The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP025930	Porphyromonas gingivalis ATCC 33277 chromosome, complete genome	2379874	417857	503071	2379874	tRNA,integrase,transposase,protease	Planktothrix_phage(18.18%)	59	415603:415618	463892:463907
415603:415618	attL	CGCTTAGATCGAACTG	NA	NA	NA	NA
AUR49854.1|417857_418784_-|integrase	bacteriophage integrase	integrase	A0A0K2CP59	Brevibacillus_phage	29.2	3.7e-31
AUR50528.1|418901_419327_+	3-dehydroquinate dehydratase	NA	NA	NA	NA	NA
AUR50212.1|419427_420078_+	O-methyltransferase	NA	NA	NA	NA	NA
AUR50365.1|420114_420663_+	thiol peroxidase	NA	NA	NA	NA	NA
AUR50432.1|420858_421350_-	guanine deaminase	NA	S4VYZ2	Pandoravirus	36.0	9.1e-21
AUR49952.1|421383_422247_-	RNA-associated protein	NA	NA	NA	NA	NA
AUR49328.1|422256_423675_-	pDZ signaling protein	NA	NA	NA	NA	NA
AUR50444.1|423707_424190_-	competence/damage-inducible protein	NA	B5TK85	Pseudomonas_phage	38.5	2.7e-17
AUR49739.1|424189_425215_-|tRNA	tRNA N6-adenosine threonylcarbamoyltransferase	tRNA	A0A0R6PI74	Moraxella_phage	40.9	2.5e-65
AUR50684.1|425632_425887_-	30S ribosomal protein S20	NA	NA	NA	NA	NA
AUR49082.1|426563_428759_-	3'-to-5' exoribonuclease RNase R	NA	Q0GXV6	Lactococcus_phage	31.9	4.7e-61
AUR49280.1|428811_430323_-	hypothetical protein	NA	NA	NA	NA	NA
AUR49168.1|430356_432207_-	lipid A export ATP-binding/permease protein	NA	W8CYL7	Bacillus_phage	31.2	3.3e-55
AUR49003.1|432832_435613_+	outer membrane porin CarboxypepD_reg-like domain	NA	NA	NA	NA	NA
AUR50222.1|436684_437329_+	pyridoxine/pyridoxamine 5'-phosphate oxidase	NA	NA	NA	NA	NA
AUR50554.1|437365_437770_+	thiosulfate sulfurtransferase	NA	NA	NA	NA	NA
AUR49057.1|437858_440204_+	alpha-12-mannosidase	NA	NA	NA	NA	NA
AUR49063.1|440228_442532_+	alpha-12-mannosidase	NA	NA	NA	NA	NA
AUR50604.1|443078_443432_+	cell division protein stabilizes FtsL against RasP cleavage	NA	NA	NA	NA	NA
AUR50596.1|443452_443815_+	hypothetical protein	NA	NA	NA	NA	NA
AUR49805.1|443834_444809_+	ribosomal large subunit pseudouridine synthase D	NA	NA	NA	NA	NA
AUR49114.1|444845_446894_+	thiol:disulfide interchange protein	NA	NA	NA	NA	NA
AUR50032.1|446911_447697_+	nucleoside triphosphate pyrophosphohydrolase	NA	NA	NA	NA	NA
AUR49137.1|447754_449719_+	DNA gyrase subunit B	NA	G3M9Z3	Bacillus_virus	44.7	2.3e-139
AUR49175.1|449711_451520_+	Zn-dependent dipeptidase	NA	NA	NA	NA	NA
AUR48962.1|452501_456476_-	DEAD/DEAH box helicase	NA	NA	NA	NA	NA
AUR49758.1|456485_457499_-	type II DNA modification methyltransferase	NA	NA	NA	NA	NA
AUR49638.1|458558_459653_+	aminodeoxychorismate lyase	NA	NA	NA	NA	NA
AUR50080.1|459649_460399_+|tRNA	tRNA threonylcarbamoyladenosine dehydratase	tRNA	NA	NA	NA	NA
AUR50202.1|460395_461055_+	lipoprotein-releasing system ATP-binding	NA	G9BWD6	Planktothrix_phage	42.5	1.1e-37
AUR50151.1|461084_461789_+	DNA-binding protein	NA	NA	NA	NA	NA
AUR50278.1|461795_462398_+	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
AUR50462.1|462880_463351_+	transcription elongation factor	NA	NA	NA	NA	NA
AUR50566.1|463366_463756_+	putative HIT-like protein	NA	NA	NA	NA	NA
AUR50455.1|464666_465143_-	lipoprotein	NA	NA	NA	NA	NA
463892:463907	attR	CGCTTAGATCGAACTG	NA	NA	NA	NA
AUR49461.1|465139_466426_-	alpha-amylase	NA	NA	NA	NA	NA
AUR49481.1|466422_467685_-	glycosyltransferase	NA	NA	NA	NA	NA
AUR49135.1|467681_469658_-	4-alpha-glucanotransferase	NA	NA	NA	NA	NA
AUR50155.1|470144_470846_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	31.2	6.6e-25
AUR49302.1|470880_472353_-	inner membrane protein unknown function	NA	NA	NA	NA	NA
AUR49486.1|472472_473729_-	phosphoglycerate kinase	NA	NA	NA	NA	NA
AUR49235.1|474024_475632_+	phosphoenolpyruvate carboxykinase [ATP]	NA	A0A2H4PQN1	Staphylococcus_phage	49.3	6.6e-129
AUR50721.1|475827_476040_-	hemagglutinin-related protein	NA	NA	NA	NA	NA
AUR50597.1|476039_476402_-	hemagglutinin-related protein	NA	NA	NA	NA	NA
AUR49885.1|482967_483870_-|transposase	transposase in IS195	transposase	NA	NA	NA	NA
AUR49369.1|484843_486211_-	outer membrane protein TolC Type I secretion system	NA	NA	NA	NA	NA
AUR49625.1|486207_487314_-	macrolide export protein	NA	NA	NA	NA	NA
AUR49482.1|487383_488646_-	macrolide export ATP-binding/permease	NA	NA	NA	NA	NA
AUR49471.1|488668_489943_-	macrolide export ATP-binding/permease	NA	NA	NA	NA	NA
AUR50203.1|489967_490627_-	putative ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	41.3	1.2e-31
AUR50552.1|490645_491053_-	hypothetical protein	NA	NA	NA	NA	NA
AUR50397.1|491538_492063_+	ECF RNA polymerase sigma factor	NA	NA	NA	NA	NA
AUR50564.1|492059_492452_+	inner membrane protein unknown function	NA	NA	NA	NA	NA
AUR49886.1|492788_493691_-|transposase	transposase in IS195	transposase	NA	NA	NA	NA
AUR49887.1|493844_494747_-|transposase	transposase in IS195	transposase	NA	NA	NA	NA
AUR49089.1|495482_497630_-	methylmalonyl-CoA mutase large subunit	NA	NA	NA	NA	NA
AUR49165.1|497658_499515_-	methylmalonyl-CoA mutase	NA	NA	NA	NA	NA
AUR49267.1|499761_501288_+|protease	t9SS C-terminal target domain-containing protease	protease	NA	NA	NA	NA
AUR49888.1|502168_503071_+|transposase	transposase in IS195	transposase	NA	NA	NA	NA
>prophage 2
CP025930	Porphyromonas gingivalis ATCC 33277 chromosome, complete genome	2379874	592589	660860	2379874	tRNA,transposase,protease	Ralstonia_phage(30.77%)	56	NA	NA
AUR49268.1|592589_594113_+|tRNA	glutamyl-tRNA synthetase	tRNA	NA	NA	NA	NA
AUR49501.1|594137_595376_+	3-deoxy-D-manno-octulosonic acid transferase	NA	NA	NA	NA	NA
AUR49139.1|595460_597416_+	lipoteichoic acid synthase	NA	NA	NA	NA	NA
AUR49947.1|597530_598400_+	glucose-1-phosphate thymidylyltransferase 2	NA	I7I009	Enterobacteria_phage	63.2	3.1e-104
AUR50301.1|598414_599005_+	dTDP-4-dehydrorhamnose epimerase	NA	I7HJC4	Enterobacteria_phage	52.8	9.2e-44
AUR49961.1|599001_599859_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.8	4.6e-36
AUR49697.1|599865_600930_+	dTDP-glucose dehydratase	NA	A0A1D8EQC0	Escherichia_phage	48.6	7.3e-84
AUR49643.1|601004_602093_+	aminomethyltransferase glycine cleavage system T	NA	NA	NA	NA	NA
AUR50629.1|603056_603383_-	hypothetical protein	NA	NA	NA	NA	NA
AUR50327.1|603388_603967_-	motA/TolQ/ExbB proton channel	NA	NA	NA	NA	NA
AUR50183.1|604036_604714_-	hypothetical protein	NA	NA	NA	NA	NA
AUR48959.1|604710_609120_-	cobN/magnesium chelatase	NA	NA	NA	NA	NA
AUR49144.1|609156_611097_-	outer membrane receptor for ferrienterochelin and colicin	NA	A0A0P0I887	Acinetobacter_phage	28.2	8.3e-09
AUR50213.1|611111_611762_-	heme-binding protein	NA	NA	NA	NA	NA
AUR49037.1|612614_615137_-|protease	thiol protease/hemagglutinin	protease	NA	NA	NA	NA
AUR50610.1|615363_615717_-	hypothetical protein	NA	NA	NA	NA	NA
AUR50330.1|615902_616478_-	superoxide dismutase [Mn/Fe]	NA	Q56AR7	Bacillus_thuringiensis_phage	40.2	4.6e-40
AUR50055.1|616615_617386_-	response to hydroperoxyde protein	NA	NA	NA	NA	NA
AUR50533.1|617470_617890_-	4-hydroxybenzoyl-CoA thioesterase	NA	NA	NA	NA	NA
AUR49519.1|617945_619166_-	collagenase precursor	NA	Q6DW11	Phage_TP	24.8	4.4e-16
AUR50505.1|619202_619646_-	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine pyrophosphokinase	NA	NA	NA	NA	NA
AUR49709.1|619648_620701_-|tRNA	S-adenosylmethionine:tRNA ribosyltransferase-isomerase	tRNA	NA	NA	NA	NA
AUR50046.1|620718_621495_-|tRNA	tRNA pseudouridine synthase B	tRNA	NA	NA	NA	NA
AUR49982.1|621504_622347_-	undecaprenyl-diphosphatase	NA	NA	NA	NA	NA
AUR50706.1|622454_622682_-	inner membrane	NA	NA	NA	NA	NA
AUR49924.1|622728_623616_-	cell division FtsX-related transmembrane transport protein	NA	NA	NA	NA	NA
AUR50617.1|625229_625571_+	transcriptional regulator	NA	NA	NA	NA	NA
AUR49653.1|627786_628872_+|transposase	transposase in ISPg8	transposase	A0A077K814	Ralstonia_phage	27.1	1.3e-19
AUR50709.1|628970_629192_-	conjugative transposon protein TraN	NA	NA	NA	NA	NA
AUR49806.1|629345_630320_+	conjugative transposon protein TraM	NA	NA	NA	NA	NA
AUR48951.1|630407_636020_+	reticulocyte binding protein 2 like	NA	NA	NA	NA	NA
AUR49295.1|636205_637690_+	hypothetical protein	NA	NA	NA	NA	NA
AUR49108.1|637785_639867_+	DNA topoisomerase III	NA	A0A076FM50	Aureococcus_anophage	25.1	5.0e-20
AUR49227.1|640008_641649_+	hypothetical protein	NA	NA	NA	NA	NA
AUR50664.1|641632_641911_-	DNA-binding helix-turn-helix regulator	NA	NA	NA	NA	NA
AUR49509.1|641923_643159_-	ATPase	NA	NA	NA	NA	NA
AUR49889.1|643285_644188_+|transposase	transposase in IS195	transposase	NA	NA	NA	NA
AUR50640.1|644226_644541_+	fusion protein	NA	NA	NA	NA	NA
AUR49654.1|644624_645710_+|transposase	transposase in ISPg8	transposase	A0A077K814	Ralstonia_phage	27.4	5.8e-20
AUR50688.1|646404_646659_+	hypothetical protein	NA	NA	NA	NA	NA
AUR50710.1|646663_646885_+	putative synthetase/amidase	NA	NA	NA	NA	NA
AUR49703.1|647101_648160_+	cell filamentation protein	NA	D7RWK9	Brochothrix_phage	28.5	1.6e-06
AUR49356.1|648190_649573_-	glycosaminoglycan attachment site	NA	NA	NA	NA	NA
AUR50511.1|649692_650130_-	conjugative transposon protein TraQ	NA	NA	NA	NA	NA
AUR50312.1|650149_650734_-	conjugative transposon protein TraO	NA	NA	NA	NA	NA
AUR49843.1|650738_651674_-	conjugative transposon protein TraN	NA	NA	NA	NA	NA
AUR49377.1|651747_653109_-	conjugative transposon protein TraM	NA	NA	NA	NA	NA
AUR50679.1|653105_653369_-	hypothetical protein	NA	NA	NA	NA	NA
AUR50254.1|653372_653996_-	conjugative transposon protein TraK	NA	NA	NA	NA	NA
AUR49796.1|654013_655000_-	conjugative transposon protein TraJ	NA	NA	NA	NA	NA
AUR50255.1|655020_655644_-	conjugative transposon protein TraI	NA	NA	NA	NA	NA
AUR50465.1|655695_656163_-	conjugative transposon protein TraG	NA	NA	NA	NA	NA
AUR50534.1|656240_656660_-	group II intron-encoded protein retron-type RNA-directed DNA polymerase	NA	NA	NA	NA	NA
AUR49655.1|656823_657909_+|transposase	transposase in ISPg8	transposase	A0A077K814	Ralstonia_phage	27.4	5.8e-20
AUR50445.1|659044_659527_+	non-heme ferritin	NA	NA	NA	NA	NA
AUR49656.1|659774_660860_-|transposase	transposase in ISPg8	transposase	A0A077K814	Ralstonia_phage	27.8	3.8e-19
>prophage 3
CP025930	Porphyromonas gingivalis ATCC 33277 chromosome, complete genome	2379874	893730	973770	2379874	tRNA,transposase,protease	Ralstonia_phage(18.18%)	57	NA	NA
AUR50129.1|893730_894447_-|tRNA	phenylalanine--tRNA ligase beta subunit	tRNA	NA	NA	NA	NA
AUR49556.1|894427_895612_-	GTPase Obg	NA	NA	NA	NA	NA
AUR50314.1|895621_896206_-	adenylate kinase	NA	NA	NA	NA	NA
AUR50387.1|896206_896743_-	hypoxanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
AUR49129.1|897336_899334_+	fructose-16-bisphosphatase	NA	NA	NA	NA	NA
AUR49055.1|899489_901844_+	monofunctional biosynthetic peptidoglycan transglycosylase	NA	NA	NA	NA	NA
AUR50138.1|901891_902602_+	ftsH-interacting integral membrane protein	NA	NA	NA	NA	NA
AUR49005.1|902766_905544_-|tRNA	leucyl-tRNA synthetase	tRNA	A0A2H4PQS0	Staphylococcus_phage	43.3	8.0e-207
AUR49248.1|907080_908640_-	NAD-utilizing dehydrogenase	NA	NA	NA	NA	NA
AUR49315.1|908624_910076_-|tRNA	tRNA nucleotidyltransferase	tRNA	A0A2I2MPB1	Mycobacterium_phage	28.8	1.2e-31
AUR49393.1|910715_912065_-	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	26.5	8.3e-32
AUR50022.1|912069_912861_-	glucosamine-6-phosphate deaminase	NA	NA	NA	NA	NA
AUR49529.1|912898_914110_-	flavodoxin	NA	NA	NA	NA	NA
AUR49969.1|914140_914992_-	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
AUR49883.1|915028_915934_-	meso-diaminopimelate D-dehydrogenase	NA	NA	NA	NA	NA
AUR49717.1|915971_917018_-	transcription termination protein	NA	NA	NA	NA	NA
AUR48948.1|917702_925202_-	gliding motility protein	NA	NA	NA	NA	NA
AUR50271.1|925241_925850_-	holliday junction ATP-dependent DNA helicase	NA	NA	NA	NA	NA
AUR49659.1|926293_927379_-|transposase	transposase in ISPg8	transposase	A0A077K814	Ralstonia_phage	27.8	2.2e-19
AUR49014.1|927933_930609_-	outer membrane porin CarboxypepD_reg-like domain	NA	NA	NA	NA	NA
AUR50132.1|930625_931342_-	hypothetical protein	NA	NA	NA	NA	NA
AUR49626.1|931928_933035_-|transposase	transposase in ISPg2	transposase	NA	NA	NA	NA
AUR50728.1|933143_933338_+	exodeoxyribonuclease 7 small subunit	NA	NA	NA	NA	NA
AUR50192.1|933334_934003_+	2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
AUR49660.1|934788_935874_-|transposase	transposase in ISPg8	transposase	A0A077K814	Ralstonia_phage	27.8	4.9e-19
AUR50389.1|936097_936631_+	DNA-binding protein	NA	NA	NA	NA	NA
AUR50479.1|936657_937116_+	hypothetical protein	NA	NA	NA	NA	NA
AUR50599.1|937473_937833_+	hypothetical protein	NA	NA	NA	NA	NA
AUR50403.1|937839_938361_+	hypothetical protein	NA	NA	NA	NA	NA
AUR50707.1|938373_938601_+	5-hydroxytryptamine receptor 2	NA	NA	NA	NA	NA
AUR50661.1|938623_938905_+	hypothetical protein	NA	NA	NA	NA	NA
AUR50651.1|938917_939220_+	hypothetical protein	NA	NA	NA	NA	NA
AUR49462.1|939941_941228_-	internalin-J	NA	NA	NA	NA	NA
AUR49516.1|942407_943631_-	adenine DNA glycosylase	NA	G3CB03	Aeropyrum_pernix_spindle-shaped_virus	31.6	3.0e-25
AUR49841.1|943680_944619_+	ABC transporter Periplasmic binding protein-like II	NA	NA	NA	NA	NA
AUR50158.1|944670_945369_+	aliphatic sulfonates import ATP-binding protein	NA	G3M9Y6	Bacillus_virus	32.0	3.4e-29
AUR50081.1|945365_946115_+	aliphatic sulfonates transport permease	NA	NA	NA	NA	NA
AUR49715.1|946164_947214_+	phosphate-selective porin O	NA	NA	NA	NA	NA
AUR50230.1|947412_948051_+	lysE type translocator	NA	NA	NA	NA	NA
AUR49008.1|948127_950869_-	DNA/RNA helicase	NA	NA	NA	NA	NA
AUR49215.1|950861_952529_-	type III restriction-modification system methylation subunit	NA	A0A220NUF4	Escherichia_phage	39.8	9.8e-75
AUR49891.1|952692_953595_+|transposase	transposase in IS195	transposase	NA	NA	NA	NA
AUR49274.1|953755_955273_+	phosphoribosylaminoimidazolecarboxamide formyltransferase	NA	Q58MG4	Prochlorococcus_phage	41.6	5.1e-54
AUR49748.1|955375_956395_+	rod shape-determining protein	NA	NA	NA	NA	NA
AUR49925.1|956432_957320_+	cell shape-determining protein	NA	NA	NA	NA	NA
AUR50404.1|957319_957838_+	rod shape-determining protein	NA	NA	NA	NA	NA
AUR49161.1|957830_959696_+	penicillin-binding protein 2	NA	NA	NA	NA	NA
AUR49309.1|959685_961143_+	rod shape-determining protein	NA	NA	NA	NA	NA
AUR49530.1|961170_962382_-	hypothetical protein	NA	NA	NA	NA	NA
AUR50480.1|962613_963072_+	Nucleoid-associated protein	NA	NA	NA	NA	NA
AUR50143.1|963136_963847_+	hypothetical protein	NA	NA	NA	NA	NA
AUR49859.1|963883_964810_+	outer membrane hypothetical protein	NA	NA	NA	NA	NA
AUR49026.1|964993_967573_+	DNA gyrase subunit A	NA	G3M9Z5	Bacillus_virus	33.8	1.9e-109
AUR49537.1|967606_968809_+|protease	Beta-barrel assembly-enhancing protease	protease	NA	NA	NA	NA
AUR48995.1|969400_972298_+	RNA polymerase-associated protein	NA	A0A2H4J643	uncultured_Caudovirales_phage	43.8	1.4e-214
AUR50495.1|972329_972782_+	hypothetical protein	NA	NA	NA	NA	NA
AUR49892.1|972867_973770_-|transposase	transposase in IS195	transposase	NA	NA	NA	NA
>prophage 4
CP025930	Porphyromonas gingivalis ATCC 33277 chromosome, complete genome	2379874	977923	1052198	2379874	transposase,integrase,protease	Streptococcus_virus(10.0%)	55	972855:972914	1066091:1067160
972855:972914	attL	ACGTCAGTTCGATCTAAGCGGAAATAGGAAAGTTAGGGTTTCTGATGATTTCAATATTGA	NA	NA	NA	NA
AUR50130.1|977923_978640_-|protease	rhomboid protease membrane protein of glp regulon	protease	NA	NA	NA	NA
AUR48999.1|978666_981522_-	LPS-assembly organic solvent tolerance protein	NA	NA	NA	NA	NA
AUR50094.1|981994_982738_-	pyridoxamine 5'-phosphate oxidase	NA	NA	NA	NA	NA
AUR49816.1|982793_983759_+	cadmium cobalt and zinc/H(+)-K(+) antiporter	NA	NA	NA	NA	NA
AUR50405.1|983755_984274_-	putative Met_synt_B12 super family	NA	NA	NA	NA	NA
AUR49209.1|984363_986043_-	aspartate/alanine antiporter cobalt transporter	NA	NA	NA	NA	NA
AUR49021.1|987959_990563_+	ferric enterobactin receptor	NA	NA	NA	NA	NA
AUR49834.1|990995_991937_+	nitronate monooxygenase	NA	NA	NA	NA	NA
AUR50703.1|991933_992164_+	putative Cys_rich_CWC	NA	NA	NA	NA	NA
AUR49224.1|992232_993879_+	fumarate hydratase	NA	NA	NA	NA	NA
AUR49176.1|994001_995810_+	DNA polymerase III subunit tau	NA	A0A1U9WR94	Streptococcus_virus	39.1	6.1e-46
AUR50740.1|996246_996417_-	ferredoxin	NA	NA	NA	NA	NA
AUR49286.1|996752_998255_-	D-alanyl-D-alanine carboxypeptidase	NA	NA	NA	NA	NA
AUR49214.1|998497_1000168_-	peptidylarginine deiminase	NA	NA	NA	NA	NA
AUR49035.1|1001383_1003915_-|protease	thiol protease hemagglutinin precursor	protease	NA	NA	NA	NA
AUR50438.1|1004054_1004540_-	67-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	42.9	9.9e-28
AUR50171.1|1004631_1005318_-	tetratricopeptide repeat-containing protein	NA	NA	NA	NA	NA
AUR50176.1|1005503_1006187_-	response regulator protein	NA	NA	NA	NA	NA
AUR49162.1|1006199_1008062_-	two-component sensor histidine kinase	NA	NA	NA	NA	NA
AUR50017.1|1009011_1009809_-	dihydroorotate dehydrogenase electron transfer subunit	NA	NA	NA	NA	NA
AUR50508.1|1009860_1010301_-	transcriptional regulator	NA	NA	NA	NA	NA
AUR49893.1|1011472_1012375_-|transposase	transposase in IS195	transposase	NA	NA	NA	NA
AUR49570.1|1012572_1013745_-	hypothetical protein	NA	NA	NA	NA	NA
AUR50215.1|1013759_1014410_-	ribonuclease H	NA	NA	NA	NA	NA
AUR49760.1|1014437_1015451_-|protease	Beta-barrel assembly-enhancing protease	protease	NA	NA	NA	NA
AUR50379.1|1015463_1016003_-	acetyltransferase	NA	NA	NA	NA	NA
AUR49183.1|1016011_1017799_-	xaa-Pro aminopeptidase metallopeptidase family M24	NA	A0A0P0I8D7	Acinetobacter_phage	40.7	2.5e-129
AUR49258.1|1017847_1019395_-	ribosylnicotinamide kinase	NA	NA	NA	NA	NA
AUR49148.1|1019977_1021900_+	chaperone	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	48.8	5.9e-140
AUR50360.1|1022110_1022665_+	DNA-binding helix-turn-helix regulator	NA	NA	NA	NA	NA
AUR49483.1|1022677_1023940_+|integrase	bacteriophage integrase	integrase	H7BUI8	unidentified_phage	26.2	2.2e-10
AUR50400.1|1023960_1024482_+	mobilizable transposon	NA	NA	NA	NA	NA
AUR49661.1|1024585_1025671_+|transposase	transposase in ISPg8	transposase	A0A077K814	Ralstonia_phage	28.1	9.9e-20
AUR50225.1|1026148_1026793_-	hypothetical protein	NA	NA	NA	NA	NA
AUR49532.1|1027662_1028868_+	virulence-associated protein putative P-loop ATPase	NA	D3W0G0	Lactococcus_phage	27.8	4.1e-14
AUR49919.1|1029095_1029986_+	DNA primase	NA	NA	NA	NA	NA
AUR50595.1|1030115_1030478_+	mobilization protein	NA	NA	NA	NA	NA
AUR49835.1|1030467_1031409_+	relaxase/mobilization protein	NA	NA	NA	NA	NA
AUR50124.1|1031434_1032157_+	inner membrane protein unknown function	NA	NA	NA	NA	NA
AUR50718.1|1032274_1032490_+	transcriptional regulator	NA	NA	NA	NA	NA
AUR49531.1|1032561_1033770_+	sirtuin	NA	NA	NA	NA	NA
AUR49152.1|1033759_1035661_+	bipolar DNA helicase	NA	NA	NA	NA	NA
AUR49718.1|1035856_1036903_+	exonuclease sbcC	NA	NA	NA	NA	NA
AUR50042.1|1036958_1037738_+	transcriptional regulator	NA	NA	NA	NA	NA
AUR50500.1|1037734_1038181_+	ATP-dependent DNA helicase	NA	NA	NA	NA	NA
AUR50484.1|1038295_1038751_+	putative N-acetyltransferase	NA	E9LUK4	Lactobacillus_phage	38.4	2.7e-19
AUR49310.1|1038804_1040262_+	ATP-dependent DNA helicase	NA	NA	NA	NA	NA
AUR49894.1|1040415_1041318_+|transposase	transposase in IS195	transposase	NA	NA	NA	NA
AUR49158.1|1041563_1043444_+	ATPase involved in DNA repair	NA	NA	NA	NA	NA
AUR49826.1|1043684_1044638_+	glycerate dehydrogenase	NA	M1NSB9	Streptococcus_phage	27.4	2.1e-21
AUR49594.1|1045024_1046173_+	8-amino-7-oxononanoate synthase	NA	NA	NA	NA	NA
AUR49350.1|1047383_1048775_+	GDSL-like lipase/acylhydrolase inner membrane lipoprotein	NA	NA	NA	NA	NA
AUR50014.1|1048779_1049586_+	lysophospholipase L1-like esterase	NA	NA	NA	NA	NA
AUR49266.1|1049606_1051142_+	peptidoglycan O-acetyltransferase	NA	A0A125RNP0	Pseudomonas_phage	36.5	1.2e-63
AUR49895.1|1051295_1052198_-|transposase	transposase in IS195	transposase	NA	NA	NA	NA
1066091:1067160	attR	TCAATATTGAAATCATCAGAAACCCTAACTTTCCTATTTCCGCTTAGATCGAACTGACGTTGTTTAGATTGATGGCTGAATAATCCTTACGAGCTCGACAAGTATCCTCCCTAAAGGTTACATCCAAATGCCAATGGAGTCGATTCTCAATTCCCCAATGCCCTCGAATATATTGCCCGATTAACTGACAATCTTCGGGTGGTAAACTGCTGATATAATACTGCCCTATCTATGCGAGTCTCTCCCTCTGAATTACTGATCTCACGCTCCACTTGAATTAAACTTCTCAAGCCCTGCCATTGACTATATTCCCCCTCGTCAAAGACCTCTGAAGCCGGTAATGTGGTATAAGTCCGCTTCTCAATACGACCATGATCTTTCTCCAGGGTCTCATAACGATGACACCTGATATTGTCCTGTAAAGCAATCCCGAACATCCTCATACAAGTGTTTTTGATTGCCTTTGAGGCTTAGAATGTAGTCGGCTTCTGATTGGATGATCTGCTCGGCAATGTTGGTTTGAGTCCCCATAGCGTCTATGCTGATGACTGCTCCTGACAAATCAAGGCTATCCAAAACTTCCGGAATGGCTTGTAACTCATTGCGTTTCTCGGCAACACTCTCTTGAGCAAGGCTTAAACCTACTTCATCAACCCAAGCTGAGAGAATATGCGTACTGCCGGTTTTCTTCTTCGAGCCTTTCAGACGTTTGCCGTCAATGGCGATATGTTTACCTTCCAAGTCGCTAATCAGCTCTTTCCCATAAACTTGAAGACAAGCATAGAGAGACTGAGGCTCAATACGTTGGAGCACTCTTTCGAAAGTGTCTACGCTCGGACAACCATTCGGCAACTCAACCGGTGGGCGAAGAGATGCTCCTCGCTCTAAGCAAAGTTCATGCATGGACTCATAATCCTCGCCTCCACACAGATAACTCGCCAGTGCTATAACTAGAATATCGCTTAACTTAACGTCAGTTCGATCTAAGCGGAAATAGGAAAGTTAGGGTTTCTGATGATTTCAATATTGAGTTCAGGCTTTTTAGGCAGGATGTTGTAAGCGATGATACC	NA	NA	NA	NA
>prophage 5
CP025930	Porphyromonas gingivalis ATCC 33277 chromosome, complete genome	2379874	1180062	1241660	2379874	transposase,tRNA,protease	Prochlorococcus_phage(20.0%)	48	NA	NA
AUR49899.1|1180062_1180965_-|transposase	transposase in IS195	transposase	NA	NA	NA	NA
AUR49871.1|1181450_1182362_+	gliding motility-associated lipoprotein	NA	NA	NA	NA	NA
AUR49250.1|1182393_1183950_+|tRNA	tRNA modification GTPase	tRNA	NA	NA	NA	NA
AUR49900.1|1184664_1185567_-|transposase	transposase in IS195	transposase	NA	NA	NA	NA
AUR49901.1|1185720_1186623_-|transposase	transposase in IS195	transposase	NA	NA	NA	NA
AUR49902.1|1187030_1187933_+|transposase	transposase in IS195	transposase	NA	NA	NA	NA
AUR49640.1|1187978_1189073_-	hypothetical protein	NA	NA	NA	NA	NA
AUR50422.1|1189069_1189573_-	thioredoxin reductase	NA	NA	NA	NA	NA
AUR49766.1|1189569_1190580_-	UDP-N-acetyl-2-amino-2-deoxy-D-glucuronate oxidase	NA	NA	NA	NA	NA
AUR49761.1|1190546_1191560_-	uridylate kinase/aspartokinase (Amino Acid Kinases (AAK) superfamily)	NA	NA	NA	NA	NA
AUR49755.1|1191549_1192566_-	Fe-S oxidoreductase	NA	NA	NA	NA	NA
AUR49955.1|1192546_1193407_-	methylthioribose kinase	NA	NA	NA	NA	NA
AUR49849.1|1193403_1194333_-	glycosyl transferase	NA	NA	NA	NA	NA
AUR49595.1|1194340_1195489_-	L-glutamine:2-deoxy-scyllo-inosose aminotransferase	NA	NA	NA	NA	NA
AUR49367.1|1195470_1196841_-	transcriptional antiterminator	NA	NA	NA	NA	NA
AUR48972.1|1197377_1200770_-	putative helicase	NA	A0A223W0B5	Agrobacterium_phage	31.2	3.8e-94
AUR49663.1|1200869_1201955_-|transposase	transposase in ISPg8	transposase	A0A077K814	Ralstonia_phage	27.4	3.4e-20
AUR49636.1|1202235_1203333_+	GDP-mannose 46-dehydratase	NA	A0A0E3G468	Synechococcus_phage	65.3	2.3e-125
AUR49691.1|1203325_1204399_+	GDP-L-fucose synthetase	NA	D1LW79	Prochlorococcus_phage	42.5	2.9e-80
AUR49749.1|1204537_1205557_+	branched-chain-amino-acid aminotransferase	NA	NA	NA	NA	NA
AUR49199.1|1205685_1207407_-	phospholipase D/nuclease	NA	NA	NA	NA	NA
AUR49034.1|1208372_1210907_+	ferrous iron transport protein B	NA	NA	NA	NA	NA
AUR50733.1|1210926_1211112_+	virus attachment protein p12	NA	NA	NA	NA	NA
AUR50488.1|1211119_1211575_+	PH domain-containing protein	NA	NA	NA	NA	NA
AUR49179.1|1212152_1213952_+	30S ribosomal protein S1	NA	NA	NA	NA	NA
AUR50380.1|1214803_1215343_-	S-adenosyl-L-methionine-dependent methyltransferase	NA	NA	NA	NA	NA
AUR50006.1|1215379_1216195_-	hypothetical protein	NA	NA	NA	NA	NA
AUR50239.1|1216212_1216845_-	hypothetical protein	NA	NA	NA	NA	NA
AUR49333.1|1216976_1218392_+	ATP-dependent helicase	NA	G0YQF1	Erwinia_phage	23.1	1.3e-11
AUR49419.1|1218408_1219740_-	hypothetical protein	NA	NA	NA	NA	NA
AUR48997.1|1219945_1222813_-	glycine dehydrogenase (glycine cleavage system P protein)	NA	E3SN07	Prochlorococcus_phage	48.1	5.3e-246
AUR50223.1|1222816_1223461_-	metallo-hydrolase	NA	NA	NA	NA	NA
AUR50185.1|1223457_1224132_-	16S rRNA methyltransferase glucose-inhibited division protein B	NA	NA	NA	NA	NA
AUR50005.1|1224157_1224973_-	hypothetical protein	NA	NA	NA	NA	NA
AUR50199.1|1225407_1226070_+	queuosine biosynthesis ATPase	NA	A0A2P1JXV3	Rhodococcus_phage	46.6	2.2e-46
AUR50427.1|1226104_1226599_+	phosphoesterase	NA	NA	NA	NA	NA
AUR49605.1|1226609_1227740_+	capsule biosynthesis	NA	A0A0N9SJ77	Staphylococcus_phage	33.0	6.3e-33
AUR49219.1|1228909_1230568_+	dipeptidase A	NA	NA	NA	NA	NA
AUR49627.1|1230940_1232047_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	50.0	5.1e-88
AUR50333.1|1232196_1232769_-	FKBP-type peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
AUR50419.1|1232819_1233326_-	LTXXQ motif family protein inner membrane protein	NA	NA	NA	NA	NA
AUR50550.1|1233322_1233733_-	hypothetical protein	NA	NA	NA	NA	NA
AUR50342.1|1233780_1234347_-	ECF RNA polymerase sigma factor	NA	NA	NA	NA	NA
AUR49216.1|1236238_1237906_-	formate--tetrahydrofolate ligase	NA	NA	NA	NA	NA
AUR49416.1|1238062_1239397_+	phosphate starvation-inducible protein	NA	A0A2I7SAD7	Vibrio_phage	33.6	2.8e-48
AUR50337.1|1239444_1240014_-	crossover junction endodeoxyribonuclease	NA	NA	NA	NA	NA
AUR50644.1|1240021_1240330_-	hypothetical protein	NA	NA	NA	NA	NA
AUR49623.1|1240550_1241660_+|protease	lys-gingipain protease	protease	NA	NA	NA	NA
>prophage 6
CP025930	Porphyromonas gingivalis ATCC 33277 chromosome, complete genome	2379874	1245968	1310676	2379874	transposase,tRNA,protease	Ralstonia_phage(44.44%)	57	NA	NA
AUR49664.1|1245968_1247054_+|transposase	transposase in ISPg8	transposase	A0A077K814	Ralstonia_phage	27.8	3.8e-19
AUR50536.1|1247583_1248003_+	large-conductance mechanosensitive channel	NA	NA	NA	NA	NA
AUR49580.1|1248380_1249538_+	NAD(P) transhydrogenase subunit alpha part 1	NA	NA	NA	NA	NA
AUR50639.1|1249647_1249962_+	NAD(P) transhydrogenase subunit alpha	NA	NA	NA	NA	NA
AUR49033.1|1249958_1252496_+	NAD(P) transhydrogenase subunit beta	NA	NA	NA	NA	NA
AUR49542.1|1252641_1253841_-	hypothetical protein	NA	NA	NA	NA	NA
AUR49801.1|1253837_1254818_-|protease	modulator of FtsH protease	protease	NA	NA	NA	NA
AUR50471.1|1254844_1255309_-|protease	membrane protein putative activity regulator of membrane protease nfeD	protease	NA	NA	NA	NA
AUR50529.1|1256317_1256743_+	SOS-response transcriptional repressor	NA	A0A2H4J538	uncultured_Caudovirales_phage	39.9	9.9e-24
AUR49379.1|1256750_1258112_+	DNA polymerase IV	NA	A0A218MNF2	uncultured_virus	36.3	8.8e-74
AUR49254.1|1258120_1259671_-	L-lactate transport	NA	NA	NA	NA	NA
AUR50464.1|1259986_1260457_+	UDP-N-acetylenolpyruvoylglucosamine reductase inner membrane lipoprotein	NA	NA	NA	NA	NA
AUR49756.1|1260456_1261473_+	UDP-N-acetylenolpyruvoylglucosamine reductase	NA	NA	NA	NA	NA
AUR49297.1|1261499_1262978_+	Octanoyltransferase	NA	NA	NA	NA	NA
AUR49665.1|1263306_1264392_-|transposase	transposase in ISPg8	transposase	A0A077K814	Ralstonia_phage	28.1	5.8e-20
AUR49615.1|1264806_1265928_+	putative teichuronic acid biosynthesis glycosyltransferase	NA	NA	NA	NA	NA
AUR49476.1|1265924_1267196_+	D-inositol 3-phosphate glycosyltransferase	NA	NA	NA	NA	NA
AUR50469.1|1267332_1267797_+	NADPH-dependent 7-cyano-7-deazaguanine reductase	NA	E7DN65	Pneumococcus_phage	68.2	1.3e-45
AUR49932.1|1267824_1268706_+	putative lipid kinase	NA	NA	NA	NA	NA
AUR50436.1|1269093_1269582_-	hypothetical protein	NA	NA	NA	NA	NA
AUR50545.1|1269592_1270006_-	polyketide cyclase / dehydrase and lipid transport	NA	NA	NA	NA	NA
AUR50237.1|1270056_1270689_-	Orotate phosphoribosyltransferase	NA	Q58MW1	Prochlorococcus_phage	27.4	5.3e-05
AUR49995.1|1270799_1271621_-	carbon-nitrogen hydrolase	NA	NA	NA	NA	NA
AUR50366.1|1271617_1272166_-	hemolysin A 1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
AUR50530.1|1272216_1272642_-	hypothetical protein	NA	NA	NA	NA	NA
AUR50179.1|1273508_1274189_-	ribosomal N-acetyltransferase	NA	NA	NA	NA	NA
AUR49882.1|1274499_1275408_-	hypothetical protein	NA	NA	NA	NA	NA
AUR49449.1|1275473_1276769_-	phosphoribosylamine--glycine ligase	NA	NA	NA	NA	NA
AUR49081.1|1276765_1278964_-	prolyl tripeptidyl peptidase	NA	NA	NA	NA	NA
AUR49314.1|1278995_1280450_-	ribosomal RNA large subunit methyltransferase K/L	NA	NA	NA	NA	NA
AUR49581.1|1281068_1282226_-	1-deoxy-D-xylulose 5-phosphate reductoisomerase	NA	NA	NA	NA	NA
AUR50394.1|1282222_1282750_-	ribosome maturation factor	NA	NA	NA	NA	NA
AUR49436.1|1282756_1284061_-	UDP-N-acetylglucosamine 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
AUR50283.1|1284091_1284694_-	hypothetical protein	NA	NA	NA	NA	NA
AUR49406.1|1284713_1286051_-	glucose-6-phosphate isomerase B	NA	NA	NA	NA	NA
AUR49778.1|1286083_1287088_-	glycerol-3-phosphate dehydrogenase [NAD(P) ]	NA	NA	NA	NA	NA
AUR49195.1|1287173_1288910_-|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SIS0	Klosneuvirus	37.6	7.7e-91
AUR49936.1|1289032_1289911_-	uridine phosphorylase	NA	NA	NA	NA	NA
AUR49329.1|1289981_1291400_-	tetratricopeptide repeat-containing protein	NA	NA	NA	NA	NA
AUR49682.1|1291609_1292692_+|transposase	transposase in ISPg2	transposase	NA	NA	NA	NA
AUR49666.1|1292809_1293895_-|transposase	transposase in ISPg8	transposase	A0A077K814	Ralstonia_phage	28.1	7.6e-20
AUR50224.1|1294643_1295288_+	butyrate--acetoacetate CoA-transferase subunit A	NA	NA	NA	NA	NA
AUR50568.1|1295341_1295731_+	3-aminobutyryl-CoA ammonia lyase	NA	NA	NA	NA	NA
AUR49996.1|1295757_1296579_+	3-keto-5-aminohexanoate cleavage enzyme	NA	NA	NA	NA	NA
AUR49721.1|1296620_1297664_+	L-erythro-35-diaminohexanoate dehydrogenase	NA	NA	NA	NA	NA
AUR49493.1|1297750_1299001_+	lysine-23-aminomutase	NA	NA	NA	NA	NA
AUR49687.1|1299027_1300107_+	hypothetical protein	NA	NA	NA	NA	NA
AUR49349.1|1300106_1301498_+	DNA mismatch repair	NA	NA	NA	NA	NA
AUR49245.1|1301525_1303097_+	D-lysine 56-aminomutase alpha subunit	NA	NA	NA	NA	NA
AUR50024.1|1303093_1303885_+	D-lysine 56-aminomutase beta subunit	NA	NA	NA	NA	NA
AUR50200.1|1303907_1304570_+	butyrate--acetoacetate CoA-transferase subunit B	NA	NA	NA	NA	NA
AUR49601.1|1304615_1305755_+	butyryl-CoA dehydrogenase	NA	NA	NA	NA	NA
AUR50033.1|1305769_1306555_+	electron transfer flavoprotein beta subunit	NA	NA	NA	NA	NA
AUR49774.1|1306568_1307576_+	electron transfer flavoprotein alpha subunit	NA	NA	NA	NA	NA
AUR50056.1|1307679_1308450_+	short-chain-enoyl-CoA hydratase	NA	NA	NA	NA	NA
AUR49977.1|1308496_1309342_+	3-hydroxybutyryl-CoA dehydrogenase	NA	NA	NA	NA	NA
AUR49667.1|1309590_1310676_+|transposase	transposase in ISPg8	transposase	A0A077K814	Ralstonia_phage	27.8	2.2e-19
>prophage 7
CP025930	Porphyromonas gingivalis ATCC 33277 chromosome, complete genome	2379874	1553577	1635473	2379874	tRNA,transposase	Ralstonia_phage(35.71%)	49	NA	NA
AUR50177.1|1553577_1554261_-|tRNA	tRNA pseudouridine synthase C	tRNA	NA	NA	NA	NA
AUR50092.1|1554304_1555051_-	3-oxoacyl-[acyl-carrier-protein] reductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	31.2	3.2e-17
AUR50234.1|1555134_1555770_-	transcriptional repressor	NA	NA	NA	NA	NA
AUR49184.1|1556345_1558133_+	elongation factor 4	NA	A0A2K9L6L3	Tupanvirus	45.5	3.1e-26
AUR49241.1|1558167_1559754_+	replicative DNA helicase	NA	A0A0F7L6J1	uncultured_marine_virus	43.7	3.2e-91
AUR49018.1|1561199_1563830_+|tRNA	alanine--tRNA ligase	tRNA	A0A2K9L1X7	Tupanvirus	41.7	2.7e-95
AUR49779.1|1563901_1564906_+	3-dehydroquinate synthase	NA	NA	NA	NA	NA
AUR50116.1|1565150_1565882_-	DNA alkylation repair enzyme	NA	NA	NA	NA	NA
AUR50034.1|1565896_1566682_-	hemolysin A 1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
AUR50676.1|1566687_1566954_+	membrane protein involved in tellurium resistance	NA	NA	NA	NA	NA
AUR49507.1|1567734_1568970_-	lipoprotein-releasing system	NA	NA	NA	NA	NA
AUR49126.1|1568982_1570992_-	DNA ligase	NA	A0A0A8J9A9	Ralstonia_phage	35.9	3.7e-105
AUR50395.1|1570979_1571507_-	ribosomal N-acetyltransferase	NA	NA	NA	NA	NA
AUR50257.1|1571513_1572137_-	recombination protein	NA	NA	NA	NA	NA
AUR49276.1|1572133_1573648_-	ribonuclease G	NA	NA	NA	NA	NA
AUR50665.1|1573968_1574247_-	Nucleoid-associated protein	NA	NA	NA	NA	NA
AUR49634.1|1574358_1575459_-|transposase	transposase in ISPg2	transposase	NA	NA	NA	NA
AUR50482.1|1575640_1576096_-	anaerobic ribonucleoside-triphosphate reductase-activating protein	NA	A0A1W5P0X3	Cronobacter_phage	42.7	3.0e-26
AUR49052.1|1576164_1578561_-	anaerobic ribonucleoside-triphosphate reductase	NA	A0A0A8WEK0	Clostridium_phage	44.0	3.1e-183
AUR49670.1|1579489_1580575_+|transposase	transposase in ISPg8	transposase	A0A077K814	Ralstonia_phage	27.8	3.8e-19
AUR49230.1|1587063_1588695_-	delta-1-pyrroline-5-carboxylate dehydrogenase	NA	NA	NA	NA	NA
AUR49851.1|1588771_1589701_-	peptidylarginine deiminase	NA	NA	NA	NA	NA
AUR49512.1|1589707_1590937_-	ornithine aminotransferase	NA	NA	NA	NA	NA
AUR50344.1|1591386_1591953_+	elongation factor P	NA	NA	NA	NA	NA
AUR50417.1|1592488_1592995_+	Nucleoid-associated protein	NA	NA	NA	NA	NA
AUR49212.1|1593136_1594813_-	aspartate/alanine antiporter cobalt transporter	NA	NA	NA	NA	NA
AUR49386.1|1595029_1596385_+	succinyl-diaminopimelate desuccinylase	NA	NA	NA	NA	NA
AUR49473.1|1596459_1597734_+	5-methylthioadenosine/S-adenosylhomocysteine deaminase	NA	NA	NA	NA	NA
AUR49998.1|1597753_1598575_+	purine nucleoside phosphorylase 1	NA	Q5YBA4	Grouper_iridovirus	41.2	7.5e-52
AUR50371.1|1599106_1599652_-	hypothetical protein	NA	NA	NA	NA	NA
AUR50407.1|1600501_1601020_+	Nucleoid-associated protein	NA	NA	NA	NA	NA
AUR49001.1|1601545_1604368_+	lysyl endopeptidase	NA	NA	NA	NA	NA
AUR48967.1|1605662_1609244_-	pyruvate synthase pyruvate:ferredoxin (flavodoxin) oxidoreductase	NA	NA	NA	NA	NA
AUR49560.1|1609432_1610614_-	ATPase component of energizing module of biotin ECF transporter	NA	NA	NA	NA	NA
AUR49671.1|1611070_1612156_+|transposase	transposase in ISPg8	transposase	A0A077K814	Ralstonia_phage	27.8	3.8e-19
AUR49815.1|1614187_1615156_+	modification methylase EcoRI	NA	A0A1B0XVT8	Campylobacter_phage	40.2	1.2e-35
AUR49904.1|1615836_1616739_-|transposase	transposase in IS195	transposase	NA	NA	NA	NA
AUR50659.1|1616968_1617256_-	hypothetical protein	NA	NA	NA	NA	NA
AUR48983.1|1617252_1620402_-	multidrug resistance protein	NA	S5VTK5	Leptospira_phage	26.0	2.3e-101
AUR49699.1|1620398_1621460_-	multidrug resistance protein	NA	NA	NA	NA	NA
AUR49352.1|1621495_1622884_-	outer membrane protein TolC Type I secretion system	NA	NA	NA	NA	NA
AUR49672.1|1623651_1624737_-|transposase	transposase in ISPg8	transposase	A0A077K814	Ralstonia_phage	27.8	6.4e-19
AUR49308.1|1625102_1626563_-	aminoacyl-histidine dipeptidase	NA	NA	NA	NA	NA
AUR50719.1|1626643_1626859_+	putative periplasmic	NA	NA	NA	NA	NA
AUR50260.1|1626891_1627512_+	outer membrane protein	NA	NA	NA	NA	NA
AUR49043.1|1627692_1630176_-	tonB-dependent receptor putative ferric aerobactin receptor	NA	NA	NA	NA	NA
AUR49973.1|1631373_1632222_+	vancomycin B-type resistance protein	NA	NA	NA	NA	NA
AUR49143.1|1632331_1634275_+	glutamine-dependent NAD(+) synthetase	NA	NA	NA	NA	NA
AUR49673.1|1634387_1635473_+|transposase	transposase in ISPg8	transposase	A0A077K814	Ralstonia_phage	27.8	3.8e-19
>prophage 8
CP025930	Porphyromonas gingivalis ATCC 33277 chromosome, complete genome	2379874	2126302	2172383	2379874	tRNA,transposase,protease	Bacillus_phage(33.33%)	31	NA	NA
AUR49204.1|2126302_2128003_+|tRNA	glutamine--tRNA ligase	tRNA	A0A222YZ70	Escherichia_phage	54.1	2.0e-168
AUR50219.1|2128030_2128678_+	inner membrane SNARE-like domain protein	NA	NA	NA	NA	NA
AUR49846.1|2128740_2129676_+	transporter YitT family	NA	NA	NA	NA	NA
AUR49753.1|2129679_2130699_+	N-acetyl-alpha-D-glucosaminyl-diphospho- ditransoctacis-undecaprenol 4-epimerase	NA	NA	NA	NA	NA
AUR49451.1|2131419_2132715_-	succinyl-CoA:coenzyme A transferase	NA	NA	NA	NA	NA
AUR50731.1|2133421_2133610_-	50S ribosomal protein L33	NA	NA	NA	NA	NA
AUR50696.1|2133629_2133869_-	50S ribosomal protein L28	NA	NA	NA	NA	NA
AUR49072.1|2134091_2136359_-	putative low-affinity inorganic phosphate transporter	NA	NA	NA	NA	NA
AUR50251.1|2136555_2137182_-	Nucleoid-associated protein	NA	NA	NA	NA	NA
AUR50331.1|2137593_2138169_+	threonylcarbamoyl-AMP synthase	NA	S4VW33	Pandoravirus	27.8	1.9e-09
AUR49339.1|2138165_2139572_+	undecaprenyl-phosphate N-acetylgalactosaminyl-1-phosphate transferase glycosyltransferase	NA	NA	NA	NA	NA
AUR49180.1|2139568_2141365_+	H(+)/Cl(-) exchange transporter	NA	NA	NA	NA	NA
AUR49784.1|2141325_2142324_-	small-conductance mechanosensitive channel	NA	NA	NA	NA	NA
AUR49927.1|2142426_2143311_+|protease	Beta-barrel assembly-enhancing protease	protease	NA	NA	NA	NA
AUR49677.1|2144440_2145526_-|transposase	transposase in ISPg8	transposase	A0A077K814	Ralstonia_phage	27.8	3.8e-19
AUR50101.1|2145629_2146370_-	mu-like prophage protein gp29	NA	NA	NA	NA	NA
AUR49983.1|2146362_2147202_-	modification methylase	NA	A0A1S5PRR3	Streptococcus_phage	46.2	9.0e-69
AUR49711.1|2147765_2148818_+	hemagglutinin	NA	NA	NA	NA	NA
AUR49641.1|2149608_2150700_-	hypothetical protein	NA	NA	NA	NA	NA
AUR49712.1|2150912_2151965_+	hemagglutinin	NA	NA	NA	NA	NA
AUR49128.1|2152331_2154338_-	hypothetical protein	NA	NA	NA	NA	NA
AUR49909.1|2155702_2156605_+|transposase	transposase in IS195	transposase	NA	NA	NA	NA
AUR49910.1|2157541_2158444_-|transposase	transposase in IS195	transposase	NA	NA	NA	NA
AUR49201.1|2159030_2160740_-|protease	serine protease carboxy-terminal processing	protease	NA	NA	NA	NA
AUR49203.1|2161536_2163243_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	30.6	4.4e-46
AUR49190.1|2163289_2165044_-	iron import ATP-binding permease	NA	W8CYL7	Bacillus_phage	26.0	9.1e-31
AUR49468.1|2165068_2166346_-	hypothetical protein	NA	NA	NA	NA	NA
AUR50026.1|2166349_2167141_-	hypothetical protein	NA	NA	NA	NA	NA
AUR49051.1|2167218_2169624_-	exporter RND superfamily	NA	NA	NA	NA	NA
AUR50288.1|2169664_2170264_-	transcriptional regulator	NA	NA	NA	NA	NA
AUR49911.1|2171480_2172383_+|transposase	transposase in IS195	transposase	NA	NA	NA	NA
