The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP024618	Escherichia coli strain SMN152SH1 chromosome, complete genome	5302502	0	8130	5302502		Escherichia_phage(41.67%)	13	NA	NA
AUL88035.1|0_552_+	hypothetical protein	NA	A0A291AWW8	Escherichia_phage	100.0	4.5e-101
AUL92906.1|698_878_+	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	94.9	5.0e-30
AUL88036.1|840_1386_+	immunity protein	NA	Q8SBF3	Shigella_phage	98.9	4.0e-94
AUL92907.1|1390_1615_+	hypothetical protein	NA	A0A291AX25	Escherichia_phage	94.6	8.5e-35
AUL88037.1|1611_2418_+	helix-turn-helix domain-containing protein	NA	A5LH71	Enterobacteria_phage	88.1	7.9e-123
AUL88038.1|2512_3166_+	phage N-6-adenine-methyltransferase	NA	Q8SBE9	Shigella_phage	99.5	3.3e-127
AUL88039.1|3162_3558_+	RusA family crossover junction endodeoxyribonuclease	NA	A5LH74	Enterobacteria_phage	96.0	9.1e-64
AUL88040.1|3720_4536_+	DNA-binding protein	NA	U5P4K5	Shigella_phage	99.6	2.9e-149
AUL88041.1|4543_5533_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	99.4	4.7e-194
AUL88042.1|5550_5916_+	antitermination protein	NA	Q777W5	Enterobacteria_phage	81.8	7.9e-54
AUL88043.1|6000_6447_-	hypothetical protein	NA	NA	NA	NA	NA
AUL88044.1|6717_6921_+	hypothetical protein	NA	A0A291AWX6	Escherichia_phage	98.5	1.8e-31
AUL88045.1|7071_8130_+	site-specific DNA-methyltransferase	NA	A0A0N7KZF8	Stx2-converting_phage	86.7	4.9e-181
>prophage 2
CP024618	Escherichia coli strain SMN152SH1 chromosome, complete genome	5302502	11852	43627	5302502	lysis,transposase,tail,integrase,terminase,holin	Stx2-converting_phage(55.56%)	28	24561:24620	43583:44348
AUL88047.1|11852_12068_+|holin	holin	holin	Q6H9V8	Enterobacteria_phage	98.6	7.7e-33
AUL88048.1|12072_12417_+	DUF1327 domain-containing protein	NA	A0A0P0ZD64	Stx2-converting_phage	100.0	1.0e-58
AUL88049.1|12467_13001_+	lysozyme	NA	A0A0N7KZF9	Stx2-converting_phage	98.3	2.8e-100
AUL88050.1|13296_13764_+|lysis	lysis protein	lysis	Q7AYI6	Enterobacteria_phage	96.1	1.8e-74
AUL88051.1|14126_14354_-	DUF3950 domain-containing protein	NA	A0A0P0ZCA1	Stx2-converting_phage	100.0	3.9e-35
AUL88052.1|14395_14761_+	HNH endonuclease	NA	A0A0P0ZCH0	Stx2-converting_phage	100.0	2.0e-65
AUL88053.1|15048_15612_+|terminase	terminase small subunit	terminase	A0A0P0ZDD1	Stx2-converting_phage	100.0	4.7e-90
AUL88054.1|15608_15872_+	hypothetical protein	NA	A0A0N7KZG0	Stx2-converting_phage	100.0	3.7e-45
AUL92908.1|16841_19352_+|tail	phage tail protein	tail	A0A0P0ZCI5	Stx2-converting_phage	95.7	0.0e+00
AUL88055.1|19418_20018_+	Ail/Lom family protein	NA	A0A0P0ZCF6	Stx2-converting_phage	99.5	2.0e-110
AUL88056.1|21395_21665_+|tail	phage tail protein	tail	Q6H9S8	Enterobacteria_phage	98.9	1.9e-44
AUL92909.1|23351_23681_+	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	61.5	1.7e-31
AUL88057.1|23858_24575_-	DUF4765 domain-containing protein	NA	A0A0N7KZG3	Stx2-converting_phage	100.0	6.6e-129
24561:24620	attL	GGTAGTGCATCCAATTAGTAGAACATGTGTTTTTCGATAAACGCTCCGATCACTTTTTCG	NA	NA	NA	NA
AUL88058.1|24574_25269_-|transposase	IS1 family transposase	transposase	NA	NA	NA	NA
AUL88059.1|25304_28019_-	DUF4765 domain-containing protein	NA	A0A0N7KZG3	Stx2-converting_phage	100.0	0.0e+00
AUL88060.1|30363_31347_-	quinone oxidoreductase	NA	NA	NA	NA	NA
AUL88061.1|31429_32845_+	replicative DNA helicase	NA	O80281	Escherichia_phage	78.3	4.8e-200
AUL88062.1|32897_33977_+	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	27.9	4.0e-29
AUL88063.1|34229_35423_+	aromatic amino acid transaminase	NA	NA	NA	NA	NA
AUL88064.1|36548_37262_+	acid phosphatase AphA	NA	NA	NA	NA	NA
AUL88065.1|37372_37789_+	thiamine phosphate synthase	NA	NA	NA	NA	NA
AUL88066.1|37792_38149_+	hypothetical protein	NA	NA	NA	NA	NA
AUL88067.1|38183_41006_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	56.1	0.0e+00
AUL88068.1|40956_41139_+	hypothetical protein	NA	NA	NA	NA	NA
AUL88069.1|41260_41797_+	ssDNA-binding protein	NA	A0A0A0P1Q9	Enterobacteria_phage	78.7	1.1e-56
AUL88070.1|41895_42177_-	hypothetical protein	NA	NA	NA	NA	NA
AUL88071.1|42135_42282_+|integrase	integrase	integrase	NA	NA	NA	NA
AUL88072.1|42933_43627_+|transposase	IS1 family transposase	transposase	NA	NA	NA	NA
43583:44348	attR	CGAAAAAGTGATCGGAGCGTTTATCGAAAAACACATGTTCTACTAATTGGATGCACTACCCTATCTTTATATTAATGAATTGATCTATGCCCGTGATAACCATTTTTTATGCTCATCGCTGATAGCGCCTGTAAACGGCTATACGATTGCACCGGCCGATTATAAGCGTGAACCTAACGTTTCTATCTATTATTACCGCGATACGCCTTTTTTCTCTGGCTATAAAATGACCTATATGAAGCGGGGAAATTATGTGGCGGTTATCAACCCTCTCTTCTGGAGTGAAGTGATGTCTGATGACCCGACATTGCAATGGGGTGTGTATGATACGGTGACGAAAACCTTTTTCTCGTTAAGCAAAGAGGCCTCGGCAGCAACGTTTTCTCCGCTGATTCATTTGAAGGATTTAACCGTACAAAGAAATGGCTATTTATATGCGACAGTTTATTCGACAAAACGCCCAATTGCAGCCATTGTTGCGACTTCATATCAACGTCTTATAACCCATTTTTATAATCATCTTATTTTTGCGTTGCCCGCCGGTATTTTGGGGAGTCTTGTTCTGCTATTACTCTGGCTACGTATTCGACAAAACTATTTATCTCCCAAACGTAAATTGCAACGCGCCCTCGAAAAACATCAACTTTGTCTTTATTACCAGCCAATAATCGATATCAAAACAGAAAAATGTATCGGCGCTGAAGCGTTGTTACGTTGGCTTGGTGAGCAGGGGCAAATAATGAATCCGGCAGAGTTTATTCCGCTG	NA	NA	NA	NA
>prophage 3
CP024618	Escherichia coli strain SMN152SH1 chromosome, complete genome	5302502	274409	381784	5302502	transposase,integrase,tail,tRNA,protease	Stx2-converting_phage(26.32%)	98	309030:309089	381783:382549
AUL88287.1|274409_275762_+|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
AUL88288.1|275816_276203_+	cytochrome b562	NA	NA	NA	NA	NA
AUL88289.1|276247_276712_-	anaerobic ribonucleoside-triphosphate reductase activating protein	NA	K4F9T1	Cronobacter_phage	57.7	3.8e-53
AUL88290.1|276870_279009_-	anaerobic ribonucleoside triphosphate reductase	NA	A0A2I7QNQ7	Vibrio_phage	64.5	1.5e-266
AUL88291.1|279402_281058_-	alpha,alpha-phosphotrehalase	NA	NA	NA	NA	NA
AUL88292.1|281107_282529_-	PTS trehalose transporter subunit IIBC	NA	NA	NA	NA	NA
AUL88293.1|282647_283595_-	HTH-type transcriptional regulator TreR	NA	C6ZCU4	Enterobacteria_phage	21.8	7.9e-13
AUL88294.1|283973_286670_+	magnesium-translocating P-type ATPase	NA	M1HLC0	Paramecium_bursaria_Chlorella_virus	27.4	9.0e-46
AUL88295.1|286875_287262_-	reactive intermediate/imine deaminase	NA	NA	NA	NA	NA
AUL88296.1|287334_287796_-	aspartate carbamoyltransferase regulatory subunit	NA	NA	NA	NA	NA
AUL88297.1|287808_288744_-	aspartate carbamoyltransferase catalytic subunit	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	40.2	2.9e-52
AUL88298.1|288747_288882_-	pyrBI operon leader peptide	NA	NA	NA	NA	NA
AUL88299.1|289011_289194_+	hypothetical protein	NA	NA	NA	NA	NA
AUL88300.1|289162_289558_-	hypothetical protein	NA	NA	NA	NA	NA
AUL88301.1|289688_290402_-	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
AUL88302.1|290472_291066_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
AUL88303.1|291785_293414_+	DNA-binding protein	NA	NA	NA	NA	NA
AUL88304.1|293486_294491_-	ornithine carbamoyltransferase	NA	NA	NA	NA	NA
AUL88305.1|294652_295069_+	regulator of ribonuclease activity B	NA	NA	NA	NA	NA
AUL88306.1|295114_295618_-	N-acetyltransferase	NA	NA	NA	NA	NA
AUL88307.1|295810_297007_+	DUF898 domain-containing protein	NA	NA	NA	NA	NA
AUL88308.1|297062_299918_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	36.7	7.9e-141
AUL92917.1|299917_300361_-	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
AUL88309.1|300494_302006_-	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	38.0	1.0e-46
AUL88310.1|302272_303373_+	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
AUL88311.1|303372_304455_+	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
AUL88312.1|306248_307268_-	NAD(P)-dependent alcohol dehydrogenase	NA	A0A0G2Y405	Acanthamoeba_polyphaga_mimivirus	30.1	2.4e-44
AUL88313.1|307734_308997_+|integrase	integrase	integrase	Q7M297	Enterobacteria_phage	38.2	1.7e-79
309030:309089	attL	TGGTGATGCCTCTAATTAGTTGAATCTGATGTATAATACGGGCTTTTGAGGTTATCTCAT	NA	NA	NA	NA
AUL88314.1|309087_309781_+|transposase	IS1 family transposase	transposase	NA	NA	NA	NA
AUL88315.1|311144_315134_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	Q9LA58	Enterobacterial_phage	45.1	5.2e-308
AUL88316.1|315747_316442_-|transposase	IS1 family transposase	transposase	NA	NA	NA	NA
AUL88317.1|316535_316898_+	hypothetical protein	NA	Q8SBF8	Shigella_phage	100.0	8.6e-61
AUL88318.1|316963_317788_+	DUF2303 domain-containing protein	NA	A0A0P0ZBZ4	Stx2-converting_phage	100.0	2.7e-150
AUL88319.1|317915_318452_+	HD family hydrolase	NA	A0A0P0ZCH9	Stx2-converting_phage	100.0	9.7e-101
AUL88320.1|318442_318793_+	Eae protein	NA	A0A0P0ZBF8	Stx2-converting_phage	100.0	7.0e-60
AUL88321.1|319920_320055_+	hypothetical protein	NA	A0A0P0ZDP5	Stx2-converting_phage	100.0	4.9e-22
AUL88322.1|320073_320328_+	excisionase	NA	Q859D3	Escherichia_coli_phage	100.0	3.0e-44
AUL88323.1|320361_321648_+|integrase	site-specific integrase	integrase	A0A0N7KZF5	Stx2-converting_phage	100.0	5.8e-253
AUL88324.1|321792_322878_+	hypothetical protein	NA	A0A0C4UQU9	Shigella_phage	53.2	1.1e-98
AUL88325.1|322868_323429_+	DUF2313 domain-containing protein	NA	C9DGQ7	Escherichia_phage	49.1	3.9e-44
AUL88326.1|323428_324340_+|tail	phage tail protein	tail	C9DGQ8	Escherichia_phage	39.5	6.4e-28
AUL92918.1|324374_324896_-|tail	phage tail protein	tail	A0A0U2QV64	Escherichia_phage	52.6	2.1e-47
AUL92919.1|324975_325179_-|tail	phage tail protein	tail	NA	NA	NA	NA
AUL88327.1|325201_325387_+	hypothetical protein	NA	NA	NA	NA	NA
AUL88328.1|328077_328275_+	envelope stress response protein PspG	NA	NA	NA	NA	NA
AUL88329.1|328358_329096_-	protein mom	NA	A0A0C4UQZ7	Shigella_phage	79.0	7.5e-104
AUL88330.1|329049_329250_-	Com family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
AUL88331.1|329859_330105_-	DUF826 domain-containing protein	NA	NA	NA	NA	NA
AUL88332.1|330245_330903_-|transposase	IS1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	99.1	8.2e-126
AUL88333.1|330942_331089_-	DUF1378 domain-containing protein	NA	A0A2R2Z345	Escherichia_phage	55.3	1.9e-06
AUL88334.1|331906_332095_-	hypothetical protein	NA	NA	NA	NA	NA
AUL88335.1|335808_336189_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
AUL88336.1|336287_336503_+	DinI family protein	NA	Q687E4	Enterobacteria_phage	98.6	1.9e-31
AUL88337.1|336874_337861_-	peptidase M85	NA	NA	NA	NA	NA
AUL88338.1|337889_338081_-	hypothetical protein	NA	NA	NA	NA	NA
AUL88339.1|338290_338560_-|tail	phage tail protein	tail	H6WZN0	Escherichia_phage	97.8	1.9e-44
AUL88340.1|338561_339875_-|tail	phage tail protein	tail	A0A0P0ZE15	Stx2-converting_phage	97.9	3.6e-80
AUL88341.1|339939_340539_-	Ail/Lom family protein	NA	A0A0P0ZCF6	Stx2-converting_phage	97.0	5.9e-107
AUL88342.1|340605_344085_-|tail	phage tail protein	tail	B6DZB5	Enterobacteria_phage	96.5	0.0e+00
AUL88343.1|344321_345002_-|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	91.1	1.6e-108
AUL88344.1|344899_345643_-|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	96.3	9.8e-144
AUL88345.1|346350_346692_-|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	97.3	4.7e-61
AUL88346.1|347600_348446_-	hypothetical protein	NA	A0A0P0ZCJ4	Stx2-converting_phage	99.2	1.1e-117
AUL88347.1|349964_350093_-|tail	phage tail protein	tail	H6WZM0	Escherichia_phage	100.0	2.5e-15
AUL88348.1|350169_350864_-|transposase	IS1 family transposase	transposase	NA	NA	NA	NA
AUL88349.1|350925_351576_+	molecular chaperone FimC	NA	NA	NA	NA	NA
AUL88350.1|351642_354279_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
AUL88351.1|354288_354819_+	protein FimF	NA	NA	NA	NA	NA
AUL88352.1|354831_355335_+	protein FimG	NA	NA	NA	NA	NA
AUL92920.1|355354_356257_+	fimbrial protein	NA	NA	NA	NA	NA
AUL88353.1|356429_357773_-	gluconate transporter	NA	NA	NA	NA	NA
AUL88354.1|357852_358161_+	hypothetical protein	NA	NA	NA	NA	NA
AUL88355.1|358112_359297_+	mannonate dehydratase	NA	NA	NA	NA	NA
AUL88356.1|359377_360838_+	fructuronate reductase	NA	H8ZJP8	Ostreococcus_tauri_virus	32.4	1.9e-50
AUL88357.1|360859_361054_-	hypothetical protein	NA	NA	NA	NA	NA
AUL88358.1|361052_361826_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AUL88359.1|361966_362794_-	DUF2686 domain-containing protein	NA	NA	NA	NA	NA
AUL88360.1|363357_363501_+	hypothetical protein	NA	NA	NA	NA	NA
AUL88361.1|363466_363859_+	anti-adapter protein IraD	NA	NA	NA	NA	NA
AUL88362.1|363851_364763_-	transcriptional regulator	NA	NA	NA	NA	NA
AUL88363.1|364827_366000_-	beta-aspartyl-peptidase	NA	NA	NA	NA	NA
AUL88364.1|366012_366474_-	hypothetical protein	NA	NA	NA	NA	NA
AUL88365.1|366470_367154_-	hypothetical protein	NA	NA	NA	NA	NA
AUL88366.1|367403_367958_+	RNA 2'-phosphotransferase	NA	A0A2R2ZGT8	Clostridioides_phage	45.6	2.0e-37
AUL88367.1|367970_369149_-	MFS transporter	NA	NA	NA	NA	NA
AUL88368.1|369216_370077_-	hypothetical protein	NA	NA	NA	NA	NA
AUL88369.1|370141_370399_-	DUF3343 domain-containing protein	NA	NA	NA	NA	NA
AUL88370.1|370395_371163_-	hypothetical protein	NA	NA	NA	NA	NA
AUL88371.1|371172_372324_-	hypothetical protein	NA	NA	NA	NA	NA
AUL88372.1|372439_373720_-	DUF445 domain-containing protein	NA	NA	NA	NA	NA
AUL88373.1|373760_374993_-	MFS transporter	NA	NA	NA	NA	NA
AUL88374.1|375250_375463_+	hypothetical protein	NA	NA	NA	NA	NA
AUL88375.1|375459_376404_+	hypothetical protein	NA	Q2A0A7	Sodalis_phage	51.7	5.9e-61
AUL88376.1|376646_378059_-	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
AUL88377.1|378235_378400_+	DUF1127 domain-containing protein	NA	NA	NA	NA	NA
AUL88378.1|378497_380591_+	hypothetical protein	NA	NA	NA	NA	NA
AUL88379.1|380637_380979_-	endoribonuclease SymE	NA	NA	NA	NA	NA
AUL88380.1|381089_381784_-|transposase	IS1 family transposase	transposase	NA	NA	NA	NA
381783:382549	attR	ATGAGATAACCTCAAAAGCCCGTATTATACATCAGATTCAACTAATTAGAGGCATCACCATCAGTAAATACAGGGAAAGTCCAGCTAAAAATAGAAAATAATAGAAACGTTACTGGAAAGATCTGGAAGAGAAATTAATGTTAATTCAGAATGGCCGGATAACAAAGTGTATCCGGCCTTCATAATTAATTTAAAGCACTCATATGATGTTCTTTAAAATTCTCTGCCTGTGCCAGCACACCCATATAAACATCATCATTCGCTACTGGCGGGAACTTATGCTTGTGTAGAAGAAGAATAAGTTCAACTTTCAGTTTCGCTTTAATATCATCGCGTTTACTCCAGTCAGGATATTTCGATGTGTTGTCAACCACGCTTTTCATCTCTTTTGCCAGTGACAGCATTTTTTCATCGTCATAGGTGAACTGATATTTATCGCGCATATGAGCAAGAATGTCGAAAAAGGCTTTTTCTTCAATATCAATACCTAAATCGGCCCAGGTGCCCATTTCGGTTTTAATATCATAGATAATATCGGTCATTTCCTGACTGAATGTATCGAATTCTTCACCGTTGAGTACATCATCTTCTCGCCGCTCATTATAACGATCTATAATCGCCTGGAAGCGGCGGGTGAAGTTAATCCCTTGCAACTGGTTCACTTTCTTGAAGTCGCTGATCGCTTTTTCCAGTAATTTTTGTAATAACTGGATCTTTGTTGCCGGAAGTTTGATCTTGTTAATTCGCGCCAGATAATCTTCGTCAAA	NA	NA	NA	NA
>prophage 4
CP024618	Escherichia coli strain SMN152SH1 chromosome, complete genome	5302502	405706	495242	5302502	lysis,transposase,head,integrase,tail,terminase,tRNA,capsid,holin	Escherichia_phage(39.68%)	98	405494:405509	439510:439525
405494:405509	attL	AAGGGATATCAGTTAA	NA	NA	NA	NA
AUL88398.1|405706_406401_-|transposase	IS1 family transposase	transposase	NA	NA	NA	NA
AUL88399.1|406561_407287_+	DNA-binding response regulator	NA	NA	NA	NA	NA
AUL88400.1|407244_407922_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
AUL88401.1|407958_408747_-	hydroxamate siderophore iron reductase FhuF	NA	NA	NA	NA	NA
AUL88402.1|408848_409124_+	DUF1435 domain-containing protein	NA	NA	NA	NA	NA
AUL88403.1|409684_410716_-	16S rRNA (guanine(1207)-N(2))-methyltransferase RsmC	NA	NA	NA	NA	NA
AUL88404.1|410818_411232_+	DNA polymerase III subunit psi	NA	NA	NA	NA	NA
AUL88405.1|411200_411647_+	ribosomal-protein-alanine N-acetyltransferase RimI	NA	NA	NA	NA	NA
AUL88406.1|411661_412339_+	noncanonical pyrimidine nucleotidase, YjjG family	NA	NA	NA	NA	NA
AUL88407.1|412724_413948_+|integrase	integrase	integrase	A0A291AWU1	Escherichia_phage	98.0	1.3e-233
AUL92923.1|414119_415025_-	hypothetical protein	NA	NA	NA	NA	NA
AUL88408.1|415898_416093_-	DNA-binding protein	NA	A5LH59	Enterobacteria_phage	98.4	5.8e-32
AUL92924.1|416092_416425_-	DUF551 domain-containing protein	NA	A5LH60	Enterobacteria_phage	100.0	1.5e-43
AUL88409.1|416927_417614_-	hypothetical protein	NA	H6WZG2	Escherichia_phage	87.1	3.7e-121
AUL88410.1|417610_417832_-	conjugal transfer protein TraR	NA	A0A1I9LJM6	Stx_converting_phage	100.0	2.9e-35
AUL88411.1|417930_418212_-	cell division protein ZapA	NA	Q6H9Z3	Enterobacteria_phage	100.0	3.2e-47
AUL88412.1|418222_418414_-	hypothetical protein	NA	A0A0P0ZC67	Stx2-converting_phage	100.0	7.3e-27
AUL88413.1|418391_418568_-	DUF1317 domain-containing protein	NA	A0A0P0ZAS9	Stx2-converting_phage	100.0	1.3e-22
AUL88414.1|418564_419245_-	exonuclease	NA	A0A0P0ZFI7	Escherichia_phage	98.2	1.9e-130
AUL88415.1|419241_420192_-	recombinase RecT	NA	A0A0P0ZFY9	Escherichia_phage	96.8	2.0e-173
AUL88416.1|420208_420490_-	hypothetical protein	NA	A0A0P0ZFG3	Escherichia_phage	100.0	1.1e-47
AUL88417.1|420510_420792_-	AbrB family transcriptional regulator	NA	A0A0P0ZGC3	Escherichia_phage	100.0	3.0e-45
AUL88418.1|420803_421016_-	cell division inhibitor protein	NA	A0A0P0ZGD1	Escherichia_phage	100.0	5.8e-33
AUL88419.1|421086_421986_-	hypothetical protein	NA	A0A0P0ZG86	Escherichia_phage	96.2	1.4e-139
AUL88420.1|422489_423443_-	restriction endonuclease	NA	A0A0P0ZG22	Escherichia_phage	100.0	7.0e-187
AUL88421.1|423439_424909_-	SAM-dependent methyltransferase	NA	A0A2L1IV91	Escherichia_phage	99.6	1.9e-284
AUL88422.1|425003_425717_-	LexA family transcriptional repressor	NA	A0A2R2X2B0	Escherichia_phage	100.0	6.3e-132
AUL88423.1|425812_426016_+	Cro/Cl family transcriptional regulator	NA	A0A2R2Z333	Escherichia_phage	98.5	9.8e-30
AUL88424.1|426186_426381_+	hypothetical protein	NA	NA	NA	NA	NA
AUL88425.1|426547_426925_+	hypothetical protein	NA	A0A2R2Z329	Escherichia_phage	98.4	7.6e-60
AUL88426.1|426918_428439_+	ATP-dependent helicase	NA	A0A2R2Z335	Escherichia_phage	99.8	8.3e-307
AUL88427.1|428428_429400_+	DNA primase	NA	A0A0H4IPK0	Shigella_phage	100.0	1.9e-195
AUL88428.1|429399_429849_+	DUF1367 domain-containing protein	NA	A0A0P0ZFW0	Escherichia_phage	100.0	7.6e-83
AUL88429.1|429856_430420_+	recombination protein NinG	NA	A0A0P0ZG59	Escherichia_phage	100.0	8.9e-105
AUL88430.1|430416_430611_+	protein ninH	NA	A0A0P0ZGE1	Escherichia_phage	98.4	1.4e-30
AUL88431.1|430603_431038_+	antitermination protein	NA	A0A0P0ZGJ3	Escherichia_phage	100.0	4.8e-82
AUL88432.1|431026_431272_-	hypothetical protein	NA	A0A0P0ZGS0	Escherichia_phage	100.0	5.0e-36
AUL88433.1|431286_431439_+	DNA methylase	NA	A0A2R2Z327	Escherichia_phage	100.0	4.0e-20
AUL88434.1|431827_432787_+	Shiga toxin Stx2 subunit A	NA	Q5TJL6	Enterobacteria_phage	99.7	9.6e-176
AUL88435.1|432798_433068_+	Shiga toxin Stx2 subunit B	NA	Q5TJL5	Enterobacteria_phage	100.0	2.1e-43
AUL88436.1|433364_433688_-	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	100.0	6.9e-62
AUL88437.1|433875_434570_-|transposase	IS1 family transposase	transposase	NA	NA	NA	NA
AUL88438.1|434705_436643_+	sialate O-acetylesterase	NA	A0A0P0ZBP4	Stx2-converting_phage	99.1	0.0e+00
AUL88439.1|436779_436959_+	DUF1378 domain-containing protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
AUL88440.1|436999_437272_+	DUF826 domain-containing protein	NA	A0A0P0ZBB8	Stx2-converting_phage	100.0	2.2e-21
AUL88441.1|437348_437564_+|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	100.0	2.0e-33
AUL88442.1|437563_438061_+	lysozyme	NA	A0A0N7KZA0	Stx2-converting_phage	97.0	2.4e-90
AUL88443.1|438057_438495_+|lysis	lysis protein	lysis	A0A0P0ZBQ9	Stx2-converting_phage	96.6	4.2e-70
AUL88444.1|438697_439195_+	DNA-binding protein	NA	A0A0P0ZBU2	Stx2-converting_phage	100.0	3.6e-94
AUL88445.1|439191_439449_+	hypothetical protein	NA	A0A0P0ZBT1	Stx2-converting_phage	100.0	5.0e-39
AUL88446.1|439525_439660_-	hypothetical protein	NA	NA	NA	NA	NA
439510:439525	attR	TTAACTGATATCCCTT	NA	NA	NA	NA
AUL88447.1|439911_440139_-	DUF3950 domain-containing protein	NA	A0A0P0ZE23	Stx2-converting_phage	100.0	1.7e-35
AUL88448.1|440180_440546_+	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	99.2	4.0e-66
AUL92925.1|440514_440652_+	DNase	NA	H6WZK7	Escherichia_phage	75.0	8.6e-06
AUL88449.1|440835_441399_+|terminase	terminase small subunit	terminase	A0A0P0ZDD1	Stx2-converting_phage	100.0	4.7e-90
AUL88450.1|443119_445057_+|capsid	phage major capsid protein	capsid	A0A0P0ZCT9	Stx2-converting_phage	99.5	0.0e+00
AUL92926.1|445101_445323_+	hypothetical protein	NA	A0A0P0ZD92	Stx2-converting_phage	100.0	5.8e-36
AUL88451.1|448184_448535_+|head,tail	head-tail adaptor protein	head,tail	A0A0P0ZB28	Stx2-converting_phage	99.1	1.0e-58
AUL88452.1|448531_448978_+	hypothetical protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
AUL88453.1|448974_449319_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
AUL88454.1|450512_450794_+	DUF4035 domain-containing protein	NA	H6WZM0	Escherichia_phage	98.9	2.3e-45
AUL88455.1|454073_454415_+|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	97.3	4.7e-61
AUL88456.1|454414_455113_+|tail	phage minor tail protein L	tail	H6WZM3	Escherichia_phage	97.8	2.0e-130
AUL88457.1|456667_457507_+|tail	phage tail protein	tail	A0A0P0ZBW1	Stx2-converting_phage	97.8	5.0e-152
AUL88458.1|457630_460144_+|tail	phage tail protein	tail	B6DZB5	Enterobacteria_phage	95.8	0.0e+00
AUL88459.1|460210_460810_+	Ail/Lom family protein	NA	A0A0P0ZCF6	Stx2-converting_phage	97.0	5.9e-107
AUL88460.1|462188_462458_+|tail	phage tail protein	tail	H6WZN0	Escherichia_phage	100.0	3.8e-45
AUL88461.1|462826_463075_-	damage-inducible protein DinI	NA	A5LH55	Enterobacteria_phage	100.0	1.1e-38
AUL88462.1|463294_464881_+	peptide chain release factor 3	NA	D0R0F5	Streptococcus_phage	24.9	5.3e-30
AUL88463.1|465273_465879_+	molecular chaperone OsmY	NA	NA	NA	NA	NA
AUL88464.1|465987_466167_+	DUF1328 domain-containing protein	NA	A0A0N7CBR2	Salmonella_phage	64.2	2.0e-10
AUL88465.1|466288_467362_+	patatin family protein	NA	NA	NA	NA	NA
AUL88466.1|467358_468141_+	metal-dependent hydrolase	NA	NA	NA	NA	NA
AUL88467.1|469088_470639_-	YjjI family glycine radical enzyme	NA	NA	NA	NA	NA
AUL88468.1|470897_471677_+	deoxyribose-phosphate aldolase	NA	NA	NA	NA	NA
AUL88469.1|471843_473166_+	thymidine phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	39.8	6.8e-79
AUL88470.1|473217_474441_+	phosphopentomutase	NA	NA	NA	NA	NA
AUL88471.1|474497_475217_+	purine-nucleoside phosphorylase	NA	NA	NA	NA	NA
AUL88472.1|475383_476715_+	type II toxin-antitoxin system HipA family toxin	NA	NA	NA	NA	NA
AUL88473.1|476715_477732_-	lipoate-protein ligase LplA	NA	NA	NA	NA	NA
AUL88474.1|477759_478404_-	hypothetical protein	NA	NA	NA	NA	NA
AUL88475.1|478509_479478_+	phosphoserine phosphatase	NA	NA	NA	NA	NA
AUL88476.1|479526_480909_+	DNA repair protein RadA	NA	NA	NA	NA	NA
AUL88477.1|480929_482162_+	trifunctional nicotinamide-nucleotide adenylyltransferase/ribosylnicotinamide kinase/transcriptional regulator NadR	NA	A0A0C5K935	Enterococcus_phage	42.6	2.1e-82
AUL88478.1|482468_484136_-	energy-dependent translational throttle protein EttA	NA	A0A1V0SKJ1	Klosneuvirus	26.4	3.7e-42
AUL92927.1|484109_484238_+	methionine aminopeptidase	NA	NA	NA	NA	NA
AUL88479.1|484346_486284_+	murein transglycosylase	NA	A0A1P8CWQ1	Bacillus_phage	35.7	2.3e-11
AUL88480.1|486373_486700_+	Trp operon repressor	NA	NA	NA	NA	NA
AUL92928.1|486846_487359_-	non-canonical purine NTP phosphatase	NA	NA	NA	NA	NA
AUL88481.1|487410_488058_+	phosphoglycerate mutase	NA	NA	NA	NA	NA
AUL88482.1|488054_488924_-	right origin-binding protein	NA	NA	NA	NA	NA
AUL88483.1|489134_489608_+	protein CreA	NA	NA	NA	NA	NA
AUL88484.1|489620_490310_+	two-component system response regulator CreB	NA	W8CYM9	Bacillus_phage	35.3	8.8e-30
AUL88485.1|490309_491734_+	two-component system sensor histidine kinase CreC	NA	Q8QKV7	Ectocarpus_siliculosus_virus	20.4	3.6e-09
AUL88486.1|491791_493144_+	cell envelope integrity protein CreD	NA	NA	NA	NA	NA
AUL88487.1|493203_493920_-	DNA-binding response regulator	NA	NA	NA	NA	NA
AUL88488.1|494015_494156_+	hypothetical protein	NA	NA	NA	NA	NA
AUL88489.1|494555_495242_+|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
>prophage 5
CP024618	Escherichia coli strain SMN152SH1 chromosome, complete genome	5302502	676218	753424	5302502	plate,tRNA,protease,transposase	uncultured_Mediterranean_phage(12.5%)	59	NA	NA
AUL88641.1|676218_677643_+|protease	periplasmic serine endoprotease DegP	protease	A0A1B1IT49	uncultured_Mediterranean_phage	28.8	1.9e-26
AUL88642.1|677797_678955_+	carbohydrate diacid regulon transcriptional regulator CdaR	NA	NA	NA	NA	NA
AUL88643.1|679043_679430_-	hypothetical protein	NA	NA	NA	NA	NA
AUL88644.1|679744_680569_-	2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase	NA	NA	NA	NA	NA
AUL88645.1|680599_683272_-	bifunctional uridylyltransferase/uridylyl-removing protein GlnD	NA	NA	NA	NA	NA
AUL88646.1|683333_684128_-	methionine aminopeptidase	NA	NA	NA	NA	NA
AUL88647.1|684495_685221_+	30S ribosomal protein S2	NA	NA	NA	NA	NA
AUL88648.1|685172_685460_-	hypothetical protein	NA	NA	NA	NA	NA
AUL88649.1|685478_686330_+	elongation factor Ts	NA	NA	NA	NA	NA
AUL88650.1|686476_687202_+	UMP kinase	NA	NA	NA	NA	NA
AUL88651.1|687493_688051_+	ribosome-recycling factor	NA	NA	NA	NA	NA
AUL88652.1|688142_689339_+	1-deoxy-D-xylulose-5-phosphate reductoisomerase	NA	NA	NA	NA	NA
AUL88653.1|689527_690286_+	(2E,6E)-farnesyl-diphosphate-specific ditrans,polycis-undecaprenyl-diphosphate synthase	NA	R9W0U9	Flavobacterium_phage	44.4	7.7e-27
AUL88654.1|690298_691156_+	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
AUL88655.1|691167_692520_+|protease	zinc metalloprotease RseP	protease	NA	NA	NA	NA
AUL88656.1|692549_694982_+	outer membrane protein assembly factor BamA	NA	NA	NA	NA	NA
AUL88657.1|695103_695589_+	chaperone protein Skp	NA	NA	NA	NA	NA
AUL88658.1|695592_696618_+	UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase	NA	NA	NA	NA	NA
AUL88659.1|696722_697178_+	beta-hydroxyacyl-ACP dehydratase	NA	NA	NA	NA	NA
AUL88660.1|697181_697970_+	acyl-[acyl-carrier-protein]--UDP-N- acetylglucosamine O-acyltransferase	NA	NA	NA	NA	NA
AUL88661.1|697969_699118_+	lipid-A-disaccharide synthase	NA	NA	NA	NA	NA
AUL88662.1|699114_699711_+	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	40.0	3.9e-26
AUL88663.1|699747_703230_+	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	36.9	1.1e-208
AUL88664.1|703242_704202_+	acetyl-CoA carboxylase carboxyl transferase subunit alpha	NA	NA	NA	NA	NA
AUL88665.1|704300_706442_+	lysine decarboxylase	NA	NA	NA	NA	NA
AUL88666.1|706498_706888_+	VOC family protein	NA	NA	NA	NA	NA
AUL88667.1|706952_708251_+|tRNA	tRNA(Ile)-lysidine synthetase	tRNA	NA	NA	NA	NA
AUL92936.1|708299_708554_-	protein rof	NA	NA	NA	NA	NA
AUL88668.1|708546_708747_-	hypothetical protein	NA	NA	NA	NA	NA
AUL88669.1|709174_709597_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
AUL88670.1|709610_710321_+	copper homeostasis/adhesion lipoprotein NlpE	NA	NA	NA	NA	NA
AUL88671.1|711351_713070_-|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
AUL88672.1|713180_713888_-|tRNA	tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO	tRNA	NA	NA	NA	NA
AUL88673.1|713884_714289_-	Rcs stress response system protein RcsF	NA	NA	NA	NA	NA
AUL88674.1|714406_715222_-	methionine ABC transporter substrate-binding protein MetQ	NA	NA	NA	NA	NA
AUL88675.1|715261_715915_-	methionine ABC transporter	NA	NA	NA	NA	NA
AUL88676.1|715907_716939_-	D-methionine ABC transporter, ATP-binding protein	NA	G9BWD6	Planktothrix_phage	40.2	1.2e-35
AUL88677.1|717126_717702_+	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
AUL88678.1|723578_724272_+|transposase	IS1 family transposase	transposase	NA	NA	NA	NA
AUL88679.1|724530_725331_+	EEP domain-containing protein	NA	NA	NA	NA	NA
AUL88680.1|725334_725958_+	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AUL88681.1|726006_727365_-	murein transglycosylase D	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	36.0	1.3e-08
AUL88682.1|727436_728192_-	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
AUL88683.1|728225_728948_+	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AUL88684.1|728944_729412_-	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.7	1.0e-50
AUL92937.1|729476_730208_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	39.0	3.4e-40
AUL88685.1|730746_731532_+	hypothetical protein	NA	NA	NA	NA	NA
AUL88686.1|731668_732148_-	hypothetical protein	NA	NA	NA	NA	NA
AUL88687.1|732157_733072_-	hypothetical protein	NA	NA	NA	NA	NA
AUL88688.1|733115_733598_-	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
AUL88689.1|734984_738449_-	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
AUL88690.1|738527_740006_-	type VI secretion system protein TssA	NA	NA	NA	NA	NA
AUL88691.1|739944_740688_-	type VI secretion system-associated protein TagO	NA	NA	NA	NA	NA
AUL88692.1|745023_746874_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
AUL88693.1|746877_747291_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
AUL88694.1|747297_748773_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
AUL88695.1|748823_749048_-	hypothetical protein	NA	NA	NA	NA	NA
AUL88696.1|749082_749583_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
AUL88697.1|752729_753424_-|transposase	IS1 family transposase	transposase	NA	NA	NA	NA
>prophage 6
CP024618	Escherichia coli strain SMN152SH1 chromosome, complete genome	5302502	1231764	1243480	5302502	integrase,holin,tail,transposase	Enterobacteria_phage(43.75%)	17	1231677:1231691	1245230:1245244
1231677:1231691	attL	GCTTTTTTATACTAA	NA	NA	NA	NA
AUL89123.1|1231764_1232835_-|integrase	integrase	integrase	Q9MCR4	Enterobacteria_phage	100.0	5.1e-202
AUL89124.1|1233119_1233431_-	hypothetical protein	NA	A0A1I9LJL8	Stx_converting_phage	100.0	2.1e-55
AUL89125.1|1233655_1234354_-	DUF1311 domain-containing protein	NA	J9Q6K3	Salmonella_phage	81.9	1.5e-101
AUL89126.1|1234484_1235093_-	eae-like domain protein	NA	Q9MCR3	Enterobacteria_phage	96.4	5.0e-21
AUL89127.1|1235236_1235605_+	hypothetical protein	NA	Q716C1	Shigella_phage	97.7	2.5e-39
AUL89128.1|1236059_1237273_-|transposase	IS3 family transposase	transposase	Q6H9S6	Enterobacteria_phage	99.0	8.4e-169
AUL89129.1|1237278_1237536_-	conjugal transfer protein TraR	NA	A0A1I9LJM6	Stx_converting_phage	97.1	2.0e-32
AUL89130.1|1237634_1237916_-	cell division protein ZapA	NA	A0A0P0ZE02	Stx2-converting_phage	98.9	5.5e-47
AUL89131.1|1237926_1238484_-	phage N-6-adenine-methyltransferase	NA	E5AGF8	Erwinia_phage	62.3	2.0e-61
AUL89132.1|1238476_1238638_-	DUF1317 domain-containing protein	NA	A0A0N7CHV0	Escherichia_phage	96.0	7.7e-22
AUL89133.1|1238634_1239315_-	exonuclease	NA	B6DZ61	Enterobacteria_phage	97.3	5.6e-130
AUL89134.1|1239311_1239494_-	recombinase	NA	A0A1I9LJN0	Stx_converting_phage	98.3	7.2e-24
AUL89135.1|1239646_1240312_+	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	98.6	7.2e-130
AUL89136.1|1240308_1240932_+	antitermination protein	NA	K7PM87	Enterobacteria_phage	98.1	2.2e-112
AUL89137.1|1241211_1241928_+	hypothetical protein	NA	NA	NA	NA	NA
AUL89138.1|1242794_1243010_+|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	100.0	2.0e-33
AUL92954.1|1243234_1243480_+|tail	phage tail protein	tail	Q687E6	Enterobacteria_phage	98.5	2.4e-30
1245230:1245244	attR	GCTTTTTTATACTAA	NA	NA	NA	NA
>prophage 7
CP024618	Escherichia coli strain SMN152SH1 chromosome, complete genome	5302502	1545229	1585374	5302502	lysis,transposase,integrase,tail,terminase,holin,protease	Escherichia_phage(30.43%)	53	1553717:1553732	1571213:1571228
AUL89398.1|1545229_1546990_-|protease	Lon protease family protein	protease	NA	NA	NA	NA
AUL89399.1|1547175_1547628_+	macrodomain Ter protein	NA	NA	NA	NA	NA
AUL89400.1|1547703_1548744_-	porin OmpA	NA	NA	NA	NA	NA
AUL89401.1|1548898_1549117_+	hypothetical protein	NA	NA	NA	NA	NA
AUL89402.1|1549100_1549610_-	cell division inhibitor SulA	NA	NA	NA	NA	NA
AUL89403.1|1549828_1550458_+	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
AUL92971.1|1550420_1552574_-	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
AUL89404.1|1552592_1553039_-	YccF domain-containing protein	NA	NA	NA	NA	NA
AUL89405.1|1553161_1555216_+	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.9	5.9e-21
1553717:1553732	attL	GCGGATTTTTTCCGCC	NA	NA	NA	NA
AUL89406.1|1555247_1555706_-	methylglyoxal synthase	NA	NA	NA	NA	NA
AUL89407.1|1555801_1556464_-	hypothetical protein	NA	NA	NA	NA	NA
AUL89408.1|1556636_1557050_+	CoA-binding protein	NA	NA	NA	NA	NA
AUL89409.1|1557094_1557412_-	heat-shock protein HspQ	NA	NA	NA	NA	NA
AUL89410.1|1557469_1558660_-	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	NA	NA	NA	NA
AUL89411.1|1558754_1559033_+	acylphosphatase	NA	NA	NA	NA	NA
AUL89412.1|1559029_1559359_-	sulfurtransferase TusE	NA	NA	NA	NA	NA
AUL89413.1|1559449_1560109_-	transmembrane protein	NA	A0A2H4JFM9	uncultured_Caudovirales_phage	48.5	6.2e-41
AUL89414.1|1560516_1561536_-|integrase	integrase	integrase	A0A192Y7M7	Salmonella_phage	49.7	1.3e-85
AUL89415.1|1561513_1561756_-	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
AUL89416.1|1561823_1564259_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	58.2	6.4e-59
AUL89417.1|1564352_1564544_-	DUF1482 domain-containing protein	NA	NA	NA	NA	NA
AUL89418.1|1564540_1564729_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
AUL92972.1|1564995_1565301_+	hypothetical protein	NA	NA	NA	NA	NA
AUL89419.1|1565302_1565488_+	hypothetical protein	NA	NA	NA	NA	NA
AUL89420.1|1565674_1566064_-	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	30.0	1.5e-05
AUL89421.1|1566075_1566204_-	hypothetical protein	NA	NA	NA	NA	NA
AUL89422.1|1566205_1566361_-	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
AUL89423.1|1566637_1566925_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
AUL89424.1|1566924_1567116_-	antitoxin	NA	NA	NA	NA	NA
AUL89425.1|1567143_1567545_-	XRE family transcriptional regulator	NA	A0A1B5FPF4	Escherichia_phage	54.5	7.4e-13
AUL89426.1|1567653_1567926_+	hypothetical protein	NA	A0A0U2S629	Escherichia_phage	45.8	1.1e-12
AUL89427.1|1568551_1568749_-	TrmB family transcriptional regulator	NA	S5MQK8	Escherichia_phage	96.9	2.6e-27
AUL89428.1|1569035_1569854_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
AUL89429.1|1570005_1570377_-	antitermination protein	NA	Q777W5	Enterobacteria_phage	84.0	1.0e-53
AUL89430.1|1570366_1570738_-	hypothetical protein	NA	V5URS4	Shigella_phage	63.7	1.3e-35
AUL89431.1|1570750_1571800_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.9	3.4e-110
1571213:1571228	attR	GCGGATTTTTTCCGCC	NA	NA	NA	NA
AUL89432.1|1571801_1572080_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
AUL89433.1|1572247_1572460_-	Hok/Gef family protein	NA	A0A0U2QV81	Escherichia_phage	95.4	1.5e-25
AUL89434.1|1573007_1573781_+	iroE	NA	NA	NA	NA	NA
AUL92973.1|1575055_1576281_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	98.7	1.1e-176
AUL89435.1|1577939_1578155_+|holin	holin	holin	Q6H9V8	Enterobacteria_phage	97.2	1.7e-32
AUL89436.1|1578117_1578462_-	hypothetical protein	NA	NA	NA	NA	NA
AUL89437.1|1578410_1578647_-	hypothetical protein	NA	NA	NA	NA	NA
AUL89438.1|1578615_1578798_+	hypothetical protein	NA	NA	NA	NA	NA
AUL89439.1|1578842_1579376_+	lysozyme	NA	A0A1U9AJ98	Stx1_converting_phage	94.4	3.1e-99
AUL89440.1|1579596_1579710_+	hypothetical protein	NA	A0A2L1IV24	Escherichia_phage	100.0	6.6e-12
AUL89441.1|1579711_1580179_+|lysis	lysis protein	lysis	Q7AYI6	Enterobacteria_phage	93.5	2.2e-72
AUL89442.1|1580261_1580402_+	hypothetical protein	NA	NA	NA	NA	NA
AUL89443.1|1580644_1580959_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
AUL89444.1|1581040_1581265_-	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	92.5	2.7e-20
AUL89445.1|1581667_1582177_+|terminase	terminase	terminase	A0A1I9KFT4	Aeromonas_phage	32.7	1.6e-12
AUL92974.1|1582999_1584682_+|tail	phage tail protein	tail	Q6H9T2	Enterobacteria_phage	98.8	7.0e-307
AUL92975.1|1584750_1585374_+	hypothetical protein	NA	A0A1U8QHD6	Enterobacteria_phage	61.4	1.3e-69
>prophage 8
CP024618	Escherichia coli strain SMN152SH1 chromosome, complete genome	5302502	1731072	1864126	5302502	lysis,transposase,head,integrase,tail,terminase,tRNA,capsid,holin	Stx2-converting_phage(25.83%)	157	1794753:1794768	1859882:1859897
AUL89585.1|1731072_1731417_+	DUF2335 domain-containing protein	NA	A0A1B0YZW3	Pseudomonas_phage	35.5	4.3e-09
AUL89586.1|1731493_1732612_-|integrase	integrase	integrase	Q77Z04	Phage_21	44.2	2.9e-83
AUL89587.1|1732580_1732850_-	excisionase	NA	NA	NA	NA	NA
AUL89588.1|1732911_1735383_-	exonuclease	NA	K7PLW7	Enterobacteria_phage	60.3	8.5e-59
AUL89589.1|1735476_1735668_-	DUF1482 domain-containing protein	NA	NA	NA	NA	NA
AUL89590.1|1735664_1735853_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
AUL89591.1|1736342_1736495_-	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	51.1	8.7e-07
AUL89592.1|1736813_1737290_-	hypothetical protein	NA	A0A2D1GNH0	Pseudomonas_phage	53.4	5.7e-12
AUL89593.1|1737414_1737738_+	transcriptional regulator	NA	A0A0R6PH31	Moraxella_phage	44.9	6.2e-10
AUL89594.1|1737721_1738147_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
AUL89595.1|1738218_1739289_+	phage replisome organizer	NA	A0A088CD36	Shigella_phage	66.2	4.5e-65
AUL89596.1|1739295_1740042_+	DNA replication protein DnaC	NA	A0A088CBP4	Shigella_phage	83.8	1.4e-113
AUL89597.1|1740063_1740780_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	63.0	1.6e-71
AUL92984.1|1740812_1741094_+	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	73.6	3.6e-30
AUL89598.1|1741090_1741318_+	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	49.3	5.1e-11
AUL89599.1|1741310_1741622_+	hypothetical protein	NA	A0A0U2QV73	Escherichia_phage	92.2	7.2e-56
AUL89600.1|1741749_1741968_+	sugar acetyltransferase inhibitor	NA	A0A2R2Z311	Escherichia_phage	70.8	3.1e-21
AUL89601.1|1741969_1742527_+	DUF551 domain-containing protein	NA	A0A0N7KZV3	Escherichia_phage	41.7	2.8e-34
AUL89602.1|1742759_1742972_+	hypothetical protein	NA	A0A0P0ZAX5	Stx2-converting_phage	98.6	8.6e-29
AUL89603.1|1743089_1743431_+	TIGR00156 family protein	NA	A0A1I9LJU6	Stx_converting_phage	92.1	7.1e-49
AUL89604.1|1743552_1743825_+	hypothetical protein	NA	S4TNP0	Salmonella_phage	53.0	1.1e-12
AUL89605.1|1744888_1745263_+	hypothetical protein	NA	V5URS4	Shigella_phage	62.7	1.3e-32
AUL89606.1|1745259_1746081_+	antitermination protein	NA	K7P7B9	Enterobacteria_phage	61.2	4.1e-82
AUL89607.1|1746646_1747078_+	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	96.5	3.6e-66
AUL89608.1|1746968_1747235_+	hypothetical protein	NA	NA	NA	NA	NA
AUL89609.1|1747645_1749496_+	9-O-acetyl-N-acetylneuraminic acid deacetylase	NA	B6DZ89	Enterobacteria_phage	98.7	0.0e+00
AUL89610.1|1749930_1750146_+|holin	holin	holin	Q6H9V8	Enterobacteria_phage	97.2	1.7e-32
AUL92985.1|1750150_1750495_+	DUF1327 domain-containing protein	NA	A0A0P0ZD64	Stx2-converting_phage	100.0	1.0e-58
AUL89611.1|1750545_1751079_+	lysozyme	NA	A0A0N7KZF9	Stx2-converting_phage	99.4	4.3e-101
AUL89612.1|1751349_1751901_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	96.3	2.3e-97
AUL89613.1|1752054_1752522_+|lysis	lysis protein	lysis	A0A0P0ZDL0	Stx2-converting_phage	100.0	9.0e-79
AUL89614.1|1752889_1753117_-	DUF3950 domain-containing protein	NA	A0A0P0ZE23	Stx2-converting_phage	100.0	1.7e-35
AUL89615.1|1753158_1753524_+	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	100.0	3.1e-66
AUL89616.1|1753520_1753700_+	hypothetical protein	NA	H6WZK7	Escherichia_phage	91.1	8.6e-22
AUL89617.1|1753815_1754379_+|terminase	terminase small subunit	terminase	A0A0N7KZJ8	Stx2-converting_phage	100.0	8.1e-90
AUL89618.1|1754375_1756037_+|terminase	terminase large subunit	terminase	A0A0P0ZEI4	Stx2-converting_phage	100.0	0.0e+00
AUL89619.1|1756100_1758038_+|capsid	phage major capsid protein	capsid	B6ETE8	Enterobacteria_phage	99.2	0.0e+00
AUL92986.1|1758082_1758304_+	hypothetical protein	NA	H6WZL1	Escherichia_phage	100.0	3.4e-36
AUL89620.1|1760824_1761151_+|head,tail	phage gp6-like head-tail connector protein	head,tail	B6ETF0	Enterobacteria_phage	100.0	7.0e-54
AUL89621.1|1761160_1761511_+|head,tail	head-tail adaptor protein	head,tail	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
AUL89622.1|1761507_1761954_+	hypothetical protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
AUL89623.1|1761950_1762295_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	99.1	9.4e-57
AUL89624.1|1762353_1763070_+|tail	phage tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	100.0	2.9e-129
AUL89625.1|1763075_1763450_+|tail	phage tail protein	tail	A0A0N7KZA2	Stx2-converting_phage	99.2	2.3e-64
AUL89626.1|1763473_1763755_+|tail	phage tail protein	tail	A0A0P0ZDE6	Stx2-converting_phage	100.0	1.3e-45
AUL89627.1|1767034_1767376_+|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	96.5	2.0e-59
AUL89628.1|1767375_1768074_+|tail	phage minor tail protein L	tail	H6WZM3	Escherichia_phage	97.0	1.7e-129
AUL89629.1|1768084_1768828_+|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	99.6	9.2e-150
AUL89630.1|1768725_1769406_+|tail	phage tail protein	tail	Q9EYE5	Enterobacteria_phage	90.2	2.3e-107
AUL89631.1|1769652_1773129_+|tail	phage tail protein	tail	Q687E8	Enterobacteria_phage	96.4	0.0e+00
AUL89632.1|1773195_1773795_+	Ail/Lom family protein	NA	A0A0P0ZBV0	Stx2-converting_phage	99.0	2.0e-110
AUL89633.1|1773859_1775173_+|tail	phage tail protein	tail	A0A0P0ZD68	Stx2-converting_phage	99.1	2.0e-78
AUL89634.1|1775174_1775444_+|tail	phage tail protein	tail	A0A2R2Z347	Escherichia_phage	98.9	2.4e-44
AUL89635.1|1775659_1778008_+	type III secretion system effector HECT-type E3 ubiquitin transferase	NA	NA	NA	NA	NA
AUL89636.1|1778598_1780659_+	type III effector	NA	A0A0N7KZG3	Stx2-converting_phage	29.1	2.8e-63
AUL89637.1|1780655_1781350_-|transposase	IS1 family transposase	transposase	NA	NA	NA	NA
AUL89638.1|1782930_1783518_+	hypothetical protein	NA	NA	NA	NA	NA
AUL89639.1|1783540_1783666_+	NleB	NA	Q8HAB2	Salmonella_phage	58.3	8.7e-05
AUL89640.1|1783745_1784021_-	secretion protein EspO	NA	NA	NA	NA	NA
AUL89641.1|1784081_1785443_-	type III secretion protein GogB	NA	Q9MBM1	Phage_Gifsy-1	29.2	1.4e-50
AUL89642.1|1785563_1785776_-	hypothetical protein	NA	NA	NA	NA	NA
AUL89643.1|1786124_1786328_+	hypothetical protein	NA	NA	NA	NA	NA
AUL89644.1|1786305_1786773_+	DUF2335 domain-containing protein	NA	A0A1B0YZW3	Pseudomonas_phage	35.0	4.4e-09
AUL89645.1|1786849_1787968_-|integrase	integrase	integrase	Q77Z04	Phage_21	44.7	3.5e-84
AUL92987.1|1787936_1788206_-	excisionase	NA	NA	NA	NA	NA
AUL89646.1|1788267_1790811_-	exonuclease	NA	V5UQJ3	Shigella_phage	69.8	7.1e-234
AUL89647.1|1790903_1791092_-	DUF1482 domain-containing protein	NA	NA	NA	NA	NA
AUL89648.1|1791088_1791277_-	cell division inhibitor	NA	NA	NA	NA	NA
AUL89649.1|1791666_1791819_-	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	55.3	6.0e-08
AUL89650.1|1792092_1792740_-	helix-turn-helix domain-containing protein	NA	A0A1P8DTH0	Proteus_phage	25.9	4.7e-09
AUL89651.1|1792836_1793064_+	cell division protein	NA	NA	NA	NA	NA
AUL89652.1|1793060_1793486_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
AUL92988.1|1793508_1794477_+	DNA-binding protein	NA	U5P0A0	Shigella_phage	52.4	9.0e-73
AUL89653.1|1794483_1795230_+	DNA replication protein DnaC	NA	A0A088CBP4	Shigella_phage	83.2	8.1e-114
1794753:1794768	attL	AAAATCCATCGCTGAC	NA	NA	NA	NA
AUL89654.1|1795251_1795968_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	63.4	1.0e-73
AUL89655.1|1795964_1796282_+	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	71.6	3.0e-33
AUL89656.1|1796278_1796584_+	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	95.0	1.5e-50
AUL89657.1|1796731_1796914_+	hypothetical protein	NA	A0A2R2Z308	Escherichia_phage	95.0	1.0e-25
AUL89658.1|1797079_1797439_+	hypothetical protein	NA	A0A076GCN9	Escherichia_phage	78.6	1.3e-37
AUL89659.1|1797441_1797729_+	hypothetical protein	NA	A0A1I9LJM1	Stx_converting_phage	95.8	2.5e-47
AUL89660.1|1797732_1798077_+	hypothetical protein	NA	A0A2R2Z2X8	Escherichia_phage	92.1	9.7e-54
AUL89661.1|1798408_1798588_+	hypothetical protein	NA	NA	NA	NA	NA
AUL89662.1|1798606_1799092_+	type II toxin-antitoxin system death-on-curing family toxin	NA	NA	NA	NA	NA
AUL92990.1|1799069_1799267_-	hypothetical protein	NA	NA	NA	NA	NA
AUL92989.1|1799207_1799486_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	6.3e-11
AUL89663.1|1799487_1800537_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.9	1.5e-110
AUL89664.1|1800549_1800909_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	65.8	1.7e-37
AUL89665.1|1800905_1801589_+	antiterminator	NA	I6PDF8	Cronobacter_phage	48.9	1.2e-55
AUL89666.1|1801807_1802005_+	TrmB family transcriptional regulator	NA	S5MQK8	Escherichia_phage	98.5	4.0e-28
AUL89667.1|1802155_1803214_+	site-specific DNA-methyltransferase	NA	A0A0N7KZF8	Stx2-converting_phage	91.5	1.2e-192
AUL89668.1|1803593_1803818_+	hypothetical protein	NA	NA	NA	NA	NA
AUL89669.1|1803870_1804092_+	hypothetical protein	NA	K7PJU3	Enterobacteria_phage	65.2	2.0e-20
AUL89670.1|1804270_1804702_+	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	96.5	3.6e-66
AUL89671.1|1804592_1804859_+	hypothetical protein	NA	NA	NA	NA	NA
AUL89672.1|1805272_1807123_+	9-O-acetyl-N-acetylneuraminic acid deacetylase	NA	B6DZ89	Enterobacteria_phage	98.7	0.0e+00
AUL89673.1|1807404_1807620_+|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	97.2	1.7e-32
AUL89674.1|1807582_1807927_-	hypothetical protein	NA	NA	NA	NA	NA
AUL89675.1|1807875_1808112_-	hypothetical protein	NA	NA	NA	NA	NA
AUL89676.1|1808080_1808275_+	hypothetical protein	NA	NA	NA	NA	NA
AUL89677.1|1808307_1808841_+	lysozyme	NA	A0A1U9AJ98	Stx1_converting_phage	95.5	2.1e-100
AUL89678.1|1808918_1809110_+	hypothetical protein	NA	A0A0M4S639	Salmonella_phage	63.9	7.8e-05
AUL92991.1|1809267_1809735_+|lysis	lysis protein	lysis	A0A0H4IT10	Shigella_phage	87.1	7.2e-68
AUL89679.1|1809758_1809983_+	hypothetical protein	NA	NA	NA	NA	NA
AUL92992.1|1809979_1810198_+	hypothetical protein	NA	Q9T1L1	Enterobacteria_phage	73.3	6.4e-11
AUL89680.1|1810339_1810480_+	hypothetical protein	NA	NA	NA	NA	NA
AUL89681.1|1810609_1810795_-	DUF3950 domain-containing protein	NA	H6WZK6	Escherichia_phage	88.5	6.4e-20
AUL89682.1|1810836_1811202_+	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	95.0	7.8e-62
AUL89683.1|1811492_1812056_+|terminase	terminase small subunit	terminase	A0A0P0ZD56	Stx2-converting_phage	100.0	1.1e-89
AUL92993.1|1812061_1813777_+|terminase	terminase	terminase	A0A0N7KZG0	Stx2-converting_phage	99.3	0.0e+00
AUL92994.1|1815753_1815975_+	hypothetical protein	NA	A0A0P0ZD92	Stx2-converting_phage	98.6	2.9e-35
AUL89684.1|1818501_1818828_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDE0	Stx2-converting_phage	99.1	2.0e-53
AUL89685.1|1818838_1819189_+|head,tail	head-tail adaptor protein	head,tail	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
AUL89686.1|1819185_1819632_+	hypothetical protein	NA	A0A0P0ZCD2	Stx2-converting_phage	98.6	5.2e-76
AUL89687.1|1819628_1819973_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
AUL89688.1|1820039_1820756_+|tail	phage tail protein	tail	B6DZA6	Enterobacteria_phage	99.6	2.8e-127
AUL89689.1|1820770_1821145_+|tail	phage tail protein	tail	A0A0P0ZE84	Stx2-converting_phage	99.2	1.7e-64
AUL89690.1|1821168_1821450_+	DUF4035 domain-containing protein	NA	H6WZM0	Escherichia_phage	98.9	2.3e-45
AUL89691.1|1822967_1823384_+	hypothetical protein	NA	A0A0P0ZDY0	Stx2-converting_phage	86.5	3.2e-43
AUL89692.1|1824716_1825055_+|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	89.5	4.0e-52
AUL89693.1|1825054_1825753_+|tail	phage minor tail protein L	tail	B6DZB1	Enterobacteria_phage	96.6	1.7e-129
AUL89694.1|1825763_1826507_+|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	98.4	7.3e-147
AUL89695.1|1826404_1827085_+|tail	phage tail protein	tail	Q9EYE5	Enterobacteria_phage	90.6	1.0e-107
AUL92995.1|1830866_1831490_+	hypothetical protein	NA	A0A1U8QHD6	Enterobacteria_phage	60.9	8.7e-69
AUL89696.1|1831554_1832868_+|tail	phage tail protein	tail	A0A0P0ZD68	Stx2-converting_phage	98.9	7.4e-78
AUL89697.1|1832869_1833139_+|tail	phage tail protein	tail	Q687E5	Enterobacteria_phage	100.0	6.4e-45
AUL89698.1|1833250_1833832_+	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	54.8	2.7e-48
AUL89699.1|1833899_1834535_+	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	92.0	3.7e-75
AUL89700.1|1834662_1835721_-	type III effector	NA	NA	NA	NA	NA
AUL89701.1|1835795_1836446_-	DUF1076 domain-containing protein	NA	B6DZZ5	Stx2-converting_phage	37.2	2.8e-25
AUL89702.1|1837492_1838356_-	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.2	2.0e-10
AUL89703.1|1838339_1839476_-	Fe3+/spermidine/putrescine ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	39.8	9.4e-29
AUL89704.1|1839454_1839670_-	hypothetical protein	NA	NA	NA	NA	NA
AUL89705.1|1839725_1840952_+	peptidase T	NA	NA	NA	NA	NA
AUL89706.1|1841000_1842122_-	50S ribosomal protein L16 arginine hydroxylase	NA	NA	NA	NA	NA
AUL89707.1|1842197_1843658_-	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
AUL89708.1|1843657_1844329_-	two-component system response regulator PhoP	NA	NA	NA	NA	NA
AUL89709.1|1844497_1845868_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	3.2e-108
AUL92996.1|1845871_1846513_-	lysogenization protein HflD	NA	NA	NA	NA	NA
AUL89710.1|1846548_1847655_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
AUL89711.1|1847708_1848170_-	NUDIX hydrolase	NA	NA	NA	NA	NA
AUL89712.1|1848179_1848833_-	23S rRNA pseudouridine synthase E	NA	NA	NA	NA	NA
AUL89713.1|1849004_1850255_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	98.1	1.9e-22
AUL89714.1|1850368_1851511_-|integrase	integrase	integrase	Q77Z02	Phage_21	99.4	1.2e-204
AUL89715.1|1851500_1851737_-	excisionase	NA	NA	NA	NA	NA
AUL92997.1|1852010_1852556_+	antiterminator	NA	I6PDF8	Cronobacter_phage	49.7	3.4e-45
AUL89716.1|1852865_1853183_+|holin	holin	holin	A0A286N2Q5	Klebsiella_phage	86.1	3.3e-40
AUL89717.1|1853169_1853646_+	lysozyme	NA	K7PKV2	Enterobacteria_phage	96.8	1.0e-85
AUL89718.1|1853642_1854104_+|lysis	lysis protein	lysis	A0A0K2FJD0	Enterobacteria_phage	100.0	1.9e-76
AUL89719.1|1854135_1854429_-	lipoprotein bor	NA	K7PL54	Enterobacteria_phage	99.0	1.5e-47
AUL89720.1|1854720_1855131_-	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	98.5	2.7e-71
AUL89721.1|1855416_1855623_+	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	100.0	5.8e-30
AUL89722.1|1855787_1855982_-	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	96.9	3.7e-26
AUL89723.1|1856370_1856916_+|terminase	terminase small subunit	terminase	A0A0K2FIG2	Enterobacteria_phage	98.3	3.1e-94
AUL89724.1|1856890_1858816_+|terminase	terminase	terminase	A0A0K2FJ14	Enterobacteria_phage	99.4	0.0e+00
AUL89725.1|1858812_1859019_+|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
AUL89726.1|1860468_1860990_+|tail	phage tail tape measure protein	tail	A0A291AWV3	Escherichia_phage	100.0	2.2e-41
1859882:1859897	attR	GTCAGCGATGGATTTT	NA	NA	NA	NA
AUL89727.1|1861054_1864126_+|tail	phage tail protein	tail	U5N099	Enterobacteria_phage	82.1	1.9e-68
>prophage 9
CP024618	Escherichia coli strain SMN152SH1 chromosome, complete genome	5302502	2066474	2222582	5302502	portal,lysis,transposase,head,integrase,tail,terminase,tRNA,capsid,holin	Escherichia_phage(35.16%)	151	2071812:2071837	2117161:2117186
AUL93012.1|2066474_2067707_-	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	39.5	4.0e-17
AUL89913.1|2067961_2068945_+	zinc transporter ZntB	NA	NA	NA	NA	NA
AUL89914.1|2069220_2069394_+	hypothetical protein	NA	NA	NA	NA	NA
AUL89915.1|2069423_2070797_+	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	32.9	1.5e-52
AUL89916.1|2070925_2071861_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	99.2	1.2e-146
2071812:2071837	attL	TTGTTCAGGTTGTATTGTTCTTTCTT	NA	NA	NA	NA
AUL89917.1|2071912_2073148_-|integrase	site-specific integrase	integrase	A0A0U2JGI6	Escherichia_phage	98.0	4.3e-237
AUL89918.1|2073149_2073365_-	hypothetical protein	NA	A0A0U2RY08	Escherichia_phage	100.0	1.8e-37
AUL89919.1|2073464_2073653_-	hypothetical protein	NA	A0A0U2QL97	Escherichia_phage	97.9	1.6e-18
AUL93013.1|2073645_2073840_-	restriction alleviation and modification enhancement protein	NA	A0A0U2QQP4	Escherichia_phage	96.9	7.6e-32
AUL89920.1|2073896_2074706_-	recombination and repair protein RecT	NA	A0A1P8DTF2	Proteus_phage	71.5	8.8e-106
AUL89921.1|2074698_2077368_-	exonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	61.3	4.2e-205
AUL93014.1|2077448_2077619_-	hypothetical protein	NA	A0A0U2SHB5	Escherichia_phage	89.3	3.3e-23
AUL89922.1|2077618_2077840_-	cell division protein FtsZ	NA	A0A0U2RTC4	Escherichia_phage	97.3	6.9e-37
AUL89923.1|2077886_2078735_-	transcriptional regulator	NA	A0A0P0ZE80	Stx2-converting_phage	60.8	5.9e-60
AUL89924.1|2078940_2079141_+	hypothetical protein	NA	NA	NA	NA	NA
AUL89925.1|2079146_2079299_-	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	55.3	1.0e-07
AUL89926.1|2079605_2080025_-	transcriptional regulator	NA	K7PH71	Enterobacterial_phage	60.6	3.1e-14
AUL89927.1|2080121_2080364_+	XRE family transcriptional regulator	NA	K7PKH4	Enterobacteria_phage	62.1	2.3e-17
AUL89928.1|2080360_2080783_+	hypothetical protein	NA	A0A0U2RXZ9	Escherichia_phage	93.6	5.9e-69
AUL89929.1|2080860_2081649_+	hypothetical protein	NA	G9L6A8	Escherichia_phage	65.0	5.1e-42
AUL89930.1|2081655_2082402_+	DNA replication protein DnaC	NA	V5UQI5	Shigella_phage	80.9	4.8e-114
AUL89931.1|2082373_2083186_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	87.7	8.5e-117
AUL89932.1|2083201_2083624_+	DUF977 domain-containing protein	NA	A0A0U2QQN3	Escherichia_phage	90.6	2.8e-63
AUL89933.1|2083620_2083851_+	hypothetical protein	NA	A0A2R2Z315	Escherichia_phage	76.8	4.1e-16
AUL89934.1|2084005_2084656_+	hypothetical protein	NA	NA	NA	NA	NA
AUL89935.1|2084642_2085764_+	DNA-binding protein	NA	NA	NA	NA	NA
AUL89936.1|2085886_2086099_+	type I toxin-antitoxin system hok family toxin	NA	A0A0U2QV81	Escherichia_phage	70.0	1.2e-17
AUL89937.1|2086073_2086262_-	hypothetical protein	NA	NA	NA	NA	NA
AUL89938.1|2086335_2086587_+	hypothetical protein	NA	NA	NA	NA	NA
AUL89939.1|2086658_2087258_+	DUF1367 domain-containing protein	NA	A0A0U2RT94	Escherichia_phage	92.5	1.0e-106
AUL89940.1|2087257_2087548_+	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	87.5	8.2e-46
AUL89941.1|2087544_2088087_+	DUF1133 domain-containing protein	NA	A0A0U2S606	Escherichia_phage	72.3	3.9e-73
AUL89942.1|2088788_2090735_+	sialate O-acetylesterase	NA	A0A075M342	Escherichia_Stx1-converting_recombinant_phage	98.6	0.0e+00
AUL89943.1|2090871_2091051_+	DUF1378 domain-containing protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
AUL89944.1|2091091_2091337_+	DUF826 domain-containing protein	NA	A0A0P0ZGR2	Escherichia_phage	100.0	8.8e-17
AUL89945.1|2091414_2091630_+|holin	holin	holin	A0A0P0ZFW5	Escherichia_phage	100.0	9.0e-34
AUL89946.1|2091634_2092168_+	lysozyme	NA	A0A1I9LJR4	Stx_converting_phage	100.0	1.8e-102
AUL89947.1|2092438_2093008_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
AUL89948.1|2093161_2093629_+|lysis	lysis protein	lysis	Q9EYC9	Enterobacteria_phage	100.0	1.2e-78
AUL89949.1|2093778_2094027_-	hypothetical protein	NA	NA	NA	NA	NA
AUL89950.1|2094083_2094560_+	DUF1441 domain-containing protein	NA	Q9EYD0	Enterobacteria_phage	100.0	2.1e-83
AUL89951.1|2094556_2096680_+|terminase	terminase	terminase	Q9EYD1	Enterobacteria_phage	100.0	0.0e+00
AUL89952.1|2096652_2096889_+	hypothetical protein	NA	S5MBY8	Escherichia_phage	100.0	4.5e-34
AUL89953.1|2096888_2098391_+|portal	phage portal protein	portal	Q9EYD2	Enterobacteria_phage	100.0	4.8e-291
AUL93015.1|2098404_2100360_+	peptidase S14	NA	S5M7Q8	Escherichia_phage	99.7	0.0e+00
AUL89954.1|2100447_2100774_+	DUF2190 domain-containing protein	NA	Q9EYD5	Enterobacteria_phage	100.0	6.1e-50
AUL89955.1|2100766_2101048_+	DNA breaking-rejoining protein	NA	Q8VNN4	Enterobacteria_phage	98.9	1.3e-45
AUL89956.1|2101050_2101674_+|tail	phage tail protein	tail	Q8VNN3	Enterobacteria_phage	98.6	2.9e-104
AUL89957.1|2101686_2102085_+|tail	phage tail protein	tail	Q9EYD7	Enterobacteria_phage	100.0	5.9e-71
AUL89958.1|2102092_2102845_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	100.0	5.8e-136
AUL89959.1|2102858_2103281_+|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	98.6	3.3e-72
AUL89960.1|2103307_2103616_+|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	99.0	3.0e-54
AUL89961.1|2103659_2106305_+|tail	phage tail tape measure protein	tail	Q687F3	Enterobacteria_phage	95.7	0.0e+00
AUL89962.1|2106301_2106631_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
AUL89963.1|2106630_2107329_+|tail	phage minor tail protein L	tail	Q6H9T5	Enterobacteria_phage	97.4	5.8e-130
AUL89964.1|2107334_2108078_+|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	97.2	2.8e-146
AUL89965.1|2107975_2108653_+|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	92.9	2.6e-111
AUL89966.1|2108893_2112367_+|tail	phage tail protein	tail	A0A0P0ZBW1	Stx2-converting_phage	89.9	0.0e+00
AUL89967.1|2112434_2113034_+	Ail/Lom family protein	NA	Q9EV15	Enterobacteria_phage	100.0	2.6e-110
AUL89968.1|2113098_2114421_+|tail	phage tail protein	tail	Q687E6	Enterobacteria_phage	98.6	2.0e-75
AUL89969.1|2114422_2114692_+|tail	phage tail protein	tail	Q6H9S8	Enterobacteria_phage	97.8	2.4e-44
AUL89970.1|2114804_2115380_+	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	88.4	5.3e-89
AUL89971.1|2115452_2116082_+	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	92.2	1.3e-77
AUL89972.1|2116163_2116805_+	DUF1076 domain-containing protein	NA	B6DZC0	Enterobacteria_phage	100.0	6.8e-109
AUL89973.1|2117385_2117820_-	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.1	4.0e-28
2117161:2117186	attR	TTGTTCAGGTTGTATTGTTCTTTCTT	NA	NA	NA	NA
AUL89974.1|2119461_2122986_-	pyruvate:ferredoxin (flavodoxin) oxidoreductase	NA	NA	NA	NA	NA
AUL89975.1|2123259_2123526_+	DUF333 domain-containing protein	NA	NA	NA	NA	NA
AUL89976.1|2123522_2123945_-	heat-shock protein HslJ	NA	NA	NA	NA	NA
AUL89977.1|2124055_2125045_-	2-hydroxyacid dehydrogenase	NA	M1I4S0	Paramecium_bursaria_Chlorella_virus	44.0	2.5e-70
AUL89978.1|2125252_2127892_+	YdbH family protein	NA	NA	NA	NA	NA
AUL89979.1|2127888_2128074_+	YnbE family lipoprotein	NA	NA	NA	NA	NA
AUL89980.1|2128081_2128408_+	DUF1318 domain-containing protein	NA	NA	NA	NA	NA
AUL89981.1|2129719_2131219_+	NAD-dependent phenylacetaldehyde dehydrogenase	NA	NA	NA	NA	NA
AUL89982.1|2131277_2133551_-	primary-amine oxidase	NA	NA	NA	NA	NA
AUL89983.1|2133798_2135844_-	bifunctional aldehyde dehydrogenase/enoyl-CoA hydratase	NA	NA	NA	NA	NA
AUL89984.1|2136128_2137058_+	1,2-phenylacetyl-CoA epoxidase subunit A	NA	NA	NA	NA	NA
AUL89985.1|2137069_2137357_+	1,2-phenylacetyl-CoA epoxidase subunit B	NA	NA	NA	NA	NA
AUL89986.1|2137365_2138112_+	phenylacetate-CoA oxygenase subunit PaaI	NA	NA	NA	NA	NA
AUL89987.1|2138126_2138624_+	phenylacetate-CoA oxygenase subunit PaaJ	NA	NA	NA	NA	NA
AUL89988.1|2138631_2139702_+	phenylacetate-CoA oxygenase/reductase subunit PaaK	NA	NA	NA	NA	NA
AUL89989.1|2139698_2140466_+	2,3-dehydroadipyl-CoA hydratase	NA	NA	NA	NA	NA
AUL89990.1|2140465_2141254_+	2-(1,2-epoxy-1,2-dihydrophenyl)acetyl-CoA isomerase	NA	NA	NA	NA	NA
AUL89991.1|2142670_2143093_+	phenylacetic acid degradation protein PaaD	NA	NA	NA	NA	NA
AUL89992.1|2143092_2144298_+	3-oxoadipyl-CoA thiolase	NA	NA	NA	NA	NA
AUL89993.1|2145740_2146691_+	phenylacetic acid degradation operon negative regulatory protein PaaX	NA	NA	NA	NA	NA
AUL89994.1|2146672_2147263_+	phenylacetic acid degradation protein PaaY	NA	NA	NA	NA	NA
AUL89995.1|2147494_2148355_+	oxidoreductase	NA	NA	NA	NA	NA
AUL89996.1|2148418_2150725_+	DUF2773 domain-containing protein	NA	NA	NA	NA	NA
AUL89997.1|2150895_2151549_+	CDP-alcohol phosphatidyltransferase family protein	NA	NA	NA	NA	NA
AUL89998.1|2151548_2152445_+	hypothetical protein	NA	NA	NA	NA	NA
AUL89999.1|2152460_2154218_+	hypothetical protein	NA	NA	NA	NA	NA
AUL93016.1|2154231_2155524_+	hypothetical protein	NA	NA	NA	NA	NA
AUL90000.1|2155574_2156180_-	FMN-dependent NADH-azoreductase	NA	NA	NA	NA	NA
AUL90001.1|2156380_2160283_+	ATP-dependent RNA helicase HrpA	NA	A0A1V0SIV3	Klosneuvirus	29.5	2.2e-53
AUL90002.1|2160554_2161355_+	YdcF family protein	NA	NA	NA	NA	NA
AUL90003.1|2161551_2162991_+	aldehyde dehydrogenase	NA	NA	NA	NA	NA
AUL90004.1|2163032_2164034_-	type I glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
AUL93017.1|2164222_2164753_+	cytochrome b561	NA	A0A0U2QLA7	Escherichia_phage	44.9	3.1e-19
AUL90005.1|2164997_2165171_+	hypothetical protein	NA	A0A0R6PKG1	Moraxella_phage	67.4	4.4e-07
AUL90006.1|2165242_2165392_-	protein HokB	NA	NA	NA	NA	NA
AUL90007.1|2165491_2166861_-|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	99.5	6.3e-112
AUL90008.1|2166938_2167151_+	Hok/Gef family protein	NA	A0A0U2QV81	Escherichia_phage	72.9	1.3e-16
AUL90009.1|2168676_2168943_+	hypothetical protein	NA	NA	NA	NA	NA
AUL90010.1|2169087_2169216_+	hypothetical protein	NA	NA	NA	NA	NA
AUL90011.1|2171768_2172113_+	DUF1327 domain-containing protein	NA	A0A0P0ZD64	Stx2-converting_phage	100.0	1.0e-58
AUL90012.1|2172163_2172697_+	lysozyme	NA	A0A0N7KZF9	Stx2-converting_phage	98.3	2.8e-100
AUL90013.1|2172774_2172993_+	hypothetical protein	NA	Q687G2	Enterobacteria_phage	93.3	1.0e-16
AUL90014.1|2172994_2173489_+|lysis	lysis protein	lysis	Q9ZXB6	Enterobacteria_phage	93.8	4.0e-77
AUL90015.1|2173485_2173710_+	hypothetical protein	NA	NA	NA	NA	NA
AUL90016.1|2174078_2174306_-	DUF3950 domain-containing protein	NA	A0A0P0ZCA1	Stx2-converting_phage	100.0	3.9e-35
AUL90017.1|2174347_2174713_+	HNH endonuclease	NA	A0A0P0ZCH0	Stx2-converting_phage	100.0	2.0e-65
AUL90018.1|2175733_2177671_+|capsid	phage major capsid protein	capsid	H6WZL0	Escherichia_phage	99.8	0.0e+00
AUL93018.1|2177715_2177937_+	hypothetical protein	NA	H6WZL1	Escherichia_phage	100.0	3.4e-36
AUL90019.1|2180463_2180790_+|head,tail	phage gp6-like head-tail connector protein	head,tail	B6ETF0	Enterobacteria_phage	100.0	7.0e-54
AUL90020.1|2180799_2181150_+|head,tail	head-tail adaptor protein	head,tail	H6WZL5	Escherichia_phage	100.0	2.0e-59
AUL90021.1|2181146_2181593_+	hypothetical protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
AUL90022.1|2181991_2182708_+|tail	phage tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	97.5	4.0e-126
AUL90023.1|2182713_2183088_+|tail	phage tail protein	tail	A0A0N7KZA2	Stx2-converting_phage	100.0	7.8e-65
AUL90024.1|2183111_2183393_+	DUF4035 domain-containing protein	NA	H6WZM0	Escherichia_phage	100.0	7.9e-46
AUL90025.1|2186674_2187016_+|tail	phage tail protein	tail	A0A0P0ZCS8	Stx2-converting_phage	100.0	8.7e-63
AUL90026.1|2187015_2187714_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	96.6	8.4e-129
AUL90027.1|2187724_2188468_+|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	97.2	6.8e-145
AUL90028.1|2188365_2189046_+|tail	tail assembly protein	tail	Q6H9T3	Enterobacteria_phage	91.2	2.3e-107
AUL90029.1|2188999_2189203_+	hypothetical protein	NA	NA	NA	NA	NA
AUL90030.1|2189233_2189761_-	superoxide dismutase	NA	Q9MC02	Salmonella_phage	60.5	1.8e-59
AUL90031.1|2189894_2193287_+|tail	phage tail protein	tail	A0A0P0ZDT4	Stx2-converting_phage	88.0	0.0e+00
AUL90032.1|2193353_2193953_+	Ail/Lom family protein	NA	H6WZM8	Escherichia_phage	94.0	4.2e-105
AUL90033.1|2194017_2195331_+|tail	phage tail protein	tail	H6WZM9	Escherichia_phage	97.9	4.8e-77
AUL90034.1|2195332_2195602_+|tail	phage tail protein	tail	Q6H9S8	Enterobacteria_phage	98.9	1.1e-44
AUL90035.1|2195742_2196618_+	secretion protein EspS	NA	A0A0P0ZCT1	Stx2-converting_phage	99.3	2.1e-161
AUL93019.1|2196842_2197214_-	DUF1076 domain-containing protein	NA	A0A0P0ZBX1	Stx2-converting_phage	99.2	1.7e-67
AUL90036.1|2199483_2199687_-	selenoprotein YdfZ	NA	J9Q802	Salmonella_phage	55.2	1.6e-11
AUL90037.1|2199864_2200551_-	transcriptional regulator	NA	NA	NA	NA	NA
AUL90038.1|2200639_2201386_-	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
AUL90039.1|2201397_2201616_-	hypothetical protein	NA	NA	NA	NA	NA
AUL93020.1|2201522_2203568_+	peptidyl-dipeptidase Dcp	NA	NA	NA	NA	NA
AUL90040.1|2203611_2204082_-	hypothetical protein	NA	NA	NA	NA	NA
AUL90041.1|2204147_2204841_+|transposase	IS1 family transposase	transposase	NA	NA	NA	NA
AUL90042.1|2205381_2206047_+	colanic acid/biofilm transcriptional regulator	NA	NA	NA	NA	NA
AUL90043.1|2206082_2208185_-	TonB-dependent siderophore receptor	NA	A0A1B0VCF0	Salmonella_phage	65.6	1.1e-134
AUL93021.1|2208099_2208279_+	hypothetical protein	NA	NA	NA	NA	NA
AUL90044.1|2208218_2208344_-	tonB-dependent receptor yncD	NA	NA	NA	NA	NA
AUL90045.1|2208426_2209488_+	hypothetical protein	NA	NA	NA	NA	NA
AUL90046.1|2209602_2211102_-	L-asparagine permease	NA	NA	NA	NA	NA
AUL90047.1|2211368_2211986_+	glutathione S-transferase family protein	NA	NA	NA	NA	NA
AUL90048.1|2212061_2212274_+	hypothetical protein	NA	NA	NA	NA	NA
AUL90049.1|2212498_2213192_+|transposase	IS1 family transposase	transposase	NA	NA	NA	NA
AUL90050.1|2213772_2215431_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.2	8.3e-26
AUL90051.1|2219243_2219486_+	hypothetical protein	NA	NA	NA	NA	NA
AUL90052.1|2219480_2220677_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
AUL90053.1|2221445_2222582_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
>prophage 10
CP024618	Escherichia coli strain SMN152SH1 chromosome, complete genome	5302502	2313690	2347634	5302502	lysis,transposase,terminase,holin,protease	Escherichia_phage(16.67%)	39	NA	NA
AUL90127.1|2313690_2314385_-|transposase	IS1 family transposase	transposase	NA	NA	NA	NA
AUL90128.1|2315340_2315859_+	L-methionine sulfoximine/L-methionine sulfone acetyltransferase	NA	NA	NA	NA	NA
AUL90129.1|2315855_2316305_+	hypothetical protein	NA	NA	NA	NA	NA
AUL90130.1|2316305_2316539_-	DUF2526 domain-containing protein	NA	NA	NA	NA	NA
AUL93023.1|2316624_2316846_-	GhoT/OrtT family toxin	NA	NA	NA	NA	NA
AUL93024.1|2316780_2316996_+	hypothetical protein	NA	NA	NA	NA	NA
AUL90131.1|2316992_2317088_+	stress response membrane protein YncL	NA	NA	NA	NA	NA
AUL90132.1|2317489_2318299_-	antibiotic acetyltransferase	NA	A0A2R8FE91	Brazilian_cedratvirus	41.0	7.7e-17
AUL90133.1|2318508_2319933_-	aminobutyraldehyde dehydrogenase	NA	NA	NA	NA	NA
AUL90134.1|2320737_2321679_-	ABC transporter permease	NA	NA	NA	NA	NA
AUL90135.1|2321679_2322657_-	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	37.4	2.6e-27
AUL90136.1|2322708_2323854_-	spermidine/putrescine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUL90137.1|2324098_2325505_-	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
AUL90138.1|2325583_2326000_-	type II toxin-antitoxin system HicB family antitoxin	NA	F1C593	Cronobacter_phage	57.8	4.8e-31
AUL90139.1|2326045_2326222_-	type II toxin-antitoxin system HicA family toxin	NA	A0A0M3LQ86	Mannheimia_phage	56.1	5.2e-11
AUL90140.1|2326443_2326674_+	DUF2554 domain-containing protein	NA	NA	NA	NA	NA
AUL90141.1|2326765_2328727_-|protease	collagenase-like protease	protease	Q6DW11	Phage_TP	28.9	9.2e-24
AUL90142.1|2328799_2329336_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AUL90143.1|2329388_2330603_+	BenE family transporter YdcO	NA	NA	NA	NA	NA
AUL90144.1|2330642_2331851_-|transposase	transposase	transposase	A0A077SL42	Escherichia_phage	93.5	3.2e-208
AUL90145.1|2332382_2333051_-	hypothetical protein	NA	NA	NA	NA	NA
AUL90146.1|2333353_2333947_-	tellurite resistance methyltransferase TehB	NA	NA	NA	NA	NA
AUL90147.1|2333943_2334936_-	dicarboxylate transporter/tellurite-resistance protein TehA	NA	NA	NA	NA	NA
AUL90148.1|2335059_2336040_+	hypothetical protein	NA	NA	NA	NA	NA
AUL90149.1|2336034_2336571_-	50S ribosomal protein L7/L12-serine acetyltransferase	NA	NA	NA	NA	NA
AUL90150.1|2336633_2336858_-	hypothetical protein	NA	NA	NA	NA	NA
AUL90151.1|2336873_2337077_+	hypothetical protein	NA	NA	NA	NA	NA
AUL90152.1|2336997_2338653_-	glucan biosynthesis protein D	NA	NA	NA	NA	NA
AUL90153.1|2338877_2340221_-	DUF1338 domain-containing protein	NA	NA	NA	NA	NA
AUL93025.1|2340437_2341361_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUL90154.1|2341398_2341578_-	chemotaxis protein	NA	NA	NA	NA	NA
AUL90155.1|2341590_2343039_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	24.4	8.4e-06
AUL90156.1|2344211_2344682_-|terminase	terminase small subunit	terminase	B6DZ97	Enterobacteria_phage	98.1	1.3e-77
AUL90157.1|2344970_2345336_-	HNH endonuclease	NA	A0A0P0ZCH0	Stx2-converting_phage	100.0	2.0e-65
AUL90158.1|2345377_2345602_+	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	92.5	2.7e-20
AUL90159.1|2345683_2345998_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
AUL90160.1|2346239_2346380_-	hypothetical protein	NA	NA	NA	NA	NA
AUL90161.1|2346462_2346930_-|lysis	lysis protein	lysis	Q7AYI6	Enterobacteria_phage	80.1	1.8e-58
AUL90162.1|2347418_2347634_-|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	7.7e-33
>prophage 11
CP024618	Escherichia coli strain SMN152SH1 chromosome, complete genome	5302502	2352575	2397315	5302502	lysis,tail,holin,capsid,terminase	Enterobacteria_phage(38.3%)	55	NA	NA
AUL93026.1|2352575_2352773_-	TrmB family transcriptional regulator	NA	S5MQK8	Escherichia_phage	96.9	6.8e-28
AUL90164.1|2352985_2353675_-	antiterminator	NA	I6PDF8	Cronobacter_phage	47.6	2.7e-55
AUL90165.1|2353671_2354031_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	61.1	6.8e-34
AUL90166.1|2354043_2355093_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	53.4	1.9e-108
AUL90167.1|2355094_2355373_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	46.9	4.8e-11
AUL90168.1|2355540_2355753_-	type I toxin-antitoxin system hok family toxin	NA	A0A0U2QV81	Escherichia_phage	92.9	6.8e-26
AUL90169.1|2355942_2356047_-	hypothetical protein	NA	NA	NA	NA	NA
AUL90170.1|2356870_2357119_+	DNA damage-inducible protein DinI	NA	B6DZC1	Enterobacteria_phage	100.0	1.4e-38
AUL90171.1|2357115_2357250_-|capsid	capsid protein	capsid	NA	NA	NA	NA
AUL90172.1|2357280_2357922_-	DUF1076 domain-containing protein	NA	B6DZC0	Enterobacteria_phage	100.0	6.8e-109
AUL90173.1|2358003_2358633_-	T3SS effector protein NleG8	NA	B6DZB9	Enterobacteria_phage	92.8	4.6e-78
AUL90174.1|2358705_2359281_-	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	88.9	1.8e-89
AUL90175.1|2359393_2359663_-|tail	phage tail protein	tail	Q6H9S8	Enterobacteria_phage	98.9	1.9e-44
AUL90176.1|2359664_2360978_-|tail	phage tail protein	tail	A0A0P0ZE15	Stx2-converting_phage	97.9	3.6e-80
AUL90177.1|2361038_2361638_-	Ail/Lom family protein	NA	A0A0P0ZCF6	Stx2-converting_phage	97.0	5.9e-107
AUL90178.1|2361704_2365181_-|tail	phage tail protein	tail	Q687E8	Enterobacteria_phage	96.3	0.0e+00
AUL90179.1|2365416_2366097_-|tail	tail assembly protein	tail	A0A0P0ZDX8	Stx2-converting_phage	98.2	9.7e-114
AUL90180.1|2365994_2366738_-|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	97.6	1.5e-147
AUL90181.1|2366748_2367447_-|tail	phage minor tail protein L	tail	H6WZM3	Escherichia_phage	98.3	1.5e-130
AUL90182.1|2367446_2367776_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
AUL90183.1|2370455_2370764_-|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	100.0	1.3e-54
AUL90184.1|2370790_2371213_-|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	97.9	2.2e-71
AUL90185.1|2371226_2371979_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	100.0	5.8e-136
AUL90186.1|2371986_2372385_-|tail	phage tail protein	tail	Q9EYD7	Enterobacteria_phage	100.0	5.9e-71
AUL90187.1|2372397_2373021_-|tail	phage tail protein	tail	Q9EYD6	Enterobacteria_phage	99.5	2.5e-100
AUL90188.1|2373023_2373305_-	DNA breaking-rejoining protein	NA	Q8VNN4	Enterobacteria_phage	97.8	3.9e-45
AUL90189.1|2373297_2373624_-	DUF2190 domain-containing protein	NA	Q9EYD5	Enterobacteria_phage	100.0	6.1e-50
AUL90190.1|2377169_2377406_-	hypothetical protein	NA	S5MBY8	Escherichia_phage	100.0	4.5e-34
AUL90191.1|2377378_2379502_-|terminase	terminase	terminase	S5MDQ1	Escherichia_phage	99.0	0.0e+00
AUL90192.1|2379498_2379975_-	DUF1441 domain-containing protein	NA	Q8VNN8	Enterobacteria_phage	100.0	3.3e-84
AUL90193.1|2380387_2380855_-|lysis	lysis protein	lysis	Q7AYI6	Enterobacteria_phage	100.0	7.7e-78
AUL90194.1|2381153_2381687_-	lysozyme	NA	G9L6J6	Escherichia_phage	96.6	2.1e-100
AUL90195.1|2382198_2382990_-	hypothetical protein	NA	Q08JA0	Stx2-converting_phage	85.5	5.7e-33
AUL90196.1|2382993_2383209_-|holin	holin	holin	Q6H9V8	Enterobacteria_phage	100.0	2.0e-33
AUL90197.1|2383285_2383558_-	DUF826 domain-containing protein	NA	A0A1I9LJR2	Stx_converting_phage	100.0	1.2e-22
AUL90198.1|2383598_2383778_-	DUF1378 domain-containing protein	NA	G9L6J3	Escherichia_phage	100.0	1.3e-25
AUL90199.1|2386447_2387506_-	site-specific DNA-methyltransferase	NA	S5MDR0	Escherichia_phage	98.6	2.6e-206
AUL90200.1|2387657_2387855_-	TrmB family transcriptional regulator	NA	S5MQK8	Escherichia_phage	96.9	6.8e-28
AUL90201.1|2388081_2388903_-	antitermination protein	NA	K7P7B9	Enterobacteria_phage	61.9	2.8e-83
AUL90202.1|2388899_2389274_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.7	4.2e-34
AUL90203.1|2389286_2390336_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.3	3.4e-110
AUL90204.1|2390337_2390607_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	52.5	2.7e-11
AUL90205.1|2390660_2390888_-	hypothetical protein	NA	NA	NA	NA	NA
AUL90206.1|2391111_2391483_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
AUL90207.1|2391475_2391793_+	transcriptional regulator	NA	NA	NA	NA	NA
AUL90208.1|2391895_2392108_-	Hok/Gef family protein	NA	A0A0U2QV81	Escherichia_phage	95.7	2.5e-28
AUL90209.1|2392152_2392326_+	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	80.6	3.1e-08
AUL90210.1|2392322_2392871_-	hypothetical protein	NA	A0A2R2Z302	Escherichia_phage	75.4	1.4e-41
AUL90211.1|2393218_2393404_-	hypothetical protein	NA	NA	NA	NA	NA
AUL90212.1|2393463_2394222_-	DUF1627 domain-containing protein	NA	A0A088CE47	Shigella_phage	68.4	1.2e-80
AUL90213.1|2394256_2394922_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	97.4	3.5e-84
AUL90214.1|2395722_2396274_-	hypothetical protein	NA	NA	NA	NA	NA
AUL90215.1|2396257_2396485_-	transcriptional regulator	NA	NA	NA	NA	NA
AUL90216.1|2396562_2396970_+	transcriptional regulator	NA	I6PD69	Cronobacter_phage	45.4	7.2e-24
AUL90217.1|2397159_2397315_+	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	51.1	8.8e-07
>prophage 12
CP024618	Escherichia coli strain SMN152SH1 chromosome, complete genome	5302502	2709764	2814265	5302502	portal,plate,transposase,integrase,tail,holin,tRNA,capsid,terminase	Enterobacteria_phage(69.39%)	107	2751986:2752045	2789327:2789447
AUL90522.1|2709764_2711537_-|tRNA	aspartate--tRNA ligase	tRNA	NA	NA	NA	NA
AUL90523.1|2711846_2712413_+	hydrolase	NA	NA	NA	NA	NA
AUL90524.1|2712409_2713228_+	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	99.2	6.5e-72
AUL90525.1|2713280_2713676_+	hypothetical protein	NA	NA	NA	NA	NA
AUL90526.1|2713716_2714460_+	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	30.0	4.6e-24
AUL90527.1|2714456_2715428_+|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
AUL90528.1|2715592_2718022_-	molybdopterin guanine dinucleotide-containing S/N-oxide reductase	NA	NA	NA	NA	NA
AUL90529.1|2718046_2719147_-	cytochrome C	NA	NA	NA	NA	NA
AUL90530.1|2719534_2720281_-	copper homeostasis protein CutC	NA	NA	NA	NA	NA
AUL90531.1|2720294_2720861_-	VOC family protein	NA	NA	NA	NA	NA
AUL90532.1|2721076_2722810_+|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.5	3.4e-86
AUL90533.1|2722986_2723475_+	DUF1311 domain-containing protein	NA	NA	NA	NA	NA
AUL90534.1|2723596_2723989_-	flagellar biosynthesis protein FlhE	NA	NA	NA	NA	NA
AUL90535.1|2723988_2726067_-	flagellar biosynthesis protein FlhA	NA	NA	NA	NA	NA
AUL90536.1|2726059_2727208_-	flagellar type III secretion system protein FlhB	NA	NA	NA	NA	NA
AUL90537.1|2728064_2728454_-	two-component system response regulator	NA	A0A2K9L4R0	Tupanvirus	32.0	1.3e-06
AUL90538.1|2728468_2729518_-	chemotaxis response regulator protein-glutamate methylesterase	NA	Q56AR1	Bacillus_thuringiensis_phage	32.8	1.0e-05
AUL90539.1|2729520_2730381_-	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
AUL90540.1|2730399_2732001_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	30.6	4.4e-16
AUL90541.1|2732046_2733708_-	methyl-accepting chemotaxis protein II	NA	A0A2H4J162	uncultured_Caudovirales_phage	62.5	1.6e-08
AUL90542.1|2733850_2734354_-	chemotaxis protein CheW	NA	NA	NA	NA	NA
AUL90543.1|2736343_2737270_-	motility protein MotB	NA	NA	NA	NA	NA
AUL90544.1|2737266_2738154_-	flagellar motor stator protein MotA	NA	NA	NA	NA	NA
AUL90545.1|2738860_2739211_-	flagellar transcriptional regulator FlhD	NA	NA	NA	NA	NA
AUL90546.1|2739990_2740419_+	universal stress protein UspC	NA	NA	NA	NA	NA
AUL90547.1|2740425_2741850_-	trehalose-6-phosphate synthase	NA	NA	NA	NA	NA
AUL90548.1|2741824_2742625_-	trehalose-phosphatase	NA	NA	NA	NA	NA
AUL90549.1|2742791_2743778_-	L-arabinose ABC transporter permease AraH	NA	NA	NA	NA	NA
AUL90550.1|2743792_2745307_-	L-arabinose ABC transporter ATP-binding protein AraG	NA	A0A2H4PQG7	Staphylococcus_phage	27.1	4.3e-13
AUL90551.1|2745387_2746365_-	arabinose ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUL90552.1|2747161_2747665_+	ferritin	NA	NA	NA	NA	NA
AUL90553.1|2747743_2747995_-	DUF2766 domain-containing protein	NA	NA	NA	NA	NA
AUL90554.1|2748106_2748253_+	hypothetical protein	NA	NA	NA	NA	NA
AUL90555.1|2748458_2748782_+	hypothetical protein	NA	NA	NA	NA	NA
AUL90556.1|2748952_2749450_+	non-heme ferritin	NA	NA	NA	NA	NA
AUL90557.1|2749486_2749726_-	DUF2492 domain-containing protein	NA	NA	NA	NA	NA
AUL90558.1|2749917_2751129_+	tyrosine transporter TyrP	NA	NA	NA	NA	NA
AUL90559.1|2751190_2751856_-	YecA family protein	NA	NA	NA	NA	NA
2751986:2752045	attL	AAAAAACCACCCGAAGGTGGTTTCACGACACTGCTTATTGCTTTGATTTTATTCTTATCT	NA	NA	NA	NA
AUL90560.1|2752212_2753214_-|integrase	integrase	integrase	Q94N03	Haemophilus_virus	58.2	9.3e-105
AUL90561.1|2753219_2753567_-	DUF2511 domain-containing protein	NA	NA	NA	NA	NA
AUL90562.1|2753596_2754247_-	hypothetical protein	NA	NA	NA	NA	NA
AUL90563.1|2754262_2754667_-	transcriptional regulator	NA	Q6QID2	Burkholderia_phage	53.8	1.6e-23
AUL90564.1|2754742_2754949_+	hypothetical protein	NA	NA	NA	NA	NA
AUL90565.1|2754965_2755169_+	DNA-binding protein	NA	P79674	Haemophilus_phage	45.2	3.1e-07
AUL90566.1|2755190_2755541_+	DUF4761 domain-containing protein	NA	A0A0A7NV42	Enterobacteria_phage	81.0	1.2e-48
AUL90567.1|2755551_2755830_+	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	77.2	6.9e-34
AUL90568.1|2755841_2756084_+	DUF4754 domain-containing protein	NA	A0A0A7NQ71	Enterobacteria_phage	97.5	3.4e-37
AUL90569.1|2756280_2756484_+	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	80.6	9.5e-25
AUL90570.1|2756480_2756699_+	hypothetical protein	NA	A0A0A7NRX6	Enterobacteria_phage	50.8	8.6e-08
AUL90571.1|2756807_2757197_+	inositol monophosphatase	NA	NA	NA	NA	NA
AUL90572.1|2757193_2760034_+	replication endonuclease	NA	A0A0A7NQ77	Enterobacteria_phage	88.6	0.0e+00
AUL90573.1|2760110_2761070_+	recombinase	NA	A0A0A7NPX4	Enterobacteria_phage	99.7	2.0e-181
AUL90574.1|2761074_2761386_+	chromosome partitioning protein	NA	A0A0A7NPT5	Enterobacteria_phage	95.1	1.2e-47
AUL90575.1|2761449_2762040_+	hypothetical protein	NA	Q8HAA6	Salmonella_phage	50.7	1.8e-31
AUL90576.1|2762529_2763576_-|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	100.0	1.5e-206
AUL90577.1|2763575_2765327_-	oxidoreductase	NA	A0A0A7NV54	Enterobacteria_phage	98.1	0.0e+00
AUL90578.1|2765481_2766318_+|capsid	phage capsid protein	capsid	A0A0A7NRY7	Enterobacteria_phage	99.6	2.7e-150
AUL90579.1|2766341_2767394_+|capsid	phage major capsid protein, P2 family	capsid	A0A0A7NQ82	Enterobacteria_phage	94.6	4.9e-189
AUL90580.1|2767439_2768240_+|terminase	terminase	terminase	A0A0A7NPX9	Enterobacteria_phage	89.1	1.5e-126
AUL90581.1|2768341_2768836_+|capsid	capsid assembly protein	capsid	A0A0A7NPU2	Enterobacteria_phage	97.0	1.9e-87
AUL90582.1|2768835_2769036_+|tail	phage tail protein	tail	A0A0A7NV57	Enterobacteria_phage	98.5	7.9e-32
AUL90583.1|2769038_2769362_+|holin	holin	holin	A0A0A7NRY9	Enterobacteria_phage	93.5	1.7e-47
AUL90584.1|2769358_2769751_+	peptidase M15	NA	A0A0A7NQ86	Enterobacteria_phage	98.5	2.9e-70
AUL90585.1|2769747_2770155_+	DUF2570 domain-containing protein	NA	A0A0A7NPY2	Enterobacteria_phage	95.6	4.2e-64
AUL90586.1|2770293_2772171_+	9-O-acetyl-N-acetylneuraminic acid deacetylase	NA	H6WZJ9	Escherichia_phage	82.2	1.1e-305
AUL90587.1|2772194_2772662_+|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	94.8	6.7e-82
AUL90588.1|2772654_2773290_+	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	100.0	1.1e-114
AUL90589.1|2773286_2773868_+|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	97.4	1.2e-101
AUL90590.1|2773864_2774215_+|plate	baseplate assembly protein	plate	A0A0A7NQ90	Enterobacteria_phage	100.0	9.2e-60
AUL90591.1|2774218_2775115_+|plate	baseplate assembly protein	plate	A0A0A7NPY5	Enterobacteria_phage	97.7	1.9e-154
AUL90592.1|2775107_2775638_+|tail	phage tail protein I	tail	A0A0A7NPV1	Enterobacteria_phage	98.8	4.3e-93
AUL90593.1|2775640_2777773_+|tail	phage tail protein	tail	U5N099	Enterobacteria_phage	66.4	2.7e-130
AUL90594.1|2777772_2778351_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	88.5	2.2e-95
AUL90595.1|2779121_2779616_-|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	99.4	1.1e-85
AUL90596.1|2779622_2782430_-|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	95.6	0.0e+00
AUL90597.1|2782416_2782653_-|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	98.0	3.9e-22
AUL90598.1|2782580_2782946_-|tail	phage tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	96.7	1.1e-55
AUL90599.1|2783000_2783513_-|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	100.0	3.2e-93
AUL90600.1|2783512_2784697_-|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	99.5	5.6e-226
AUL90601.1|2784854_2785964_+	late control protein	NA	A0A0A7NQ97	Enterobacteria_phage	94.0	2.4e-194
AUL90602.1|2786363_2787503_+	hypothetical protein	NA	NA	NA	NA	NA
AUL90603.1|2787792_2788053_+	hypothetical protein	NA	NA	NA	NA	NA
AUL90604.1|2788243_2788384_+	Hok/Gef family protein	NA	A0A0A7NPZ4	Enterobacteria_phage	100.0	7.0e-19
AUL90605.1|2788572_2788965_-	hypothetical protein	NA	NA	NA	NA	NA
AUL90606.1|2789845_2790394_-	CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase	NA	NA	NA	NA	NA
2789327:2789447	attR	AAAAAACCACCCGAAGGTGGTTTCACGACACTGCTTATTGCTTTGATTTTATTCTTATCTTTCCCATGGTACCCGGAGCGGGACTTGAACCCGCACAGCGCGAACGCCGAGGGATTTTAAA	NA	NA	NA	NA
AUL90607.1|2790450_2792283_-	excinuclease ABC subunit UvrC	NA	NA	NA	NA	NA
AUL90608.1|2792279_2792936_-	DNA-binding response regulator	NA	NA	NA	NA	NA
AUL90609.1|2793394_2793619_+	DUF2594 domain-containing protein	NA	NA	NA	NA	NA
AUL90610.1|2794638_2795391_-	L-cystine ABC transporter ATP-binding protein YecC	NA	G9BWD6	Planktothrix_phage	41.4	6.0e-32
AUL90611.1|2795387_2796056_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
AUL90612.1|2796070_2797057_-	D-cysteine desulfhydrase	NA	NA	NA	NA	NA
AUL90613.1|2797161_2797962_-	cystine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUL90614.1|2798049_2798601_-	flagella biosynthesis regulatory protein FliZ	NA	NA	NA	NA	NA
AUL90615.1|2799528_2800860_-	flagellin FliC	NA	NA	NA	NA	NA
AUL90616.1|2801105_2802521_+	flagellar filament capping protein FliD	NA	NA	NA	NA	NA
AUL90617.1|2802536_2802947_+	flagella export chaperone FliS	NA	NA	NA	NA	NA
AUL90618.1|2802946_2803312_+	flagellar protein FliT	NA	NA	NA	NA	NA
AUL90619.1|2803389_2804877_+	alpha-amylase	NA	NA	NA	NA	NA
AUL90620.1|2804910_2805324_-	hypothetical protein	NA	NA	NA	NA	NA
AUL90621.1|2805510_2806716_+	YeeE/YedE family protein	NA	NA	NA	NA	NA
AUL90622.1|2806712_2806946_+	SirA-like protein	NA	NA	NA	NA	NA
AUL90623.1|2807052_2807721_+	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	60.8	9.6e-82
AUL90624.1|2808113_2808428_-	flagellar hook-basal body complex protein FliE	NA	NA	NA	NA	NA
AUL90625.1|2808642_2810301_+	flagellar basal body M-ring protein FliF	NA	NA	NA	NA	NA
AUL90626.1|2810293_2811289_+	flagellar motor switch protein FliG	NA	NA	NA	NA	NA
AUL90627.1|2811281_2811968_+	flagellar assembly protein FliH	NA	NA	NA	NA	NA
AUL90628.1|2813068_2814265_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
>prophage 13
CP024618	Escherichia coli strain SMN152SH1 chromosome, complete genome	5302502	2839224	2904107	5302502	plate,lysis,transposase,head,tail,holin,protease	Escherichia_phage(41.94%)	89	NA	NA
AUL90658.1|2839224_2839919_-|transposase	IS1 family transposase	transposase	NA	NA	NA	NA
AUL90659.1|2839980_2840511_+	cytochrome b	NA	A0A0U2QLA7	Escherichia_phage	99.1	1.6e-55
AUL90660.1|2840533_2840776_+	hypothetical protein	NA	NA	NA	NA	NA
AUL90661.1|2841146_2841461_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
AUL90662.1|2841674_2841851_-	hypothetical protein	NA	NA	NA	NA	NA
AUL90663.1|2841920_2842388_-|lysis	lysis protein	lysis	Q7AYI6	Enterobacteria_phage	87.7	2.1e-67
AUL90664.1|2842544_2843114_-	hypothetical protein	NA	A0A2R2Z339	Escherichia_phage	99.5	1.5e-104
AUL90665.1|2843388_2843922_-	lysozyme	NA	A0A1I9LJR4	Stx_converting_phage	97.7	1.3e-100
AUL90666.1|2843926_2844142_-|holin	holin	holin	A0A2R2Z340	Escherichia_phage	100.0	1.2e-33
AUL90667.1|2844219_2844465_-	DUF826 domain-containing protein	NA	A0A0P0ZGR2	Escherichia_phage	100.0	8.8e-17
AUL90668.1|2844505_2844685_-	DUF1378 domain-containing protein	NA	A0A0P0ZCJ7	Stx2-converting_phage	100.0	3.7e-25
AUL90669.1|2847075_2847342_-	hypothetical protein	NA	NA	NA	NA	NA
AUL93043.1|2847232_2847487_-	hypothetical protein	NA	H6WZJ6	Escherichia_phage	98.8	1.0e-36
AUL90670.1|2847763_2848348_-	hypothetical protein	NA	A0A2D1GNR8	Pseudomonas_phage	39.8	4.2e-17
AUL90671.1|2848515_2848764_+	transcriptional regulator	NA	A0A2D1GNH1	Pseudomonas_phage	73.2	1.3e-28
AUL90672.1|2848765_2850856_+|transposase	transposase	transposase	A0A2D1GNK9	Pseudomonas_phage	47.4	4.0e-166
AUL90673.1|2850927_2851860_+	transcriptional regulator	NA	A0A0C4UQR3	Shigella_phage	48.3	1.2e-69
AUL90674.1|2851862_2852084_+	hypothetical protein	NA	NA	NA	NA	NA
AUL90675.1|2852096_2852351_+	hypothetical protein	NA	NA	NA	NA	NA
AUL90676.1|2852352_2852634_+	host nuclease inhibitor protein	NA	I6WB15	Burkholderia_virus	47.4	2.8e-11
AUL90677.1|2852630_2852903_+	hypothetical protein	NA	NA	NA	NA	NA
AUL90678.1|2852907_2853201_+	hypothetical protein	NA	NA	NA	NA	NA
AUL90679.1|2853212_2853743_+	host-nuclease inhibitor protein Gam	NA	C9DGL8	Escherichia_phage	57.1	1.9e-48
AUL90680.1|2853840_2854383_+	hypothetical protein	NA	A0A0C4UQZ6	Shigella_phage	39.4	4.9e-28
AUL90681.1|2854386_2854920_+	hypothetical protein	NA	A0A0C4UQU2	Shigella_phage	66.7	5.9e-66
AUL90682.1|2854919_2855435_+	hypothetical protein	NA	C9DGM0	Escherichia_phage	55.4	1.2e-47
AUL90683.1|2855438_2855990_+	AsnC family protein	NA	NA	NA	NA	NA
AUL90684.1|2855986_2856298_+	hypothetical protein	NA	NA	NA	NA	NA
AUL90685.1|2856294_2856663_+	hypothetical protein	NA	NA	NA	NA	NA
AUL93044.1|2856678_2857011_+	hypothetical protein	NA	NA	NA	NA	NA
AUL90686.1|2857003_2857201_+	hypothetical protein	NA	A0A291AXE7	Shigella_phage	34.5	1.2e-05
AUL90687.1|2857190_2857487_+	hypothetical protein	NA	NA	NA	NA	NA
AUL90688.1|2857483_2857993_+	DUF1018 domain-containing protein	NA	A0A0C4UQU3	Shigella_phage	41.9	1.1e-26
AUL90689.1|2858062_2858488_+	transcriptional regulator	NA	NA	NA	NA	NA
AUL90690.1|2858559_2859060_+	endolysin	NA	B6SD29	Bacteriophage	42.6	3.0e-27
AUL93045.1|2859278_2859725_+	lysozyme	NA	B6SD19	Bacteriophage	48.0	1.2e-11
AUL90691.1|2859734_2859962_+	conjugal transfer protein TraR	NA	NA	NA	NA	NA
AUL90692.1|2859942_2860251_+	DUF2730 domain-containing protein	NA	NA	NA	NA	NA
AUL90693.1|2860247_2860538_+	hypothetical protein	NA	A0A0C4UR00	Shigella_phage	63.2	4.7e-25
AUL90694.1|2860540_2861122_+	DUF3486 domain-containing protein	NA	A0A0C4UQU5	Shigella_phage	57.0	1.9e-49
AUL90695.1|2861121_2862786_+	hypothetical protein	NA	A0A0C4UR29	Shigella_phage	73.2	8.1e-231
AUL93046.1|2862785_2864375_+	DUF935 domain-containing protein	NA	A0A0C4UQR8	Shigella_phage	57.7	1.4e-168
AUL90696.1|2864358_2865690_+|head	phage head morphogenesis protein	head	A0A0C4UQY9	Shigella_phage	58.8	3.9e-151
AUL90697.1|2865811_2866285_+	phage virion morphogenesis protein	NA	A0A0C4UR01	Shigella_phage	53.9	1.7e-37
AUL90698.1|2866461_2867586_+|protease	protease	protease	A0A0C4UQU6	Shigella_phage	47.9	2.9e-78
AUL90699.1|2867585_2868533_+|head	head protein	head	A0A0C4UQR9	Shigella_phage	67.2	1.2e-122
AUL90700.1|2868576_2868987_+	hypothetical protein	NA	NA	NA	NA	NA
AUL90701.1|2868983_2869403_+	DUF1320 domain-containing protein	NA	A0A0C4UR02	Shigella_phage	53.6	4.7e-34
AUL90702.1|2869399_2869960_+	DUF1834 domain-containing protein	NA	A0A0C4UQU7	Shigella_phage	47.7	1.1e-41
AUL90703.1|2869960_2870206_+	DUF2635 domain-containing protein	NA	C9DGP6	Escherichia_phage	54.5	2.8e-07
AUL90704.1|2870202_2871705_+|tail	phage tail protein	tail	C9DGP7	Escherichia_phage	51.3	5.6e-138
AUL90705.1|2871713_2872079_+|tail	phage tail protein	tail	C9DGP8	Escherichia_phage	51.7	2.0e-25
AUL90706.1|2872093_2872570_+	hypothetical protein	NA	A0A0C4UR03	Shigella_phage	50.8	1.0e-21
AUL90707.1|2872511_2872694_+	hypothetical protein	NA	C9DGQ0	Escherichia_phage	54.8	3.2e-08
AUL90708.1|2872696_2874772_+|tail	tail tape measure protein	tail	A0A0C4UQU8	Shigella_phage	37.7	3.7e-71
AUL90709.1|2874737_2876108_+	multidrug DMT transporter permease	NA	C9DGQ2	Escherichia_phage	33.1	1.0e-53
AUL90710.1|2876091_2877216_+|tail	phage tail protein	tail	C9DGQ3	Escherichia_phage	48.5	2.9e-91
AUL90711.1|2877205_2877820_+|plate	phage baseplate assembly protein V	plate	A0A0C4UQZ3	Shigella_phage	51.0	4.7e-51
AUL90712.1|2877812_2878250_+	hypothetical protein	NA	A0A0C4UR04	Shigella_phage	53.5	1.9e-38
AUL90713.1|2879319_2879880_+	DUF2313 domain-containing protein	NA	C9DGQ7	Escherichia_phage	48.1	2.3e-44
AUL90714.1|2879879_2880791_+|tail	phage tail protein	tail	C9DGQ8	Escherichia_phage	47.5	2.9e-36
AUL93047.1|2880825_2881347_-|tail	phage tail protein	tail	A0A0U2QV64	Escherichia_phage	52.6	2.1e-47
AUL93048.1|2881426_2881630_-|tail	phage tail protein	tail	NA	NA	NA	NA
AUL90715.1|2881652_2881859_+	hypothetical protein	NA	NA	NA	NA	NA
AUL90716.1|2881852_2882413_+	DNA-invertase	NA	A0A0C4UR34	Shigella_phage	75.7	4.3e-75
AUL90717.1|2882512_2884552_+	sialate O-acetylesterase	NA	S5MDQ7	Escherichia_phage	79.4	4.3e-274
AUL90718.1|2884698_2884881_+	DUF1378 domain-containing protein	NA	S5MBZ5	Escherichia_phage	54.4	1.3e-09
AUL90719.1|2884916_2885162_+	DUF826 domain-containing protein	NA	NA	NA	NA	NA
AUL93049.1|2885200_2885512_-	hypothetical protein	NA	NA	NA	NA	NA
AUL90720.1|2885779_2885980_+	Com family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
AUL90721.1|2885933_2886671_+	protein mom	NA	A0A0C4UQZ7	Shigella_phage	79.0	1.7e-103
AUL90722.1|2887424_2888138_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AUL90723.1|2888272_2888470_-	TrmB family transcriptional regulator	NA	S5MQK8	Escherichia_phage	95.4	7.5e-27
AUL90724.1|2888694_2889249_-	DUF1133 domain-containing protein	NA	A0A0U2S606	Escherichia_phage	66.9	6.8e-65
AUL90725.1|2889257_2889617_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.5	5.0e-37
AUL90726.1|2889629_2890679_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.3	3.4e-110
AUL90727.1|2890680_2890953_-	hypothetical protein	NA	NA	NA	NA	NA
AUL90728.1|2891074_2891419_-	TIGR00156 family protein	NA	A0A1I9LJU6	Stx_converting_phage	99.1	6.1e-56
AUL90729.1|2891538_2891751_-	Hok/Gef family protein	NA	A0A0P0ZAX5	Stx2-converting_phage	100.0	6.0e-30
AUL90730.1|2891984_2892542_-	DUF551 domain-containing protein	NA	A0A0N7KZV3	Escherichia_phage	41.7	2.8e-34
AUL90731.1|2892888_2893200_-	hypothetical protein	NA	A0A0U2QV73	Escherichia_phage	92.2	7.2e-56
AUL90732.1|2893192_2893420_-	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	49.3	5.1e-11
AUL93050.1|2893416_2893698_-	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	73.6	1.0e-29
AUL90733.1|2893730_2894447_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	62.6	2.1e-71
AUL90734.1|2894468_2895215_-	DNA replication protein DnaC	NA	A0A088CBP4	Shigella_phage	82.8	1.8e-113
AUL90735.1|2895221_2896292_-	phage replisome organizer	NA	A0A088CD36	Shigella_phage	65.7	8.5e-64
AUL90736.1|2896363_2896789_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
AUL93051.1|2897728_2898526_+	protein MtfA	NA	NA	NA	NA	NA
AUL90737.1|2902894_2904107_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	98.0	3.5e-167
>prophage 14
CP024618	Escherichia coli strain SMN152SH1 chromosome, complete genome	5302502	3005706	3039499	5302502	transposase,lysis,tail,integrase,terminase	Enterobacteria_phage(35.29%)	38	3009385:3009400	3029518:3029533
AUL90817.1|3005706_3005844_+|tail	phage tail protein	tail	A0A2R2Z347	Escherichia_phage	95.6	3.7e-17
AUL90818.1|3005949_3006831_+	T3SS effector protein NleH	NA	A5LH48	Enterobacteria_phage	90.4	3.9e-147
AUL93057.1|3006805_3006991_-	hypothetical protein	NA	NA	NA	NA	NA
AUL90819.1|3007097_3007886_+	cell division protein	NA	A5LH49	Enterobacteria_phage	98.1	1.6e-144
AUL90820.1|3008009_3008381_-|integrase	integrase	integrase	K7PH54	Enterobacteria_phage	95.1	1.1e-58
AUL90821.1|3008403_3008670_-	hypothetical protein	NA	Q9ZXG3	Shigella_phage	95.5	1.6e-43
3009385:3009400	attL	TACCCGACGATAACCA	NA	NA	NA	NA
AUL90822.1|3009829_3010327_-|terminase	terminase	terminase	A0A1I9KFT4	Aeromonas_phage	32.5	1.0e-11
AUL90823.1|3010721_3010946_+	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	92.7	4.1e-21
AUL90824.1|3011027_3011342_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
AUL90825.1|3011582_3011723_-	hypothetical protein	NA	NA	NA	NA	NA
AUL90826.1|3011805_3012273_-|lysis	lysis protein	lysis	Q7AYI6	Enterobacteria_phage	87.7	2.1e-67
AUL90827.1|3012424_3012640_-	hypothetical protein	NA	NA	NA	NA	NA
AUL90828.1|3012762_3013296_-	lysozyme	NA	B6DZ92	Enterobacteria_phage	95.5	2.4e-99
AUL90829.1|3013421_3013685_+	hypothetical protein	NA	NA	NA	NA	NA
AUL90830.1|3014151_3014379_-	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	90.4	4.2e-21
AUL90831.1|3014922_3015639_-	hypothetical protein	NA	NA	NA	NA	NA
AUL90832.1|3015849_3016539_-	antitermination protein	NA	I6PDF8	Cronobacter_phage	48.1	1.5e-58
AUL90833.1|3016553_3016676_-	hypothetical protein	NA	NA	NA	NA	NA
AUL90834.1|3017013_3017973_+	DUF2219 domain-containing protein	NA	NA	NA	NA	NA
AUL90835.1|3019034_3019379_+	hypothetical protein	NA	K7PJY7	Enterobacterial_phage	99.1	1.5e-59
AUL90836.1|3019485_3019704_+	excisionase	NA	Q77WA4	Escherichia_phage	100.0	3.7e-35
AUL90837.1|3019681_3020755_+|integrase	integrase	integrase	K7PHK0	Enterobacteria_phage	95.8	9.7e-193
AUL90838.1|3021098_3022346_+	multidrug resistance protein MdtA	NA	NA	NA	NA	NA
AUL90839.1|3022345_3025468_+	multidrug transporter subunit MdtB	NA	NA	NA	NA	NA
AUL90840.1|3025468_3028546_+	multidrug resistance protein MdtC	NA	NA	NA	NA	NA
AUL90841.1|3028546_3029962_+	multidrug transporter subunit MdtD	NA	NA	NA	NA	NA
3029518:3029533	attR	TGGTTATCGTCGGGTA	NA	NA	NA	NA
AUL90842.1|3029958_3031362_+	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	29.0	3.0e-32
AUL90843.1|3031358_3032081_+	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.2	1.9e-30
AUL90844.1|3032271_3032604_+	DUF1508 domain-containing protein	NA	NA	NA	NA	NA
AUL90845.1|3032812_3033109_+	type II toxin-antitoxin system ParD family antitoxin	NA	NA	NA	NA	NA
AUL90846.1|3033110_3033407_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
AUL90847.1|3033509_3034871_+	U32 family peptidase	NA	Q6DW11	Phage_TP	99.5	1.6e-216
AUL90848.1|3035004_3035214_-	hypothetical protein	NA	NA	NA	NA	NA
AUL90849.1|3035201_3035519_-	hypothetical protein	NA	NA	NA	NA	NA
AUL90850.1|3035932_3036832_+	lipid kinase YegS	NA	NA	NA	NA	NA
AUL90851.1|3036913_3037693_-	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
AUL90852.1|3037792_3038800_-	galactitol-1-phosphate 5-dehydrogenase	NA	NA	NA	NA	NA
AUL90853.1|3038804_3039499_-|transposase	IS1 family transposase	transposase	NA	NA	NA	NA
>prophage 15
CP024618	Escherichia coli strain SMN152SH1 chromosome, complete genome	5302502	3056352	3139144	5302502	transposase,lysis,head,tail,integrase,holin,tRNA,capsid,terminase	Enterobacteria_phage(38.57%)	84	3073453:3073468	3141400:3141415
AUL90868.1|3056352_3057046_+|transposase	IS1 family transposase	transposase	NA	NA	NA	NA
AUL90869.1|3058457_3059132_-	fimbrial assembly protein	NA	NA	NA	NA	NA
AUL90870.1|3059212_3059755_-	hypothetical protein	NA	NA	NA	NA	NA
AUL90871.1|3060046_3060328_-	DUF2574 domain-containing protein	NA	NA	NA	NA	NA
AUL90872.1|3060590_3061700_-	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
AUL90873.1|3061831_3063865_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.8e-54
AUL90874.1|3071501_3071819_+	hypothetical protein	NA	NA	NA	NA	NA
AUL90875.1|3072124_3073213_+	MoxR family ATPase	NA	NA	NA	NA	NA
AUL90876.1|3073223_3075503_+	hypothetical protein	NA	NA	NA	NA	NA
3073453:3073468	attL	TTGCTGAATTTTCGCC	NA	NA	NA	NA
AUL90877.1|3075495_3076632_+	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.1	4.2e-162
AUL90878.1|3076628_3078026_+	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	67.0	2.9e-237
AUL90879.1|3078150_3078612_+	DUF1307 domain-containing protein	NA	Q9EYF5	Enterobacteria_phage	99.3	2.4e-76
AUL90880.1|3078651_3079122_-	DUF1456 domain-containing protein	NA	Q9EYF4	Enterobacteria_phage	99.4	2.6e-81
AUL90881.1|3079168_3079888_-	DNA-binding response regulator	NA	NA	NA	NA	NA
AUL90882.1|3079884_3081570_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	99.3	8.1e-303
AUL90883.1|3081767_3082462_-|transposase	IS1 family transposase	transposase	NA	NA	NA	NA
AUL93058.1|3082630_3083659_+	secretion protein EspV	NA	Q6H9S1	Enterobacteria_phage	99.4	2.0e-195
AUL90884.1|3084311_3085556_+	hypothetical protein	NA	H6WZN2	Escherichia_phage	91.1	2.0e-229
AUL90885.1|3085887_3086469_-	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	60.0	4.3e-54
AUL90886.1|3086579_3086849_-|tail	phage tail protein	tail	B6DZB8	Enterobacteria_phage	98.9	4.9e-45
AUL90887.1|3088887_3092364_-|tail	phage tail protein	tail	A0A0P0ZCI5	Stx2-converting_phage	97.3	0.0e+00
AUL90888.1|3092599_3093280_-|tail	tail assembly protein	tail	A0A0P0ZDX8	Stx2-converting_phage	96.4	4.1e-112
AUL90889.1|3093177_3093921_-|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	96.3	7.5e-144
AUL90890.1|3093931_3094630_-|tail	phage minor tail protein L	tail	H6WZM3	Escherichia_phage	98.7	3.1e-131
AUL90891.1|3094629_3094971_-|tail	phage tail protein	tail	A0A0P0ZCS8	Stx2-converting_phage	100.0	8.7e-63
AUL90892.1|3098253_3098535_-	DUF4035 domain-containing protein	NA	H6WZM0	Escherichia_phage	98.9	2.3e-45
AUL90893.1|3099724_3100069_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
AUL90894.1|3100065_3100512_-	hypothetical protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
AUL90895.1|3100508_3100859_-|head,tail	head-tail adaptor protein	head,tail	A0A0P0ZB28	Stx2-converting_phage	99.1	1.0e-58
AUL90896.1|3100869_3101196_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDE0	Stx2-converting_phage	100.0	5.4e-54
AUL90897.1|3103722_3103944_-	hypothetical protein	NA	A0A0P0ZD92	Stx2-converting_phage	100.0	5.8e-36
AUL90898.1|3103988_3105926_-|capsid	phage major capsid protein	capsid	A0A0P0ZCT9	Stx2-converting_phage	100.0	0.0e+00
AUL90899.1|3105989_3107651_-|terminase	terminase	terminase	A0A0P0ZEI4	Stx2-converting_phage	98.6	0.0e+00
AUL90900.1|3107647_3108211_-|terminase	terminase small subunit	terminase	A0A0P0ZD56	Stx2-converting_phage	92.5	3.3e-83
AUL90901.1|3108394_3108532_-	DNase	NA	H6WZK7	Escherichia_phage	75.0	6.6e-06
AUL90902.1|3108500_3108866_-	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	99.2	4.0e-66
AUL90903.1|3108907_3109135_+	DUF3950 domain-containing protein	NA	A0A0P0ZE23	Stx2-converting_phage	100.0	1.7e-35
AUL90904.1|3109386_3109521_+	hypothetical protein	NA	NA	NA	NA	NA
AUL90905.1|3109597_3109855_-	hypothetical protein	NA	A0A0P0ZBT1	Stx2-converting_phage	100.0	5.0e-39
AUL90906.1|3109851_3110349_-	DNA-binding protein	NA	A0A0P0ZBU2	Stx2-converting_phage	100.0	3.6e-94
AUL90907.1|3110548_3110986_-|lysis	lysis protein	lysis	A0A0P0ZBQ9	Stx2-converting_phage	96.6	4.2e-70
AUL90908.1|3110982_3111480_-	lysozyme	NA	A0A0N7KZA0	Stx2-converting_phage	97.0	2.4e-90
AUL90909.1|3111479_3111695_-|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	7.7e-33
AUL90910.1|3111693_3111855_+	hypothetical protein	NA	NA	NA	NA	NA
AUL90911.1|3111978_3113829_-	9-O-acetyl-N-acetylneuraminic acid deacetylase	NA	B6DZ89	Enterobacteria_phage	98.5	0.0e+00
AUL90912.1|3114906_3115395_-	antiterminator	NA	Q5TJL7	Enterobacteria_phage	99.4	7.7e-89
AUL90913.1|3115385_3116057_-	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	96.9	1.6e-129
AUL90914.1|3116053_3116659_-	protein NinG	NA	Q5TJL9	Enterobacteria_phage	99.0	8.1e-96
AUL90915.1|3116658_3117381_-	DNA-binding protein	NA	O48426	Enterobacteria_phage	96.7	3.6e-127
AUL90916.1|3117532_3118582_-	hypothetical protein	NA	Q9T208	Enterobacteria_phage	100.0	1.3e-181
AUL90917.1|3118763_3119291_-	phage N-6-adenine-methyltransferase	NA	A0A1I9LJP9	Stx_converting_phage	98.9	2.3e-99
AUL90918.1|3119287_3119746_-	recombination protein NinB	NA	M1FPM8	Enterobacteria_phage	100.0	1.6e-80
AUL90919.1|3119801_3120092_-	protein ren	NA	A0A1I9LJP5	Stx_converting_phage	100.0	9.6e-47
AUL90920.1|3120088_3120790_-	Replication protein P	NA	K7P6G2	Enterobacteria_phage	99.1	8.4e-129
AUL90921.1|3120786_3121725_-	Replication protein O	NA	A0A1I9LJP3	Stx_converting_phage	100.0	1.3e-172
AUL90922.1|3121757_3122054_-	hypothetical protein	NA	Q6H9X8	Enterobacteria_phage	100.0	5.2e-48
AUL90923.1|3122192_3122420_-	DNA-binding protein	NA	G9L677	Escherichia_phage	100.0	7.8e-36
AUL90924.1|3122498_3123206_+	phage repressor protein C	NA	G9L676	Escherichia_phage	100.0	1.5e-133
AUL90925.1|3123266_3123608_+	DUF3024 domain-containing protein	NA	G9L675	Escherichia_phage	98.2	2.8e-61
AUL90926.1|3123674_3124136_+	hypothetical protein	NA	G9L674	Escherichia_phage	99.3	1.9e-76
AUL90927.1|3124129_3125176_+	serine/threonine protein kinase	NA	G9L673	Escherichia_phage	99.4	1.3e-205
AUL90928.1|3125831_3126215_+	antitermination protein	NA	G9L671	Escherichia_phage	100.0	3.9e-64
AUL90929.1|3126328_3127541_+|transposase	IS3 family transposase	transposase	Q6H9S6	Enterobacteria_phage	99.0	8.4e-169
AUL90930.1|3127586_3128057_+	hypothetical protein	NA	A0A1U9AJ69	Stx1_converting_phage	100.0	1.7e-88
AUL90931.1|3128207_3128576_+	DUF2528 domain-containing protein	NA	A0A1U9AJB3	Stx1_converting_phage	100.0	2.0e-65
AUL90932.1|3128655_3128895_+	host cell division inhibitory peptide Kil	NA	A0A0P0ZAF7	Stx2-converting_phage	100.0	1.6e-31
AUL90933.1|3128920_3130133_+|transposase	IS3 family transposase	transposase	Q6H9S6	Enterobacteria_phage	99.7	3.4e-170
AUL90934.1|3130313_3130610_+	host-nuclease inhibitor protein Gam	NA	Q9EYA6	Enterobacteria_phage	100.0	4.3e-50
AUL90935.1|3130615_3131401_+	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
AUL90936.1|3131397_3132078_+	exonuclease	NA	B6DZ61	Enterobacteria_phage	98.2	3.0e-131
AUL90937.1|3132074_3132257_+	DUF1317 domain-containing protein	NA	A0A1U8QQC1	Enterobacteria_phage	96.7	6.9e-27
AUL90938.1|3132229_3132421_+	hypothetical protein	NA	A0A0P0ZC67	Stx2-converting_phage	98.4	2.1e-26
AUL90939.1|3132431_3132713_+	hypothetical protein	NA	A0A0P0ZE02	Stx2-converting_phage	98.9	7.2e-47
AUL90940.1|3132811_3133033_+	conjugal transfer protein TraR	NA	A0A1I9LJM6	Stx_converting_phage	100.0	2.9e-35
AUL90941.1|3133029_3133800_+	hypothetical protein	NA	Q6H9Z5	Enterobacteria_phage	98.8	6.2e-141
AUL93059.1|3134290_3134551_+	DUF551 domain-containing protein	NA	A5LH60	Enterobacteria_phage	82.3	1.5e-43
AUL90942.1|3134638_3134881_+	DUF4222 domain-containing protein	NA	B6DZ51	Enterobacteria_phage	100.0	1.5e-37
AUL90943.1|3134884_3135019_+	hypothetical protein	NA	A0A0P0ZDP5	Stx2-converting_phage	100.0	4.9e-22
AUL90944.1|3135037_3135292_+	excisionase	NA	Q859D3	Escherichia_coli_phage	100.0	3.0e-44
AUL90945.1|3135325_3136612_+|integrase	site-specific integrase	integrase	Q9EY96	Enterobacteria_phage	100.0	7.6e-253
AUL90946.1|3136632_3137334_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.5	3.9e-102
AUL90947.1|3137393_3137501_+	hypothetical protein	NA	NA	NA	NA	NA
AUL90948.1|3137481_3138213_-	osmoprotectant uptake system permease	NA	NA	NA	NA	NA
AUL90949.1|3138217_3139144_-	ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.1	3.3e-24
3141400:3141415	attR	GGCGAAAATTCAGCAA	NA	NA	NA	NA
>prophage 16
CP024618	Escherichia coli strain SMN152SH1 chromosome, complete genome	5302502	3330182	3474849	5302502	plate,portal,bacteriocin,transposase,lysis,tail,integrase,holin,tRNA,capsid,terminase	Escherichia_phage(39.52%)	168	3410009:3410025	3457407:3457423
AUL91103.1|3330182_3331073_-|transposase	ISNCY family transposase	transposase	Q2A0A7	Sodalis_phage	43.9	1.2e-66
AUL91104.1|3331269_3332043_-	histidine transport ATP-binding protein HisP	NA	G9BWD6	Planktothrix_phage	38.1	2.4e-23
AUL91105.1|3332050_3332767_-	histidine ABC transporter permease	NA	NA	NA	NA	NA
AUL91106.1|3332763_3333450_-	histidine ABC transporter permease	NA	NA	NA	NA	NA
AUL91107.1|3333539_3334322_-	histidine ABC transporter substrate-binding protein HisJ	NA	NA	NA	NA	NA
AUL91108.1|3334542_3335325_-	lysine/arginine/ornithine ABC transporter substrate-binding protein ArgT	NA	NA	NA	NA	NA
AUL91109.1|3335590_3336160_-	3-octaprenyl-4-hydroxybenzoate carboxy-lyase	NA	NA	NA	NA	NA
AUL91110.1|3336254_3337772_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	44.0	5.9e-87
AUL91111.1|3337808_3338297_-	colicin V production protein	NA	NA	NA	NA	NA
AUL91112.1|3338555_3339218_-	SPOR domain-containing protein	NA	NA	NA	NA	NA
AUL91113.1|3339207_3340476_-	bifunctional tetrahydrofolate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
AUL91114.1|3340545_3341460_-	acetyl-CoA carboxylase carboxyltransferase subunit beta	NA	NA	NA	NA	NA
AUL91115.1|3341615_3342275_-	protein DedA	NA	NA	NA	NA	NA
AUL91116.1|3342357_3343170_-|tRNA	tRNA pseudouridine(38-40) synthase	tRNA	NA	NA	NA	NA
AUL91117.1|3343169_3344183_-	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
AUL91118.1|3344248_3345406_-	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	29.3	1.7e-22
AUL91119.1|3346498_3347712_-|transposase	IS3 family transposase	transposase	Q6H9S6	Enterobacteria_phage	99.7	3.4e-170
AUL91120.1|3347785_3348136_+|plate	baseplate assembly protein	plate	A0A0A7NQ90	Enterobacteria_phage	99.1	2.7e-59
AUL91121.1|3348139_3349036_+|plate	baseplate assembly protein	plate	A0A0A7NPY5	Enterobacteria_phage	97.7	1.1e-154
AUL91122.1|3349028_3349559_+|tail	phage tail protein I	tail	A0A0A7NPV1	Enterobacteria_phage	99.4	5.1e-94
AUL91123.1|3349561_3352024_+|tail	phage tail protein	tail	A0A0A7NV63	Enterobacteria_phage	97.2	8.1e-110
AUL91124.1|3352023_3352602_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	88.5	2.9e-95
AUL93069.1|3352645_3353122_-	serine acetyltransferase	NA	NA	NA	NA	NA
AUL91125.1|3353374_3353869_-|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	99.4	1.1e-85
AUL91126.1|3353875_3356683_-|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	95.8	0.0e+00
AUL91127.1|3356669_3356906_-|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	96.1	1.9e-21
AUL91128.1|3356833_3357199_-|tail	phage tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	98.3	1.7e-56
AUL91129.1|3357253_3357766_-|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	100.0	3.2e-93
AUL91130.1|3357765_3358950_-|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	99.0	8.1e-225
AUL91131.1|3359107_3359431_+|tail	phage tail protein	tail	A0A0A7NQ97	Enterobacteria_phage	100.0	1.1e-43
AUL91132.1|3362792_3363053_+	hypothetical protein	NA	NA	NA	NA	NA
AUL91133.1|3363244_3363385_+	Hok/Gef family protein	NA	A0A0A7NPZ4	Enterobacteria_phage	100.0	7.0e-19
AUL91134.1|3363647_3363980_+	zinc ribbon domain-containing protein	NA	NA	NA	NA	NA
AUL91135.1|3363984_3364878_+	type VI secretion protein	NA	NA	NA	NA	NA
AUL91136.1|3365146_3366142_+	flagella biosynthesis regulator Flk	NA	NA	NA	NA	NA
AUL91137.1|3366138_3367317_-	arabinose transporter	NA	NA	NA	NA	NA
AUL91138.1|3367258_3367480_+	hypothetical protein	NA	NA	NA	NA	NA
AUL91139.1|3367625_3368846_-	beta-ketoacyl-[acyl-carrier-protein] synthase I	NA	NA	NA	NA	NA
AUL91140.1|3369004_3371011_+|tRNA	bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC	tRNA	NA	NA	NA	NA
AUL91141.1|3371131_3371410_-	YfcL family protein	NA	NA	NA	NA	NA
AUL91142.1|3371443_3371992_-	elongation factor P hydroxylase	NA	NA	NA	NA	NA
AUL91143.1|3371991_3372801_-	hypothetical protein	NA	NA	NA	NA	NA
AUL91144.1|3372800_3373625_-	penicillin-insensitive murein endopeptidase	NA	NA	NA	NA	NA
AUL91145.1|3373628_3374714_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	48.4	9.1e-90
AUL91146.1|3374748_3375681_-	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
AUL91147.1|3375846_3376398_+	endonuclease SmrB	NA	NA	NA	NA	NA
AUL91148.1|3376519_3377377_-	DUF2544 domain-containing protein	NA	NA	NA	NA	NA
AUL91149.1|3377378_3377903_-	fimbrial protein	NA	NA	NA	NA	NA
AUL91150.1|3380884_3381448_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
AUL91151.1|3382122_3382608_-	phosphohistidine phosphatase	NA	NA	NA	NA	NA
AUL91152.1|3382810_3384955_-	fatty acid oxidation complex subunit alpha FadJ	NA	NA	NA	NA	NA
AUL91153.1|3384954_3386265_-	acetyl-CoA C-acyltransferase FadI	NA	NA	NA	NA	NA
AUL91154.1|3386445_3386730_-	hypothetical protein	NA	NA	NA	NA	NA
AUL91155.1|3386814_3387066_-	hypothetical protein	NA	NA	NA	NA	NA
AUL91156.1|3387101_3388442_+	long-chain fatty acid transporter	NA	NA	NA	NA	NA
AUL91157.1|3388807_3389866_+	hypothetical protein	NA	NA	NA	NA	NA
AUL91158.1|3390047_3390803_-	phospholipid-binding lipoprotein MlaA	NA	NA	NA	NA	NA
AUL91159.1|3390828_3390999_-	hypothetical protein	NA	NA	NA	NA	NA
AUL91160.1|3391096_3392029_+	hypothetical protein	NA	E7DYY8	Enterobacteria_phage	99.7	2.1e-167
AUL91161.1|3392250_3400602_-	hypothetical protein	NA	Q08J70	Stx2-converting_phage	94.3	0.0e+00
AUL91162.1|3400670_3401936_-	hypothetical protein	NA	A0A1I9LJU3	Stx_converting_phage	98.8	9.9e-205
AUL91163.1|3401946_3402198_-|bacteriocin	bacteriocin	bacteriocin	A0A2R2Z351	Escherichia_phage	100.0	7.9e-13
AUL91164.1|3402207_3402654_-	hypothetical protein	NA	A0A2R2Z357	Escherichia_phage	100.0	6.2e-77
AUL91165.1|3402656_3403313_-	hypothetical protein	NA	A0A2R2Z361	Escherichia_phage	100.0	2.4e-109
AUL91166.1|3403406_3403808_-	hypothetical protein	NA	A0A2R2Z359	Escherichia_phage	100.0	3.7e-73
AUL91167.1|3403864_3404005_-	Hok/Gef family protein	NA	A0A2R2X2B4	Escherichia_phage	100.0	3.1e-19
AUL91168.1|3404061_3404307_+	hypothetical protein	NA	Q7Y2U2	Escherichia_phage	100.0	5.7e-40
AUL91169.1|3404237_3404972_-	outer membrane protein	NA	A0A2R2Z365	Escherichia_phage	100.0	1.3e-135
AUL91170.1|3405062_3405680_-	hypothetical protein	NA	A0A2R2Z362	Escherichia_phage	100.0	1.1e-121
AUL91171.1|3405685_3405964_-	outer membrane protein	NA	A0A2R2Z367	Escherichia_phage	100.0	1.1e-50
AUL91172.1|3405978_3407247_-	host specificity protein J	NA	A0A2L1IV54	Escherichia_phage	89.5	2.6e-213
AUL91173.1|3407243_3408869_-	hypothetical protein	NA	A0A088CBK0	Shigella_phage	99.8	0.0e+00
AUL91174.1|3409034_3409277_+	outer membrane protein	NA	NA	NA	NA	NA
AUL91175.1|3409172_3409406_-	hypothetical protein	NA	A0A0N7CHY0	Escherichia_phage	100.0	1.6e-39
AUL91176.1|3409490_3409760_-|tail	phage tail protein	tail	Q9EYE9	Enterobacteria_phage	98.9	6.4e-45
AUL91177.1|3409761_3411699_-|tail	phage tail protein	tail	A0A1I9LJS9	Stx_converting_phage	100.0	1.1e-64
3410009:3410025	attL	CCCTTCGGCCCCTGAGG	NA	NA	NA	NA
AUL91178.1|3411695_3412346_-	hypothetical protein	NA	A0A0H4J3F2	Shigella_phage	99.5	3.9e-120
AUL91179.1|3412345_3412909_-	hypothetical protein	NA	A0A2R2Z349	Escherichia_phage	100.0	3.2e-102
AUL91180.1|3412892_3413354_-	hypothetical protein	NA	A0A2R2Z354	Escherichia_phage	100.0	7.8e-75
AUL91181.1|3413403_3413793_-	hypothetical protein	NA	A0A2R2Z353	Escherichia_phage	100.0	9.9e-63
AUL91182.1|3413848_3415063_-|capsid	N4-gp56 family major capsid protein	capsid	A0A2R2Z358	Escherichia_phage	100.0	1.3e-233
AUL91183.1|3415086_3416094_-	hypothetical protein	NA	A0A2R2Z355	Escherichia_phage	99.7	1.5e-179
AUL91184.1|3416251_3418396_-|portal	portal protein	portal	A0A2R2Z346	Escherichia_phage	99.9	0.0e+00
AUL91185.1|3418395_3420102_-|terminase	terminase	terminase	A0A1U9AJA6	Stx1_converting_phage	100.0	0.0e+00
AUL91186.1|3420082_3420889_-|terminase	terminase	terminase	A0A1U9AJA9	Stx1_converting_phage	100.0	1.7e-133
AUL91187.1|3421288_3421546_-	hypothetical protein	NA	A0A0P0ZBT1	Stx2-converting_phage	100.0	5.0e-39
AUL93070.1|3421542_3422040_-	DNA-binding protein	NA	A0A0H4IPL1	Shigella_phage	100.0	2.4e-93
AUL91188.1|3422220_3422688_-|lysis	lysis protein	lysis	A0A0H4IT10	Shigella_phage	100.0	1.2e-78
AUL91189.1|3422844_3423411_-	hypothetical protein	NA	A0A0H4IQ87	Shigella_phage	100.0	1.4e-105
AUL91190.1|3423685_3424219_-	lysozyme	NA	V5USG4	Shigella_phage	100.0	7.9e-103
AUL91191.1|3424223_3424439_-|holin	holin	holin	Q9ZWW2	Enterobacteria_phage	100.0	6.9e-34
AUL91192.1|3424515_3424788_-	DUF826 domain-containing protein	NA	A0A1I9LJR2	Stx_converting_phage	100.0	1.2e-22
AUL91193.1|3424828_3425008_-	DUF1378 domain-containing protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
AUL91194.1|3425142_3427080_-	sialate O-acetylesterase	NA	A0A1I9LJQ8	Stx_converting_phage	99.8	0.0e+00
AUL91195.1|3427206_3427434_-	hypothetical protein	NA	Q5MBW5	Stx1-converting_phage	98.3	7.8e-28
AUL91196.1|3427889_3428603_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AUL93071.1|3428641_3428821_+	hypothetical protein	NA	NA	NA	NA	NA
AUL91197.1|3430183_3430381_-	TrmB family transcriptional regulator	NA	S5MQK8	Escherichia_phage	96.9	9.8e-27
AUL91198.1|3430607_3431429_-	antitermination protein	NA	K7P7B9	Enterobacteria_phage	61.2	4.1e-82
AUL91199.1|3431425_3431803_-	RusA family crossover junction endodeoxyribonuclease	NA	A5VW85	Enterobacteria_phage	64.9	1.1e-37
AUL91200.1|3431799_3432090_-	DUF1364 domain-containing protein	NA	K7PKV0	Enterobacteria_phage	100.0	3.4e-52
AUL91201.1|3432089_3432812_-	DNA-binding protein	NA	A0A0P0ZBS6	Stx2-converting_phage	99.6	3.0e-129
AUL91202.1|3432886_3433564_-	phage antirepressor Ant	NA	A0A0P0ZC44	Stx2-converting_phage	98.7	4.0e-128
AUL91203.1|3433839_3434022_-	NinE family protein	NA	A0A0N7C1X3	Escherichia_phage	100.0	5.7e-29
AUL91204.1|3434018_3434546_-	phage N-6-adenine-methyltransferase	NA	H6WZI7	Escherichia_phage	99.4	1.2e-100
AUL91205.1|3434542_3434989_-	recombination protein NinB	NA	A0A0N7C2V1	Escherichia_phage	100.0	2.4e-81
AUL91206.1|3434945_3435182_-	restriction alleviation protein, Lar family	NA	Q8HA09	Enterobacteria_phage	100.0	1.2e-39
AUL91207.1|3435192_3435408_-	hypothetical protein	NA	A0A1I9LJP7	Stx_converting_phage	100.0	1.3e-32
AUL91208.1|3435540_3435819_-	hypothetical protein	NA	Q9EYB9	Enterobacteria_phage	98.9	2.2e-48
AUL91209.1|3435889_3437266_-	replicative DNA helicase	NA	A0A0P0ZC27	Stx2-converting_phage	99.1	2.4e-252
AUL91210.1|3437262_3438150_-	replication protein	NA	A5VW95	Enterobacteria_phage	98.0	4.9e-142
AUL91211.1|3438212_3438485_-	hypothetical protein	NA	G9L679	Escherichia_phage	100.0	2.7e-43
AUL91212.1|3438507_3438807_-	hypothetical protein	NA	A0A0P0ZBJ0	Stx2-converting_phage	99.0	3.7e-49
AUL91213.1|3438948_3439164_-	XRE family transcriptional regulator	NA	A0A0N7C2U7	Escherichia_phage	100.0	2.2e-35
AUL91214.1|3439239_3439935_+	phage repressor	NA	A0A0N7BTS4	Escherichia_phage	100.0	8.6e-134
AUL91215.1|3440436_3440958_+	hypothetical protein	NA	A0A0N7BTU4	Escherichia_phage	100.0	1.8e-88
AUL91216.1|3441068_3441230_-	hypothetical protein	NA	A0A0P0ZCZ3	Stx2-converting_phage	100.0	2.7e-22
AUL91217.1|3441526_3441709_+	hypothetical protein	NA	A0A0N7C057	Escherichia_phage	100.0	2.8e-28
AUL91218.1|3441686_3441959_+	antitermination protein N	NA	A0A0N7C217	Escherichia_phage	100.0	5.7e-41
AUL91219.1|3442018_3442489_+	hypothetical protein	NA	A0A1I9LJN4	Stx_converting_phage	99.4	1.8e-87
AUL91220.1|3442687_3442927_+	host cell division inhibitory peptide Kil	NA	K7PL44	Enterobacteria_phage	97.5	2.6e-37
AUL91221.1|3442923_3443112_+	hypothetical protein	NA	G9L668	Escherichia_phage	100.0	2.2e-28
AUL91222.1|3443120_3443801_+	ATP-binding protein	NA	G9L667	Escherichia_phage	100.0	3.4e-127
AUL91223.1|3443797_3444385_+	DUF669 domain-containing protein	NA	G9L666	Escherichia_phage	99.0	5.4e-105
AUL91224.1|3444408_3444705_+	RecBCD nuclease inhibitor	NA	A5VWB0	Enterobacteria_phage	98.0	9.5e-50
AUL91225.1|3444715_3444880_+	DUF2737 domain-containing protein	NA	A0A2I6PID4	Escherichia_phage	98.1	4.6e-22
AUL91226.1|3444876_3445491_+	hypothetical protein	NA	A0A0P0ZFU9	Escherichia_phage	71.7	9.2e-55
AUL91227.1|3445487_3445898_+	hypothetical protein	NA	A0A076G6X8	Escherichia_phage	72.1	2.0e-29
AUL91228.1|3445906_3446566_+	hypothetical protein	NA	A0A2I6TCG8	Escherichia_phage	61.5	3.4e-39
AUL91229.1|3446562_3447333_+	hypothetical protein	NA	Q08J58	Stx2-converting_phage	100.0	1.5e-142
AUL91230.1|3447334_3447526_+	hypothetical protein	NA	Q6H9Z6	Enterobacteria_phage	100.0	1.2e-26
AUL91231.1|3447528_3448125_+	DUF551 domain-containing protein	NA	Q6H9Z7	Enterobacteria_phage	99.5	6.3e-117
AUL91232.1|3448220_3448949_+	hypothetical protein	NA	A0A0P0ZD96	Stx2-converting_phage	100.0	7.9e-130
AUL91233.1|3449272_3449911_+	phage antirepressor Ant	NA	A0A0P0ZG08	Escherichia_phage	99.5	5.5e-119
AUL91234.1|3449966_3450398_+	regulator	NA	A0A2R2Z303	Escherichia_phage	99.3	2.1e-74
AUL91235.1|3450394_3451021_+	adenine methylase	NA	A0A2R2Z304	Escherichia_phage	100.0	1.0e-122
AUL91236.1|3450980_3451193_+	hypothetical protein	NA	A0A0P0ZGA1	Escherichia_phage	100.0	7.1e-31
AUL91237.1|3451228_3451606_+	hypothetical protein	NA	A0A2R2Z2X7	Escherichia_phage	98.4	1.7e-51
AUL91238.1|3451684_3451867_+	DNA-binding protein	NA	A0A2R2Z2X2	Escherichia_phage	100.0	4.1e-27
AUL91239.1|3451850_3453020_-|integrase	integrase	integrase	A0A2R2Z2Y0	Escherichia_phage	99.7	3.7e-230
AUL91240.1|3453451_3454618_+|integrase	integrase	integrase	Q716F9	Shigella_phage	98.7	1.6e-220
AUL91241.1|3454714_3455413_-	T3SS effector protein NleD	NA	NA	NA	NA	NA
AUL91242.1|3455459_3455669_+	hypothetical protein	NA	NA	NA	NA	NA
AUL91243.1|3455643_3456525_-	T3SS effector protein NleH	NA	A5LH48	Enterobacteria_phage	89.4	1.1e-144
AUL91244.1|3456630_3456900_-|tail	phage tail protein	tail	B6DZB8	Enterobacteria_phage	98.9	4.9e-45
AUL91245.1|3458276_3458876_-	Ail/Lom family protein	NA	A0A0P0ZE39	Stx2-converting_phage	98.0	8.2e-109
3457407:3457423	attR	CCCTTCGGCCCCTGAGG	NA	NA	NA	NA
AUL91246.1|3458942_3459674_-	host specificity protein J	NA	Q687E8	Enterobacteria_phage	99.6	4.2e-123
AUL91247.1|3460060_3460276_-|holin	holin	holin	Q9ZWW2	Enterobacteria_phage	100.0	6.9e-34
AUL91248.1|3460352_3460625_-	DUF826 domain-containing protein	NA	A0A0P0ZC09	Stx2-converting_phage	100.0	4.8e-24
AUL91249.1|3460665_3460845_-	DUF1378 domain-containing protein	NA	A0A2R2Z345	Escherichia_phage	96.6	1.4e-24
AUL91250.1|3460981_3462919_-	sialate O-acetylesterase	NA	A0A0P0ZBP4	Stx2-converting_phage	96.4	0.0e+00
AUL91251.1|3463629_3463782_-	DNA methylase	NA	A0A2R2Z327	Escherichia_phage	100.0	4.0e-20
AUL91252.1|3463796_3464042_+	hypothetical protein	NA	A0A0P0ZGS0	Escherichia_phage	100.0	5.0e-36
AUL91253.1|3464030_3464465_-	antitermination protein	NA	Q777W5	Enterobacteria_phage	99.3	1.8e-81
AUL91254.1|3464457_3464652_-	protein ninH	NA	G9L694	Escherichia_phage	100.0	1.9e-30
AUL91255.1|3464648_3465254_-	recombination protein NinG	NA	Q8VNP2	Enterobacteria_phage	100.0	1.9e-97
AUL91256.1|3465253_3465976_-	DNA-binding protein	NA	A0A0P0ZCB2	Stx2-converting_phage	99.6	3.9e-129
AUL91257.1|3466050_3466785_-	phage antirepressor Ant	NA	A0A0N7C203	Escherichia_phage	99.6	5.5e-123
AUL91258.1|3467145_3467841_-|transposase	IS1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	97.8	3.1e-131
AUL91259.1|3467876_3468017_-	NinE family protein	NA	A5VW90	Enterobacteria_phage	100.0	1.0e-14
AUL91260.1|3468536_3468983_-	recombination protein NinB	NA	A0A0N7C2V1	Escherichia_phage	100.0	2.4e-81
AUL91261.1|3468939_3469176_-	restriction alleviation protein, Lar family	NA	Q8HA09	Enterobacteria_phage	100.0	1.2e-39
AUL91262.1|3469186_3469402_-	hypothetical protein	NA	A0A1I9LJP7	Stx_converting_phage	100.0	1.3e-32
AUL91263.1|3469534_3469813_-	hypothetical protein	NA	Q9ZWY1	Enterobacteria_phage	100.0	3.4e-49
AUL91264.1|3469883_3470174_-	protein ren	NA	A0A1I9LJP5	Stx_converting_phage	100.0	9.6e-47
AUL91265.1|3470170_3470872_-	Replication protein P	NA	A0A1U9AJJ8	Stx1_converting_phage	100.0	3.4e-130
AUL93072.1|3470868_3471420_-	replication protein O	NA	M1FN81	Enterobacteria_phage	99.5	9.6e-104
AUL91266.1|3473415_3474849_+	glycosyl hydrolase family 32	NA	F8WPR5	Bacillus_phage	25.4	9.1e-29
>prophage 17
CP024618	Escherichia coli strain SMN152SH1 chromosome, complete genome	5302502	3695666	3782630	5302502	plate,portal,head,tail,integrase,tRNA,capsid	Salmonella_phage(60.66%)	99	3739356:3739400	3774390:3774434
AUL91457.1|3695666_3696404_-|tRNA	tRNA (adenosine(37)-N6)-methyltransferase TrmM	tRNA	NA	NA	NA	NA
AUL91458.1|3696535_3697864_+	ATP-dependent RNA helicase SrmB	NA	E3T5E1	Cafeteria_roenbergensis_virus	30.8	2.9e-45
AUL91459.1|3698072_3698954_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUL91460.1|3699056_3699644_+	cysteine/O-acetylserine efflux protein	NA	NA	NA	NA	NA
AUL91461.1|3699699_3700083_-	autonomous glycyl radical cofactor GrcA	NA	Q7Y524	Enterobacteria_phage	72.0	1.4e-32
AUL91462.1|3700385_3701075_+	uracil-DNA glycosylase	NA	A0A1L2JU97	Alcelaphine_gammaherpesvirus	51.5	1.3e-54
AUL91463.1|3701122_3702160_-	methyltransferase	NA	NA	NA	NA	NA
AUL91464.1|3702149_3702353_-	hypothetical protein	NA	NA	NA	NA	NA
AUL91465.1|3702366_3702786_+	thiol disulfide reductase thioredoxin	NA	A0A0K2FIM3	Achromobacter_phage	38.5	2.8e-15
AUL93077.1|3702854_3703553_+	DTW domain-containing protein YfiP	NA	NA	NA	NA	NA
AUL91466.1|3703584_3706245_+	protein lysine acetyltransferase	NA	NA	NA	NA	NA
AUL91467.1|3706358_3707714_+	phosphatidylserine synthase	NA	NA	NA	NA	NA
AUL91468.1|3707759_3708083_+	lipoprotein	NA	NA	NA	NA	NA
AUL91469.1|3708079_3709378_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	32.2	1.3e-45
AUL91470.1|3709359_3709473_-	alpha-ketoglutarate permease	NA	NA	NA	NA	NA
AUL91471.1|3715154_3717728_-	chaperone protein ClpB	NA	H6X3M6	Enterobacteria_phage	35.3	2.6e-127
AUL91472.1|3717857_3718589_-	laccase domain-containing protein	NA	NA	NA	NA	NA
AUL91473.1|3718585_3719566_-	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
AUL91474.1|3719700_3720438_+	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
AUL91475.1|3720467_3720674_+	hypothetical protein	NA	NA	NA	NA	NA
AUL91476.1|3720708_3721050_+	ribosome-associated inhibitor A	NA	NA	NA	NA	NA
AUL91477.1|3721300_3722461_+	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
AUL91478.1|3722503_3723625_-	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
AUL91479.1|3723635_3724706_-	3-deoxy-7-phosphoheptulonate synthase	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.2	4.0e-90
AUL91480.1|3724915_3725281_+	hypothetical protein	NA	NA	NA	NA	NA
AUL91481.1|3725430_3725949_+	DUF4154 domain-containing protein	NA	NA	NA	NA	NA
AUL91482.1|3725938_3727165_+	diguanylate cyclase	NA	NA	NA	NA	NA
AUL91483.1|3727180_3727663_+	hypothetical protein	NA	NA	NA	NA	NA
AUL91484.1|3727739_3728087_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
AUL91485.1|3728128_3728896_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
AUL91486.1|3728926_3729475_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
AUL91487.1|3729493_3729742_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
AUL91488.1|3729878_3731240_-	signal recognition particle protein	NA	NA	NA	NA	NA
AUL93078.1|3731406_3732198_+	inner membrane protein YpjD	NA	NA	NA	NA	NA
AUL93079.1|3732263_3733505_+	magnesium/cobalt efflux protein	NA	NA	NA	NA	NA
AUL91489.1|3733559_3734153_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
AUL91490.1|3734149_3734344_-	molecular chaperone GrpE	NA	NA	NA	NA	NA
AUL91491.1|3734275_3735154_+	NAD(+) kinase	NA	NA	NA	NA	NA
AUL91492.1|3735239_3736901_+	DNA repair protein RecN	NA	NA	NA	NA	NA
AUL91493.1|3737049_3737391_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
AUL91494.1|3737452_3737743_-	RnfH family protein	NA	NA	NA	NA	NA
AUL91495.1|3737732_3738209_-	ubiquinone-binding protein	NA	NA	NA	NA	NA
AUL91496.1|3738340_3738823_+	SsrA-binding protein	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
3739356:3739400	attL	ATGTAGGAATTTCGGACGCGGGTTCAACTCCCGCCAGCTCCACCA	NA	NA	NA	NA
AUL91497.1|3739523_3740006_+	hypothetical protein	NA	Q19UP0	Mannheimia_phage	34.3	2.7e-17
AUL93080.1|3740032_3740251_-	levansucrase regulator	NA	Q53ZE7	Salmonella_virus	77.8	7.5e-28
AUL91498.1|3740319_3741420_-	late control protein D	NA	A0A1S6KZZ5	Salmonella_phage	88.5	3.4e-177
AUL91499.1|3741416_3741902_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	80.6	8.3e-67
AUL91500.1|3741898_3745060_-|tail	phage tail tape measure protein	tail	E5G6Q1	Salmonella_phage	59.6	1.8e-308
AUL91501.1|3745052_3745172_-|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.8e-13
AUL91502.1|3745186_3745489_-|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	89.0	5.3e-40
AUL91503.1|3745543_3746059_-|tail	phage major tail tube protein	tail	A0A1S6L002	Salmonella_phage	95.3	2.1e-89
AUL91504.1|3746068_3747241_-|tail	phage tail protein	tail	A0A1S6KZY7	Salmonella_phage	90.3	2.1e-204
AUL91505.1|3747383_3747950_-	DNA-invertase	NA	A0A0F7LA37	Escherichia_phage	86.3	3.2e-86
AUL93081.1|3748022_3748526_+|tail	phage tail protein	tail	Q9MCR6	Enterobacteria_phage	54.3	1.8e-40
AUL91506.1|3748525_3749128_+|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	89.4	6.6e-98
AUL91507.1|3749099_3749540_-|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	69.7	4.7e-53
AUL91508.1|3749566_3750967_-|tail	phage tail protein	tail	M1TAS6	Escherichia_phage	78.4	7.5e-153
AUL91509.1|3750963_3751569_-|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	93.0	1.8e-111
AUL91510.1|3751561_3752470_-|plate	baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	90.1	1.3e-142
AUL91511.1|3752456_3752816_-|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	85.7	2.8e-51
AUL91512.1|3752812_3753391_-|plate	phage baseplate assembly protein V	plate	A0A1S6KZX7	Salmonella_phage	85.9	8.8e-92
AUL91513.1|3753459_3753906_-	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	84.9	1.1e-62
AUL91514.1|3753898_3754330_-|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	93.0	1.3e-71
AUL91515.1|3754292_3754496_-	hypothetical protein	NA	A0A1S6KZX6	Salmonella_phage	76.1	3.0e-23
AUL91516.1|3754425_3754854_-	hypothetical protein	NA	E5G6N2	Salmonella_phage	75.2	4.2e-46
AUL91517.1|3754850_3755228_-	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	39.2	1.1e-15
AUL93082.1|3755229_3755703_-	lysozyme	NA	E5G6N1	Salmonella_phage	91.0	3.7e-80
AUL91518.1|3755722_3755938_-	hypothetical protein	NA	E5G6N0	Salmonella_phage	80.3	1.8e-26
AUL91519.1|3755941_3756145_-|tail	phage tail protein	tail	E5G6M9	Salmonella_phage	92.5	1.4e-31
AUL91520.1|3756144_3756609_-|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	88.3	7.9e-75
AUL91521.1|3756704_3757355_-	hypothetical protein	NA	E5G6M7	Salmonella_phage	94.0	4.7e-110
AUL91522.1|3757358_3758417_-|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	93.1	1.4e-180
AUL91523.1|3758433_3759267_-|capsid	capsid protein	capsid	A0A1S6KZW9	Salmonella_phage	91.0	8.2e-123
AUL91524.1|3759409_3761176_+	oxidoreductase	NA	A0A1S6KZW3	Salmonella_phage	99.5	0.0e+00
AUL91525.1|3761175_3762201_+|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	88.1	2.1e-173
AUL91526.1|3762246_3762540_-	hypothetical protein	NA	NA	NA	NA	NA
AUL91527.1|3763023_3764916_-	NTPase KAP	NA	NA	NA	NA	NA
AUL91528.1|3765237_3765543_-	DinI family protein	NA	E5G6M1	Salmonella_phage	100.0	4.7e-36
AUL93083.1|3765481_3765670_-	hypothetical protein	NA	E5G6M0	Salmonella_phage	98.4	5.5e-27
AUL91529.1|3765823_3768238_-	replication endonuclease	NA	E5G6L9	Salmonella_phage	97.8	0.0e+00
AUL91530.1|3768234_3769092_-	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	96.8	7.8e-161
AUL91531.1|3769088_3769391_-	DUF3850 domain-containing protein	NA	A0A0A8WI22	Clostridium_phage	42.1	9.8e-10
AUL91532.1|3769387_3769615_-	hypothetical protein	NA	E5G6L7	Salmonella_phage	100.0	2.7e-36
AUL91533.1|3769614_3769848_-	DUF2732 domain-containing protein	NA	E5G6L6	Salmonella_phage	98.7	6.4e-33
AUL91534.1|3769915_3770257_-	hypothetical protein	NA	E5G6L5	Salmonella_phage	97.3	6.6e-55
AUL91535.1|3770374_3770671_-	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	90.4	4.9e-22
AUL91536.1|3770678_3771188_-	hypothetical protein	NA	E5G6L3	Salmonella_phage	94.1	7.3e-82
AUL91537.1|3771220_3771463_-	Rha family transcriptional regulator	NA	A0A1S6KZZ6	Salmonella_phage	97.5	6.8e-38
AUL91538.1|3771586_3772216_+	phage repressor protein	NA	A0A1S6KZZ7	Salmonella_phage	55.5	2.1e-62
AUL91539.1|3772219_3773239_+|integrase	integrase	integrase	E5G6L0	Salmonella_phage	94.0	6.4e-186
AUL91540.1|3773241_3774273_+	hypothetical protein	NA	NA	NA	NA	NA
AUL91541.1|3774705_3774954_+	damage-inducible protein DinI	NA	A5LH55	Enterobacteria_phage	98.8	5.4e-38
3774390:3774434	attR	ATGTAGGAATTTCGGACGCGGGTTCAACTCCCGCCAGCTCCACCA	NA	NA	NA	NA
AUL91542.1|3775114_3775756_-	DUF1076 domain-containing protein	NA	B6DZC0	Enterobacteria_phage	98.6	4.8e-107
AUL91543.1|3775837_3776467_-	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	92.2	2.1e-78
AUL91544.1|3776539_3777121_-	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	55.3	2.1e-48
AUL91545.1|3777231_3777501_-|tail	phage tail protein	tail	B6DZB8	Enterobacteria_phage	98.9	4.9e-45
AUL91546.1|3777502_3778816_-|tail	phage tail protein	tail	H6WZM9	Escherichia_phage	97.0	5.9e-75
AUL91547.1|3778967_3779567_-	Ail/Lom family protein	NA	A0A0P0ZE39	Stx2-converting_phage	96.5	3.1e-108
AUL91548.1|3780857_3782630_+	hypothetical protein	NA	A0A1U9AJG3	Stx1_converting_phage	98.8	0.0e+00
>prophage 18
CP024618	Escherichia coli strain SMN152SH1 chromosome, complete genome	5302502	5294529	5302459	5302502		Enterobacteria_phage(40.0%)	15	NA	NA
AUL92891.1|5294529_5295063_+	hypothetical protein	NA	K7PKJ4	Enterobacteria_phage	99.4	5.3e-99
AUL92892.1|5295480_5295762_-	pyocin activator protein PrtN	NA	K7PGU0	Enterobacteria_phage	96.8	2.8e-43
AUL92893.1|5295798_5296371_-	3'-5' exoribonuclease	NA	K7PLW7	Enterobacteria_phage	100.0	2.4e-110
AUL92894.1|5297380_5297572_-	hypothetical protein	NA	K7PKJ7	Enterobacteria_phage	98.4	1.6e-26
AUL92895.1|5297573_5298128_-	hypothetical protein	NA	K7PJQ4	Enterobacteria_phage	99.5	4.1e-102
AUL92896.1|5298124_5298364_-	hypothetical protein	NA	S5MQM0	Escherichia_phage	100.0	4.4e-37
AUL92897.1|5298356_5298560_-	hypothetical protein	NA	K7PLX1	Enterobacteria_phage	98.5	5.2e-31
AUL92898.1|5298556_5298919_-	hypothetical protein	NA	S5MC15	Escherichia_phage	99.2	2.1e-67
AUL92899.1|5298909_5299446_-	HD family hydrolase	NA	S5MW55	Escherichia_phage	100.0	7.4e-101
AUL92900.1|5299573_5300398_-	DUF2303 domain-containing protein	NA	U5P439	Shigella_phage	100.0	6.0e-150
AUL92901.1|5300462_5300825_-	hypothetical protein	NA	Q8SBF8	Shigella_phage	100.0	8.6e-61
AUL92902.1|5300897_5301092_+	hypothetical protein	NA	A0A291AWX8	Escherichia_phage	100.0	1.0e-31
AUL92903.1|5301193_5301424_-	hypothetical protein	NA	A0A291AWY6	Escherichia_phage	97.4	2.5e-13
AUL92904.1|5301493_5302168_-	LexA family transcriptional repressor	NA	U5P0T5	Shigella_phage	99.1	8.6e-131
AUL92905.1|5302258_5302459_+	transcriptional regulator	NA	U5P445	Shigella_phage	100.0	7.9e-32
>prophage 1
CP024617	Escherichia coli strain SMN152SH1 plasmid pO177A1, complete sequence	88896	11113	19863	88896		Stx2-converting_phage(66.67%)	7	NA	NA
AUL87970.1|11113_11494_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
AUL87971.1|11753_12101_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
AUL87972.1|14130_18033_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	Q9LA58	Enterobacterial_phage	40.4	5.5e-238
AUL87973.1|18337_18529_+	hypothetical protein	NA	K7PLX1	Enterobacteria_phage	41.3	3.5e-05
AUL88027.1|18539_18905_+	hypothetical protein	NA	NA	NA	NA	NA
AUL87974.1|19138_19519_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
AUL87975.1|19515_19863_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
