The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP020817	Enterobacter sp. Crenshaw chromosome, complete genome	4630785	1757828	1815721	4630785	capsid,integrase,terminase,portal,head,tail,tRNA	Enterobacterial_phage(33.33%)	76	1767937:1767951	1785674:1785688
AUM03207.1|1757828_1758941_-|tRNA	tRNA(5-methylaminomethyl-2-thiouridine)- methyltransferase	tRNA	NA	NA	NA	NA
AUM03208.1|1758981_1759455_-	NUDIX hydrolase	NA	NA	NA	NA	NA
AUM03209.1|1759464_1760118_-	23S rRNA pseudouridine synthase E	NA	NA	NA	NA	NA
AUM03210.1|1760235_1761486_+	isocitrate dehydrogenase (NADP(+))	NA	Q77Z09	Phage_21	94.4	7.9e-21
AUM03211.1|1761563_1761911_+	hypothetical protein	NA	NA	NA	NA	NA
AUM03212.1|1761985_1762231_+	hypothetical protein	NA	NA	NA	NA	NA
AUM03213.1|1762521_1764021_-	diguanylate phosphodiesterase	NA	NA	NA	NA	NA
AUM05854.1|1764256_1765777_+	hypothetical protein	NA	NA	NA	NA	NA
AUM05855.1|1765902_1767375_+	sensor domain-containing diguanylate cyclase	NA	G3MA91	Bacillus_virus	31.2	2.0e-15
AUM03214.1|1767660_1767909_+	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
1767937:1767951	attL	AGATGGCGGCCTTTT	NA	NA	NA	NA
AUM05856.1|1768183_1769212_-	sensor domain-containing diguanylate cyclase	NA	G3MA91	Bacillus_virus	33.2	1.7e-16
AUM03215.1|1769522_1769777_+	DUF333 domain-containing protein	NA	NA	NA	NA	NA
AUM03216.1|1769857_1770163_+	hypothetical protein	NA	NA	NA	NA	NA
AUM03217.1|1770163_1770508_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
AUM03218.1|1770609_1771317_+	hypothetical protein	NA	NA	NA	NA	NA
AUM03219.1|1771349_1772537_-	MFS transporter	NA	NA	NA	NA	NA
AUM03220.1|1772636_1773428_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AUM03221.1|1773411_1773858_-	DUF441 family protein	NA	NA	NA	NA	NA
AUM03222.1|1774129_1774630_-	hypothetical protein	NA	NA	NA	NA	NA
AUM03223.1|1774892_1776035_-|integrase	integrase	integrase	O21929	Phage_21	47.9	4.6e-92
AUM03224.1|1776009_1776273_-	hypothetical protein	NA	NA	NA	NA	NA
AUM03225.1|1776305_1776575_-	hypothetical protein	NA	K7PKM4	Enterobacterial_phage	86.5	4.9e-37
AUM03226.1|1777528_1777729_-	hypothetical protein	NA	NA	NA	NA	NA
AUM03227.1|1777730_1778171_-	hypothetical protein	NA	K7P6V8	Enterobacteria_phage	46.8	7.9e-08
AUM03228.1|1778119_1778311_-	hypothetical protein	NA	NA	NA	NA	NA
AUM03229.1|1778307_1778778_-	hypothetical protein	NA	A0A2H4FN96	Salmonella_phage	50.0	7.9e-14
AUM03230.1|1778774_1779602_-	chromosome partitioning protein ParB	NA	K7PKM7	Enterobacterial_phage	87.4	6.0e-126
AUM03231.1|1779601_1779961_-	hypothetical protein	NA	K7PJS4	Enterobacterial_phage	91.6	6.5e-53
AUM03232.1|1780684_1780873_-	hypothetical protein	NA	K7PGV8	Enterobacterial_phage	96.3	8.2e-07
AUM03233.1|1781012_1781732_-	LexA family transcriptional repressor	NA	A0A2R2X2B0	Escherichia_phage	62.9	2.4e-78
AUM03234.1|1781830_1782049_+	hypothetical protein	NA	A0A2K8HL98	Pseudomonas_phage	60.3	4.9e-11
AUM03235.1|1782090_1782561_+	hypothetical protein	NA	K7PJS5	Enterobacterial_phage	92.9	4.2e-76
AUM03236.1|1782801_1783014_+	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	63.5	3.3e-12
AUM03237.1|1782970_1783897_+	transcriptional regulator	NA	K7PLZ7	Enterobacterial_phage	88.2	3.3e-72
AUM03238.1|1783893_1784388_+	hypothetical protein	NA	NA	NA	NA	NA
AUM03239.1|1784387_1785047_+	DNA methyltransferase	NA	I6PDF5	Cronobacter_phage	80.5	2.6e-100
AUM03240.1|1785043_1785292_+	hypothetical protein	NA	NA	NA	NA	NA
AUM03241.1|1785288_1785609_+	LexA family transcriptional regulator	NA	K7PHB4	Enterobacterial_phage	78.3	1.0e-41
AUM03242.1|1785605_1785995_+	hypothetical protein	NA	K7PKN5	Enterobacterial_phage	100.0	4.4e-71
1785674:1785688	attR	AAAAGGCCGCCATCT	NA	NA	NA	NA
AUM03243.1|1785991_1786981_+	hypothetical protein	NA	K7PJS6	Enterobacterial_phage	95.1	5.1e-188
AUM05857.1|1786995_1787358_+	antitermination protein Q	NA	K7PGW2	Enterobacterial_phage	97.5	1.9e-60
AUM03244.1|1787791_1788043_-	hypothetical protein	NA	NA	NA	NA	NA
AUM05858.1|1788053_1788917_-	hypothetical protein	NA	NA	NA	NA	NA
AUM03245.1|1789161_1789557_+	hypothetical protein	NA	K7PHB9	Enterobacterial_phage	99.2	9.1e-64
AUM03246.1|1789543_1789825_+	hypothetical protein	NA	K7PKN9	Enterobacterial_phage	92.5	5.3e-42
AUM03247.1|1789824_1790454_+	endolysin	NA	G8C7W0	Escherichia_phage	84.7	3.4e-97
AUM03248.1|1790461_1790737_+	hypothetical protein	NA	G8C7W1	Escherichia_phage	78.9	4.7e-27
AUM03249.1|1790913_1791426_-	hypothetical protein	NA	NA	NA	NA	NA
AUM03250.1|1791476_1792934_+	glycosyltransferase	NA	A0A220NRM5	Escherichia_phage	89.1	2.2e-264
AUM03251.1|1792915_1793506_+	hypothetical protein	NA	K7PGW6	Enterobacterial_phage	80.6	1.0e-90
AUM03252.1|1793502_1793847_+	HNH endonuclease	NA	K7P7P4	Enterobacteria_phage	73.0	1.1e-46
AUM03253.1|1793973_1794438_+|terminase	terminase	terminase	Q9B019	Phage_GMSE-1	62.7	5.7e-49
AUM03254.1|1794391_1796134_+|terminase	terminase	terminase	A0A0U2C138	Paracoccus_phage	44.3	1.7e-133
AUM03255.1|1796133_1797438_+|portal	phage portal protein	portal	K7PJU5	Enterobacteria_phage	88.9	2.9e-223
AUM03256.1|1797451_1798300_+	peptidase S14	NA	K7PH05	Enterobacteria_phage	92.1	1.8e-138
AUM03257.1|1798309_1799521_+|capsid	phage major capsid protein	capsid	K7PM57	Enterobacteria_phage	86.5	5.2e-195
AUM03258.1|1799561_1799810_+	hypothetical protein	NA	K7PHI6	Enterobacteria_phage	83.0	4.9e-15
AUM03259.1|1799809_1800136_+	hypothetical protein	NA	K7PKT4	Enterobacteria_phage	77.8	7.0e-46
AUM03260.1|1800144_1800483_+|head,tail	head-tail adaptor protein	head,tail	A0A2H4JHK5	uncultured_Caudovirales_phage	67.9	4.7e-37
AUM03261.1|1800479_1800929_+	hypothetical protein	NA	K7PH84	Enterobacterial_phage	98.0	2.9e-74
AUM03262.1|1800925_1801273_+	hypothetical protein	NA	K7PKL6	Enterobacterial_phage	97.4	4.2e-57
AUM03263.1|1801326_1801797_+|tail	phage tail protein	tail	A0A220NRQ0	Escherichia_phage	98.7	4.4e-81
AUM03264.1|1801851_1802253_+|tail	phage tail protein	tail	K7PGV0	Enterobacterial_phage	99.2	7.3e-69
AUM05859.1|1802276_1802540_+|tail	phage tail protein	tail	K7P7L5	Enterobacteria_phage	90.8	3.0e-39
AUM03265.1|1802612_1802954_+	hypothetical protein	NA	NA	NA	NA	NA
AUM03266.1|1802995_1806256_+|tail	phage tail tape measure protein	tail	A0A220NRN7	Escherichia_phage	74.8	0.0e+00
AUM03267.1|1806269_1806863_+	hypothetical protein	NA	S4TSP7	Salmonella_phage	86.8	6.5e-98
AUM03268.1|1806862_1807447_+	hypothetical protein	NA	S4TND4	Salmonella_phage	85.5	2.5e-94
AUM03269.1|1807453_1807852_+	hypothetical protein	NA	S4TR39	Salmonella_phage	82.6	1.2e-63
AUM03270.1|1807851_1810560_+|tail	phage tail protein	tail	S4TTF5	Salmonella_phage	74.8	0.0e+00
AUM03271.1|1810562_1811516_+	hypothetical protein	NA	G5DMH8	Enterobacter_virus	53.8	3.2e-99
AUM03272.1|1811563_1812868_+|tail	phage tail protein	tail	K7PHF0	Enterobacteria_phage	90.6	3.6e-141
AUM03273.1|1812963_1813230_-	virulence protein MsgA	NA	K7PKR6	Enterobacteria_phage	94.3	8.9e-39
AUM03274.1|1813318_1813558_+	hypothetical protein	NA	K7P7N3	Enterobacteria_phage	93.6	6.7e-38
AUM03275.1|1813557_1813878_+	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	96.2	1.3e-55
AUM03276.1|1814437_1815721_-	hypothetical protein	NA	A0A140HLI1	Bacillus_phage	36.3	1.3e-10
>prophage 2
CP020817	Enterobacter sp. Crenshaw chromosome, complete genome	4630785	1985109	2043239	4630785	integrase,terminase,tail	Enterobacteria_phage(27.45%)	62	1977801:1977841	2050812:2050852
1977801:1977841	attL	CGTAGGCCGGGTAAGCGTCAGCGCCACCCGGCAATAAAAAA	NA	NA	NA	NA
AUM03436.1|1985109_1986408_-	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	24.5	4.7e-16
AUM03437.1|1986437_1987718_-|integrase	site-specific integrase	integrase	A0A0U2JGI6	Escherichia_phage	53.1	1.3e-122
AUM03438.1|1987717_1987933_-	hypothetical protein	NA	A0A0U2RY08	Escherichia_phage	50.7	8.5e-16
AUM03439.1|1987997_1988240_-	DUF4060 domain-containing protein	NA	K7PHF4	Enterobacteria_phage	94.9	7.8e-34
AUM03440.1|1988278_1989364_-	enterohemolysin	NA	K7PKR8	Enterobacteria_phage	63.6	3.7e-123
AUM03441.1|1989373_1992094_-	exodeoxyribonuclease VIII	NA	H6WRX1	Salmonella_phage	62.6	5.5e-293
AUM03442.1|1992276_1992453_-	DUF1482 domain-containing protein	NA	NA	NA	NA	NA
AUM03443.1|1992662_1992854_+	hypothetical protein	NA	S5FM78	Shigella_phage	45.8	1.2e-08
AUM03444.1|1993311_1994229_-	hypothetical protein	NA	A0A1R3Y6Z6	Salmonella_virus	75.1	6.0e-135
AUM03445.1|1994318_1994732_-	transcriptional regulator	NA	A0A0M4R5D1	Salmonella_phage	75.0	6.8e-46
AUM03446.1|1994804_1995032_+	Rha family transcriptional regulator	NA	A0A0M4QX15	Salmonella_phage	64.9	1.4e-21
AUM03447.1|1995034_1995586_+	hypothetical protein	NA	K7PJT7	Enterobacteria_phage	48.4	5.2e-33
AUM03448.1|1995730_1996588_+	hypothetical protein	NA	K7PGZ0	Enterobacteria_phage	70.4	3.4e-100
AUM03449.1|1996584_1997271_+	phage replication protein	NA	G8C7U6	Escherichia_phage	64.6	4.0e-83
AUM03450.1|1997390_1997609_+	hypothetical protein	NA	NA	NA	NA	NA
AUM05865.1|1997935_1998844_-	lipid A biosynthesis palmitoleoyl acyltransferase	NA	A0A1W6JP29	Morganella_phage	52.9	2.4e-75
AUM05866.1|1999036_1999312_-	hypothetical protein	NA	NA	NA	NA	NA
AUM05867.1|1999712_1999946_+	hypothetical protein	NA	A0A192Y6D5	Salmonella_phage	55.3	3.2e-16
AUM03451.1|1999963_2008546_-	cyclic beta 1-2 glucan synthetase	NA	NA	NA	NA	NA
AUM03452.1|2009200_2009425_+	DNA damage-inducible protein I	NA	K7PM44	Enterobacteria_phage	62.3	3.1e-21
AUM05868.1|2009576_2009774_+	hypothetical protein	NA	K7PHG9	Enterobacteria_phage	70.5	3.1e-20
AUM03453.1|2009813_2010425_+	hypothetical protein	NA	H6WRY7	Salmonella_phage	82.5	2.0e-94
AUM03454.1|2010415_2010622_+	hypothetical protein	NA	H6WRY8	Salmonella_phage	78.5	2.3e-26
AUM05869.1|2010624_2010987_+	hypothetical protein	NA	K7PM48	Enterobacteria_phage	80.5	2.6e-49
AUM03455.1|2010983_2011817_+	antitermination protein	NA	K7PKS8	Enterobacteria_phage	78.3	6.3e-123
AUM03456.1|2012009_2012201_+	hypothetical protein	NA	NA	NA	NA	NA
AUM03457.1|2012871_2013174_+	hypothetical protein	NA	O64361	Escherichia_phage	67.3	3.1e-32
AUM03458.1|2013173_2013710_+	lysozyme	NA	K7PM52	Enterobacteria_phage	89.6	2.6e-90
AUM03459.1|2013706_2014225_+	hypothetical protein	NA	K7PHH7	Enterobacteria_phage	84.2	2.3e-75
AUM03460.1|2014613_2015027_+	C-lysozyme inhibitor	NA	NA	NA	NA	NA
AUM03461.1|2015107_2015341_-	hypothetical protein	NA	NA	NA	NA	NA
AUM03462.1|2015480_2016482_+|terminase	terminase small subunit	terminase	I6X6R5	Burkholderia_virus	42.7	2.0e-38
AUM03463.1|2016459_2017767_+|terminase	terminase	terminase	A0A1B1P9C9	Acinetobacter_phage	56.7	1.6e-141
AUM03464.1|2017768_2019157_+	hypothetical protein	NA	A0A1B0VMH0	Pseudomonas_phage	49.5	5.5e-124
AUM03465.1|2019158_2020256_+	hypothetical protein	NA	I6PD76	Cronobacter_phage	58.5	1.6e-118
AUM03466.1|2020336_2021107_+	hypothetical protein	NA	A0A1B0VMG1	Pseudomonas_phage	60.3	2.4e-68
AUM03467.1|2021118_2022072_+	hypothetical protein	NA	A0A1B0VMF8	Pseudomonas_phage	75.3	6.9e-134
AUM03468.1|2022389_2022872_+	hypothetical protein	NA	A0A2I7RQ74	Vibrio_phage	30.6	3.3e-07
AUM03469.1|2022871_2023222_+	hypothetical protein	NA	I6PD77	Cronobacter_phage	49.6	1.4e-28
AUM03470.1|2023223_2023808_+	hypothetical protein	NA	G8C7Q1	Escherichia_phage	52.6	3.2e-49
AUM03471.1|2023804_2024215_+	hypothetical protein	NA	I6PDJ8	Cronobacter_phage	53.6	8.3e-36
AUM03472.1|2024281_2024953_+|tail	phage tail protein	tail	I6PBN6	Cronobacter_phage	47.3	6.1e-52
AUM03473.1|2025020_2025332_+	hypothetical protein	NA	I6PDG2	Cronobacter_phage	68.0	2.4e-35
AUM03474.1|2025328_2025640_+	hypothetical protein	NA	I6PD79	Cronobacter_phage	63.3	1.1e-16
AUM03475.1|2025639_2028552_+|tail	phage tail tape measure protein	tail	I6PCW3	Cronobacter_phage	35.8	2.0e-131
AUM03476.1|2028671_2029028_+	hypothetical protein	NA	NA	NA	NA	NA
AUM03477.1|2029092_2029440_+|tail	phage tail protein	tail	I6PBN7	Cronobacter_phage	60.9	3.7e-37
AUM03478.1|2029436_2030192_+|tail	phage minor tail protein L	tail	K7PJS0	Enterobacterial_phage	78.4	9.4e-118
AUM03479.1|2030193_2030916_+	peptidase P60	NA	K7PJV6	Enterobacteria_phage	83.9	9.6e-128
AUM03480.1|2030915_2031506_+|tail	phage tail protein	tail	K7PH91	Enterobacterial_phage	61.7	3.8e-58
AUM03481.1|2031559_2032276_+	methyltransferase	NA	NA	NA	NA	NA
AUM03482.1|2032329_2035515_+	host specificity protein	NA	O64335	Escherichia_phage	86.7	0.0e+00
AUM03483.1|2035514_2035817_+	hypothetical protein	NA	K7PHM8	Enterobacterial_phage	85.9	4.2e-45
AUM03484.1|2035816_2036491_+	hypothetical protein	NA	K7PGX6	Enterobacteria_phage	80.4	5.6e-98
AUM03485.1|2036601_2036841_+	cor protein	NA	E4WL42	Enterobacteria_phage	59.7	1.8e-19
AUM03486.1|2036897_2038295_+|tail	phage tail protein	tail	K7PHF0	Enterobacteria_phage	58.9	8.0e-139
AUM03487.1|2038446_2038866_+	DNA polymerase V subunit UmuD	NA	A0A1W6JNS2	Morganella_phage	57.5	8.5e-36
AUM03488.1|2038868_2040137_+	DNA polymerase V subunit UmuC	NA	I6RSM4	Salmonella_phage	92.4	3.1e-230
AUM03489.1|2041023_2041251_-	hypothetical protein	NA	NA	NA	NA	NA
AUM03490.1|2041806_2042025_-	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	62.7	2.1e-17
AUM03491.1|2042312_2042525_+	cold-shock protein	NA	NA	NA	NA	NA
AUM03492.1|2042576_2043239_-	DUF159 family protein	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	57.8	2.8e-73
2050812:2050852	attR	TTTTTTATTGCCGGGTGGCGCTGACGCTTACCCGGCCTACG	NA	NA	NA	NA
>prophage 3
CP020817	Enterobacter sp. Crenshaw chromosome, complete genome	4630785	2120597	2130671	4630785		Oenococcus_phage(16.67%)	9	NA	NA
AUM03563.1|2120597_2121812_+	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.2	1.1e-46
AUM03564.1|2121826_2122846_+	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	27.0	1.0e-18
AUM03565.1|2122919_2124287_+	MFS transporter	NA	NA	NA	NA	NA
AUM03566.1|2124506_2125970_+	D-mannonate oxidoreductase	NA	G8DCZ3	Micromonas_pusilla_virus	31.0	5.1e-43
AUM03567.1|2126013_2126217_-	selenoprotein YdfZ	NA	J9Q802	Salmonella_phage	58.2	3.4e-14
AUM03568.1|2126505_2126937_+	universal stress protein UspG	NA	A0A1W6JNV4	Morganella_phage	36.6	1.1e-17
AUM03569.1|2126970_2127657_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AUM03570.1|2127748_2128495_-	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
AUM03571.1|2128637_2130671_+	dipeptidyl carboxypeptidase II	NA	A0A1V0SIU1	Klosneuvirus	21.5	2.1e-18
>prophage 4
CP020817	Enterobacter sp. Crenshaw chromosome, complete genome	4630785	2572404	2622988	4630785	capsid,plate,terminase,integrase,head,portal,tail,holin,protease	Erwinia_phage(34.21%)	62	2592020:2592042	2623065:2623087
AUM03970.1|2572404_2573451_-|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	28.7	8.1e-19
AUM03971.1|2573702_2574464_+	NAD(P)-dependent oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.5	8.0e-08
AUM03972.1|2574460_2575051_+	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
AUM03973.1|2575086_2575962_-	23S rRNA pseudouridylate synthase B	NA	NA	NA	NA	NA
AUM03974.1|2576058_2576679_-	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
AUM03975.1|2576675_2577557_-	phosphatase	NA	NA	NA	NA	NA
AUM03976.1|2577834_2579397_+	anthranilate synthase component I	NA	NA	NA	NA	NA
AUM03977.1|2579396_2580992_+	bifunctional glutamine amidotransferase/anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	37.9	2.2e-52
AUM03978.1|2580995_2582354_+	bifunctional indole-3-glycerol phosphate synthase/phosphoribosylanthranilate isomerase	NA	A0A0P0IR83	Acinetobacter_phage	40.6	2.5e-36
AUM03979.1|2582364_2583558_+	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
AUM03980.1|2583557_2584367_+	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
AUM03981.1|2584547_2585759_+	hypothetical protein	NA	NA	NA	NA	NA
AUM03982.1|2585755_2585989_+	SirA-like protein	NA	NA	NA	NA	NA
AUM03983.1|2586115_2586454_+	hypothetical protein	NA	NA	NA	NA	NA
AUM03984.1|2586500_2587133_-	outer membrane protein OmpW	NA	NA	NA	NA	NA
AUM03985.1|2587415_2587820_+	zinc/iron-chelating domain-containing protein	NA	NA	NA	NA	NA
AUM03986.1|2587845_2588589_+	hypothetical protein	NA	NA	NA	NA	NA
AUM03987.1|2588645_2589185_+	intracellular septation protein A	NA	NA	NA	NA	NA
AUM03988.1|2589289_2589685_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
AUM03989.1|2589724_2590447_-	TonB system transport protein TonB	NA	NA	NA	NA	NA
AUM03990.1|2590667_2590964_+	hypothetical protein	NA	NA	NA	NA	NA
AUM03991.1|2591005_2591959_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
2592020:2592042	attL	ATAAAAAAGGCTCCCTCAGGAGC	NA	NA	NA	NA
AUM03992.1|2592280_2593000_-	hypothetical protein	NA	NA	NA	NA	NA
AUM03993.1|2592996_2593836_-	hypothetical protein	NA	NA	NA	NA	NA
AUM05886.1|2594174_2594573_+	hypothetical protein	NA	NA	NA	NA	NA
AUM03994.1|2594615_2594837_-	transcriptional regulator	NA	A0A2I8TV89	Erwinia_phage	72.9	4.6e-25
AUM03995.1|2594913_2596083_-	hypothetical protein	NA	Q6K1G4	Salmonella_virus	74.9	1.4e-160
AUM03996.1|2596079_2596544_-|tail	phage tail protein	tail	A0A218M4I2	Erwinia_phage	70.8	1.3e-58
AUM03997.1|2596556_2599004_-|tail	phage tail tape measure protein	tail	M1T2S3	Escherichia_phage	69.6	4.6e-299
AUM03998.1|2598993_2599116_-|tail	GpE family phage tail protein	tail	O80316	Escherichia_phage	87.2	4.2e-12
AUM03999.1|2599148_2599454_-	hypothetical protein	NA	A0A0F7LDQ8	Escherichia_phage	73.6	1.1e-27
AUM04000.1|2599514_2600033_-|tail	phage major tail tube protein	tail	A0A218M4J0	Erwinia_phage	82.0	2.6e-79
AUM04001.1|2600045_2601239_-|tail	phage tail protein	tail	A0A0F7LBW9	Escherichia_phage	80.4	3.1e-184
AUM04002.1|2601363_2601960_-|tail	phage tail protein	tail	A0A218M4J2	Erwinia_phage	83.2	5.0e-90
AUM04003.1|2601959_2602946_-|tail	phage tail protein	tail	A0A2I8TVA9	Erwinia_phage	79.1	7.1e-142
AUM04004.1|2602942_2603551_-|tail	phage tail protein I	tail	A0A218M4J3	Erwinia_phage	96.0	1.2e-110
AUM04005.1|2603543_2604452_-|plate	baseplate assembly protein	plate	A0A218M4K5	Erwinia_phage	93.4	1.0e-150
AUM04006.1|2604458_2604809_-|plate	baseplate assembly protein	plate	A0A0M4RE59	Salmonella_phage	69.8	5.8e-38
AUM04007.1|2604805_2605447_-|plate	baseplate assembly protein	plate	Q6K1H6	Salmonella_virus	83.1	2.7e-97
AUM04008.1|2605677_2606607_+	TIR domain-containing protein	NA	NA	NA	NA	NA
AUM04009.1|2606676_2607546_+|protease	serine protease	protease	NA	NA	NA	NA
AUM04010.1|2607660_2608107_-	phage virion morphogenesis protein	NA	O80313	Escherichia_phage	66.0	3.0e-47
AUM04011.1|2608099_2608567_-|tail	phage tail protein	tail	A0A218M4K6	Erwinia_phage	69.0	3.0e-58
AUM04012.1|2608529_2608775_-|holin	holin	holin	S4TNY4	Salmonella_phage	76.5	1.0e-28
AUM04013.1|2608662_2609088_-	protein lysB	NA	O80310	Escherichia_phage	69.3	3.5e-45
AUM04014.1|2609084_2609594_-	glycoside hydrolase	NA	A0A218M4K3	Erwinia_phage	85.7	1.1e-77
AUM04015.1|2609577_2609799_-	primosomal protein	NA	A0A218M4L5	Erwinia_phage	75.3	1.1e-26
AUM04016.1|2609789_2609993_-|tail	phage tail protein	tail	A0A218M4L8	Erwinia_phage	80.6	1.1e-25
AUM04017.1|2609992_2610499_-|head	head completion/stabilization protein	head	O80306	Escherichia_phage	70.8	1.1e-61
AUM04018.1|2610598_2611348_-|terminase	terminase	terminase	O80305	Escherichia_phage	71.2	8.8e-76
AUM04019.1|2611351_2612419_-|capsid	phage major capsid protein, P2 family	capsid	S4TUA6	Salmonella_phage	83.1	2.0e-169
AUM04020.1|2612474_2613329_-|capsid	GPO family capsid scaffolding protein	capsid	A0A218M4L9	Erwinia_phage	72.2	9.9e-116
AUM04021.1|2613495_2615265_+	oxidoreductase	NA	A0A218M4M1	Erwinia_phage	84.7	5.1e-300
AUM04022.1|2615266_2616292_+|portal	phage portal protein	portal	Q6K1J0	Salmonella_virus	83.9	1.9e-169
AUM04023.1|2616639_2617563_-	hypothetical protein	NA	NA	NA	NA	NA
AUM04024.1|2617656_2619945_-	replication protein	NA	A0A0F7LBQ2	Escherichia_phage	73.4	0.0e+00
AUM04025.1|2619946_2620210_-	hypothetical protein	NA	U5N3W1	Enterobacteria_phage	58.1	1.5e-22
AUM04026.1|2620233_2620452_-	hypothetical protein	NA	S4TP68	Salmonella_phage	66.7	1.7e-11
AUM04027.1|2620518_2621019_-	replication protein B	NA	M1SV55	Escherichia_phage	75.3	2.8e-70
AUM04028.1|2621185_2621461_-	hypothetical protein	NA	Q1JS60	Enterobacteria_phage	86.5	1.2e-41
AUM04029.1|2621581_2621881_+	transcriptional regulator	NA	Q1JS61	Enterobacteria_phage	77.8	2.2e-38
AUM04030.1|2621977_2622988_+|integrase	integrase	integrase	Q83VS6	Escherichia_phage	75.8	6.8e-148
2623065:2623087	attR	ATAAAAAAGGCTCCCTCAGGAGC	NA	NA	NA	NA
>prophage 5
CP020817	Enterobacter sp. Crenshaw chromosome, complete genome	4630785	3009438	3017385	4630785		Escherichia_phage(33.33%)	7	NA	NA
AUM04368.1|3009438_3010542_-	aminotransferase	NA	E5ES42	Bathycoccus_sp._RCC1105_virus	32.1	3.0e-40
AUM04369.1|3010997_3011393_-	dTDP-6-deoxy-3,4-keto-hexulose isomerase	NA	NA	NA	NA	NA
AUM04370.1|3011396_3012260_-	glucose-1-phosphate thymidylyltransferase	NA	A0A291LA53	Escherichia_phage	68.8	1.0e-112
AUM04371.1|3012259_3013345_-	dTDP-glucose 4,6-dehydratase	NA	A0A1D7XFE8	Escherichia_phage	51.8	5.7e-100
AUM04372.1|3013697_3014594_-	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	41.9	2.0e-42
AUM04373.1|3014809_3015805_-	UDP-N-acetylglucosamine 4-epimerase	NA	A0A0K1L6Z1	Scale_drop_disease_virus	30.7	2.1e-08
AUM04374.1|3015987_3017385_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	32.8	3.7e-19
>prophage 6
CP020817	Enterobacter sp. Crenshaw chromosome, complete genome	4630785	3966724	4008122	4630785	plate,tRNA,tail,lysis	Erwinia_phage(44.12%)	53	NA	NA
AUM05917.1|3966724_3967966_+|tRNA	multifunctional CCA tRNA nucleotidyl transferase/2'3'-cyclic phosphodiesterase/2'nucleotidase/phosphatase	tRNA	A0A0F6YPT7	Sinorhizobium_phage	51.4	1.3e-92
AUM05187.1|3967976_3968798_-	undecaprenyl-diphosphatase	NA	NA	NA	NA	NA
AUM05188.1|3968904_3969273_-	bifunctional dihydroneopterin aldolase/7,8-dihydroneopterin epimerase	NA	NA	NA	NA	NA
AUM05189.1|3969380_3970001_+	glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
AUM05190.1|3970086_3971553_+	MFS transporter	NA	NA	NA	NA	NA
AUM05191.1|3971593_3972016_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
AUM05192.1|3972163_3973177_+	alpha/beta hydrolase	NA	L7RDF8	Acanthamoeba_polyphaga_moumouvirus	38.8	1.4e-55
AUM05193.1|3973321_3974149_+	urease accessory protein	NA	NA	NA	NA	NA
AUM05194.1|3974159_3974462_+	urease subunit gamma	NA	NA	NA	NA	NA
AUM05195.1|3974472_3974787_+	urease subunit beta	NA	NA	NA	NA	NA
AUM05196.1|3974779_3976483_+	urease subunit alpha	NA	NA	NA	NA	NA
AUM05197.1|3976492_3976957_+	urease accessory protein UreE	NA	NA	NA	NA	NA
AUM05198.1|3976966_3977506_+	urease accessory protein UreJ	NA	NA	NA	NA	NA
AUM05199.1|3977505_3978180_+	urease accessory protein UreF	NA	NA	NA	NA	NA
AUM05200.1|3978189_3978807_+	urease accessory protein UreG	NA	NA	NA	NA	NA
AUM05201.1|3978851_3979865_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	58.6	2.8e-109
AUM05202.1|3980101_3980317_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
AUM05203.1|3980432_3982178_+	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	39.0	1.4e-76
AUM05204.1|3982195_3982315_+	RNA polymerase subunit sigma	NA	NA	NA	NA	NA
AUM05205.1|3982331_3984179_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	8.4e-35
AUM05206.1|3984280_3984787_-	mismatch-specific DNA-glycosylase	NA	NA	NA	NA	NA
AUM05207.1|3985069_3985270_-	late control protein B	NA	A0A2I8TV89	Erwinia_phage	79.6	6.3e-21
AUM05208.1|3985337_3986492_-	hypothetical protein	NA	A0A0M5M5V5	Salmonella_phage	62.0	1.5e-130
AUM05209.1|3986488_3986953_-|tail	phage tail protein	tail	O80317	Escherichia_phage	66.7	6.9e-55
AUM05210.1|3986964_3989244_-|tail	phage tail tape measure protein	tail	Q7Y4C8	Escherichia_virus	39.9	5.9e-131
AUM05918.1|3989236_3989356_-|tail	GpE family phage tail protein	tail	O80316	Escherichia_phage	89.7	9.7e-14
AUM05211.1|3989388_3989697_-	hypothetical protein	NA	A0A0F7LDQ8	Escherichia_phage	69.0	4.5e-26
AUM05212.1|3989753_3990272_-|tail	phage major tail tube protein	tail	A0A218M4J0	Erwinia_phage	80.8	7.7e-79
AUM05213.1|3990283_3991471_-|tail	phage tail protein	tail	S4TRX2	Salmonella_phage	83.3	6.1e-188
AUM05214.1|3991529_3992123_-	DNA-invertase	NA	A0A0F7LA37	Escherichia_phage	75.0	1.4e-79
AUM05215.1|3992565_3992961_+|tail	phage tail protein	tail	A0A2P1JUG3	Erwinia_phage	35.4	3.6e-12
AUM05216.1|3992944_3993541_-|tail	phage tail protein	tail	A0A218M4J2	Erwinia_phage	58.9	4.7e-64
AUM05217.1|3993540_3994623_-|tail	phage tail protein	tail	A0A2I8TVA9	Erwinia_phage	66.4	4.8e-123
AUM05218.1|3994619_3995228_-|tail	phage tail protein I	tail	A0A218M4J3	Erwinia_phage	88.1	1.9e-100
AUM05219.1|3995220_3996129_-|plate	baseplate assembly protein	plate	A0A218M4K5	Erwinia_phage	85.8	1.4e-139
AUM05220.1|3996134_3996485_-|plate	baseplate assembly protein	plate	A0A0M4RE59	Salmonella_phage	69.8	5.2e-39
AUM05221.1|3996481_3997123_-|plate	baseplate assembly protein	plate	A0A0M4S6F6	Salmonella_phage	76.5	2.3e-88
AUM05222.1|3997235_3997703_-|tail	phage tail protein	tail	A0A218M4K6	Erwinia_phage	61.9	4.0e-50
AUM05223.1|3997665_3997839_-|lysis	phage lysis protein	lysis	S4TNY4	Salmonella_phage	74.5	8.1e-17
AUM05224.1|3997798_3998326_-	protein lysB	NA	A0A218M4K2	Erwinia_phage	57.5	7.2e-32
AUM05225.1|3998220_3998730_-	glycoside hydrolase	NA	A0A218M4K3	Erwinia_phage	82.1	3.3e-74
AUM05226.1|3998713_3998935_-	primosomal protein	NA	A0A218M4L5	Erwinia_phage	75.0	4.6e-25
AUM05227.1|3998925_3999129_-|tail	phage tail protein	tail	U5N3E7	Enterobacteria_phage	71.6	4.0e-23
AUM05228.1|3999308_3999749_-	DinI family protein	NA	A0A218M4I0	Erwinia_phage	75.2	5.2e-52
AUM05229.1|3999858_4002048_-	replication protein	NA	A0A218M4H2	Erwinia_phage	73.3	0.0e+00
AUM05230.1|4002049_4002271_-	hypothetical protein	NA	A0A0M4S5Q7	Salmonella_phage	76.4	1.2e-25
AUM05231.1|4002270_4002498_-	hypothetical protein	NA	A0A0M3UL87	Salmonella_phage	64.0	9.9e-15
AUM05232.1|4002566_4002905_-	hypothetical protein	NA	A0A218M4I7	Erwinia_phage	73.9	5.1e-39
AUM05233.1|4003132_4003708_+	phage repressor protein CI	NA	A0A218M4J1	Erwinia_phage	62.8	1.7e-66
AUM05234.1|4003990_4005160_+	DNA repair protein	NA	NA	NA	NA	NA
AUM05235.1|4005160_4005925_-	siderophore-interacting protein	NA	NA	NA	NA	NA
AUM05236.1|4006071_4006566_+	PadR family transcriptional regulator	NA	NA	NA	NA	NA
AUM05237.1|4006562_4008122_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	29.8	1.4e-11
