002789_+	inositol monophosphatase	NA	NA	NA	NA	NA
AUL27262.1|3002835_3004536_-	long-chain fatty acid--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	27.5	1.0e-31
AUL27263.1|3004598_3005798_+	amidohydrolase	NA	NA	NA	NA	NA
AUL27264.1|3005808_3006687_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUL27265.1|3006793_3007831_+	hypothetical protein	NA	NA	NA	NA	NA
AUL27985.1|3007911_3008316_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
AUL27266.1|3008327_3009785_+	magnesium transporter	NA	NA	NA	NA	NA
AUL27267.1|3010427_3011024_-	gamma-glutamylcyclotransferase	NA	NA	NA	NA	NA
AUL27268.1|3011184_3011643_-	transcriptional regulator	NA	NA	NA	NA	NA
AUL27269.1|3012420_3013392_-	hypothetical protein	NA	NA	NA	NA	NA
AUL27270.1|3013513_3013933_+	hypothetical protein	NA	NA	NA	NA	NA
AUL27271.1|3014808_3015069_-|transposase	transposase	transposase	NA	NA	NA	NA
AUL27272.1|3015224_3016445_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.1	1.0e-182
AUL27273.1|3016506_3017394_-	HflC protein	NA	NA	NA	NA	NA
AUL27274.1|3017411_3018716_-	HflK protein	NA	NA	NA	NA	NA
AUL27275.1|3018681_3019788_-	GTPase HflX	NA	NA	NA	NA	NA
AUL27276.1|3019875_3020112_-	RNA chaperone Hfq	NA	NA	NA	NA	NA
AUL27277.1|3020295_3021369_-	histidinol-phosphate transaminase	NA	NA	NA	NA	NA
AUL27278.1|3021365_3022721_-	ribosome biogenesis GTPase Der	NA	NA	NA	NA	NA
AUL27279.1|3022745_3023903_-	outer membrane protein assembly factor BamB	NA	NA	NA	NA	NA
AUL27280.1|3023908_3024547_-	hypothetical protein	NA	NA	NA	NA	NA
AUL27281.1|3024550_3025846_-|tRNA	histidine--tRNA ligase	tRNA	NA	NA	NA	NA
AUL27282.1|3025878_3027165_-	4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase	NA	NA	NA	NA	NA
AUL27283.1|3027177_3027666_-	transcriptional regulator	NA	NA	NA	NA	NA
AUL27284.1|3027662_3028811_-	23S rRNA (adenine(2503)-C(2))-methyltransferase	NA	NA	NA	NA	NA
AUL27285.1|3028840_3029266_-	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	42.9	2.4e-22
AUL27286.1|3029585_3032465_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	37.1	1.1e-137
AUL27287.1|3032518_3033739_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.1	1.0e-182
AUL27288.1|3033787_3034651_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
AUL27289.1|3034650_3035244_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
AUL27290.1|3035535_3035796_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
AUL27291.1|3036295_3036547_-	hypothetical protein	NA	NA	NA	NA	NA
AUL27292.1|3036533_3039155_-|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	39.5	2.8e-84
>prophage 21
CP018892	Bordetella holmesii isolate F617 chromosome, complete genome	3699592	3098012	3153310	3699592	protease,transposase,tRNA	Ralstonia_virus(25.0%)	40	NA	NA
AUL27343.1|3098012_3099233_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
AUL27987.1|3099274_3100531_-	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AUL27344.1|3100771_3101917_+	Bcr/CflA family drug resistance efflux transporter	NA	NA	NA	NA	NA
AUL27345.1|3102223_3102460_+	50S ribosomal protein L28	NA	NA	NA	NA	NA
AUL27346.1|3102540_3102708_+	50S ribosomal protein L33	NA	NA	NA	NA	NA
AUL27347.1|3102864_3103953_+	hypothetical protein	NA	NA	NA	NA	NA
AUL27348.1|3103978_3105199_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.1	1.0e-182
AUL27349.1|3107417_3107849_+	DNA-binding protein	NA	NA	NA	NA	NA
AUL27350.1|3107975_3108488_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
AUL27988.1|3108520_3109681_+	MFS transporter	NA	NA	NA	NA	NA
AUL27351.1|3109752_3112410_+|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	38.7	7.5e-170
AUL27352.1|3112421_3113099_+	hypothetical protein	NA	NA	NA	NA	NA
AUL27353.1|3113098_3114148_+	DNA polymerase III subunit delta	NA	NA	NA	NA	NA
AUL27354.1|3114171_3115431_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	46.2	1.9e-94
AUL27355.1|3115437_3115827_+	hypothetical protein	NA	NA	NA	NA	NA
AUL27356.1|3115978_3116263_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AUL27357.1|3116259_3116649_+	hypothetical protein	NA	NA	NA	NA	NA
AUL27989.1|3116661_3117825_-	secretion protein	NA	NA	NA	NA	NA
AUL27358.1|3117851_3119612_-|protease	protease/lipase ABC transporter ATP-binding protein	protease	F2Y2R6	Organic_Lake_phycodnavirus	28.5	3.5e-14
AUL27359.1|3119608_3120910_-	hypothetical protein	NA	NA	NA	NA	NA
AUL27360.1|3121147_3121408_+|transposase	transposase	transposase	NA	NA	NA	NA
AUL27361.1|3121446_3122268_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	44.0	1.9e-55
AUL27362.1|3128668_3130186_-	propionyl-CoA--succinate CoA transferase	NA	NA	NA	NA	NA
AUL27363.1|3131420_3133811_+	mechanosensitive ion channel protein	NA	NA	NA	NA	NA
AUL27364.1|3133812_3134583_-	hypothetical protein	NA	NA	NA	NA	NA
AUL27365.1|3134579_3135458_-	EamA family transporter	NA	NA	NA	NA	NA
AUL27366.1|3135641_3135932_+	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
AUL27367.1|3135947_3136490_-	DNA polymerase III subunit epsilon	NA	A0A0A7RWA3	Clostridium_phage	29.7	7.2e-11
AUL27368.1|3136713_3139305_+	bifunctional aconitate hydratase 2/2-methylisocitrate dehydratase	NA	NA	NA	NA	NA
AUL27369.1|3141969_3142572_+	hypothetical protein	NA	NA	NA	NA	NA
AUL27990.1|3142820_3145526_+	aconitate hydratase 1	NA	NA	NA	NA	NA
AUL27370.1|3145591_3146374_-	dioxygenase	NA	NA	NA	NA	NA
AUL27371.1|3146535_3147741_+	hypothetical protein	NA	NA	NA	NA	NA
AUL27372.1|3147747_3148836_+	hypothetical protein	NA	NA	NA	NA	NA
AUL27373.1|3148993_3149551_+	elongation factor P	NA	NA	NA	NA	NA
AUL27374.1|3149632_3150067_-	hypothetical protein	NA	NA	NA	NA	NA
AUL27375.1|3150140_3150845_-	hypothetical protein	NA	NA	NA	NA	NA
AUL27376.1|3150946_3152329_-	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
AUL27377.1|3152338_3152791_-	hypothetical protein	NA	NA	NA	NA	NA
AUL27378.1|3152809_3153310_-|transposase	transposase	transposase	S5WIU1	Leptospira_phage	50.3	9.5e-42
>prophage 22
CP018892	Bordetella holmesii isolate F617 chromosome, complete genome	3699592	3353432	3419239	3699592	transposase,tRNA	Synechococcus_phage(12.5%)	60	NA	NA
AUL27550.1|3353432_3355568_+|tRNA	glycine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
AUL27551.1|3355564_3356104_+	D-glycero-beta-D-manno-heptose-1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
AUL27552.1|3356107_3356836_+	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
AUL27553.1|3356822_3357656_+	hypothetical protein	NA	NA	NA	NA	NA
AUL27554.1|3357660_3358587_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUL28000.1|3358665_3360081_+	FAD-binding dehydrogenase	NA	NA	NA	NA	NA
AUL27555.1|3360067_3361150_+	tricarballylate utilization protein B	NA	NA	NA	NA	NA
AUL27556.1|3361263_3361659_+	lactoylglutathione lyase	NA	NA	NA	NA	NA
AUL27557.1|3361664_3362198_+	peptide deformylase	NA	E3SLL2	Synechococcus_phage	35.6	7.5e-13
AUL27558.1|3364588_3365818_+	hypothetical protein	NA	NA	NA	NA	NA
AUL27559.1|3365818_3367261_-	pyruvate kinase	NA	NA	NA	NA	NA
AUL27560.1|3367356_3368499_+	glycerate kinase	NA	W6LM47	Streptococcus_phage	38.0	3.2e-37
AUL27561.1|3368517_3368997_+	thioesterase	NA	NA	NA	NA	NA
AUL27562.1|3369025_3369814_-	16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))- dimethyltransferase	NA	NA	NA	NA	NA
AUL27563.1|3369827_3371366_-	molecular chaperone SurA	NA	NA	NA	NA	NA
AUL28001.1|3371362_3373771_-	LPS biosynthesis protein	NA	NA	NA	NA	NA
AUL27564.1|3373924_3374992_+	aminoglycoside phosphotransferase	NA	NA	NA	NA	NA
AUL27565.1|3374991_3375672_+	mannose-1-phosphate guanylyltransferase	NA	NA	NA	NA	NA
AUL27566.1|3375813_3376539_+	hypothetical protein	NA	NA	NA	NA	NA
AUL27567.1|3376547_3376871_-	4a-hydroxytetrahydrobiopterin dehydratase	NA	NA	NA	NA	NA
AUL27568.1|3376924_3377572_-	hypothetical protein	NA	NA	NA	NA	NA
AUL27569.1|3377707_3378121_+	hypothetical protein	NA	NA	NA	NA	NA
AUL27570.1|3378206_3379256_+	NADP(H)-dependent aldo-keto reductase	NA	NA	NA	NA	NA
AUL27571.1|3379401_3380352_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
AUL27572.1|3380390_3381098_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUL27573.1|3381065_3381887_-|transposase	transposase	transposase	S5WIU1	Leptospira_phage	44.0	1.9e-55
AUL27574.1|3381925_3382186_-|transposase	transposase	transposase	NA	NA	NA	NA
AUL27575.1|3382243_3383752_-	sulfite reductase	NA	NA	NA	NA	NA
AUL27576.1|3383908_3385432_-	hypothetical protein	NA	NA	NA	NA	NA
AUL27577.1|3385486_3386134_-	carbonate dehydratase	NA	NA	NA	NA	NA
AUL27578.1|3386276_3386618_-	hypothetical protein	NA	NA	NA	NA	NA
AUL27579.1|3386775_3387108_+	PsiF repeat family protein	NA	NA	NA	NA	NA
AUL27580.1|3387156_3388197_-	cyclase	NA	NA	NA	NA	NA
AUL27581.1|3388200_3388980_-	3-oxoadipate enol-lactonase	NA	NA	NA	NA	NA
AUL27582.1|3389015_3389312_-	hypothetical protein	NA	NA	NA	NA	NA
AUL27583.1|3389326_3389602_-	muconolactone delta-isomerase	NA	NA	NA	NA	NA
AUL27584.1|3389669_3390314_-	3-oxoadipate CoA-transferase	NA	NA	NA	NA	NA
AUL27585.1|3390316_3390406_-	3-oxoadipate CoA-transferase	NA	NA	NA	NA	NA
AUL27586.1|3390596_3391382_+	IclR family transcriptional regulator	NA	NA	NA	NA	NA
AUL27587.1|3391419_3392145_-	short-chain dehydrogenase	NA	NA	NA	NA	NA
AUL27588.1|3392158_3393499_-	short-chain fatty acid transporter	NA	NA	NA	NA	NA
AUL27589.1|3393593_3394526_-	3-hydroxybutyryl-CoA dehydrogenase	NA	NA	NA	NA	NA
AUL27590.1|3394754_3397526_-	peptidase S8	NA	NA	NA	NA	NA
AUL27591.1|3397964_3400811_-	phosphoenolpyruvate carboxylase	NA	NA	NA	NA	NA
AUL27592.1|3400957_3401671_+	7-cyano-7-deazaguanine synthase QueC	NA	A0A0A0RPC6	Escherichia_phage	41.4	1.6e-47
AUL27593.1|3401683_3402226_-	GNAT family N-acetyltransferase	NA	A0A2H4J136	uncultured_Caudovirales_phage	45.8	1.1e-27
AUL27594.1|3402331_3403240_+	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	25.7	4.4e-05
AUL27595.1|3403331_3405188_+	dihydroxy-acid dehydratase	NA	NA	NA	NA	NA
AUL27596.1|3405371_3406412_-	GntR family transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	28.2	4.3e-20
AUL27597.1|3406554_3407460_+	dihydrodipicolinate synthase family protein	NA	NA	NA	NA	NA
AUL27598.1|3409147_3410098_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
AUL27599.1|3410154_3410922_-	trans-aconitate 2-methyltransferase	NA	NA	NA	NA	NA
AUL27600.1|3411039_3411684_+	hypothetical protein	NA	NA	NA	NA	NA
AUL27601.1|3411947_3412244_+	polysaccharide deacetylase	NA	NA	NA	NA	NA
AUL27602.1|3412390_3413461_+	rRNA methyltransferase	NA	NA	NA	NA	NA
AUL27603.1|3413693_3413888_-	hypothetical protein	NA	NA	NA	NA	NA
AUL27604.1|3414156_3415011_+	hypothetical protein	NA	NA	NA	NA	NA
AUL27605.1|3415036_3416257_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.1	1.0e-182
AUL28002.1|3416574_3418506_+	hypothetical protein	NA	NA	NA	NA	NA
AUL27606.1|3418978_3419239_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 23
CP018892	Bordetella holmesii isolate F617 chromosome, complete genome	3699592	3612977	3661678	3699592	holin,transposase,tRNA	Catovirus(20.0%)	39	NA	NA
AUL27778.1|3612977_3614768_-|tRNA	aspartate--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	24.5	5.5e-07
AUL27779.1|3614809_3615445_-	hypothetical protein	NA	A0A2I7S9X1	Vibrio_phage	29.0	1.2e-12
AUL27780.1|3615447_3615762_-	FmdB family transcriptional regulator	NA	NA	NA	NA	NA
AUL27781.1|3617312_3618935_-|holin	choline dehydrogenase	holin	A0A1V0S9J5	Catovirus	29.6	5.4e-46
AUL27782.1|3619105_3619210_-	dihydrodipicolinate synthase	NA	NA	NA	NA	NA
AUL27783.1|3619202_3619913_-	dihydrodipicolinate synthase	NA	NA	NA	NA	NA
AUL27784.1|3620187_3620676_-	diguanylate cyclase	NA	NA	NA	NA	NA
AUL27785.1|3620817_3622017_+	2-aminoadipate aminotransferase	NA	NA	NA	NA	NA
AUL27786.1|3622092_3623016_+	4-hydroxybenzoate polyprenyltransferase	NA	NA	NA	NA	NA
AUL27787.1|3623350_3623731_+	hypothetical protein	NA	NA	NA	NA	NA
AUL28008.1|3623874_3624633_-	transcriptional regulator GlcC	NA	NA	NA	NA	NA
AUL28009.1|3624844_3627016_+	malate synthase G	NA	NA	NA	NA	NA
AUL27788.1|3627073_3628147_-	lipase	NA	G9BWD6	Planktothrix_phage	37.1	2.6e-28
AUL27789.1|3628139_3629909_-	spermidine/putrescine ABC transporter permease	NA	NA	NA	NA	NA
AUL27790.1|3629923_3631033_-	iron ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUL27791.1|3631148_3633638_-	signal protein	NA	NA	NA	NA	NA
AUL27792.1|3633624_3634296_-	DNA-binding response regulator	NA	NA	NA	NA	NA
AUL27793.1|3634819_3635866_+	oxidoreductase	NA	NA	NA	NA	NA
AUL27794.1|3635874_3636444_+	N-acetyltransferase	NA	NA	NA	NA	NA
AUL27795.1|3637541_3638624_+	UDP-N-acetylglucosamine 2-epimerase	NA	A0A0N9R0B2	Chrysochromulina_ericina_virus	33.2	1.1e-45
AUL27796.1|3638648_3639902_+	glycosyltransferase WbuB	NA	NA	NA	NA	NA
AUL27797.1|3639906_3641094_+	UDP-4-amino-4, 6-dideoxy-N-acetyl-beta-L-altrosamine transaminase	NA	NA	NA	NA	NA
AUL27798.1|3641090_3641684_+	sugar transferase	NA	NA	NA	NA	NA
AUL27799.1|3642070_3644008_+	polysaccharide biosynthesis protein	NA	A0A2P1ELS8	Moumouvirus	27.9	2.2e-25
AUL27800.1|3644141_3645092_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
AUL27801.1|3645173_3645881_-	hypothetical protein	NA	NA	NA	NA	NA
AUL27802.1|3645944_3648581_+	DNA topoisomerase III	NA	A0A0G2YA05	Acanthamoeba_polyphaga_mimivirus	26.3	8.0e-23
AUL27803.1|3648710_3649931_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.1	1.1e-181
AUL27804.1|3650009_3651065_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUL27805.1|3651064_3651835_+	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
AUL27806.1|3652402_3653203_+	gluconate 5-dehydrogenase	NA	NA	NA	NA	NA
AUL27807.1|3653291_3654719_+	aldehyde dehydrogenase	NA	NA	NA	NA	NA
AUL27808.1|3654813_3655314_-|transposase	transposase	transposase	S5WIU1	Leptospira_phage	50.3	9.5e-42
AUL27809.1|3655406_3655667_-|transposase	transposase	transposase	NA	NA	NA	NA
AUL28010.1|3655732_3656431_+	3-oxoacyl-ACP reductase	NA	NA	NA	NA	NA
AUL27810.1|3658394_3658874_+	AsnC family transcriptional regulator	NA	NA	NA	NA	NA
AUL27811.1|3658861_3659788_-	bestrophin	NA	NA	NA	NA	NA
AUL27812.1|3659904_3660432_+	SET domain-containing protein-lysine N-methyltransferase	NA	NA	NA	NA	NA
AUL27813.1|3660457_3661678_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
