The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP025602	Mycobacterium tuberculosis strain GG-109-10 chromosome, complete genome	4411463	1125405	1177206	4411463	protease,integrase,transposase,tRNA	Klosneuvirus(20.0%)	54	1133228:1133244	1182286:1182302
AUP95094.1|1125405_1126965_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SHR2	Klosneuvirus	39.2	2.8e-100
AUP97887.1|1127050_1127845_+	YchF/TatD family DNA exonuclease	NA	NA	NA	NA	NA
AUP95095.1|1128052_1129141_+	resuscitation-promoting factor RpfB	NA	Q856D9	Mycobacterium_phage	59.4	8.2e-22
AUP95096.1|1129113_1130067_+	ribosomal RNA small subunit methyltransferase A	NA	NA	NA	NA	NA
AUP97888.1|1130152_1131073_+	4-diphosphocytidyl-2C-methyl-D-erythritol kinase	NA	NA	NA	NA	NA
AUP95097.1|1131089_1131383_+	hypothetical protein	NA	NA	NA	NA	NA
AUP97889.1|1131342_1131642_-	hypothetical protein	NA	NA	NA	NA	NA
AUP95098.1|1131586_1133221_+	polyketide synthase	NA	NA	NA	NA	NA
1133228:1133244	attL	CGAGCAGACGCAAAATC	NA	NA	NA	NA
AUP95099.1|1133294_1133870_-|tRNA	peptidyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
AUP95100.1|1133882_1134530_-	50S ribosomal protein L25	NA	NA	NA	NA	NA
AUP95101.1|1134746_1135427_-	hypothetical protein	NA	NA	NA	NA	NA
AUP95102.1|1135462_1136443_-	ribose-phosphate diphosphokinase	NA	A0A1V0SHF7	Hokovirus	32.7	1.8e-44
AUP95103.1|1136534_1138022_-	bifunctional N-acetylglucosamine-1-phosphate uridyltransferase/glucosamine-1-phosphate acetyltransferase	NA	NA	NA	NA	NA
AUP97890.1|1138276_1138870_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
AUP95104.1|1138928_1142633_+	transcription-repair coupling factor	NA	NA	NA	NA	NA
AUP97891.1|1142632_1143610_+	nucleoside triphosphate pyrophosphohydrolase	NA	NA	NA	NA	NA
AUP95105.1|1143697_1144429_+	murein transglycosylase B	NA	NA	NA	NA	NA
AUP95106.1|1144525_1145815_+	enolase	NA	W6LP63	Streptococcus_phage	56.6	2.1e-133
AUP95107.1|1145819_1146506_+	septation inhibitor protein	NA	NA	NA	NA	NA
AUP97892.1|1146522_1146990_+	DUF501 domain-containing protein	NA	NA	NA	NA	NA
AUP95108.1|1146980_1147940_+	exopolyphosphatase	NA	NA	NA	NA	NA
AUP95109.1|1148179_1148392_+	hypothetical protein	NA	NA	NA	NA	NA
AUP95110.1|1148388_1149069_-	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	30.6	4.2e-24
AUP95111.1|1149065_1151648_-	sensor protein KdpD	NA	NA	NA	NA	NA
AUP95112.1|1151738_1151885_+	potassium transporter Trk	NA	NA	NA	NA	NA
AUP97893.1|1151881_1151974_+	K(+)-transporting ATPase subunit F	NA	NA	NA	NA	NA
AUP95113.1|1151973_1153689_+	potassium-transporting ATPase A chain	NA	NA	NA	NA	NA
AUP95114.1|1153685_1155815_+	potassium-transporting ATPase subunit B	NA	M1HRW9	Paramecium_bursaria_Chlorella_virus	26.2	3.8e-23
AUP95115.1|1155814_1156384_+	potassium-transporting ATPase subunit C	NA	NA	NA	NA	NA
AUP95116.1|1156387_1157917_-	sensor histidine kinase	NA	NA	NA	NA	NA
AUP95117.1|1157924_1158698_-	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	36.3	2.3e-34
AUP95118.1|1160505_1160790_-	type VII secretion protein EsxI	NA	NA	NA	NA	NA
AUP95119.1|1160816_1161113_-	WXG100 family type VII secretion target	NA	NA	NA	NA	NA
AUP95120.1|1161258_1162434_-	PPE family protein	NA	NA	NA	NA	NA
AUP95121.1|1162510_1163338_-	PE family protein	NA	NA	NA	NA	NA
AUP95122.1|1163898_1164147_+	hypothetical protein	NA	NA	NA	NA	NA
AUP95123.1|1164125_1164365_-	hypothetical protein	NA	NA	NA	NA	NA
AUP95124.1|1164270_1164489_-	hypothetical protein	NA	NA	NA	NA	NA
AUP97894.1|1164533_1165016_-|transposase	IS5 family transposase	transposase	A0A1V0SLQ8	Klosneuvirus	28.7	8.1e-06
AUP95125.1|1165053_1165452_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AUP97895.1|1165743_1166769_-|protease	serine protease	protease	NA	NA	NA	NA
AUP95126.1|1167015_1167639_+	hypothetical protein	NA	NA	NA	NA	NA
AUP95127.1|1167635_1168517_+	hypothetical protein	NA	NA	NA	NA	NA
AUP95128.1|1168598_1169387_-	hypothetical protein	NA	NA	NA	NA	NA
AUP95129.1|1169386_1170634_+|transposase	IS256 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	45.1	3.1e-81
AUP95130.1|1171001_1172117_-	hypothetical protein	NA	NA	NA	NA	NA
AUP95131.1|1172073_1172277_-	hypothetical protein	NA	NA	NA	NA	NA
AUP95132.1|1172349_1172796_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
AUP97896.1|1172844_1173750_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
AUP95133.1|1173908_1174664_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
AUP97897.1|1174958_1175585_-	hypothetical protein	NA	NA	NA	NA	NA
AUP95134.1|1175651_1175834_+	hypothetical protein	NA	NA	NA	NA	NA
AUP95135.1|1176529_1176868_+|integrase	integrase	integrase	NA	NA	NA	NA
AUP95136.1|1176891_1177206_+|integrase	integrase	integrase	Q854H9	Mycobacterium_phage	53.6	1.0e-09
1182286:1182302	attR	CGAGCAGACGCAAAATC	NA	NA	NA	NA
>prophage 2
CP025602	Mycobacterium tuberculosis strain GG-109-10 chromosome, complete genome	4411463	2941127	2976493	4411463	head,protease,integrase,capsid,transposase,terminase,tRNA	Tupanvirus(11.11%)	42	2969928:2969955	2980910:2980937
AUP96598.1|2941127_2943206_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L6B6	Tupanvirus	34.9	2.5e-104
AUP96599.1|2943314_2943542_+	hypothetical protein	NA	NA	NA	NA	NA
AUP98090.1|2943538_2944924_-	PE family protein	NA	NA	NA	NA	NA
AUP96600.1|2945268_2945769_+	DUF1990 domain-containing protein	NA	NA	NA	NA	NA
AUP96601.1|2945785_2946226_-	DoxX family membrane protein	NA	NA	NA	NA	NA
AUP98091.1|2946372_2947050_+	transcriptional regulator	NA	NA	NA	NA	NA
AUP96602.1|2947034_2947388_-	cupin domain-containing protein	NA	NA	NA	NA	NA
AUP96603.1|2947400_2947826_-	hypothetical protein	NA	NA	NA	NA	NA
AUP96604.1|2947822_2948497_-	transcriptional regulator	NA	NA	NA	NA	NA
AUP96605.1|2948574_2949396_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AUP96606.1|2949531_2950425_+	universal stress protein	NA	NA	NA	NA	NA
AUP98092.1|2950427_2951246_-	universal stress protein	NA	NA	NA	NA	NA
AUP96607.1|2951260_2952442_-|protease	site-2 protease family protein	protease	NA	NA	NA	NA
AUP96608.1|2952500_2952932_-	hypoxic response protein 1	NA	A0A2I6B2H4	Macacine_betaherpesvirus	100.0	1.9e-75
AUP96609.1|2953445_2954687_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
AUP98093.1|2954996_2955359_+	hypothetical protein	NA	NA	NA	NA	NA
AUP96610.1|2955705_2956830_+	hypothetical protein	NA	NA	NA	NA	NA
AUP96611.1|2956831_2957371_+	archease	NA	NA	NA	NA	NA
AUP96612.1|2957510_2958809_+	RNA-splicing ligase RtcB	NA	A2RQD0	Archaeal_BJ1_virus	43.3	3.8e-90
AUP96613.1|2958847_2959129_-	DUF1876 domain-containing protein	NA	NA	NA	NA	NA
AUP96614.1|2959273_2959759_-	hemerythrin domain-containing protein	NA	NA	NA	NA	NA
AUP96615.1|2959785_2960043_-	hypothetical protein	NA	NA	NA	NA	NA
AUP96616.1|2960043_2962380_-	PE family protein	NA	NA	NA	NA	NA
AUP96617.1|2962408_2962651_+	hypothetical protein	NA	NA	NA	NA	NA
AUP96618.1|2962651_2963329_+	hypothetical protein	NA	NA	NA	NA	NA
AUP96619.1|2963524_2964181_+	DedA family protein	NA	NA	NA	NA	NA
AUP96620.1|2964343_2964790_+	STAS domain-containing protein	NA	NA	NA	NA	NA
AUP96621.1|2964964_2965297_-	YnfA family protein	NA	NA	NA	NA	NA
AUP96622.1|2965416_2965776_-	transcriptional regulator	NA	NA	NA	NA	NA
AUP96623.1|2965877_2966336_+	cadmium-induced protein CadI	NA	NA	NA	NA	NA
AUP96624.1|2966471_2966852_+	transcriptional regulator	NA	NA	NA	NA	NA
AUP96625.1|2966848_2968345_+	arsenical-resistance protein	NA	A0A2H4PQT9	Staphylococcus_phage	39.7	5.1e-14
AUP98094.1|2968534_2968771_+	DUF3018 domain-containing protein	NA	NA	NA	NA	NA
AUP96626.1|2968843_2969017_+	hypothetical protein	NA	NA	NA	NA	NA
2969928:2969955	attL	ACTGGTTCAATCCCAGTATCGCGCACCA	NA	NA	NA	NA
AUP96627.1|2970061_2970493_+	hypothetical protein	NA	NA	NA	NA	NA
AUP96628.1|2970489_2971488_+|integrase	integrase	integrase	A0A2D1G8E2	Mycobacterium_phage	47.8	7.4e-62
AUP96629.1|2971501_2971966_+	hypothetical protein	NA	NA	NA	NA	NA
AUP96630.1|2971953_2972142_+	hypothetical protein	NA	NA	NA	NA	NA
AUP96631.1|2972098_2973359_+|transposase	IS3-like element IS987 family transposase	transposase	Q8W6R2	Burkholderia_virus	59.1	9.6e-83
AUP96632.1|2973733_2975173_-|capsid	phage major capsid protein	capsid	A0A1B3AYS4	Gordonia_phage	40.6	1.4e-66
AUP98095.1|2975180_2975714_-|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	32.9	3.1e-06
AUP96633.1|2975866_2976493_-|terminase	phage terminase small subunit P27 family	terminase	V9H0V4	Actinophage	47.2	1.6e-17
2980910:2980937	attR	ACTGGTTCAATCCCAGTATCGCGCACCA	NA	NA	NA	NA
>prophage 3
CP025602	Mycobacterium tuberculosis strain GG-109-10 chromosome, complete genome	4411463	3710410	3796339	4411463	transposase,tRNA	Burkholderia_virus(28.57%)	57	NA	NA
AUP97237.1|3710410_3711671_+|transposase	IS3-like element IS987 family transposase	transposase	Q8W6R2	Burkholderia_virus	59.1	9.6e-83
AUP97238.1|3711909_3713439_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
AUP98201.1|3713371_3714310_-	RNA polymerase sigma factor SigJ	NA	NA	NA	NA	NA
AUP97239.1|3714318_3715686_+	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	25.8	9.0e-18
AUP97240.1|3715754_3716972_+	D-alanyl-D-alanine carboxypeptidase	NA	A0A1P8VVG5	Erythrobacter_phage	27.3	8.0e-10
AUP97241.1|3717067_3718576_+	MFS transporter	NA	NA	NA	NA	NA
AUP97242.1|3718572_3719724_+	N-acetylglucosamine-6-phosphate deacetylase	NA	NA	NA	NA	NA
AUP97243.1|3719914_3720760_-	DUF732 domain-containing protein	NA	NA	NA	NA	NA
AUP98202.1|3720736_3721216_+	hypothetical protein	NA	NA	NA	NA	NA
AUP97244.1|3721234_3721675_+	Zn(2+)-responsive transcriptional regulator	NA	NA	NA	NA	NA
AUP97245.1|3721708_3722578_-	inner membrane protein YhjD	NA	NA	NA	NA	NA
AUP97246.1|3722598_3723609_-|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
AUP97247.1|3723893_3724526_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
AUP97248.1|3724592_3725822_-	isocitrate dehydrogenase (NADP(+))	NA	NA	NA	NA	NA
AUP97249.1|3726104_3727454_+	bifunctional o-acetylhomoserine/o-acetylserine sulfhydrylase	NA	A0A0B5JD48	Pandoravirus	26.5	2.5e-12
AUP97250.1|3727465_3728605_+	homoserine O-acetyltransferase	NA	NA	NA	NA	NA
AUP98203.1|3728601_3729333_+	methyltransferase	NA	NA	NA	NA	NA
AUP97251.1|3729341_3736913_-	PPE family protein	NA	NA	NA	NA	NA
AUP97252.1|3743166_3743424_-	DUF3017 domain-containing protein	NA	NA	NA	NA	NA
AUP97253.1|3743679_3753153_-	PPE family protein	NA	NA	NA	NA	NA
AUP98205.1|3753190_3753682_-	hypothetical protein	NA	NA	NA	NA	NA
AUP98204.1|3753778_3754225_+|transposase	transposase	transposase	NA	NA	NA	NA
AUP97254.1|3754261_3755080_-|transposase	transposase	transposase	NA	NA	NA	NA
AUP97255.1|3755296_3755533_-|transposase	transposase	transposase	NA	NA	NA	NA
AUP97256.1|3755920_3767071_-	PPE family protein	NA	NA	NA	NA	NA
AUP97257.1|3767314_3768109_-	oxidoreductase	NA	NA	NA	NA	NA
AUP97258.1|3768190_3768562_-	FAD-binding oxidoreductase	NA	A0A0B5JBT9	Pandoravirus	56.4	3.3e-15
AUP97259.1|3768459_3768870_-	FAD-binding protein	NA	NA	NA	NA	NA
AUP98206.1|3768704_3768965_-	oxidoreductase	NA	NA	NA	NA	NA
AUP97260.1|3769079_3769469_+	DUF732 domain-containing protein	NA	NA	NA	NA	NA
AUP97261.1|3769482_3769776_-	DUF3017 domain-containing protein	NA	NA	NA	NA	NA
AUP97262.1|3769772_3770618_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase	NA	NA	NA	NA	NA
AUP97263.1|3770741_3771017_+	antitoxin	NA	NA	NA	NA	NA
AUP97264.1|3771013_3771271_+	Txe/YoeB family addiction module toxin	NA	NA	NA	NA	NA
AUP97265.1|3771312_3772503_+	NADH:flavin oxidoreductase	NA	NA	NA	NA	NA
AUP97266.1|3772619_3772988_+	hypothetical protein	NA	NA	NA	NA	NA
AUP97267.1|3772984_3773536_-	pentapeptide repeat protein MfpA	NA	NA	NA	NA	NA
AUP97268.1|3773542_3774124_-	ATP/GTP-binding protein	NA	NA	NA	NA	NA
AUP98207.1|3774104_3774473_-	DUF742 domain-containing protein	NA	NA	NA	NA	NA
AUP97269.1|3774450_3774843_-	dynein regulation protein LC7	NA	NA	NA	NA	NA
AUP97270.1|3774839_3777470_-	two-component system sensor histidine kinase EnvZ	NA	NA	NA	NA	NA
AUP97271.1|3777705_3778170_+|tRNA	tRNA (cytidine(34)-2'-O)-methyltransferase	tRNA	NA	NA	NA	NA
AUP97272.1|3778536_3780312_+	PE family protein	NA	NA	NA	NA	NA
AUP97273.1|3780312_3780957_-	oxidoreductase	NA	NA	NA	NA	NA
AUP97274.1|3780955_3781390_+	TIGR03667 family PPOX class F420-dependent oxidoreductase	NA	NA	NA	NA	NA
AUP97275.1|3781478_3784718_-	DNA polymerase III subunit alpha	NA	A0A1C9LWS4	Streptomyces_phage	32.4	1.6e-118
AUP97276.1|3784909_3786250_+	wax ester/triacylglycerol synthase family O-acyltransferase	NA	NA	NA	NA	NA
AUP97277.1|3786291_3787467_+	trehalose-phosphatase	NA	NA	NA	NA	NA
AUP97278.1|3787703_3788345_+	enoyl-CoA hydratase	NA	NA	NA	NA	NA
AUP97279.1|3788345_3788594_+	enoyl-CoA hydratase	NA	NA	NA	NA	NA
AUP97280.1|3788598_3790026_+	amidase	NA	NA	NA	NA	NA
AUP98208.1|3790133_3790787_+	haloacid dehalogenase	NA	NA	NA	NA	NA
AUP97281.1|3790825_3792331_-	type B diterpene cyclase	NA	NA	NA	NA	NA
AUP97282.1|3792335_3793226_-	diterpene synthase	NA	NA	NA	NA	NA
AUP97283.1|3793234_3794845_-	1-deoxy-D-xylulose-5-phosphate synthase	NA	NA	NA	NA	NA
AUP97284.1|3794789_3795035_-	1-deoxy-D-xylulose-5-phosphate synthase	NA	NA	NA	NA	NA
AUP97285.1|3795077_3796339_-|transposase	IS3-like element IS987 family transposase	transposase	Q8W6R2	Burkholderia_virus	59.1	9.6e-83
