The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP018899	Bordetella holmesii isolate F615 chromosome, complete genome	3687853	148531	195415	3687853	protease,transposase	uncultured_Mediterranean_phage(22.22%)	49	NA	NA
AUL49498.1|148531_148969_-|protease	ClpXP protease specificity-enhancing factor	protease	NA	NA	NA	NA
AUL49499.1|148977_149589_-	glutathione S-transferase	NA	NA	NA	NA	NA
AUL49500.1|149741_150593_-	cytochrome c1	NA	NA	NA	NA	NA
AUL49501.1|150617_152006_-	cytochrome b	NA	NA	NA	NA	NA
AUL49502.1|152087_152729_-	ubiquinol-cytochrome c reductase iron-sulfur subunit	NA	NA	NA	NA	NA
AUL49503.1|152877_153315_+	large-conductance mechanosensitive channel protein	NA	NA	NA	NA	NA
AUL49504.1|153372_154149_-	Nif3-like dinuclear metal center hexameric protein	NA	NA	NA	NA	NA
AUL49505.1|154168_155299_+	2-alkenal reductase	NA	A0A1B1IRD3	uncultured_Mediterranean_phage	37.2	3.0e-11
AUL49506.1|155363_156149_-	twin arginine-targeting protein translocase TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	34.4	5.0e-29
AUL49507.1|156145_156643_-	twin arginine-targeting protein translocase TatB	NA	NA	NA	NA	NA
AUL49508.1|156691_156913_-	Sec-independent protein translocase TatA	NA	NA	NA	NA	NA
AUL49509.1|156928_157297_-	histidine triad nucleotide-binding protein	NA	NA	NA	NA	NA
AUL49510.1|157304_157655_-	phosphoribosyl-ATP diphosphatase	NA	NA	NA	NA	NA
AUL49511.1|157651_158056_-	phosphoribosyl-AMP cyclohydrolase	NA	NA	NA	NA	NA
AUL49512.1|158057_158873_-	imidazole glycerol phosphate synthase subunit HisF	NA	NA	NA	NA	NA
AUL49513.1|158869_159610_-	1-(5-phosphoribosyl)-5-[(5- phosphoribosylamino)methylideneamino]imidazole-4- carboxamide isomerase	NA	NA	NA	NA	NA
AUL49514.1|159676_160363_-	imidazole glycerol phosphate synthase subunit HisH	NA	NA	NA	NA	NA
AUL49515.1|160381_160969_-	imidazoleglycerol-phosphate dehydratase	NA	NA	NA	NA	NA
AUL49516.1|160970_162065_-	histidinol-phosphate transaminase	NA	NA	NA	NA	NA
AUL49517.1|162061_163369_-	histidinol dehydrogenase	NA	NA	NA	NA	NA
AUL49518.1|163394_164066_-	ATP phosphoribosyltransferase	NA	NA	NA	NA	NA
AUL49519.1|164062_165328_-	UDP-N-acetylglucosamine 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
AUL49520.1|165327_165573_-	BolA family transcriptional regulator	NA	NA	NA	NA	NA
AUL49521.1|165576_166374_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
AUL49522.1|166370_167180_-	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	31.8	2.8e-19
AUL49523.1|167316_167943_-	ABC transporter	NA	NA	NA	NA	NA
AUL49524.1|167968_168760_-	hypothetical protein	NA	NA	NA	NA	NA
AUL49525.1|168824_169313_-	outer membrane lipid asymmetry maintenance protein MlaD	NA	NA	NA	NA	NA
AUL49526.1|169325_170108_-	ABC transporter permease	NA	NA	NA	NA	NA
AUL49527.1|170104_170941_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	33.2	3.7e-22
AUL49528.1|171122_172103_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUL49529.1|172167_172803_-	hypothetical protein	NA	NA	NA	NA	NA
AUL49530.1|173003_174470_-	glutamate synthase	NA	NA	NA	NA	NA
AUL49531.1|174478_179218_-	glutamate synthase subunit alpha	NA	NA	NA	NA	NA
AUL49532.1|179571_180792_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
AUL49533.1|180907_181651_-	hypothetical protein	NA	NA	NA	NA	NA
AUL49534.1|181820_182927_+	S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase	NA	A0A0K0KVL7	Prochlorococcus_phage	28.4	8.0e-33
AUL49535.1|182937_183777_+	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
AUL49536.1|183834_184524_+	hypothetical protein	NA	NA	NA	NA	NA
AUL49537.1|184620_185073_+	hypothetical protein	NA	NA	NA	NA	NA
AUL49538.1|185076_186297_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
AUL49539.1|186520_187408_+	RNA polymerase factor sigma-32	NA	A0A248SJA5	Salicola_phage	38.5	2.1e-39
AUL52512.1|187722_188508_-	phosphodiesterase	NA	NA	NA	NA	NA
AUL49540.1|191350_192127_-	NUDIX hydrolase	NA	NA	NA	NA	NA
AUL49541.1|192619_192880_+|transposase	transposase	transposase	NA	NA	NA	NA
AUL49542.1|192918_193740_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	43.7	7.2e-55
AUL49543.1|193774_194044_+	cytochrome c oxidase subunit II	NA	NA	NA	NA	NA
AUL49544.1|194015_194366_+	bifunctional protein GlmU	NA	NA	NA	NA	NA
AUL49545.1|194464_195415_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 2
CP018899	Bordetella holmesii isolate F615 chromosome, complete genome	3687853	227205	264019	3687853	transposase	Leptospira_phage(40.0%)	32	NA	NA
AUL49570.1|227205_227466_+|transposase	transposase	transposase	NA	NA	NA	NA
AUL49571.1|227558_228059_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	50.3	9.5e-42
AUL49572.1|228432_229653_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
AUL49573.1|230307_231585_+	cytosine deaminase	NA	NA	NA	NA	NA
AUL49574.1|231639_232206_-	cysteine dioxygenase	NA	NA	NA	NA	NA
AUL49575.1|232291_233455_-	alpha-hydroxy-acid oxidizing enzyme	NA	NA	NA	NA	NA
AUL49576.1|233623_233908_+	acylphosphatase	NA	NA	NA	NA	NA
AUL49577.1|233931_234570_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
AUL49578.1|234691_235663_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUL49579.1|237241_238012_+	IclR family transcriptional regulator	NA	NA	NA	NA	NA
AUL49580.1|238223_239174_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
AUL52519.1|239146_239650_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	49.7	3.4e-39
AUL49581.1|239726_240731_-	hypothetical protein	NA	NA	NA	NA	NA
AUL49582.1|240802_242371_-	acetolactate synthase large subunit	NA	G9E4W7	Ostreococcus_lucimarinus_virus	27.1	4.5e-05
AUL49583.1|242507_243557_+	glycosyl hydrolase	NA	NA	NA	NA	NA
AUL49584.1|243559_244744_+	CoA transferase	NA	NA	NA	NA	NA
AUL49585.1|244772_245903_+	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
AUL49586.1|245915_247058_+	carnitine dehydratase	NA	NA	NA	NA	NA
AUL49587.1|248867_249482_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
AUL49588.1|249530_250433_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUL49589.1|250559_250949_+	4-carboxymuconolactone decarboxylase	NA	NA	NA	NA	NA
AUL49590.1|250950_251832_+	3-hydroxyisobutyrate dehydrogenase	NA	NA	NA	NA	NA
AUL49591.1|251860_252829_+	MFS transporter	NA	NA	NA	NA	NA
AUL49592.1|253037_254027_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUL49593.1|255576_256356_+	oxidoreductase	NA	NA	NA	NA	NA
AUL52520.1|256386_258132_+	dihydroxy-acid dehydratase	NA	NA	NA	NA	NA
AUL49594.1|258128_259031_+	2-hydroxy-3-oxopropionate reductase	NA	NA	NA	NA	NA
AUL49595.1|259314_260523_+	ferredoxin reductase	NA	NA	NA	NA	NA
AUL49596.1|260704_260968_+	hypothetical protein	NA	NA	NA	NA	NA
AUL49597.1|260973_261453_+	DUF188 domain-containing protein	NA	NA	NA	NA	NA
AUL49598.1|261513_262623_-	porin	NA	NA	NA	NA	NA
AUL49599.1|262798_264019_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
>prophage 3
CP018899	Bordetella holmesii isolate F615 chromosome, complete genome	3687853	584565	653399	3687853	tRNA,transposase	Staphylococcus_phage(21.43%)	59	NA	NA
AUL49871.1|584565_585516_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
AUL49872.1|585512_586640_-	anhydro-N-acetylmuramic acid kinase	NA	NA	NA	NA	NA
AUL49873.1|586648_588064_-	metallopeptidase	NA	A8ATH6	Listeria_phage	42.7	6.7e-16
AUL49874.1|588343_589573_+|tRNA	tyrosine--tRNA ligase	tRNA	NA	NA	NA	NA
AUL49875.1|589611_590268_+	phospholipid-binding protein	NA	NA	NA	NA	NA
AUL49876.1|590471_591722_+	serine hydroxymethyltransferase	NA	A0A219YCZ0	Aeromonas_phage	52.2	2.8e-98
AUL49877.1|591882_592368_+	transcriptional regulator NrdR	NA	NA	NA	NA	NA
AUL49878.1|592372_593335_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AUL49879.1|593334_593895_-	hydrolase	NA	NA	NA	NA	NA
AUL49880.1|593930_595205_+	riboflavin biosynthesis protein RibD	NA	A0A2H4PQS8	Staphylococcus_phage	31.9	1.5e-38
AUL49881.1|595226_595868_+	riboflavin synthase subunit alpha	NA	A0A2H4PQS5	Staphylococcus_phage	36.1	7.2e-26
AUL49882.1|598155_599418_+	hypothetical protein	NA	NA	NA	NA	NA
AUL49883.1|599414_600935_+	SpoVR family protein	NA	NA	NA	NA	NA
AUL49884.1|600931_601768_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AUL49885.1|603005_603905_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUL49886.1|604280_604937_+	glutathione S-transferase	NA	NA	NA	NA	NA
AUL49887.1|605114_605522_-	alkylhydroperoxidase	NA	NA	NA	NA	NA
AUL49888.1|606836_608057_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.6	9.3e-184
AUL49889.1|608053_608524_+	MFS permease	NA	NA	NA	NA	NA
AUL49890.1|608533_608989_-	hypothetical protein	NA	NA	NA	NA	NA
AUL49891.1|609956_611525_-	argininosuccinate lyase	NA	NA	NA	NA	NA
AUL49892.1|611747_612185_+	universal stress protein	NA	NA	NA	NA	NA
AUL49893.1|612196_612607_-	hypothetical protein	NA	NA	NA	NA	NA
AUL49894.1|612637_613411_-	NADH pyrophosphatase	NA	NA	NA	NA	NA
AUL49895.1|613638_615741_+	dehydrogenase	NA	NA	NA	NA	NA
AUL49896.1|616249_617098_+	two-component response regulator	NA	NA	NA	NA	NA
AUL49897.1|617117_617333_-	hypothetical protein	NA	NA	NA	NA	NA
AUL49898.1|617487_618384_+	hypothetical protein	NA	NA	NA	NA	NA
AUL49899.1|618487_619378_+	nicotinate-nucleotide diphosphorylase (carboxylating)	NA	NA	NA	NA	NA
AUL49900.1|619454_620423_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUL49901.1|620423_621134_-	hypothetical protein	NA	NA	NA	NA	NA
AUL49902.1|621209_623303_-	TonB-dependent receptor	NA	NA	NA	NA	NA
AUL49903.1|623332_623641_-	hypothetical protein	NA	NA	NA	NA	NA
AUL49904.1|623827_624613_-	enoyl-[acyl-carrier-protein] reductase	NA	NA	NA	NA	NA
AUL49905.1|624671_626084_-	lytic transglycosylase	NA	A0A223LD43	Bacillus_phage	29.3	2.1e-06
AUL49906.1|626091_626901_-	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
AUL49907.1|626918_627683_+	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AUL49908.1|627751_628213_+	ribonuclease HI	NA	J9Q745	Salmonella_phage	51.5	4.5e-38
AUL49909.1|628337_629420_+	efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
AUL49910.1|629435_629633_+	hypothetical protein	NA	NA	NA	NA	NA
AUL49911.1|629595_630816_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.6	4.2e-184
AUL49912.1|633825_634560_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	42.4	2.6e-40
AUL49913.1|634728_635949_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.1	1.0e-182
AUL49914.1|636323_637310_+	HlyD family secretion protein	NA	NA	NA	NA	NA
AUL49915.1|637313_640037_+	multidrug ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.2	6.6e-20
AUL49916.1|640037_641165_+	hypothetical protein	NA	NA	NA	NA	NA
AUL49917.1|641177_642590_+	RND transporter	NA	NA	NA	NA	NA
AUL49918.1|642764_643421_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AUL49919.1|643441_644488_+	glycosyltransferase	NA	F1C5B0	Cronobacter_phage	39.5	1.4e-58
AUL49920.1|644484_646074_+	dolichyl-phosphate-mannose--protein mannosyltransferase	NA	NA	NA	NA	NA
AUL49921.1|646228_647338_+	hypothetical protein	NA	NA	NA	NA	NA
AUL49922.1|647327_648224_-	alpha/beta hydrolase	NA	A0A1C9C5K3	Heterosigma_akashiwo_virus	33.1	6.5e-09
AUL49923.1|648270_648903_-	hypothetical protein	NA	NA	NA	NA	NA
AUL49924.1|648927_649812_-	EamA family transporter	NA	NA	NA	NA	NA
AUL49925.1|649939_651421_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AUL49926.1|651493_651838_+	TIGR01244 family protein	NA	NA	NA	NA	NA
AUL49927.1|651923_652388_+	universal stress protein	NA	NA	NA	NA	NA
AUL49928.1|652545_652806_+|transposase	transposase	transposase	NA	NA	NA	NA
AUL49929.1|652898_653399_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	49.7	2.8e-41
>prophage 4
CP018899	Bordetella holmesii isolate F615 chromosome, complete genome	3687853	656707	721753	3687853	tRNA,transposase	Ralstonia_virus(42.86%)	58	NA	NA
AUL49932.1|656707_657658_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
AUL49933.1|657690_658137_+|tRNA	cys-tRNA(pro)/cys-tRNA(cys) deacylase	tRNA	NA	NA	NA	NA
AUL49934.1|658185_658875_-	tol-pal system protein YbgF	NA	NA	NA	NA	NA
AUL49935.1|658962_659457_-	peptidoglycan-associated lipoprotein	NA	NA	NA	NA	NA
AUL49936.1|659488_660805_-	Tol-Pal system beta propeller repeat protein TolB	NA	NA	NA	NA	NA
AUL49937.1|660821_661742_-	protein TolA	NA	NA	NA	NA	NA
AUL49938.1|661776_662238_-	protein TolR	NA	NA	NA	NA	NA
AUL49939.1|662237_662912_-	protein TolQ	NA	NA	NA	NA	NA
AUL49940.1|662914_663337_-	tol-pal system-associated acyl-CoA thioesterase	NA	NA	NA	NA	NA
AUL49941.1|663390_665121_-|tRNA	proline--tRNA ligase	tRNA	A0A2K9L3R9	Tupanvirus	28.6	1.2e-11
AUL49942.1|665186_665756_+	RNA pyrophosphohydrolase	NA	NA	NA	NA	NA
AUL49943.1|665736_666423_+	DNA-binding response regulator	NA	NA	NA	NA	NA
AUL49944.1|666442_667948_+	sensor histidine kinase	NA	NA	NA	NA	NA
AUL49945.1|668176_668626_+	tripartite tricarboxylate transporter TctB	NA	NA	NA	NA	NA
AUL49946.1|668631_670152_+	hypothetical protein	NA	NA	NA	NA	NA
AUL49947.1|670205_671426_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
AUL49948.1|671522_672452_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUL49949.1|672610_673516_-	oxidoreductase	NA	NA	NA	NA	NA
AUL49950.1|673715_674936_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.1	4.6e-183
AUL49951.1|674991_676497_-	hypothetical protein	NA	NA	NA	NA	NA
AUL49952.1|676518_676974_-	tricarboxylate transporter	NA	NA	NA	NA	NA
AUL49953.1|677330_677903_+	hypothetical protein	NA	NA	NA	NA	NA
AUL49954.1|677902_678214_+	cell division protein ZapA	NA	NA	NA	NA	NA
AUL49955.1|678527_679289_+	hypothetical protein	NA	NA	NA	NA	NA
AUL49956.1|679257_680052_-	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
AUL49957.1|680230_680566_+	cytochrome C	NA	NA	NA	NA	NA
AUL49958.1|680582_681140_+	peptide-methionine (S)-S-oxide reductase	NA	NA	NA	NA	NA
AUL49959.1|681201_682314_-	4-hydroxyphenylpyruvate dioxygenase	NA	NA	NA	NA	NA
AUL49960.1|682454_682931_+	AsnC family transcriptional regulator	NA	NA	NA	NA	NA
AUL49961.1|689271_689466_+	hypothetical protein	NA	NA	NA	NA	NA
AUL49962.1|689593_689854_+|transposase	transposase	transposase	NA	NA	NA	NA
AUL49963.1|689946_690447_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	50.3	9.5e-42
AUL49964.1|690684_691059_+	hypothetical protein	NA	NA	NA	NA	NA
AUL52538.1|691276_691555_-	DNA topoisomerase III	NA	NA	NA	NA	NA
AUL49965.1|691703_692897_+	peptidase M20	NA	NA	NA	NA	NA
AUL49966.1|692909_693968_+	dihydroorotase	NA	NA	NA	NA	NA
AUL49967.1|694005_695814_-	ABC transporter ATP-binding protein	NA	A0A1B0RXA0	Streptococcus_phage	29.5	2.5e-44
AUL49968.1|696588_697017_+	cell division/cell wall cluster transcriptional repressor MraZ	NA	NA	NA	NA	NA
AUL49969.1|697025_698099_+	16S rRNA (cytosine(1402)-N(4))-methyltransferase	NA	NA	NA	NA	NA
AUL49970.1|698098_698386_+	cell division protein FtsL	NA	NA	NA	NA	NA
AUL49971.1|698382_700116_+	cell division protein	NA	NA	NA	NA	NA
AUL49972.1|700112_702935_+	UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D- alanine ligase	NA	NA	NA	NA	NA
AUL49973.1|702924_704094_+	phospho-N-acetylmuramoyl-pentapeptide- transferase	NA	NA	NA	NA	NA
AUL49974.1|704090_705623_+	UDP-N-acetylmuramoylalanine--D-glutamate ligase	NA	NA	NA	NA	NA
AUL49975.1|705619_706813_+	putative lipid II flippase FtsW	NA	NA	NA	NA	NA
AUL49976.1|706809_707883_+	undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase	NA	NA	NA	NA	NA
AUL49977.1|707879_709286_+	UDP-N-acetylmuramate--L-alanine ligase	NA	NA	NA	NA	NA
AUL49978.1|709282_710236_+	D-alanine--D-alanine ligase	NA	NA	NA	NA	NA
AUL49979.1|710244_711069_+	cell division protein FtsQ	NA	NA	NA	NA	NA
AUL49980.1|711073_712300_+	cell division protein FtsA	NA	NA	NA	NA	NA
AUL49981.1|712495_713680_+	cell division protein FtsZ	NA	NA	NA	NA	NA
AUL49982.1|713919_714843_+	UDP-3-O-[3-hydroxymyristoyl] N-acetylglucosamine deacetylase	NA	NA	NA	NA	NA
AUL49983.1|714933_715149_+	hypothetical protein	NA	NA	NA	NA	NA
AUL49984.1|715185_715680_-	flagellar hook-length control protein FliK	NA	NA	NA	NA	NA
AUL49985.1|715722_716706_+	peptidase M23	NA	A0A292GJG6	Xanthomonas_phage	47.7	1.2e-27
AUL49986.1|716866_719602_+	preprotein translocase subunit SecA	NA	NA	NA	NA	NA
AUL49987.1|719603_720323_+	hypothetical protein	NA	NA	NA	NA	NA
AUL49988.1|720532_721753_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
>prophage 5
CP018899	Bordetella holmesii isolate F615 chromosome, complete genome	3687853	796631	844200	3687853	transposase,holin	Leptospira_phage(11.11%)	47	NA	NA
AUL50048.1|796631_798731_-|holin	phospholipase C, phosphocholine-specific	holin	NA	NA	NA	NA
AUL50049.1|798872_799712_-	branched chain amino acid aminotransferase	NA	NA	NA	NA	NA
AUL50050.1|800841_801729_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
AUL50051.1|801819_801954_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUL50052.1|802029_803034_-	ABC transporter permease	NA	NA	NA	NA	NA
AUL50053.1|803078_803900_-|transposase	transposase	transposase	S5WIU1	Leptospira_phage	44.0	1.9e-55
AUL50054.1|803938_804199_-|transposase	transposase	transposase	NA	NA	NA	NA
AUL50055.1|804473_805109_-	endonuclease III	NA	NA	NA	NA	NA
AUL50056.1|805129_805768_-	ferredoxin	NA	NA	NA	NA	NA
AUL50057.1|805818_807045_-	esterase	NA	NA	NA	NA	NA
AUL50058.1|807181_807979_-	ferredoxin--NADP(+) reductase	NA	NA	NA	NA	NA
AUL50059.1|808009_808333_-	ferredoxin	NA	NA	NA	NA	NA
AUL50060.1|808497_809673_+	nicotinate phosphoribosyltransferase	NA	A0A2L0UZQ6	Agrobacterium_phage	32.5	4.2e-48
AUL50061.1|809711_810065_+	hypothetical protein	NA	NA	NA	NA	NA
AUL50062.1|810095_810515_-	hypothetical protein	NA	NA	NA	NA	NA
AUL50063.1|810607_811447_-	hypothetical protein	NA	NA	NA	NA	NA
AUL50064.1|811643_813890_+	GTP pyrophosphokinase	NA	NA	NA	NA	NA
AUL50065.1|813909_815223_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	41.0	1.5e-83
AUL50066.1|815388_816540_+	acetylornithine deacetylase (ArgE)	NA	NA	NA	NA	NA
AUL50067.1|816680_817880_+	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
AUL50068.1|817876_818740_+	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
AUL50069.1|818769_819648_+	acetyl-CoA carboxylase subunit beta	NA	NA	NA	NA	NA
AUL50070.1|819856_820402_+	hypothetical protein	NA	NA	NA	NA	NA
AUL50071.1|820572_820833_+|transposase	transposase	transposase	NA	NA	NA	NA
AUL50072.1|821781_824913_-	ribonuclease E/G	NA	NA	NA	NA	NA
AUL50073.1|825492_826398_+	RNA pseudouridine synthase	NA	NA	NA	NA	NA
AUL50074.1|826399_827056_+	HAD family hydrolase	NA	NA	NA	NA	NA
AUL50075.1|827173_828133_+	mononuclear molybdenum enzyme YedY	NA	NA	NA	NA	NA
AUL50076.1|828145_828772_+	sulfoxide reductase heme-binding subunit YedZ	NA	NA	NA	NA	NA
AUL50077.1|828752_829535_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A076YN96	Rhizobium_phage	32.4	5.0e-13
AUL50078.1|829538_830249_-	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AUL50079.1|830245_830839_-	septum formation protein Maf	NA	NA	NA	NA	NA
AUL50080.1|831056_831704_+	hypothetical protein	NA	NA	NA	NA	NA
AUL50081.1|831756_831939_+	50S ribosomal protein L32	NA	NA	NA	NA	NA
AUL50082.1|831997_833062_+	phosphate acyltransferase	NA	NA	NA	NA	NA
AUL50083.1|833061_834048_+	3-oxoacyl-ACP synthase	NA	NA	NA	NA	NA
AUL50084.1|834107_835043_+	[acyl-carrier-protein] S-malonyltransferase	NA	NA	NA	NA	NA
AUL50085.1|835045_835795_+	3-oxoacyl-ACP reductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	34.0	2.7e-16
AUL50086.1|836012_836252_+	acyl carrier protein	NA	B2ZXV3	Ralstonia_phage	48.5	1.6e-10
AUL50087.1|836423_837653_+	beta-ketoacyl-[acyl-carrier-protein] synthase II	NA	NA	NA	NA	NA
AUL50088.1|837655_838087_+	hypothetical protein	NA	NA	NA	NA	NA
AUL50089.1|838083_838683_+	RNA polymerase sigma factor RpoE	NA	A0A0F6TH34	Sinorhizobium_phage	26.9	2.6e-06
AUL50090.1|838695_839181_+	hypothetical protein	NA	NA	NA	NA	NA
AUL50091.1|839180_840215_+	siderophore-interacting protein	NA	NA	NA	NA	NA
AUL50092.1|840255_841758_+	serine peptidase	NA	A0A1B1IT49	uncultured_Mediterranean_phage	31.2	1.1e-21
AUL50093.1|841842_843063_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	74.9	5.1e-182
AUL50094.1|843249_844200_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 6
CP018899	Bordetella holmesii isolate F615 chromosome, complete genome	3687853	849338	902086	3687853	transposase	Ralstonia_virus(26.67%)	47	NA	NA
AUL50100.1|849338_850160_-|transposase	transposase	transposase	S5WIU1	Leptospira_phage	44.0	1.9e-55
AUL50101.1|850198_850459_-|transposase	transposase	transposase	NA	NA	NA	NA
AUL50102.1|851521_852742_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
AUL50103.1|853150_853861_-	hypothetical protein	NA	NA	NA	NA	NA
AUL50104.1|853953_854202_-	hypothetical protein	NA	NA	NA	NA	NA
AUL50105.1|854220_854658_-	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
AUL50106.1|854675_856190_-	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	38.9	7.3e-53
AUL50107.1|856244_857354_+	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
AUL50108.1|858443_859661_+	ABC transporter permease	NA	NA	NA	NA	NA
AUL50109.1|859724_861209_+	methylmalonate-semialdehyde dehydrogenase (acylating)	NA	NA	NA	NA	NA
AUL50110.1|861365_862310_+	transcriptional regulator	NA	NA	NA	NA	NA
AUL50111.1|862436_863657_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
AUL50112.1|863824_864160_+	hypothetical protein	NA	NA	NA	NA	NA
AUL50113.1|864355_865021_-	hypothetical protein	NA	A0A0A8WF62	Clostridium_phage	34.5	1.6e-15
AUL50114.1|865266_867156_+	propionate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	30.7	2.4e-61
AUL50115.1|867152_867560_+	hypothetical protein	NA	NA	NA	NA	NA
AUL50116.1|867643_868870_+	MFS transporter	NA	NA	NA	NA	NA
AUL50117.1|869019_870999_+	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	43.6	6.1e-84
AUL50118.1|871064_872285_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
AUL50119.1|873312_874326_+	low-specificity L-threonine aldolase	NA	NA	NA	NA	NA
AUL50120.1|874347_875181_-	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
AUL50121.1|875230_876877_-	electron transfer flavoprotein-ubiquinone oxidoreductase	NA	NA	NA	NA	NA
AUL50122.1|877009_877456_+	thioesterase	NA	NA	NA	NA	NA
AUL50123.1|877570_878269_+	succinyl-CoA--3-ketoacid-CoA transferase	NA	NA	NA	NA	NA
AUL50124.1|878281_878935_+	succinyl-CoA--3-ketoacid-CoA transferase	NA	NA	NA	NA	NA
AUL50125.1|879135_880020_+	transcriptional regulator	NA	NA	NA	NA	NA
AUL50126.1|880016_880997_+	beta-aspartyl-peptidase	NA	NA	NA	NA	NA
AUL50127.1|881034_882915_+	glutathione ABC transporter ATP-binding protein GsiA	NA	G9BWD6	Planktothrix_phage	29.8	2.0e-20
AUL50128.1|882989_884543_+	glutathione ABC transporter substrate-binding protein GsiB	NA	NA	NA	NA	NA
AUL50129.1|884616_885537_+	glutathione ABC transporter permease GsiC	NA	NA	NA	NA	NA
AUL50130.1|885544_886438_+	glutathione ABC transporter permease GsiD	NA	NA	NA	NA	NA
AUL50131.1|886527_887595_+	aminopeptidase	NA	NA	NA	NA	NA
AUL50132.1|887605_888424_+	aminopeptidase	NA	NA	NA	NA	NA
AUL50133.1|888438_890235_+	Xaa-Pro aminopeptidase	NA	A0A0P0I8D7	Acinetobacter_phage	49.7	1.3e-165
AUL50134.1|890478_892131_+	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	53.5	1.7e-156
AUL50135.1|892302_892506_+	hypothetical protein	NA	NA	NA	NA	NA
AUL50136.1|892480_892585_+	hypothetical protein	NA	NA	NA	NA	NA
AUL50137.1|892588_893875_+	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	63.4	5.5e-150
AUL50138.1|893948_894320_+	cell division protein FtsB	NA	NA	NA	NA	NA
AUL50139.1|894338_894968_-	hypothetical protein	NA	NA	NA	NA	NA
AUL50140.1|895047_895968_-	Hsp33 family molecular chaperone	NA	NA	NA	NA	NA
AUL50141.1|896006_896528_-	gamma carbonic anhydrase family protein	NA	NA	NA	NA	NA
AUL50142.1|896550_898218_-	AMP-binding protein	NA	A0A2H4PQU7	Staphylococcus_phage	33.4	9.8e-67
AUL50143.1|898413_899253_-	UDP-2,3-diacylglucosamine hydrolase	NA	A0A218MKA7	uncultured_virus	48.1	1.9e-66
AUL50144.1|899334_899859_-	RDD family protein	NA	NA	NA	NA	NA
AUL50145.1|900774_901035_-|transposase	transposase	transposase	NA	NA	NA	NA
AUL50146.1|901078_902086_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	74.8	1.3e-146
>prophage 7
CP018899	Bordetella holmesii isolate F615 chromosome, complete genome	3687853	1092764	1190002	3687853	tRNA,protease,transposase	Ralstonia_virus(16.67%)	91	NA	NA
AUL50296.1|1092764_1093985_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.6	4.2e-184
AUL50297.1|1094072_1094663_+	EamA family transporter	NA	NA	NA	NA	NA
AUL52553.1|1094650_1094962_+	hypothetical protein	NA	NA	NA	NA	NA
AUL50298.1|1095013_1096003_+	quinone oxidoreductase	NA	NA	NA	NA	NA
AUL50299.1|1096123_1097005_-|protease	zinc metalloprotease HtpX	protease	NA	NA	NA	NA
AUL50300.1|1097178_1098033_+	hypothetical protein	NA	NA	NA	NA	NA
AUL50301.1|1098064_1098913_+	sulfurtransferase	NA	NA	NA	NA	NA
AUL50302.1|1099040_1100261_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
AUL50303.1|1100279_1100846_-	phosphohydrolase	NA	NA	NA	NA	NA
AUL50304.1|1101043_1102195_-	Rieske (2Fe-2S) protein	NA	NA	NA	NA	NA
AUL50305.1|1102333_1103338_-	hypothetical protein	NA	A0A0F6TJ51	Escherichia_coli_O157_typing_phage	25.9	3.9e-18
AUL50306.1|1103494_1104466_-	MFS transporter	NA	NA	NA	NA	NA
AUL50307.1|1104544_1105333_+	IclR family transcriptional regulator	NA	NA	NA	NA	NA
AUL50308.1|1105404_1105641_+	exodeoxyribonuclease VII small subunit	NA	NA	NA	NA	NA
AUL50309.1|1105649_1106561_+	geranyl transferase	NA	NA	NA	NA	NA
AUL50310.1|1106604_1108476_+	1-deoxy-D-xylulose-5-phosphate synthase	NA	NA	NA	NA	NA
AUL50311.1|1108636_1109434_+	GTP cyclohydrolase	NA	NA	NA	NA	NA
AUL50312.1|1109665_1110040_+	30S ribosomal protein S6	NA	NA	NA	NA	NA
AUL50313.1|1110116_1110440_+	primosomal replication protein N	NA	NA	NA	NA	NA
AUL50314.1|1110523_1110796_+	30S ribosomal protein S18	NA	NA	NA	NA	NA
AUL50315.1|1110810_1111266_+	50S ribosomal protein L9	NA	NA	NA	NA	NA
AUL50316.1|1111387_1112224_+	hypothetical protein	NA	NA	NA	NA	NA
AUL50317.1|1112220_1113594_+	replicative DNA helicase	NA	C7BGG1	Burkholderia_phage	57.7	1.1e-132
AUL50318.1|1113670_1114627_-	bile acid:sodium symporter	NA	NA	NA	NA	NA
AUL50319.1|1114714_1115692_-	4-hydroxythreonine-4-phosphate dehydrogenase PdxA	NA	NA	NA	NA	NA
AUL50320.1|1115816_1117472_-	phosphate starvation-inducible protein PhoH	NA	A0A1L2CUJ9	Pectobacterium_phage	33.7	1.2e-69
AUL50321.1|1117520_1117985_-	peroxiredoxin	NA	NA	NA	NA	NA
AUL50322.1|1117981_1118443_-	hypothetical protein	NA	NA	NA	NA	NA
AUL50323.1|1118668_1119856_+	alanine transaminase	NA	NA	NA	NA	NA
AUL50324.1|1119852_1121157_+	homoserine dehydrogenase	NA	NA	NA	NA	NA
AUL50325.1|1121153_1122563_+	threonine synthase	NA	NA	NA	NA	NA
AUL50326.1|1122756_1123017_+|transposase	transposase	transposase	NA	NA	NA	NA
AUL50327.1|1123055_1123877_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	43.7	7.2e-55
AUL50328.1|1124011_1125031_-	fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	34.8	3.0e-50
AUL50329.1|1125039_1127745_-	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	25.1	6.8e-17
AUL50330.1|1127884_1128538_+	hypothetical protein	NA	NA	NA	NA	NA
AUL50331.1|1128600_1128963_-	DNA-binding protein	NA	NA	NA	NA	NA
AUL50332.1|1129529_1130990_+|protease	metalloprotease TldD	protease	NA	NA	NA	NA
AUL50333.1|1131252_1132326_+	3-deoxy-7-phosphoheptulonate synthase	NA	A0A2I6UFP9	Klebsiella_phage	46.4	7.9e-78
AUL50334.1|1132410_1133631_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.1	3.5e-183
AUL50335.1|1135388_1136210_-|transposase	transposase	transposase	S5WIU1	Leptospira_phage	43.7	7.2e-55
AUL50336.1|1136248_1136509_-|transposase	transposase	transposase	NA	NA	NA	NA
AUL52554.1|1136536_1137982_+	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
AUL50337.1|1137995_1139099_+	glycolate oxidase subunit GlcE	NA	NA	NA	NA	NA
AUL50338.1|1139103_1140354_+	glycolate oxidase iron-sulfur subunit	NA	NA	NA	NA	NA
AUL50339.1|1140350_1141796_-	NAD synthetase	NA	NA	NA	NA	NA
AUL50340.1|1141792_1142107_-	NAD(P)(+) transhydrogenase	NA	NA	NA	NA	NA
AUL50341.1|1142108_1143227_-	NAD(P) transhydrogenase subunit alpha	NA	NA	NA	NA	NA
AUL50342.1|1143409_1144630_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
AUL50343.1|1144729_1145596_-	N-formylglutamate amidohydrolase	NA	NA	NA	NA	NA
AUL50344.1|1145656_1146637_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUL50345.1|1146783_1147704_+	LysR family transcriptional regulator	NA	Q6JIH3	Burkholderia_virus	30.8	2.1e-26
AUL50346.1|1147712_1148825_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
AUL50347.1|1148906_1149728_+	hypothetical protein	NA	NA	NA	NA	NA
AUL50348.1|1149803_1150412_-	glutathione S-transferase	NA	NA	NA	NA	NA
AUL52555.1|1150549_1151926_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	46.1	7.2e-108
AUL50349.1|1151987_1152431_+	cytochrome C	NA	NA	NA	NA	NA
AUL52556.1|1152497_1153169_-	cytochrome B	NA	NA	NA	NA	NA
AUL50350.1|1153196_1153457_+|transposase	transposase	transposase	NA	NA	NA	NA
AUL50351.1|1154176_1154458_-	hypothetical protein	NA	NA	NA	NA	NA
AUL50352.1|1155168_1155957_+	hypothetical protein	NA	NA	NA	NA	NA
AUL50353.1|1155953_1157060_+	AI-2E family transporter	NA	NA	NA	NA	NA
AUL50354.1|1157734_1159093_-	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	38.3	2.1e-19
AUL50355.1|1159207_1159405_-	gas vesicle protein	NA	NA	NA	NA	NA
AUL50356.1|1159422_1160244_-|transposase	transposase	transposase	S5WIU1	Leptospira_phage	44.0	1.9e-55
AUL50357.1|1160282_1160543_-|transposase	transposase	transposase	NA	NA	NA	NA
AUL50358.1|1160636_1161191_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	43.7	1.3e-31
AUL52557.1|1161778_1163095_-	hypothetical protein	NA	NA	NA	NA	NA
AUL50359.1|1163107_1164121_-	dimethylhistidine N-methyltransferase	NA	NA	NA	NA	NA
AUL50360.1|1164667_1165618_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
AUL50361.1|1165697_1165997_+	hypothetical protein	NA	NA	NA	NA	NA
AUL50362.1|1167357_1169016_-	FMN-binding glutamate synthase family protein	NA	NA	NA	NA	NA
AUL50363.1|1169164_1170385_-	hypothetical protein	NA	NA	NA	NA	NA
AUL50364.1|1170502_1171786_-	arsenical efflux pump membrane protein ArsB	NA	A0A2H4J144	uncultured_Caudovirales_phage	68.4	4.6e-157
AUL50365.1|1171789_1172731_-	transporter	NA	NA	NA	NA	NA
AUL50366.1|1172840_1173299_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AUL52558.1|1173679_1174300_+	DTW domain-containing protein	NA	NA	NA	NA	NA
AUL50367.1|1174707_1177128_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	32.1	3.9e-64
AUL50368.1|1177235_1177973_+	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
AUL50369.1|1178019_1179264_+	hypothetical protein	NA	A0A0B5JD48	Pandoravirus	27.1	1.3e-10
AUL50370.1|1179586_1179859_+	DNA-binding protein HU	NA	A4JWM7	Burkholderia_virus	56.2	4.2e-20
AUL50371.1|1180442_1181171_+	energy transducer TonB	NA	NA	NA	NA	NA
AUL50372.1|1181192_1182110_+	flagellar motor protein MotA	NA	NA	NA	NA	NA
AUL50373.1|1182109_1182619_+	biopolymer transporter ExbD	NA	NA	NA	NA	NA
AUL50374.1|1182735_1183407_+	DNA-binding response regulator	NA	NA	NA	NA	NA
AUL50375.1|1183516_1184584_+	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	27.7	2.8e-14
AUL50376.1|1184567_1186448_+	potassium transporter Kup	NA	A7K9V6	Acanthocystis_turfacea_chlorella_virus	30.0	3.5e-65
AUL50377.1|1186584_1187772_+	hypothetical protein	NA	NA	NA	NA	NA
AUL50378.1|1188072_1188858_+	hypothetical protein	NA	NA	NA	NA	NA
AUL50379.1|1188881_1189142_+|transposase	transposase	transposase	NA	NA	NA	NA
AUL50380.1|1189180_1190002_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	44.0	1.9e-55
>prophage 8
CP018899	Bordetella holmesii isolate F615 chromosome, complete genome	3687853	1198029	1259127	3687853	tRNA,protease,transposase	Ralstonia_virus(21.43%)	55	NA	NA
AUL50388.1|1198029_1199250_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
AUL50389.1|1199325_1199607_+	malate dehydrogenase	NA	NA	NA	NA	NA
AUL50390.1|1201438_1202434_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUL50391.1|1202476_1203247_+	2-dehydro-3-deoxyglucarate aldolase	NA	NA	NA	NA	NA
AUL50392.1|1203372_1203636_-	30S ribosomal protein S20	NA	NA	NA	NA	NA
AUL50393.1|1203837_1203984_-	transmembrane sensor protein	NA	NA	NA	NA	NA
AUL50394.1|1204037_1204988_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
AUL50395.1|1205069_1205549_-	transmembrane sensor protein	NA	NA	NA	NA	NA
AUL50396.1|1205580_1206402_-|transposase	transposase	transposase	S5WIU1	Leptospira_phage	44.0	1.9e-55
AUL50397.1|1206440_1206701_-|transposase	transposase	transposase	NA	NA	NA	NA
AUL50398.1|1206758_1207958_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	74.9	1.2e-178
AUL50399.1|1208103_1208481_-	cytochrome c family protein	NA	NA	NA	NA	NA
AUL50400.1|1208504_1210286_-	GMC family oxidoreductase	NA	NA	NA	NA	NA
AUL50401.1|1210294_1211032_-	hypothetical protein	NA	NA	NA	NA	NA
AUL50402.1|1211316_1212876_-	murein biosynthesis integral membrane protein MurJ	NA	NA	NA	NA	NA
AUL50403.1|1212935_1213694_-	3-hydroxyacyl-CoA dehydrogenase	NA	NA	NA	NA	NA
AUL50404.1|1213790_1214447_-	adenylate kinase	NA	NA	NA	NA	NA
AUL50405.1|1214600_1215365_-	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
AUL50406.1|1215379_1215559_-	hypothetical protein	NA	NA	NA	NA	NA
AUL50407.1|1215584_1216619_-	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
AUL50408.1|1216615_1217029_-	biopolymer transporter ExbD	NA	NA	NA	NA	NA
AUL50409.1|1217025_1217610_-	flagellar motor protein MotA	NA	NA	NA	NA	NA
AUL50410.1|1217962_1219321_+	exodeoxyribonuclease VII large subunit	NA	A0A1V0SD82	Indivirus	33.6	1.0e-29
AUL50411.1|1219414_1219993_+	superoxide dismutase	NA	NA	NA	NA	NA
AUL50412.1|1220117_1220939_-|transposase	transposase	transposase	S5WIU1	Leptospira_phage	44.0	1.9e-55
AUL50413.1|1220977_1221238_-|transposase	transposase	transposase	NA	NA	NA	NA
AUL52560.1|1221265_1222567_+	chloride channel protein-related protein	NA	NA	NA	NA	NA
AUL50414.1|1222670_1223876_+	3-oxoadipyl-CoA thiolase	NA	NA	NA	NA	NA
AUL50415.1|1223939_1224389_-	hypothetical protein	NA	A0A1B1IUW8	uncultured_Mediterranean_phage	42.2	6.8e-15
AUL50416.1|1224521_1224767_-	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	75.0	6.5e-20
AUL50417.1|1224991_1225306_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	43.9	8.4e-12
AUL50418.1|1225397_1225682_-	hypothetical protein	NA	NA	NA	NA	NA
AUL50419.1|1225949_1230512_+	alpha-2-macroglobulin	NA	NA	NA	NA	NA
AUL50420.1|1230559_1232665_+	penicillin-binding protein 1C	NA	NA	NA	NA	NA
AUL50421.1|1232718_1235028_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	9.1e-164
AUL50422.1|1236381_1238049_+	paraquat-inducible protein B	NA	NA	NA	NA	NA
AUL50423.1|1238051_1238717_+	hypothetical protein	NA	NA	NA	NA	NA
AUL50424.1|1238849_1242656_+	trifunctional transcriptional regulator/proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
AUL50425.1|1242881_1244027_+	branched chain amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUL50426.1|1244145_1245075_+	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
AUL50427.1|1245071_1246148_+	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
AUL50428.1|1246144_1246951_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	23.9	7.2e-15
AUL50429.1|1246947_1247679_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.3	2.6e-16
AUL50430.1|1247882_1248065_+	hypothetical protein	NA	NA	NA	NA	NA
AUL50431.1|1248055_1249294_-	ammonia channel protein	NA	H8ZJB2	Ostreococcus_tauri_virus	28.3	6.2e-26
AUL50432.1|1249341_1249680_-	transcriptional regulator	NA	NA	NA	NA	NA
AUL50433.1|1249927_1250878_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
AUL50434.1|1251196_1251379_+	hypothetical protein	NA	NA	NA	NA	NA
AUL50435.1|1251444_1252665_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.6	4.2e-184
AUL50436.1|1252724_1252988_+	hypothetical protein	NA	NA	NA	NA	NA
AUL50437.1|1253109_1254609_+|protease	ATP-dependent protease	protease	NA	NA	NA	NA
AUL50438.1|1255029_1255227_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
AUL50439.1|1255242_1255602_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
AUL50440.1|1255674_1256697_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2H4UW22	Bodo_saltans_virus	38.8	6.1e-27
AUL50441.1|1256709_1259127_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
>prophage 9
CP018899	Bordetella holmesii isolate F615 chromosome, complete genome	3687853	1268474	1314847	3687853	tRNA,transposase,holin	Ralstonia_virus(20.0%)	46	NA	NA
AUL50454.1|1268474_1270436_-|holin	choline transporter	holin	A0A2I7QNT1	Vibrio_phage	29.9	2.3e-27
AUL50455.1|1270564_1270813_-	hypothetical protein	NA	NA	NA	NA	NA
AUL50456.1|1270942_1271221_-	hypothetical protein	NA	NA	NA	NA	NA
AUL50457.1|1271314_1271767_+	hypothetical protein	NA	G1JW61	Mycobacterium_phage	36.3	8.9e-07
AUL50458.1|1271763_1272234_-	ArsR family transcriptional regulator	NA	NA	NA	NA	NA
AUL50459.1|1272525_1273119_+	twin-arginine translocation pathway signal	NA	NA	NA	NA	NA
AUL50460.1|1273166_1273451_+	CsbD family protein	NA	NA	NA	NA	NA
AUL50461.1|1273507_1273690_-	hypothetical protein	NA	NA	NA	NA	NA
AUL50462.1|1273841_1274045_+	hypothetical protein	NA	NA	NA	NA	NA
AUL50463.1|1274139_1274382_+	hypothetical protein	NA	NA	NA	NA	NA
AUL50464.1|1274529_1274742_+	hypothetical protein	NA	NA	NA	NA	NA
AUL50465.1|1274869_1275952_+	N-acylglucosamine 2-epimerase	NA	NA	NA	NA	NA
AUL50466.1|1276042_1276258_+	hypothetical protein	NA	NA	NA	NA	NA
AUL50467.1|1276264_1276630_-	Rieske (2Fe-2S) protein	NA	NA	NA	NA	NA
AUL50468.1|1276683_1278483_-	metal ABC transporter permease	NA	W8CYL7	Bacillus_phage	28.4	8.7e-45
AUL50469.1|1278632_1279007_+	2,5-diketo-D-gluconic acid reductase	NA	A0A2H4PQR8	Staphylococcus_phage	42.5	1.5e-20
AUL50470.1|1279030_1279291_+|transposase	transposase	transposase	NA	NA	NA	NA
AUL50471.1|1279329_1280151_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	44.0	1.9e-55
AUL50472.1|1280634_1281621_+	alcohol dehydrogenase	NA	NA	NA	NA	NA
AUL50473.1|1281667_1281874_-	hypothetical protein	NA	NA	NA	NA	NA
AUL50474.1|1281870_1283046_-	hypothetical protein	NA	NA	NA	NA	NA
AUL50475.1|1283223_1283877_+	serine/threonine protein phosphatase	NA	A0A2H4J0P0	uncultured_Caudovirales_phage	47.7	6.3e-54
AUL50476.1|1283871_1286394_-	penicillin-binding protein	NA	NA	NA	NA	NA
AUL50477.1|1286565_1288482_-	S9 family peptidase	NA	NA	NA	NA	NA
AUL50478.1|1288614_1289061_+	hypothetical protein	NA	NA	NA	NA	NA
AUL50479.1|1289089_1289518_-	phenylacetic acid degradation protein	NA	NA	NA	NA	NA
AUL50480.1|1290145_1291366_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
AUL50481.1|1292099_1292561_-|tRNA	glutamyl-tRNA amidotransferase	tRNA	A0A292GL36	Xanthomonas_phage	44.1	2.0e-17
AUL50482.1|1292699_1293926_+	nitric oxide dioxygenase	NA	NA	NA	NA	NA
AUL50483.1|1293947_1294385_+	BadM/Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
AUL50484.1|1294507_1295755_+	D-amino acid dehydrogenase small subunit	NA	NA	NA	NA	NA
AUL50485.1|1295762_1296596_-	class III aminotransferase	NA	NA	NA	NA	NA
AUL50486.1|1296592_1297120_-	3-hydroxyacyl-CoA dehydrogenase	NA	NA	NA	NA	NA
AUL50487.1|1297209_1298430_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
AUL50488.1|1298437_1300102_-	long-chain-fatty-acid--CoA ligase	NA	Q75ZG1	Hepacivirus	27.3	2.7e-40
AUL50489.1|1300109_1300619_-	hypothetical protein	NA	NA	NA	NA	NA
AUL50490.1|1300615_1301230_-	DUF4442 domain-containing protein	NA	NA	NA	NA	NA
AUL50491.1|1301230_1302424_-	acetyl-CoA acetyltransferase	NA	NA	NA	NA	NA
AUL50492.1|1302433_1304818_-	3-hydroxyacyl-CoA dehydrogenase	NA	NA	NA	NA	NA
AUL50493.1|1304877_1306170_-	fatty acid transporter	NA	NA	NA	NA	NA
AUL50494.1|1306191_1308150_-	enoyl-CoA hydratase	NA	NA	NA	NA	NA
AUL50495.1|1308146_1309439_-	acetyl-CoA acetyltransferase	NA	NA	NA	NA	NA
AUL50496.1|1309449_1311780_-	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
AUL50497.1|1311805_1312474_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
AUL50498.1|1312853_1313798_+	serine acetyltransferase	NA	NA	NA	NA	NA
AUL50499.1|1313896_1314847_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 10
CP018899	Bordetella holmesii isolate F615 chromosome, complete genome	3687853	1549669	1606803	3687853	tRNA,transposase	Leptospira_phage(15.79%)	45	NA	NA
AUL50707.1|1549669_1550158_+|tRNA	aminoacyl-tRNA deacylase	tRNA	NA	NA	NA	NA
AUL50708.1|1550272_1551388_-	D-alanyl-D-alanine endopeptidase	NA	NA	NA	NA	NA
AUL52576.1|1552020_1553184_+	MFS transporter	NA	NA	NA	NA	NA
AUL50709.1|1553366_1556024_+	hypothetical protein	NA	NA	NA	NA	NA
AUL50710.1|1556027_1559417_+	nuclease	NA	NA	NA	NA	NA
AUL50711.1|1559807_1561877_+	DNA polymerase III subunit gamma/tau	NA	A0A1U9WR94	Streptococcus_virus	37.7	1.1e-46
AUL50712.1|1561915_1562242_+	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
AUL50713.1|1562256_1562865_+	recombination protein RecR	NA	NA	NA	NA	NA
AUL50714.1|1564305_1565346_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUL50715.1|1565338_1566148_+	mannosyltransferase	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	25.5	1.1e-12
AUL50716.1|1566153_1566948_+	ABC transporter permease	NA	NA	NA	NA	NA
AUL52577.1|1567011_1567968_-	transaldolase	NA	M4SPL0	Cyanophage	30.7	3.6e-13
AUL50717.1|1568191_1569346_+	carbamoyl phosphate synthase small subunit	NA	R4TGJ8	Halovirus	33.1	2.6e-50
AUL50718.1|1569356_1572596_+	carbamoyl phosphate synthase large subunit	NA	NA	NA	NA	NA
AUL50719.1|1572660_1573557_+	aspartyl beta-hydroxylase	NA	H8ZJK8	Ostreococcus_tauri_virus	38.3	2.2e-36
AUL50720.1|1573624_1574386_+	short-chain dehydrogenase	NA	NA	NA	NA	NA
AUL50721.1|1574391_1575030_-	histidine phosphatase family protein	NA	NA	NA	NA	NA
AUL50722.1|1575022_1575931_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUL50723.1|1577036_1578728_-	ABC transporter permease	NA	NA	NA	NA	NA
AUL50724.1|1578795_1580118_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUL50725.1|1580215_1580491_-	hypothetical protein	NA	NA	NA	NA	NA
AUL50726.1|1580626_1581943_+	pyrimidine utilization transport protein G	NA	Q9KX94	Enterobacteria_phage	68.0	2.9e-154
AUL50727.1|1582143_1582572_+	transcriptional regulator	NA	A0A1X9I5R1	Streptococcus_phage	30.3	4.2e-06
AUL50728.1|1582637_1583858_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
AUL50729.1|1584212_1584689_+	transcription elongation factor GreA	NA	NA	NA	NA	NA
AUL50730.1|1584947_1585556_-	hypothetical protein	NA	NA	NA	NA	NA
AUL50731.1|1585574_1586246_+	rRNA methyltransferase	NA	NA	NA	NA	NA
AUL50732.1|1586419_1588306_+	cell division protein FtsH	NA	E5ESM9	Bathycoccus_sp._RCC1105_virus	42.5	6.2e-110
AUL50733.1|1588333_1589176_+	dihydropteroate synthase	NA	A0A0B5J4J5	Pandoravirus	32.5	6.5e-27
AUL50734.1|1589172_1590516_+	phosphoglucosamine mutase	NA	A0A1X9I671	Streptococcus_phage	27.1	2.7e-06
AUL50735.1|1590700_1591516_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AUL50736.1|1591581_1593063_-	exopolyphosphatase	NA	NA	NA	NA	NA
AUL50737.1|1593261_1595334_+	polyphosphate kinase 1	NA	NA	NA	NA	NA
AUL50738.1|1595553_1596591_+	phosphate ABC transporter substrate-binding protein PstS	NA	E3SKK5	Synechococcus_phage	40.2	8.5e-53
AUL50739.1|1596712_1598635_+	hypothetical protein	NA	NA	NA	NA	NA
AUL50740.1|1598662_1599439_+	phosphate ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.7	5.6e-17
AUL50741.1|1600266_1600776_+	hypothetical protein	NA	NA	NA	NA	NA
AUL50742.1|1601017_1601722_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	36.5	1.9e-27
AUL50743.1|1601853_1602624_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	56.6	2.8e-77
AUL52578.1|1602620_1603631_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	45.9	4.4e-78
AUL52579.1|1603689_1603950_+|transposase	transposase	transposase	NA	NA	NA	NA
AUL52580.1|1603982_1604771_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	37.5	1.4e-44
AUL50744.1|1604938_1605199_+|transposase	transposase	transposase	NA	NA	NA	NA
AUL50745.1|1605237_1606059_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	44.0	1.9e-55
AUL50746.1|1606113_1606803_+	hypothetical protein	NA	A0A1B0VBP7	Salmonella_phage	47.1	1.3e-49
>prophage 11
CP018899	Bordetella holmesii isolate F615 chromosome, complete genome	3687853	1624061	1671060	3687853	tRNA,transposase	Ralstonia_virus(20.0%)	47	NA	NA
AUL50764.1|1624061_1625282_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
AUL50765.1|1625540_1626146_+	hypothetical protein	NA	NA	NA	NA	NA
AUL50766.1|1626156_1627317_+	succinate--CoA ligase subunit beta	NA	NA	NA	NA	NA
AUL50767.1|1627338_1628220_+	succinate--CoA ligase subunit alpha	NA	A0A2K9L1S3	Tupanvirus	31.4	1.1e-19
AUL50768.1|1628516_1629215_+	hypothetical protein	NA	W8EBD0	Pseudomonas_phage	33.8	8.9e-22
AUL50769.1|1629356_1630079_+	hypothetical protein	NA	A0A2R2YAT9	Pseudomonas_phage	43.8	8.0e-42
AUL50770.1|1630197_1631136_+	hydroxymethylbilane synthase	NA	NA	NA	NA	NA
AUL50771.1|1631166_1631946_+	uroporphyrinogen-III synthase	NA	NA	NA	NA	NA
AUL50772.1|1631932_1633156_+	heme biosynthesis operon protein HemX	NA	NA	NA	NA	NA
AUL50773.1|1633160_1634708_+	protoheme IX synthesis protein	NA	NA	NA	NA	NA
AUL50774.1|1634743_1635277_+	inorganic pyrophosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	55.5	1.8e-51
AUL52582.1|1635520_1636216_+	5-carboxymethyl-2-hydroxymuconate isomerase	NA	NA	NA	NA	NA
AUL50775.1|1636230_1636362_+	entericidin	NA	NA	NA	NA	NA
AUL50776.1|1636409_1637534_+	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
AUL50777.1|1637539_1639879_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	40.3	6.9e-151
AUL50778.1|1639875_1640283_-	heat-shock protein Hsp20	NA	NA	NA	NA	NA
AUL50779.1|1640544_1640805_+	hypothetical protein	NA	NA	NA	NA	NA
AUL50780.1|1641027_1641978_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
AUL50781.1|1642027_1643236_+	pilus assembly protein	NA	NA	NA	NA	NA
AUL50782.1|1643457_1643997_+	pilus assembly protein	NA	NA	NA	NA	NA
AUL50783.1|1644221_1644626_+	pilus assembly protein	NA	NA	NA	NA	NA
AUL50784.1|1644690_1645446_+	Flp pilus assembly protein CpaB	NA	NA	NA	NA	NA
AUL50785.1|1645445_1646807_+	secretion protein	NA	NA	NA	NA	NA
AUL50786.1|1646803_1647427_+	pilus assembly protein	NA	NA	NA	NA	NA
AUL50787.1|1647470_1647731_+|transposase	transposase	transposase	NA	NA	NA	NA
AUL50788.1|1647769_1648591_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	44.0	1.9e-55
AUL50789.1|1648541_1649246_+	pilus assembly protein	NA	NA	NA	NA	NA
AUL50790.1|1649242_1649998_+	pilus assembly protein	NA	NA	NA	NA	NA
AUL52583.1|1650174_1650969_+	pilus assembly protein	NA	NA	NA	NA	NA
AUL50791.1|1650965_1651403_+	hypothetical protein	NA	NA	NA	NA	NA
AUL50792.1|1652087_1653056_-	homoserine kinase	NA	NA	NA	NA	NA
AUL50793.1|1653212_1654220_+|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
AUL50794.1|1654277_1654736_-	hypothetical protein	NA	NA	NA	NA	NA
AUL50795.1|1654809_1656156_-	hypothetical protein	NA	NA	NA	NA	NA
AUL50796.1|1656173_1656545_+	hypothetical protein	NA	NA	NA	NA	NA
AUL50797.1|1656544_1658014_+	hypothetical protein	NA	A0A075BSJ0	Microcystis_phage	36.1	5.8e-47
AUL50798.1|1658169_1658895_+	hypothetical protein	NA	NA	NA	NA	NA
AUL50799.1|1658908_1661623_-	histidine kinase	NA	NA	NA	NA	NA
AUL50800.1|1661874_1663239_+	diguanylate cyclase	NA	NA	NA	NA	NA
AUL50801.1|1663278_1664337_+	chorismate synthase	NA	A0A291AU41	Pandoravirus	43.7	4.9e-80
AUL50802.1|1664364_1665183_+	peptidase M48	NA	NA	NA	NA	NA
AUL52584.1|1665220_1665499_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
AUL50803.1|1666444_1666705_-|transposase	transposase	transposase	NA	NA	NA	NA
AUL50804.1|1666762_1667062_-	LuxR family transcriptional regulator	NA	NA	NA	NA	NA
AUL50805.1|1667631_1669035_+	3-isopropylmalate dehydratase large subunit	NA	NA	NA	NA	NA
AUL50806.1|1669047_1669698_+	3-isopropylmalate dehydratase small subunit	NA	NA	NA	NA	NA
AUL50807.1|1669839_1671060_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
>prophage 12
CP018899	Bordetella holmesii isolate F615 chromosome, complete genome	3687853	1675262	1795126	3687853	tRNA,integrase,transposase,holin	Leptospira_phage(17.39%)	114	1703448:1703507	1788910:1790218
AUL50811.1|1675262_1676078_+|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
AUL52585.1|1676125_1677163_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUL50812.1|1677214_1677874_+	N-(5'-phosphoribosyl)anthranilate isomerase	NA	NA	NA	NA	NA
AUL50813.1|1678513_1679389_-|transposase	transposase	transposase	U5P429	Shigella_phage	61.3	6.2e-97
AUL52586.1|1679385_1679676_-|transposase	transposase	transposase	U5P4I9	Shigella_phage	55.7	1.4e-16
AUL50814.1|1680440_1680701_-|transposase	transposase	transposase	NA	NA	NA	NA
AUL50815.1|1681099_1681789_+	permease	NA	NA	NA	NA	NA
AUL50816.1|1681888_1682050_-	hypothetical protein	NA	NA	NA	NA	NA
AUL50817.1|1682491_1682728_-	hypothetical protein	NA	NA	NA	NA	NA
AUL50818.1|1682917_1683166_-	hypothetical protein	NA	NA	NA	NA	NA
AUL50819.1|1683279_1684650_+	oxygen-independent coproporphyrinogen III oxidase	NA	NA	NA	NA	NA
AUL50820.1|1684650_1685391_-	DNA-binding response regulator	NA	NA	NA	NA	NA
AUL50821.1|1685877_1687830_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	36.1	2.4e-125
AUL50822.1|1687850_1688399_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	29.3	3.8e-12
AUL50823.1|1688564_1689521_+	glutathione synthase	NA	NA	NA	NA	NA
AUL52587.1|1689534_1689933_+	PTS mannose transporter subunit IIA	NA	NA	NA	NA	NA
AUL52588.1|1689995_1690265_+	phosphocarrier protein HPr	NA	NA	NA	NA	NA
AUL50824.1|1690293_1692069_+	phosphoenolpyruvate--protein phosphotransferase	NA	NA	NA	NA	NA
AUL50825.1|1692116_1692326_-	hypothetical protein	NA	NA	NA	NA	NA
AUL50826.1|1692372_1692795_-	OsmC family peroxiredoxin	NA	NA	NA	NA	NA
AUL50827.1|1692914_1693892_+	ornithine cyclodeaminase	NA	NA	NA	NA	NA
AUL50828.1|1695292_1696180_+	ectoine/hydroxyectoine ABC transporter substrate-binding protein EhuB	NA	NA	NA	NA	NA
AUL50829.1|1696190_1696832_+	ectoine/hydroxyectoine ABC transporter permease subunit EhuC	NA	NA	NA	NA	NA
AUL50830.1|1696828_1697500_+	ectoine/hydroxyectoine ABC transporter permease subunit EhuD	NA	NA	NA	NA	NA
AUL50831.1|1697499_1698270_+	ectoine/hydroxyectoine ABC transporter ATP-binding protein EhuA	NA	G9BWD6	Planktothrix_phage	35.8	2.0e-27
AUL50832.1|1698320_1698770_-	deoxyuridine 5'-triphosphate nucleotidohydrolase	NA	Q2NP83	Xanthomonas_phage	62.8	2.3e-47
AUL50833.1|1698811_1699270_-	hypothetical protein	NA	NA	NA	NA	NA
AUL50834.1|1699290_1699923_-	hypothetical protein	NA	NA	NA	NA	NA
AUL50835.1|1700032_1700500_+	hydrolase	NA	NA	NA	NA	NA
AUL50836.1|1700521_1701064_+	hydrolase	NA	NA	NA	NA	NA
AUL50837.1|1701076_1701781_+	dipeptidase E	NA	NA	NA	NA	NA
AUL50838.1|1701799_1702270_-	AsnC family transcriptional regulator	NA	NA	NA	NA	NA
AUL50839.1|1702362_1703103_+	permease	NA	NA	NA	NA	NA
AUL50840.1|1703146_1703407_+|transposase	transposase	transposase	NA	NA	NA	NA
1703448:1703507	attL	GACCGAGCGCGTGGTTCGCCCAGCGGCAATCGCGCCGAATCAGAGTTGGTCAATGGACTT	NA	NA	NA	NA
AUL50841.1|1703499_1704000_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	50.3	9.5e-42
1703448:1703507	attL	GACCGAGCGCGTGGTTCGCCCAGCGGCAATCGCGCCGAATCAGAGTTGGTCAATGGACTT	NA	NA	NA	NA
AUL50842.1|1704280_1705492_-	phosphopantothenate synthase	NA	Q9HH70	Methanothermobacter_phage	30.4	2.9e-36
AUL50843.1|1705552_1706068_-	signal peptidase II	NA	NA	NA	NA	NA
AUL50844.1|1706070_1708932_-|tRNA	isoleucine--tRNA ligase	tRNA	A0A1V0SJ93	Klosneuvirus	25.4	1.0e-71
AUL52589.1|1708921_1709887_-	riboflavin biosynthesis protein RibF	NA	NA	NA	NA	NA
AUL50845.1|1710643_1712119_+	rRNA methyltransferase	NA	NA	NA	NA	NA
AUL52590.1|1712123_1712399_-	hypothetical protein	NA	NA	NA	NA	NA
AUL50846.1|1712735_1712996_+|transposase	transposase	transposase	NA	NA	NA	NA
AUL50847.1|1714158_1715367_+	acyl-CoA desaturase	NA	NA	NA	NA	NA
AUL50848.1|1715363_1717646_+	DNA helicase II	NA	A7KV33	Bacillus_phage	36.2	2.5e-105
AUL50849.1|1717656_1720038_-	TonB-dependent receptor	NA	NA	NA	NA	NA
AUL50850.1|1722224_1723115_-	ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
AUL50851.1|1723121_1724255_-	succinyl-diaminopimelate desuccinylase	NA	NA	NA	NA	NA
AUL50852.1|1724254_1725076_-	2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase	NA	NA	NA	NA	NA
AUL50853.1|1725100_1726291_-	succinyldiaminopimelate transaminase	NA	NA	NA	NA	NA
AUL50854.1|1726592_1726874_+|integrase	integrase	integrase	NA	NA	NA	NA
AUL50855.1|1727039_1727360_+	hypothetical protein	NA	NA	NA	NA	NA
AUL50856.1|1727399_1727666_+|transposase	transposase	transposase	NA	NA	NA	NA
AUL52591.1|1727698_1728487_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	37.5	1.4e-44
AUL50857.1|1728682_1728943_+	hypothetical protein	NA	NA	NA	NA	NA
AUL50858.1|1729021_1729282_+|transposase	transposase	transposase	NA	NA	NA	NA
AUL50859.1|1729435_1730206_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	56.6	2.8e-77
AUL52592.1|1730202_1731213_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	45.9	4.4e-78
AUL52593.1|1731271_1732090_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	46.0	1.2e-54
AUL50860.1|1732552_1733338_-	exodeoxyribonuclease III	NA	NA	NA	NA	NA
AUL50861.1|1734197_1734458_+|transposase	transposase	transposase	NA	NA	NA	NA
AUL50862.1|1734496_1735318_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	43.7	7.2e-55
AUL50863.1|1736383_1737388_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	60.8	4.4e-139
1734766:1735334	attR	GACCGAGCGCGTGGTTCGCCCAGCGGCAATCGCGCCGAATCAGAGTTGGTCAATGGACTTTGTGGCCGACGGCCTAGCCTATGGCCGCCGATTCCGCTGTTTGACTATCGTCGATGACTACACTCGCGAATGCCTGGCCATCGAGGTCGATACGTCGTTGCCGGGACTGCGTGTTGCCATGGTGCTGCAACGGCTGGCGGAGATGCGTGGCCTGCCGCGATCTATTACCGTGGACAACGGGCCAGAGTTCGCCGGAAGAGCCTTGGACGCCTGGGCCTACCAAGCAGGCGTAAAGCTGTCGTTTATTCGGCCGGGTAAGCCGGTGGAGAACGCTTATATCGAAAGTTTCAACGGCAAGTTCCGCGACGAATGCCTTAACGAGCACTGGTTCTTGTCCCTGCGACAGGCTAAAAGCTTGATCGAAAACTGGCGAGTCGAGTACAACACCGATCGGCCTCACAGCGCGCTCGGATATTTAACGCCGGCGCAATTCGTGCAGGCTCATCAGAAAGAAGGTCTTTTACCCCTGGGCTCTATGTCGGTGCCGTACTAAATCTGGGGGCAGGTCA	NA	NA	NA	NA
AUL50864.1|1737463_1738276_+	nucleotide pyrophosphatase	NA	NA	NA	NA	NA
1734766:1735334	attR	GACCGAGCGCGTGGTTCGCCCAGCGGCAATCGCGCCGAATCAGAGTTGGTCAATGGACTTTGTGGCCGACGGCCTAGCCTATGGCCGCCGATTCCGCTGTTTGACTATCGTCGATGACTACACTCGCGAATGCCTGGCCATCGAGGTCGATACGTCGTTGCCGGGACTGCGTGTTGCCATGGTGCTGCAACGGCTGGCGGAGATGCGTGGCCTGCCGCGATCTATTACCGTGGACAACGGGCCAGAGTTCGCCGGAAGAGCCTTGGACGCCTGGGCCTACCAAGCAGGCGTAAAGCTGTCGTTTATTCGGCCGGGTAAGCCGGTGGAGAACGCTTATATCGAAAGTTTCAACGGCAAGTTCCGCGACGAATGCCTTAACGAGCACTGGTTCTTGTCCCTGCGACAGGCTAAAAGCTTGATCGAAAACTGGCGAGTCGAGTACAACACCGATCGGCCTCACAGCGCGCTCGGATATTTAACGCCGGCGCAATTCGTGCAGGCTCATCAGAAAGAAGGTCTTTTACCCCTGGGCTCTATGTCGGTGCCGTACTAAATCTGGGGGCAGGTCA	NA	NA	NA	NA
AUL50865.1|1738503_1740675_+|holin	phospholipase C, phosphocholine-specific	holin	NA	NA	NA	NA
AUL50866.1|1740728_1742048_-	MFS transporter	NA	NA	NA	NA	NA
AUL50867.1|1742136_1743357_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
AUL50868.1|1743575_1744436_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUL50869.1|1744432_1745656_-	MFS transporter	NA	NA	NA	NA	NA
AUL50870.1|1745954_1746452_+	osmotically inducible protein Y	NA	NA	NA	NA	NA
AUL50871.1|1746490_1747273_-	hydrolase	NA	NA	NA	NA	NA
AUL50872.1|1747298_1747517_-	SlyX protein	NA	NA	NA	NA	NA
AUL50873.1|1747591_1747861_+	hypothetical protein	NA	NA	NA	NA	NA
AUL50874.1|1748080_1748545_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AUL50875.1|1748618_1748900_-	peptidylprolyl isomerase	NA	NA	NA	NA	NA
AUL52594.1|1749016_1750000_-|integrase	integrase	integrase	NA	NA	NA	NA
AUL50876.1|1750243_1751242_+	cointegrate resolution protein	NA	NA	NA	NA	NA
AUL50877.1|1751344_1751776_+	energy transducer TonB	NA	NA	NA	NA	NA
AUL50878.1|1751840_1752752_+	3-phosphoglycerate dehydrogenase	NA	M1HBE3	Paramecium_bursaria_Chlorella_virus	30.7	3.7e-20
AUL50879.1|1752884_1754966_+	bifunctional diguanylate cyclase/phosphodiesterase	NA	NA	NA	NA	NA
AUL50880.1|1755004_1755709_-	fumarylacetoacetate hydrolase	NA	NA	NA	NA	NA
AUL50881.1|1755801_1756686_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AUL50882.1|1756761_1757163_-	hypothetical protein	NA	NA	NA	NA	NA
AUL50883.1|1757253_1757400_-	50S ribosomal protein L36	NA	NA	NA	NA	NA
AUL50884.1|1757661_1758597_-	transcriptional regulator	NA	NA	NA	NA	NA
AUL50885.1|1758678_1759332_+	short-chain dehydrogenase	NA	NA	NA	NA	NA
AUL50886.1|1759948_1760425_-	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
AUL50887.1|1760449_1761244_-	ABC transporter permease	NA	NA	NA	NA	NA
AUL50888.1|1761260_1762241_-	taurine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUL50889.1|1762413_1762626_-	hypothetical protein	NA	NA	NA	NA	NA
AUL50890.1|1763039_1764815_-	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	25.4	3.5e-38
AUL50891.1|1764830_1766495_-	dihydrolipoyllysine-residue acetyltransferase	NA	NA	NA	NA	NA
AUL50892.1|1766507_1769219_-	pyruvate dehydrogenase (acetyl-transferring), homodimeric type	NA	NA	NA	NA	NA
AUL52595.1|1769764_1771519_+	PAS domain-containing sensor histidine kinase	NA	NA	NA	NA	NA
AUL50893.1|1771515_1772142_+	DNA-binding response regulator	NA	NA	NA	NA	NA
AUL50894.1|1772138_1772993_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase	NA	A0A249XZQ2	Enterococcus_phage	37.8	1.1e-29
AUL50895.1|1773112_1775167_+	oligopeptidase A	NA	NA	NA	NA	NA
AUL50896.1|1775276_1776227_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
AUL50897.1|1776223_1776739_-	methyltransferase	NA	NA	NA	NA	NA
AUL50898.1|1777096_1777717_+	SCO family protein	NA	NA	NA	NA	NA
AUL50899.1|1777816_1778068_+	hypothetical protein	NA	NA	NA	NA	NA
AUL50900.1|1778155_1779634_-	multidrug transporter	NA	NA	NA	NA	NA
AUL50901.1|1779630_1782801_-	multidrug efflux RND transporter permease	NA	NA	NA	NA	NA
AUL50902.1|1782813_1784010_-	efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
AUL50903.1|1784198_1785131_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUL50904.1|1785199_1785931_-	pseudouridylate synthase	NA	NA	NA	NA	NA
AUL50905.1|1785996_1786632_+	chorismate--pyruvate lyase	NA	NA	NA	NA	NA
AUL50906.1|1786617_1787796_-	arabinose transporter	NA	NA	NA	NA	NA
AUL50907.1|1787956_1788505_-	hypothetical protein	NA	NA	NA	NA	NA
AUL50908.1|1788585_1788945_+	lysine transporter LysE	NA	NA	NA	NA	NA
AUL50909.1|1788993_1790214_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
AUL50910.1|1790289_1791411_-	transporter	NA	NA	NA	NA	NA
AUL50911.1|1791448_1792162_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.1	1.7e-12
AUL50912.1|1792172_1793393_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.1	4.6e-183
AUL50913.1|1794175_1795126_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 13
CP018899	Bordetella holmesii isolate F615 chromosome, complete genome	3687853	1958316	2015676	3687853	integrase,transposase	Leptospira_phage(22.22%)	49	1952999:1953014	1984210:1984225
1952999:1953014	attL	GGCTGTTGCCGGCAAG	NA	NA	NA	NA
AUL51061.1|1958316_1958577_-|transposase	transposase	transposase	NA	NA	NA	NA
AUL51062.1|1958600_1958795_-	hypothetical protein	NA	NA	NA	NA	NA
AUL51063.1|1958794_1961002_-	outer membrane receptor protein	NA	NA	NA	NA	NA
AUL51064.1|1961274_1962072_+	enterobactin-dependent positive regulator	NA	NA	NA	NA	NA
AUL51065.1|1962117_1963173_-	diguanylate cyclase	NA	NA	NA	NA	NA
AUL51066.1|1963207_1963402_-|integrase	integrase	integrase	A0A1W6JTA0	Pseudomonas_phage	52.8	1.1e-06
AUL51067.1|1963398_1964340_-	LD-carboxypeptidase	NA	NA	NA	NA	NA
AUL51068.1|1964842_1965727_+	hypothetical protein	NA	NA	NA	NA	NA
AUL51069.1|1966151_1968380_+	isocitrate dehydrogenase (NADP(+))	NA	NA	NA	NA	NA
AUL51070.1|1968664_1969129_+	hypothetical protein	NA	NA	NA	NA	NA
AUL51071.1|1969135_1970653_+	hypothetical protein	NA	NA	NA	NA	NA
AUL51072.1|1970701_1971454_-	polar amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	42.3	4.3e-30
AUL51073.1|1971461_1972115_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
AUL51074.1|1972151_1972940_-	amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUL51075.1|1973057_1973639_-	polyisoprenoid-binding protein	NA	NA	NA	NA	NA
AUL51076.1|1973921_1974305_-	hypothetical protein	NA	NA	NA	NA	NA
AUL51077.1|1974889_1975219_+	hypothetical protein	NA	NA	NA	NA	NA
AUL51078.1|1976398_1977127_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	23.1	1.8e-09
AUL52605.1|1977123_1977888_-	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	31.2	2.3e-18
AUL51079.1|1977887_1979771_-	ABC transporter permease	NA	NA	NA	NA	NA
AUL51080.1|1979783_1980989_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUL51081.1|1981056_1981911_-	hypothetical protein	NA	NA	NA	NA	NA
AUL51082.1|1981926_1982214_-	hypothetical protein	NA	NA	NA	NA	NA
AUL51083.1|1982359_1983310_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
AUL51084.1|1983269_1983671_-	hypothetical protein	NA	NA	NA	NA	NA
AUL51085.1|1983754_1984489_-	hypothetical protein	NA	NA	NA	NA	NA
1984210:1984225	attR	GGCTGTTGCCGGCAAG	NA	NA	NA	NA
AUL51086.1|1984665_1985457_+	hydratase	NA	NA	NA	NA	NA
AUL51087.1|1985479_1987024_-	hypothetical protein	NA	A0A0R6PEZ3	Moraxella_phage	42.9	5.2e-38
AUL51088.1|1987768_1988968_+	diguanylate phosphodiesterase	NA	NA	NA	NA	NA
AUL51089.1|1989404_1990028_+	DNA-binding response regulator	NA	NA	NA	NA	NA
AUL52606.1|1990033_1993690_+	virulence sensor protein	NA	Q8QKV7	Ectocarpus_siliculosus_virus	32.0	6.5e-39
AUL51090.1|1995878_1997576_+	hypothetical protein	NA	NA	NA	NA	NA
AUL51091.1|1997960_1998221_+|transposase	transposase	transposase	NA	NA	NA	NA
AUL51092.1|1998259_1999081_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	44.0	1.9e-55
AUL51093.1|1999113_1999428_+	glutamate decarboxylase	NA	NA	NA	NA	NA
AUL51094.1|1999517_2001218_+	transporter	NA	NA	NA	NA	NA
AUL51095.1|2001297_2001675_+	hypothetical protein	NA	NA	NA	NA	NA
AUL51096.1|2001811_2002537_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AUL51097.1|2002669_2003656_+	C4-dicarboxylate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUL51098.1|2003658_2004132_+	TRAP transporter small permease protein	NA	NA	NA	NA	NA
AUL51099.1|2004136_2005420_+	C4-dicarboxylate ABC transporter permease	NA	NA	NA	NA	NA
AUL51100.1|2005416_2006307_+	CoA ester lyase	NA	NA	NA	NA	NA
AUL51101.1|2006303_2008001_+	thiamine pyrophosphate-binding protein	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	25.7	4.0e-31
AUL51102.1|2009325_2010825_+	aldehyde dehydrogenase PuuC	NA	NA	NA	NA	NA
AUL51103.1|2010897_2011416_+	hypothetical protein	NA	NA	NA	NA	NA
AUL51104.1|2011489_2012380_+	phosphatidylserine decarboxylase	NA	NA	NA	NA	NA
AUL51105.1|2012437_2013691_+	alpha-hydroxy-acid oxidizing enzyme	NA	NA	NA	NA	NA
AUL51106.1|2013725_2014490_-	iron ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUL51107.1|2014854_2015676_-|transposase	transposase	transposase	S5WIU1	Leptospira_phage	44.0	1.1e-55
>prophage 14
CP018899	Bordetella holmesii isolate F615 chromosome, complete genome	3687853	2123901	2179570	3687853	tRNA,protease,transposase	uncultured_Mediterranean_phage(14.29%)	60	NA	NA
AUL51188.1|2123901_2124162_+|transposase	transposase	transposase	NA	NA	NA	NA
AUL51189.1|2124200_2125022_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	44.0	1.9e-55
AUL51190.1|2125065_2125818_-	hypothetical protein	NA	NA	NA	NA	NA
AUL51191.1|2126109_2126532_-	hypothetical protein	NA	NA	NA	NA	NA
AUL51192.1|2126801_2127581_-	3'-5' exonuclease	NA	NA	NA	NA	NA
AUL51193.1|2127577_2128441_-	peptidase	NA	A0A292GJG6	Xanthomonas_phage	40.5	8.5e-14
AUL51194.1|2128458_2129256_-	protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	47.5	9.8e-33
AUL51195.1|2129240_2129999_-	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	53.3	1.9e-70
AUL51196.1|2130163_2130802_+	glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
AUL51197.1|2130798_2131377_-	hypothetical protein	NA	NA	NA	NA	NA
AUL51198.1|2131388_2131922_-	carboxymuconolactone decarboxylase	NA	NA	NA	NA	NA
AUL51199.1|2131926_2132886_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUL51200.1|2132916_2133699_-	amidohydrolase	NA	NA	NA	NA	NA
AUL51201.1|2133808_2134801_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUL51202.1|2134802_2135840_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	53.7	5.6e-97
AUL51203.1|2135924_2137217_+	guanine permease	NA	A0A0R6PHV4	Moraxella_phage	36.7	2.9e-66
AUL51204.1|2137399_2138416_+	luciferase	NA	NA	NA	NA	NA
AUL51205.1|2138524_2138908_+	thioredoxin	NA	V9SJ74	Achromobacter_phage	26.8	1.2e-09
AUL52613.1|2138911_2139268_-	hypothetical protein	NA	NA	NA	NA	NA
AUL51206.1|2139288_2139519_-	hypothetical protein	NA	NA	NA	NA	NA
AUL51207.1|2139542_2140340_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUL51208.1|2140344_2141112_-	ABC transporter permease	NA	NA	NA	NA	NA
AUL51209.1|2141108_2142104_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUL51210.1|2142153_2142918_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	33.7	6.3e-29
AUL51211.1|2143090_2144695_-	ABC-F family ATPase	NA	A0A1V0SKJ1	Klosneuvirus	28.9	7.7e-53
AUL51212.1|2144948_2145929_-	LD-carboxypeptidase	NA	NA	NA	NA	NA
AUL51213.1|2145925_2146414_-|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	S4VYT2	Pandoravirus	39.1	1.3e-06
AUL51214.1|2146406_2147255_-	hydrolase	NA	NA	NA	NA	NA
AUL51215.1|2147346_2147844_-	hypothetical protein	NA	NA	NA	NA	NA
AUL51216.1|2147981_2148341_-	cation:proton antiporter	NA	NA	NA	NA	NA
AUL51217.1|2148337_2148619_-	K+/H+ antiporter subunit F	NA	NA	NA	NA	NA
AUL51218.1|2148618_2149101_-	Na+/H+ antiporter subunit E	NA	NA	NA	NA	NA
AUL51219.1|2149102_2150731_-	monovalent cation/H+ antiporter subunit D	NA	NA	NA	NA	NA
AUL51220.1|2150727_2151072_-	Na+/H+ antiporter subunit C	NA	NA	NA	NA	NA
AUL51221.1|2151073_2154016_-	monovalent cation/H+ antiporter subunit A	NA	NA	NA	NA	NA
AUL51222.1|2154461_2155433_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUL52614.1|2155422_2156805_-	GTP-binding protein	NA	NA	NA	NA	NA
AUL51223.1|2156947_2157898_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
AUL51224.1|2157857_2159099_-	GTP-binding protein	NA	NA	NA	NA	NA
AUL51225.1|2159095_2160217_-	DNA repair exonuclease	NA	NA	NA	NA	NA
AUL51226.1|2161708_2162176_+	transcriptional regulator	NA	NA	NA	NA	NA
AUL51227.1|2162246_2162897_+	hypothetical protein	NA	NA	NA	NA	NA
AUL51228.1|2162983_2164123_+	hypothetical protein	NA	NA	NA	NA	NA
AUL51229.1|2164291_2165296_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	60.8	4.4e-139
AUL51230.1|2165292_2166540_+	UDP-N-acetylglucosamine 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
AUL51231.1|2166892_2167759_+	DeoR family transcriptional regulator	NA	A0A077SK06	Escherichia_phage	30.0	5.9e-23
AUL51232.1|2167718_2169323_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
AUL51233.1|2169334_2170021_-	type 1 glutamine amidotransferase domain-containing protein	NA	NA	NA	NA	NA
AUL51234.1|2170017_2171058_-	NADP-dependent oxidoreductase	NA	NA	NA	NA	NA
AUL51235.1|2171173_2171845_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
AUL52615.1|2171865_2172834_+	secretion protein HlyD	NA	NA	NA	NA	NA
AUL51236.1|2172830_2173769_+	multidrug ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.4	8.6e-20
AUL51237.1|2173765_2174920_+	mannose-1-phosphate guanyltransferase	NA	NA	NA	NA	NA
AUL51238.1|2174928_2176380_+	ABC transporter permease	NA	NA	NA	NA	NA
AUL51239.1|2176410_2176893_+	hypothetical protein	NA	NA	NA	NA	NA
AUL51240.1|2176894_2177788_+	hypothetical protein	NA	Q9J5E1	Fowlpox_virus	34.8	6.5e-25
AUL51241.1|2177784_2178228_+	hypothetical protein	NA	NA	NA	NA	NA
AUL51242.1|2178240_2178618_-	hypothetical protein	NA	NA	NA	NA	NA
AUL51243.1|2178757_2179156_+|protease	membrane-associated protease	protease	NA	NA	NA	NA
AUL51244.1|2179282_2179570_+|protease	CAAX protease family protein	protease	NA	NA	NA	NA
>prophage 15
CP018899	Bordetella holmesii isolate F615 chromosome, complete genome	3687853	2261227	2303380	3687853	transposase	Planktothrix_phage(25.0%)	41	NA	NA
AUL51327.1|2261227_2261488_+|transposase	transposase	transposase	NA	NA	NA	NA
AUL51328.1|2262417_2263143_+	peptide ABC transporter permease	NA	NA	NA	NA	NA
AUL51329.1|2263139_2264138_+	methionine ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.7	3.6e-16
AUL52618.1|2264143_2265145_+	peptide ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.5	1.8e-15
AUL51330.1|2265175_2266744_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUL51331.1|2266743_2268051_+	palmitoyl-CoA hydrolase	NA	NA	NA	NA	NA
AUL51332.1|2268047_2268554_+	CMD domain protein	NA	NA	NA	NA	NA
AUL51333.1|2268550_2269138_+	alkylhydroperoxidase	NA	NA	NA	NA	NA
AUL51334.1|2269225_2270059_+	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AUL51335.1|2270228_2270510_+	hypothetical protein	NA	NA	NA	NA	NA
AUL51336.1|2270519_2271095_-	peptidase	NA	NA	NA	NA	NA
AUL51337.1|2271102_2272575_-	peptidase M20	NA	NA	NA	NA	NA
AUL52619.1|2272731_2276781_-	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	68.4	2.2e-160
AUL51338.1|2277161_2277548_+	TRAP C4-dicarboxylate transporter	NA	NA	NA	NA	NA
AUL51339.1|2277561_2278383_-|transposase	transposase	transposase	S5WIU1	Leptospira_phage	44.0	1.9e-55
AUL51340.1|2278421_2278682_-|transposase	transposase	transposase	NA	NA	NA	NA
AUL51341.1|2278892_2280191_+	C4-dicarboxylate ABC transporter	NA	NA	NA	NA	NA
AUL51342.1|2280233_2281262_+	C4-dicarboxylate ABC transporter	NA	NA	NA	NA	NA
AUL51343.1|2281376_2281943_-	transcription elongation factor GreB	NA	NA	NA	NA	NA
AUL51344.1|2282001_2282847_-	phosphatase	NA	NA	NA	NA	NA
AUL52620.1|2282904_2283780_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
AUL51345.1|2284031_2284646_-	hypothetical protein	NA	NA	NA	NA	NA
AUL51346.1|2284655_2285876_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
AUL51347.1|2285924_2286590_-	hypothetical protein	NA	NA	NA	NA	NA
AUL51348.1|2286637_2287633_-	hypothetical protein	NA	NA	NA	NA	NA
AUL51349.1|2290810_2291725_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUL51350.1|2291874_2292840_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUL51351.1|2292847_2293264_+	4-carboxymuconolactone decarboxylase	NA	NA	NA	NA	NA
AUL51352.1|2293260_2294178_+	oxidoreductase	NA	NA	NA	NA	NA
AUL51353.1|2294189_2294609_+	hypothetical protein	NA	NA	NA	NA	NA
AUL51354.1|2294517_2295906_+	succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
AUL52621.1|2295902_2296154_-	hypothetical protein	NA	NA	NA	NA	NA
AUL51355.1|2296324_2297281_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUL51356.1|2297263_2297476_+	hypothetical protein	NA	NA	NA	NA	NA
AUL51357.1|2297525_2298299_+	MBL fold hydrolase	NA	NA	NA	NA	NA
AUL51358.1|2298295_2299429_+	malate dehydrogenase	NA	NA	NA	NA	NA
AUL51359.1|2299438_2300389_+	D-3-phosphoglycerate dehydrogenase	NA	M1HKI4	Acanthocystis_turfacea_Chlorella_virus	28.4	4.8e-18
AUL51360.1|2300420_2301221_+	aldolase	NA	NA	NA	NA	NA
AUL51361.1|2301235_2302390_+	hypothetical protein	NA	NA	NA	NA	NA
AUL51362.1|2302217_2303093_-|transposase	transposase	transposase	U5P429	Shigella_phage	61.3	6.2e-97
AUL52622.1|2303089_2303380_-|transposase	transposase	transposase	U5P4I9	Shigella_phage	55.7	1.4e-16
>prophage 16
CP018899	Bordetella holmesii isolate F615 chromosome, complete genome	3687853	2327928	2438758	3687853	tRNA,protease,transposase	Escherichia_phage(12.5%)	103	NA	NA
AUL51377.1|2327928_2329443_+|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.9	8.8e-83
AUL51378.1|2329455_2329743_+	hypothetical protein	NA	NA	NA	NA	NA
AUL52624.1|2329763_2330651_-	methylglyoxal synthase	NA	NA	NA	NA	NA
AUL51379.1|2330801_2331308_+	RNA polymerase subunit sigma	NA	NA	NA	NA	NA
AUL51380.1|2331304_2332261_+	iron dicitrate transport regulator FecR	NA	NA	NA	NA	NA
AUL51381.1|2332448_2333795_+	protein FpvAIII	NA	NA	NA	NA	NA
AUL51382.1|2334740_2335511_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	56.6	2.8e-77
AUL52625.1|2335507_2336518_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	45.9	4.4e-78
AUL51383.1|2336587_2336833_-|transposase	transposase	transposase	NA	NA	NA	NA
AUL51384.1|2336832_2337279_+	hypothetical protein	NA	NA	NA	NA	NA
AUL51385.1|2337334_2337529_-	Fe-S assembly protein IscX	NA	NA	NA	NA	NA
AUL51386.1|2337530_2337872_-	ferredoxin, 2Fe-2S type, ISC system	NA	NA	NA	NA	NA
AUL51387.1|2337881_2339744_-	Fe-S protein assembly chaperone HscA	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	38.7	1.4e-98
AUL51388.1|2339783_2340290_-	Fe-S protein assembly co-chaperone HscB	NA	NA	NA	NA	NA
AUL51389.1|2340293_2340617_-	iron-sulfur cluster assembly protein IscA	NA	A0A2H4N7N5	Lake_Baikal_phage	54.2	6.8e-25
AUL51390.1|2340618_2341023_-	Fe-S cluster assembly scaffold IscU	NA	A0A218MKD1	uncultured_virus	79.8	1.9e-53
AUL51391.1|2341059_2342271_-	IscS subfamily cysteine desulfurase	NA	NA	NA	NA	NA
AUL51392.1|2342292_2342841_-	Fe-S cluster assembly transcriptional regulator IscR	NA	NA	NA	NA	NA
AUL51393.1|2343065_2343557_-	protein tyrosine phosphatase	NA	NA	NA	NA	NA
AUL51394.1|2343772_2345803_-	excinuclease ABC subunit B	NA	NA	NA	NA	NA
AUL51395.1|2345877_2347080_+	aromatic amino acid aminotransferase	NA	NA	NA	NA	NA
AUL51396.1|2347622_2348558_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUL51397.1|2349591_2349873_+	hypothetical protein	NA	NA	NA	NA	NA
AUL51398.1|2349959_2350133_+	osmotically inducible protein OsmC	NA	NA	NA	NA	NA
AUL51399.1|2350244_2350589_+	alkylhydroperoxidase	NA	NA	NA	NA	NA
AUL51400.1|2350660_2351329_+	anti-sigma factor	NA	NA	NA	NA	NA
AUL51401.1|2352744_2353788_+	alcohol dehydrogenase	NA	A0A2K9L339	Tupanvirus	29.2	1.4e-31
AUL52626.1|2353784_2353886_+	hypothetical protein	NA	NA	NA	NA	NA
AUL51402.1|2353977_2354238_+|transposase	transposase	transposase	NA	NA	NA	NA
AUL51403.1|2354276_2355098_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	44.0	1.9e-55
AUL51404.1|2355347_2356001_+	repressor LexA	NA	A0A2H4JG58	uncultured_Caudovirales_phage	50.7	1.9e-10
AUL51405.1|2356116_2357337_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
AUL51406.1|2357387_2359817_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	51.4	3.6e-219
AUL51407.1|2359982_2361281_-|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	54.3	3.1e-129
AUL51408.1|2361385_2362039_-	ATP-dependent Clp endopeptidase, proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	55.9	2.0e-55
AUL51409.1|2362041_2363352_-	trigger factor	NA	NA	NA	NA	NA
AUL51410.1|2363579_2364119_+	TIGR00645 family protein	NA	K4K6D8	Caulobacter_phage	35.8	5.6e-24
AUL51411.1|2364603_2364864_+|transposase	transposase	transposase	NA	NA	NA	NA
AUL52627.1|2365149_2366160_+|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	45.9	4.4e-78
AUL51412.1|2366156_2366927_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	56.6	2.8e-77
AUL51413.1|2367006_2367672_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	46.1	2.1e-49
AUL51414.1|2367639_2368131_-	SpoVR like family protein	NA	NA	NA	NA	NA
AUL51415.1|2368240_2368444_-	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	66.7	6.6e-18
AUL51416.1|2368761_2369082_-	hypothetical protein	NA	NA	NA	NA	NA
AUL51417.1|2369065_2369401_-	hypothetical protein	NA	NA	NA	NA	NA
AUL51418.1|2369455_2369668_-	autotransporter	NA	NA	NA	NA	NA
AUL51419.1|2369743_2370082_+|transposase	transposase	transposase	A0A218MNG9	uncultured_virus	50.0	3.7e-05
AUL52628.1|2370078_2370414_+|transposase	transposase	transposase	NA	NA	NA	NA
AUL51420.1|2370476_2372048_+|transposase	IS66 family transposase	transposase	A0A218MNE7	uncultured_virus	47.5	2.0e-125
AUL51421.1|2372841_2373153_+	hypothetical protein	NA	NA	NA	NA	NA
AUL51422.1|2373345_2373846_-|transposase	transposase	transposase	S5WIU1	Leptospira_phage	50.3	9.5e-42
AUL51423.1|2373938_2374199_-|transposase	transposase	transposase	NA	NA	NA	NA
AUL51424.1|2374326_2374521_-	hypothetical protein	NA	NA	NA	NA	NA
AUL52629.1|2380602_2380893_+|transposase	transposase	transposase	U5P4I9	Shigella_phage	55.7	1.4e-16
AUL51425.1|2380889_2381765_+|transposase	transposase	transposase	U5P429	Shigella_phage	60.9	1.8e-96
AUL51426.1|2382149_2383613_+	ribonuclease E/G	NA	NA	NA	NA	NA
AUL51427.1|2383745_2385296_+	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	32.9	4.1e-19
AUL51428.1|2385607_2386429_-|transposase	transposase	transposase	S5WIU1	Leptospira_phage	44.0	1.9e-55
AUL51429.1|2386467_2386728_-|transposase	transposase	transposase	NA	NA	NA	NA
AUL51430.1|2386804_2387659_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	77.8	7.3e-127
AUL51431.1|2387841_2388699_+	EamA family transporter	NA	NA	NA	NA	NA
AUL51432.1|2388751_2389249_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
AUL51433.1|2389369_2390785_+	hypothetical protein	NA	NA	NA	NA	NA
AUL51434.1|2390794_2391979_+	HlyD family secretion protein	NA	NA	NA	NA	NA
AUL51435.1|2391975_2393574_+	MFS transporter	NA	NA	NA	NA	NA
AUL51436.1|2393669_2394788_-	tartrate dehydrogenase	NA	NA	NA	NA	NA
AUL51437.1|2394756_2395002_-	hypothetical protein	NA	NA	NA	NA	NA
AUL51438.1|2395412_2395598_+	hypothetical protein	NA	NA	NA	NA	NA
AUL51439.1|2395753_2396665_+	EamA family transporter	NA	NA	NA	NA	NA
AUL51440.1|2396786_2397629_-	glyoxylate/hydroxypyruvate reductase A	NA	NA	NA	NA	NA
AUL51441.1|2397831_2399205_+	aspartate aminotransferase family protein	NA	NA	NA	NA	NA
AUL51442.1|2399514_2401026_-	ATP-binding protein	NA	A0A248XCZ8	Klebsiella_phage	45.9	2.5e-77
AUL51443.1|2401178_2401910_+	hypothetical protein	NA	NA	NA	NA	NA
AUL51444.1|2402016_2403318_+	phosphoribosylamine--glycine ligase	NA	NA	NA	NA	NA
AUL51445.1|2403325_2404234_+	coproporphyrinogen III oxidase	NA	NA	NA	NA	NA
AUL51446.1|2404230_2404824_+	nicotinate (nicotinamide) nucleotide adenylyltransferase	NA	NA	NA	NA	NA
AUL51447.1|2404867_2405281_+	ribosome silencing factor	NA	NA	NA	NA	NA
AUL51448.1|2405277_2405748_+	23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH	NA	NA	NA	NA	NA
AUL51449.1|2405754_2406360_+	septum formation inhibitor Maf	NA	NA	NA	NA	NA
AUL51450.1|2408161_2409946_+	two-component sensor histidine kinase	NA	NA	NA	NA	NA
AUL51451.1|2409942_2411328_+	Fis family transcriptional regulator	NA	NA	NA	NA	NA
AUL51452.1|2411313_2412276_-	serine dehydratase	NA	NA	NA	NA	NA
AUL51453.1|2412345_2412975_-	DNA-binding protein	NA	NA	NA	NA	NA
AUL51454.1|2413012_2414221_-	hypothetical protein	NA	NA	NA	NA	NA
AUL51455.1|2414342_2414912_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
AUL51456.1|2415043_2416597_+	methyltransferase	NA	NA	NA	NA	NA
AUL51457.1|2416900_2418121_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
AUL51458.1|2418528_2419431_+	iron ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUL51459.1|2419427_2420297_+	manganese/iron transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.8	1.5e-10
AUL51460.1|2420293_2421145_+	hypothetical protein	NA	NA	NA	NA	NA
AUL51461.1|2421141_2421966_+	hypothetical protein	NA	NA	NA	NA	NA
AUL51462.1|2423737_2423998_-|transposase	transposase	transposase	NA	NA	NA	NA
AUL51463.1|2424808_2427169_+	pyrroloquinoline quinone-dependent dehydrogenase	NA	NA	NA	NA	NA
AUL51464.1|2427185_2427848_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
AUL51465.1|2429209_2430160_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
AUL51466.1|2430177_2430990_+	hypothetical protein	NA	A0A1B0VCF0	Salmonella_phage	56.3	3.3e-76
AUL51467.1|2431005_2432412_-	MFS transporter	NA	A0A0M3UL24	Mycobacterium_phage	28.2	1.5e-20
AUL51468.1|2432513_2432984_+	hypothetical protein	NA	NA	NA	NA	NA
AUL51469.1|2433235_2434495_-	aspartate kinase	NA	NA	NA	NA	NA
AUL51470.1|2434579_2435629_-|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
AUL51471.1|2435646_2436612_-	acetyl-CoA carboxylase carboxyltransferase subunit alpha	NA	NA	NA	NA	NA
AUL51472.1|2436645_2437290_-	DNA-3-methyladenine glycosylase	NA	NA	NA	NA	NA
AUL51473.1|2437300_2438758_-|tRNA	cysteine--tRNA ligase	tRNA	A0A2K9L6B7	Tupanvirus	30.0	7.5e-39
>prophage 17
CP018899	Bordetella holmesii isolate F615 chromosome, complete genome	3687853	2470705	2514571	3687853	tRNA,protease,transposase	Shigella_phage(40.0%)	35	NA	NA
AUL51502.1|2470705_2471353_-|protease	site-2 protease family protein	protease	NA	NA	NA	NA
AUL51503.1|2471437_2472064_-	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
AUL51504.1|2472128_2472974_+	hypothetical protein	NA	A0A1I9SA48	Rhodococcus_phage	35.1	2.4e-37
AUL51505.1|2473303_2473855_+	hypothetical protein	NA	NA	NA	NA	NA
AUL51506.1|2474618_2474912_-	hypothetical protein	NA	NA	NA	NA	NA
AUL51507.1|2475126_2475456_-	alkylhydroperoxidase	NA	NA	NA	NA	NA
AUL51508.1|2476039_2477500_+	cardiolipin synthase	NA	NA	NA	NA	NA
AUL51509.1|2477458_2477683_-	hypothetical protein	NA	NA	NA	NA	NA
AUL51510.1|2478059_2479379_-	MFS transporter	NA	NA	NA	NA	NA
AUL51511.1|2479421_2479895_-	hypothetical protein	NA	NA	NA	NA	NA
AUL51512.1|2479891_2480902_-	hypothetical protein	NA	NA	NA	NA	NA
AUL51513.1|2480966_2481932_-	pyridoxal-5'-phosphate-dependent protein	NA	NA	NA	NA	NA
AUL51514.1|2482056_2482317_+|transposase	transposase	transposase	NA	NA	NA	NA
AUL51515.1|2483160_2484036_-|transposase	transposase	transposase	U5P429	Shigella_phage	61.3	6.2e-97
AUL52632.1|2484032_2484323_-|transposase	transposase	transposase	U5P4I9	Shigella_phage	55.7	1.4e-16
AUL51516.1|2484592_2485510_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUL51517.1|2486865_2488152_+	phospholipase	NA	NA	NA	NA	NA
AUL51518.1|2488245_2488845_+	hypothetical protein	NA	NA	NA	NA	NA
AUL51519.1|2489069_2489591_-	hypothetical protein	NA	NA	NA	NA	NA
AUL51520.1|2489856_2490411_+	hypothetical protein	NA	NA	NA	NA	NA
AUL51521.1|2490430_2491792_-	hypothetical protein	NA	NA	NA	NA	NA
AUL51522.1|2492144_2494724_+	bifunctional diguanylate cyclase/phosphodiesterase	NA	NA	NA	NA	NA
AUL51523.1|2494770_2495877_+|tRNA	tRNA 2-selenouridine(34) synthase MnmH	tRNA	NA	NA	NA	NA
AUL51524.1|2496023_2496533_+	dehydratase	NA	NA	NA	NA	NA
AUL51525.1|2496556_2497537_+	LacI family transcriptional regulator	NA	NA	NA	NA	NA
AUL52633.1|2497542_2498958_+	2-methylcitrate dehydratase	NA	NA	NA	NA	NA
AUL51526.1|2498954_2500127_+	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
AUL51527.1|2500123_2501344_+	CoA transferase	NA	NA	NA	NA	NA
AUL51528.1|2501340_2502138_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AUL51529.1|2502986_2507666_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	A0A2L1IV18	Escherichia_phage	28.4	1.1e-27
AUL51530.1|2510814_2511777_-	iron dicitrate transport regulator FecR	NA	NA	NA	NA	NA
AUL51531.1|2511773_2512292_-	RNA polymerase subunit sigma	NA	NA	NA	NA	NA
AUL52634.1|2512444_2512765_+	amidohydrolase	NA	NA	NA	NA	NA
AUL51532.1|2513450_2513711_+|transposase	transposase	transposase	NA	NA	NA	NA
AUL51533.1|2513749_2514571_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	44.4	2.9e-56
>prophage 18
CP018899	Bordetella holmesii isolate F615 chromosome, complete genome	3687853	2553391	2654112	3687853	tRNA,transposase	Leptospira_phage(17.65%)	95	NA	NA
AUL51568.1|2553391_2553652_-|transposase	transposase	transposase	NA	NA	NA	NA
AUL51569.1|2554661_2555177_+	hypothetical protein	NA	T1SAR8	Salmonella_phage	44.6	3.9e-06
AUL51570.1|2555449_2555764_+	virulence factor	NA	NA	NA	NA	NA
AUL51571.1|2555951_2556188_-	hypothetical protein	NA	NA	NA	NA	NA
AUL51572.1|2556478_2557834_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	47.5	2.1e-83
AUL52637.1|2557880_2559221_-	recombination factor protein RarA	NA	G3MBE0	Bacillus_virus	38.9	9.3e-76
AUL51573.1|2559322_2559955_-	outer membrane lipoprotein carrier protein LolA	NA	NA	NA	NA	NA
AUL51574.1|2559954_2562324_-	cell division protein FtsK	NA	S5VNE3	Mycobacterium_phage	47.7	2.2e-80
AUL51575.1|2562356_2563316_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	40.2	2.4e-57
AUL51576.1|2563302_2563995_+	DNA mismatch repair protein MutS	NA	NA	NA	NA	NA
AUL51577.1|2563991_2564324_+	QacE family quaternary ammonium compound efflux SMR transporter	NA	NA	NA	NA	NA
AUL51578.1|2564439_2565390_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
AUL51579.1|2565386_2567453_-	cation acetate symporter	NA	NA	NA	NA	NA
AUL51580.1|2567452_2567725_-	hypothetical protein	NA	NA	NA	NA	NA
AUL51581.1|2568419_2568509_+	potassium-transporting ATPase subunit F	NA	NA	NA	NA	NA
AUL51582.1|2568508_2570293_+	potassium-transporting ATPase subunit KdpA	NA	NA	NA	NA	NA
AUL51583.1|2570316_2572482_+	potassium-transporting ATPase subunit B	NA	M1HBF8	Paramecium_bursaria_Chlorella_virus	26.9	7.8e-24
AUL51584.1|2572492_2573092_+	potassium-transporting ATPase subunit C	NA	NA	NA	NA	NA
AUL51585.1|2575855_2576551_+	two-component system response regulator KdpE	NA	NA	NA	NA	NA
AUL51586.1|2576559_2577801_-	hypothetical protein	NA	NA	NA	NA	NA
AUL51587.1|2577950_2578931_-	hypothetical protein	NA	NA	NA	NA	NA
AUL51588.1|2579129_2580386_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	64.8	1.2e-11
AUL51589.1|2580588_2581014_+	hypothetical protein	NA	NA	NA	NA	NA
AUL51590.1|2581064_2581427_-	cytochrome	NA	NA	NA	NA	NA
AUL52638.1|2581955_2582843_+	ATP-binding protein	NA	NA	NA	NA	NA
AUL51591.1|2584039_2584258_-	N-acetyltransferase	NA	NA	NA	NA	NA
AUL51592.1|2584278_2584653_-	hypothetical protein	NA	NA	NA	NA	NA
AUL51593.1|2584985_2587736_+	peptidase M16	NA	A0A2K9LA15	Tupanvirus	28.1	1.5e-19
AUL51594.1|2587904_2589050_-	molecular chaperone DnaJ	NA	A0A1V0SBY2	Catovirus	60.8	4.0e-19
AUL51595.1|2589150_2591076_-	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	49.8	4.6e-145
AUL51596.1|2591164_2591539_-	thiol reductase thioredoxin	NA	NA	NA	NA	NA
AUL51597.1|2591560_2592091_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
AUL51598.1|2592204_2592438_-	hypothetical protein	NA	NA	NA	NA	NA
AUL51599.1|2592524_2593616_-	ferrochelatase	NA	NA	NA	NA	NA
AUL51600.1|2593648_2594653_-	heat-inducible transcriptional repressor HrcA	NA	NA	NA	NA	NA
AUL51601.1|2594762_2595662_+	NAD kinase	NA	NA	NA	NA	NA
AUL51602.1|2595683_2597339_+	DNA repair protein RecN	NA	NA	NA	NA	NA
AUL51603.1|2598154_2598976_-|transposase	transposase	transposase	S5WIU1	Leptospira_phage	44.4	2.9e-56
AUL51604.1|2599014_2599275_-|transposase	transposase	transposase	NA	NA	NA	NA
AUL51605.1|2599989_2600406_-	ferric iron uptake transcriptional regulator	NA	NA	NA	NA	NA
AUL52639.1|2600676_2601174_+	hypothetical protein	NA	NA	NA	NA	NA
AUL51606.1|2601189_2601981_+	4-hydroxy-tetrahydrodipicolinate reductase	NA	NA	NA	NA	NA
AUL52640.1|2602038_2603025_-	UDP-N-acetylenolpyruvoylglucosamine reductase	NA	NA	NA	NA	NA
AUL52641.1|2603371_2603917_-|transposase	transposase	transposase	U5P429	Shigella_phage	66.3	2.2e-68
AUL51607.1|2603959_2604220_+|transposase	transposase	transposase	NA	NA	NA	NA
AUL51608.1|2604312_2604813_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	50.3	9.5e-42
AUL51609.1|2605329_2605983_+	thiol:disulfide interchange protein DsbG	NA	NA	NA	NA	NA
AUL51610.1|2606164_2606872_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AUL51611.1|2606868_2609484_+	Fe/S-dependent 2-methylisocitrate dehydratase AcnD	NA	NA	NA	NA	NA
AUL51612.1|2609540_2610725_+	putative methylaconitate Delta-isomerase PrpF	NA	NA	NA	NA	NA
AUL51613.1|2610785_2611394_+	lysine transporter LysE	NA	NA	NA	NA	NA
AUL51614.1|2611516_2612542_-	LacI family transcriptional regulator	NA	NA	NA	NA	NA
AUL51615.1|2612605_2613136_-	short-chain dehydrogenase	NA	NA	NA	NA	NA
AUL51616.1|2613015_2613357_-	hypothetical protein	NA	NA	NA	NA	NA
AUL51617.1|2613353_2614061_-	short-chain dehydrogenase	NA	NA	NA	NA	NA
AUL51618.1|2614070_2614964_-	carboxyvinyl-carboxyphosphonate phosphorylmutase	NA	NA	NA	NA	NA
AUL51619.1|2614947_2615706_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AUL51620.1|2615997_2618673_+	aconitate hydratase 1	NA	NA	NA	NA	NA
AUL51621.1|2618689_2620051_+	dihydroorotase	NA	NA	NA	NA	NA
AUL51622.1|2620070_2620793_+	hydrolase	NA	NA	NA	NA	NA
AUL51623.1|2620797_2621796_+	cobalamin biosynthesis protein CobW	NA	NA	NA	NA	NA
AUL51624.1|2622216_2622525_+	hypothetical protein	NA	NA	NA	NA	NA
AUL51625.1|2622572_2623145_+	hypothetical protein	NA	NA	NA	NA	NA
AUL51626.1|2623122_2623527_-	hypothetical protein	NA	NA	NA	NA	NA
AUL51627.1|2623645_2624563_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUL51628.1|2624572_2625154_+	NUDIX hydrolase	NA	NA	NA	NA	NA
AUL51629.1|2625150_2625903_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
AUL51630.1|2625945_2626665_+	arginyltransferase	NA	NA	NA	NA	NA
AUL51631.1|2626707_2627763_+	dihydroorotate dehydrogenase (quinone)	NA	NA	NA	NA	NA
AUL51632.1|2627872_2628715_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	77.8	4.5e-129
AUL51633.1|2628772_2629033_+|transposase	transposase	transposase	NA	NA	NA	NA
AUL51634.1|2630525_2631644_+	porin	NA	NA	NA	NA	NA
AUL51635.1|2631716_2632574_+	hypothetical protein	NA	NA	NA	NA	NA
AUL51636.1|2632595_2633435_-	UTP--glucose-1-phosphate uridylyltransferase	NA	A0A127AW70	Bacillus_phage	46.2	1.6e-62
AUL51637.1|2633508_2635026_+	peptidase	NA	NA	NA	NA	NA
AUL51638.1|2635038_2636136_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
AUL51639.1|2636147_2636570_-	DUF4440 domain-containing protein	NA	NA	NA	NA	NA
AUL51640.1|2636599_2636803_-	hypothetical protein	NA	NA	NA	NA	NA
AUL51641.1|2637150_2637903_+	hypothetical protein	NA	NA	NA	NA	NA
AUL51642.1|2637902_2638394_+	hypothetical protein	NA	NA	NA	NA	NA
AUL51643.1|2638465_2639839_+	ATP-dependent RNA helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.6	1.8e-50
AUL51644.1|2639945_2640329_-	thiol reductase thioredoxin	NA	NA	NA	NA	NA
AUL51645.1|2640327_2641182_+	hypothetical protein	NA	NA	NA	NA	NA
AUL51646.1|2641204_2642020_+	competence/damage-inducible protein A	NA	NA	NA	NA	NA
AUL51647.1|2642133_2642964_+	IclR family transcriptional regulator	NA	NA	NA	NA	NA
AUL51648.1|2643112_2644090_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUL51649.1|2645758_2646337_+	Phasin (PHA-granule associated protein)	NA	NA	NA	NA	NA
AUL51650.1|2646896_2647718_-|transposase	transposase	transposase	S5WIU1	Leptospira_phage	43.7	7.2e-55
AUL51651.1|2647756_2648017_-|transposase	transposase	transposase	NA	NA	NA	NA
AUL51652.1|2648060_2648690_-	calcium:sodium antiporter	NA	NA	NA	NA	NA
AUL51653.1|2648847_2650191_+	Xaa-Pro aminopeptidase	NA	NA	NA	NA	NA
AUL51654.1|2650199_2650583_-	hypothetical protein	NA	NA	NA	NA	NA
AUL51655.1|2650742_2651894_+	monooxygenase	NA	NA	NA	NA	NA
AUL51656.1|2651992_2652943_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
AUL51657.1|2653086_2654112_+|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
>prophage 19
CP018899	Bordetella holmesii isolate F615 chromosome, complete genome	3687853	2934234	3034004	3687853	tRNA,transposase	Ralstonia_virus(20.0%)	83	NA	NA
AUL51890.1|2934234_2935014_+|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
AUL51891.1|2935036_2935984_+	prolyl aminopeptidase	NA	NA	NA	NA	NA
AUL51892.1|2935985_2936186_+	thiamine biosynthesis protein ThiS	NA	NA	NA	NA	NA
AUL51893.1|2936520_2936781_+|transposase	transposase	transposase	NA	NA	NA	NA
AUL51894.1|2936819_2937641_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	44.0	1.9e-55
AUL51895.1|2937961_2938678_-	phosphoserine phosphatase SerB	NA	NA	NA	NA	NA
AUL51896.1|2938674_2939568_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUL51897.1|2939731_2940952_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
AUL51898.1|2941104_2942187_+	iron ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.1	1.5e-31
AUL51899.1|2942197_2943844_+	iron ABC transporter permease	NA	NA	NA	NA	NA
AUL51900.1|2943867_2944851_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUL51901.1|2944913_2946326_-	signal recognition particle protein	NA	NA	NA	NA	NA
AUL51902.1|2946443_2947286_+	hypothetical protein	NA	NA	NA	NA	NA
AUL51903.1|2947564_2948173_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A1W6DX33	Sphingobium_phage	46.8	1.0e-05
AUL51904.1|2948188_2948809_+	glutathione S-transferase	NA	NA	NA	NA	NA
AUL51905.1|2948874_2949585_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.3	1.6e-13
AUL51906.1|2949586_2950309_-	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	28.6	1.9e-11
AUL51907.1|2950295_2950586_-	inner-membrane translocator	NA	NA	NA	NA	NA
AUL51908.1|2950661_2951882_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.1	2.1e-183
AUL51909.1|2952606_2953458_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
AUL51910.1|2953509_2954763_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUL51911.1|2954939_2955728_-	hypothetical protein	NA	NA	NA	NA	NA
AUL51912.1|2955847_2956762_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUL51913.1|2956894_2958787_-	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	37.9	4.6e-121
AUL51914.1|2958972_2960352_+	xanthine permease XanP	NA	H9YQ34	environmental_Halophage	50.7	4.1e-26
AUL51915.1|2960796_2961093_+	site-specific recombinase	NA	NA	NA	NA	NA
AUL51916.1|2961136_2961397_+|transposase	transposase	transposase	NA	NA	NA	NA
AUL51917.1|2961489_2961990_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	50.3	9.5e-42
AUL51918.1|2962003_2962228_-|transposase	transposase	transposase	NA	NA	NA	NA
AUL51919.1|2964893_2965496_-	3-methyladenine DNA glycosylase	NA	NA	NA	NA	NA
AUL51920.1|2965629_2966088_+	zinc/iron-chelating domain-containing protein	NA	NA	NA	NA	NA
AUL51921.1|2966089_2966689_-	iron transport sensor protein	NA	NA	NA	NA	NA
AUL51922.1|2966697_2967507_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AUL51923.1|2967541_2968396_+	permease	NA	NA	NA	NA	NA
AUL51924.1|2968515_2969103_+	histidine utilization protein HutD	NA	NA	NA	NA	NA
AUL51925.1|2969099_2970479_+	formimidoylglutamate deiminase	NA	NA	NA	NA	NA
AUL51926.1|2978801_2980142_+	8-amino-7-oxononanoate synthase	NA	G9E4Q1	Emiliania_huxleyi_virus	32.3	2.9e-45
AUL51927.1|2980155_2981007_+	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	40.4	4.4e-47
AUL51928.1|2981018_2982284_-	capsule biosynthesis protein CapA	NA	NA	NA	NA	NA
AUL51929.1|2982345_2984427_-	beta-3-deoxy-D-manno-oct-2-ulosonic acid transferase	NA	NA	NA	NA	NA
AUL51930.1|2985374_2985635_+|transposase	transposase	transposase	NA	NA	NA	NA
AUL51931.1|2985727_2986228_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	50.3	9.5e-42
AUL51932.1|2986224_2987079_-	sulfatase	NA	NA	NA	NA	NA
AUL51933.1|2987071_2987866_-	short-chain dehydrogenase	NA	NA	NA	NA	NA
AUL51934.1|2988081_2989032_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
AUL51935.1|2989634_2990432_-	metal ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUL51936.1|2990471_2991125_-	DL-methionine transporter permease subunit	NA	NA	NA	NA	NA
AUL51937.1|2991105_2992170_-	phosphate ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.3	6.5e-32
AUL51938.1|2992333_2994559_-	glycosyl hydrolase	NA	NA	NA	NA	NA
AUL51939.1|2994804_2996649_-	FAD-dependent cmnm(5)s(2)U34 oxidoreductase	NA	NA	NA	NA	NA
AUL51940.1|2996765_2997638_+	inositol monophosphatase	NA	NA	NA	NA	NA
AUL51941.1|2997684_2999385_-	long-chain fatty acid--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	27.5	1.0e-31
AUL51942.1|2999447_3000647_+	amidohydrolase	NA	NA	NA	NA	NA
AUL51943.1|3000657_3001536_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUL51944.1|3001642_3002680_+	hypothetical protein	NA	NA	NA	NA	NA
AUL52651.1|3002760_3003165_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
AUL51945.1|3003176_3004634_+	magnesium transporter	NA	NA	NA	NA	NA
AUL51946.1|3005276_3005873_-	gamma-glutamylcyclotransferase	NA	NA	NA	NA	NA
AUL51947.1|3006033_3006492_-	transcriptional regulator	NA	NA	NA	NA	NA
AUL51948.1|3007269_3008241_-	hypothetical protein	NA	NA	NA	NA	NA
AUL51949.1|3008362_3008782_+	hypothetical protein	NA	NA	NA	NA	NA
AUL51950.1|3009657_3009918_-|transposase	transposase	transposase	NA	NA	NA	NA
AUL51951.1|3010073_3011294_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
AUL51952.1|3011355_3012243_-	HflC protein	NA	NA	NA	NA	NA
AUL51953.1|3012260_3013565_-	HflK protein	NA	NA	NA	NA	NA
AUL51954.1|3013530_3014637_-	GTPase HflX	NA	NA	NA	NA	NA
AUL51955.1|3014724_3014961_-	RNA chaperone Hfq	NA	NA	NA	NA	NA
AUL51956.1|3015144_3016218_-	histidinol-phosphate transaminase	NA	NA	NA	NA	NA
AUL51957.1|3016214_3017570_-	ribosome biogenesis GTPase Der	NA	NA	NA	NA	NA
AUL51958.1|3017594_3018752_-	outer membrane protein assembly factor BamB	NA	NA	NA	NA	NA
AUL51959.1|3018757_3019396_-	hypothetical protein	NA	NA	NA	NA	NA
AUL51960.1|3019399_3020695_-|tRNA	histidine--tRNA ligase	tRNA	NA	NA	NA	NA
AUL51961.1|3020727_3022014_-	4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase	NA	NA	NA	NA	NA
AUL51962.1|3022026_3022515_-	transcriptional regulator	NA	NA	NA	NA	NA
AUL51963.1|3022511_3023660_-	23S rRNA (adenine(2503)-C(2))-methyltransferase	NA	NA	NA	NA	NA
AUL51964.1|3023689_3024115_-	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	42.9	2.4e-22
AUL51965.1|3024434_3027314_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	37.1	1.1e-137
AUL51966.1|3027367_3028588_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	74.9	3.0e-182
AUL51967.1|3028636_3029500_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
AUL51968.1|3029499_3030093_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
AUL51969.1|3030384_3030645_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
AUL51970.1|3031144_3031396_-	hypothetical protein	NA	NA	NA	NA	NA
AUL51971.1|3031382_3034004_-|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	39.5	2.8e-84
>prophage 20
CP018899	Bordetella holmesii isolate F615 chromosome, complete genome	3687853	3065348	3117761	3687853	tRNA,protease,transposase	Synechococcus_phage(20.0%)	43	NA	NA
AUL52002.1|3065348_3066299_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
AUL52003.1|3067839_3070611_+	bifunctional glutamine synthetase adenylyltransferase/deadenyltransferase	NA	NA	NA	NA	NA
AUL52004.1|3070650_3071325_+	hypothetical protein	NA	NA	NA	NA	NA
AUL52005.1|3071331_3072723_-	L-serine ammonia-lyase	NA	NA	NA	NA	NA
AUL52006.1|3072900_3074565_+	Na/Pi cotransporter	NA	NA	NA	NA	NA
AUL52007.1|3074633_3075305_+	phosphoglycolate phosphatase	NA	A0A1D8KNV9	Synechococcus_phage	28.3	1.7e-06
AUL52008.1|3075335_3076130_-	carboxymethylenebutenolidase	NA	NA	NA	NA	NA
AUL52009.1|3076169_3077018_-	ZIP family metal transporter	NA	NA	NA	NA	NA
AUL52652.1|3078668_3079619_+	ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
AUL52010.1|3079650_3081654_+	cytochrome o ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
AUL52011.1|3081646_3082288_+	cytochrome o ubiquinol oxidase subunit III	NA	NA	NA	NA	NA
AUL52012.1|3082284_3082674_+	cytochrome o ubiquinol oxidase subunit IV	NA	NA	NA	NA	NA
AUL52013.1|3082705_3083464_+	hypothetical protein	NA	NA	NA	NA	NA
AUL52014.1|3083417_3086138_-	DNA polymerase I	NA	A0A218MKQ4	uncultured_virus	29.9	6.5e-68
AUL52015.1|3086154_3086820_+	Rossman fold protein, TIGR00730 family	NA	A0A1D8KU27	Synechococcus_phage	32.8	3.1e-16
AUL52016.1|3086905_3087379_+	toxin	NA	NA	NA	NA	NA
AUL52017.1|3087386_3088007_+	toxin	NA	NA	NA	NA	NA
AUL52018.1|3089250_3089625_-	4-oxalocrotonate tautomerase	NA	NA	NA	NA	NA
AUL52019.1|3089713_3090967_-	glycine/betaine ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	36.6	5.1e-28
AUL52020.1|3090963_3091821_-	ABC transporter permease	NA	NA	NA	NA	NA
AUL52021.1|3091960_3092956_-	glycine/betaine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUL52022.1|3093505_3094726_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
AUL52653.1|3094767_3096024_-	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AUL52023.1|3096264_3097410_+	Bcr/CflA family drug resistance efflux transporter	NA	NA	NA	NA	NA
AUL52024.1|3097716_3097953_+	50S ribosomal protein L28	NA	NA	NA	NA	NA
AUL52025.1|3098033_3098201_+	50S ribosomal protein L33	NA	NA	NA	NA	NA
AUL52026.1|3098357_3099446_+	hypothetical protein	NA	NA	NA	NA	NA
AUL52027.1|3099471_3100692_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.1	1.0e-182
AUL52028.1|3102910_3103342_+	DNA-binding protein	NA	NA	NA	NA	NA
AUL52029.1|3103468_3103981_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
AUL52654.1|3104013_3105174_+	MFS transporter	NA	NA	NA	NA	NA
AUL52030.1|3105245_3107903_+|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	38.7	7.5e-170
AUL52031.1|3107914_3108592_+	hypothetical protein	NA	NA	NA	NA	NA
AUL52032.1|3108591_3109641_+	DNA polymerase III subunit delta	NA	NA	NA	NA	NA
AUL52033.1|3109664_3110924_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	46.2	1.9e-94
AUL52034.1|3110930_3111320_+	hypothetical protein	NA	NA	NA	NA	NA
AUL52035.1|3111471_3111756_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AUL52036.1|3111752_3112142_+	hypothetical protein	NA	NA	NA	NA	NA
AUL52655.1|3112154_3113318_-	secretion protein	NA	NA	NA	NA	NA
AUL52037.1|3113344_3115105_-|protease	protease/lipase ABC transporter ATP-binding protein	protease	F2Y2R6	Organic_Lake_phycodnavirus	28.5	3.5e-14
AUL52038.1|3115101_3116403_-	hypothetical protein	NA	NA	NA	NA	NA
AUL52039.1|3116640_3116901_+|transposase	transposase	transposase	NA	NA	NA	NA
AUL52040.1|3116939_3117761_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	44.0	1.9e-55
>prophage 21
CP018899	Bordetella holmesii isolate F615 chromosome, complete genome	3687853	3340407	3407116	3687853	tRNA,transposase	Synechococcus_phage(12.5%)	60	NA	NA
AUL52218.1|3340407_3341319_+|tRNA	glycine--tRNA ligase subunit alpha	tRNA	NA	NA	NA	NA
AUL52219.1|3341320_3343456_+|tRNA	glycine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
AUL52220.1|3343452_3343992_+	D-glycero-beta-D-manno-heptose-1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
AUL52221.1|3343995_3344724_+	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
AUL52222.1|3344710_3345544_+	hypothetical protein	NA	NA	NA	NA	NA
AUL52223.1|3345548_3346475_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUL52669.1|3346553_3347969_+	FAD-binding dehydrogenase	NA	NA	NA	NA	NA
AUL52224.1|3347955_3349038_+	tricarballylate utilization protein B	NA	NA	NA	NA	NA
AUL52225.1|3349151_3349547_+	lactoylglutathione lyase	NA	NA	NA	NA	NA
AUL52226.1|3349552_3350086_+	peptide deformylase	NA	E3SLL2	Synechococcus_phage	35.6	7.5e-13
AUL52227.1|3352476_3353706_+	hypothetical protein	NA	NA	NA	NA	NA
AUL52228.1|3353706_3355149_-	pyruvate kinase	NA	NA	NA	NA	NA
AUL52229.1|3355244_3356387_+	glycerate kinase	NA	W6LM47	Streptococcus_phage	38.0	3.2e-37
AUL52230.1|3356405_3356885_+	thioesterase	NA	NA	NA	NA	NA
AUL52231.1|3356913_3357702_-	16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))- dimethyltransferase	NA	NA	NA	NA	NA
AUL52232.1|3357715_3359254_-	molecular chaperone SurA	NA	NA	NA	NA	NA
AUL52670.1|3359250_3361659_-	LPS biosynthesis protein	NA	NA	NA	NA	NA
AUL52233.1|3361812_3362880_+	aminoglycoside phosphotransferase	NA	NA	NA	NA	NA
AUL52234.1|3362879_3363560_+	mannose-1-phosphate guanylyltransferase	NA	NA	NA	NA	NA
AUL52235.1|3363701_3364427_+	hypothetical protein	NA	NA	NA	NA	NA
AUL52236.1|3364435_3364759_-	4a-hydroxytetrahydrobiopterin dehydratase	NA	NA	NA	NA	NA
AUL52237.1|3364812_3365460_-	hypothetical protein	NA	NA	NA	NA	NA
AUL52238.1|3365595_3366009_+	hypothetical protein	NA	NA	NA	NA	NA
AUL52239.1|3366094_3367144_+	NADP(H)-dependent aldo-keto reductase	NA	NA	NA	NA	NA
AUL52240.1|3367289_3368153_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
AUL52241.1|3368278_3368986_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUL52242.1|3368953_3369775_-|transposase	transposase	transposase	S5WIU1	Leptospira_phage	44.0	1.9e-55
AUL52243.1|3369813_3370074_-|transposase	transposase	transposase	NA	NA	NA	NA
AUL52244.1|3370131_3371640_-	sulfite reductase	NA	NA	NA	NA	NA
AUL52245.1|3371796_3373320_-	hypothetical protein	NA	NA	NA	NA	NA
AUL52246.1|3373374_3374022_-	carbonate dehydratase	NA	NA	NA	NA	NA
AUL52247.1|3374164_3374506_-	hypothetical protein	NA	NA	NA	NA	NA
AUL52248.1|3374663_3374996_+	PsiF repeat family protein	NA	NA	NA	NA	NA
AUL52249.1|3375044_3376085_-	cyclase	NA	NA	NA	NA	NA
AUL52250.1|3376088_3376868_-	3-oxoadipate enol-lactonase	NA	NA	NA	NA	NA
AUL52251.1|3376903_3377200_-	hypothetical protein	NA	NA	NA	NA	NA
AUL52252.1|3377214_3377490_-	muconolactone delta-isomerase	NA	NA	NA	NA	NA
AUL52253.1|3377557_3378202_-	3-oxoadipate CoA-transferase	NA	NA	NA	NA	NA
AUL52254.1|3378204_3378294_-	3-oxoadipate CoA-transferase	NA	NA	NA	NA	NA
AUL52255.1|3378484_3379270_+	IclR family transcriptional regulator	NA	NA	NA	NA	NA
AUL52256.1|3379307_3380033_-	short-chain dehydrogenase	NA	NA	NA	NA	NA
AUL52257.1|3380046_3381387_-	short-chain fatty acid transporter	NA	NA	NA	NA	NA
AUL52258.1|3381481_3382414_-	3-hydroxybutyryl-CoA dehydrogenase	NA	NA	NA	NA	NA
AUL52259.1|3382642_3385414_-	peptidase S8	NA	NA	NA	NA	NA
AUL52260.1|3385853_3388700_-	phosphoenolpyruvate carboxylase	NA	NA	NA	NA	NA
AUL52261.1|3388846_3389560_+	7-cyano-7-deazaguanine synthase QueC	NA	A0A0A0RPC6	Escherichia_phage	41.4	1.6e-47
AUL52262.1|3389572_3390115_-	GNAT family N-acetyltransferase	NA	A0A2H4J136	uncultured_Caudovirales_phage	46.4	1.7e-28
AUL52263.1|3390220_3391129_+	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	25.7	4.4e-05
AUL52264.1|3391220_3393077_+	dihydroxy-acid dehydratase	NA	NA	NA	NA	NA
AUL52265.1|3393260_3394301_-	GntR family transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	28.2	4.3e-20
AUL52266.1|3394443_3395349_+	dihydrodipicolinate synthase family protein	NA	NA	NA	NA	NA
AUL52267.1|3397036_3397987_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
AUL52268.1|3398043_3398811_-	trans-aconitate 2-methyltransferase	NA	NA	NA	NA	NA
AUL52269.1|3398928_3399573_+	hypothetical protein	NA	NA	NA	NA	NA
AUL52270.1|3399836_3400133_+	polysaccharide deacetylase	NA	NA	NA	NA	NA
AUL52271.1|3401562_3401757_-	hypothetical protein	NA	NA	NA	NA	NA
AUL52272.1|3402033_3402888_+	hypothetical protein	NA	NA	NA	NA	NA
AUL52273.1|3402913_3404134_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
AUL52671.1|3404451_3406383_+	hypothetical protein	NA	NA	NA	NA	NA
AUL52274.1|3406855_3407116_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 22
CP018899	Bordetella holmesii isolate F615 chromosome, complete genome	3687853	3600860	3651024	3687853	tRNA,transposase,holin	Catovirus(18.18%)	40	NA	NA
AUL52445.1|3600860_3602651_-|tRNA	aspartate--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	24.5	5.5e-07
AUL52446.1|3602692_3603328_-	hypothetical protein	NA	A0A2I7S9X1	Vibrio_phage	29.0	1.2e-12
AUL52447.1|3603330_3603645_-	FmdB family transcriptional regulator	NA	NA	NA	NA	NA
AUL52448.1|3605195_3606818_-|holin	choline dehydrogenase	holin	A0A1V0S9J5	Catovirus	29.6	5.4e-46
AUL52449.1|3606988_3607093_-	dihydrodipicolinate synthase	NA	NA	NA	NA	NA
AUL52450.1|3607085_3607796_-	dihydrodipicolinate synthase	NA	NA	NA	NA	NA
AUL52451.1|3608070_3608559_-	diguanylate cyclase	NA	NA	NA	NA	NA
AUL52452.1|3608700_3609900_+	2-aminoadipate aminotransferase	NA	NA	NA	NA	NA
AUL52453.1|3609975_3610899_+	4-hydroxybenzoate polyprenyltransferase	NA	NA	NA	NA	NA
AUL52454.1|3611233_3611614_+	hypothetical protein	NA	NA	NA	NA	NA
AUL52678.1|3611757_3612516_-	transcriptional regulator GlcC	NA	NA	NA	NA	NA
AUL52679.1|3612727_3614899_+	malate synthase G	NA	NA	NA	NA	NA
AUL52455.1|3614956_3616030_-	lipase	NA	G9BWD6	Planktothrix_phage	37.1	4.4e-28
AUL52456.1|3616022_3617792_-	spermidine/putrescine ABC transporter permease	NA	NA	NA	NA	NA
AUL52457.1|3617806_3618916_-	iron ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUL52458.1|3619031_3621521_-	signal protein	NA	NA	NA	NA	NA
AUL52459.1|3621507_3622179_-	DNA-binding response regulator	NA	NA	NA	NA	NA
AUL52460.1|3622702_3623749_+	oxidoreductase	NA	NA	NA	NA	NA
AUL52461.1|3623757_3624327_+	N-acetyltransferase	NA	NA	NA	NA	NA
AUL52462.1|3625424_3626507_+	UDP-N-acetylglucosamine 2-epimerase	NA	A0A0N9R0B2	Chrysochromulina_ericina_virus	32.9	2.3e-45
AUL52463.1|3626531_3627785_+	glycosyltransferase WbuB	NA	NA	NA	NA	NA
AUL52464.1|3627789_3628977_+	UDP-4-amino-4, 6-dideoxy-N-acetyl-beta-L-altrosamine transaminase	NA	NA	NA	NA	NA
AUL52465.1|3628973_3629567_+	sugar transferase	NA	NA	NA	NA	NA
AUL52466.1|3629953_3631891_+	polysaccharide biosynthesis protein	NA	A0A2P1ELS8	Moumouvirus	27.9	2.2e-25
AUL52467.1|3632024_3632975_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
AUL52468.1|3633056_3633764_-	hypothetical protein	NA	NA	NA	NA	NA
AUL52469.1|3633827_3636464_+	DNA topoisomerase III	NA	A0A0G2YA05	Acanthamoeba_polyphaga_mimivirus	26.3	8.0e-23
AUL52470.1|3636593_3637814_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.1	1.1e-181
AUL52471.1|3637892_3638948_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUL52472.1|3638947_3639718_+	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
AUL52473.1|3640285_3641086_+	gluconate 5-dehydrogenase	NA	NA	NA	NA	NA
AUL52474.1|3641174_3642602_+	aldehyde dehydrogenase	NA	NA	NA	NA	NA
AUL52475.1|3642621_3643380_+	3-oxoacyl-ACP reductase	NA	NA	NA	NA	NA
AUL52476.1|3645343_3645823_+	AsnC family transcriptional regulator	NA	NA	NA	NA	NA
AUL52477.1|3645810_3646737_-	bestrophin	NA	NA	NA	NA	NA
AUL52478.1|3646853_3647381_+	SET domain-containing protein-lysine N-methyltransferase	NA	NA	NA	NA	NA
AUL52479.1|3647406_3648627_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
AUL52680.1|3649022_3649691_+	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	40.7	2.3e-35
AUL52480.1|3649903_3650725_-|transposase	transposase	transposase	S5WIU1	Leptospira_phage	43.7	7.2e-55
AUL52481.1|3650763_3651024_-|transposase	transposase	transposase	NA	NA	NA	NA
