The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 2
CP025932	Porphyromonas gingivalis strain W83 chromosome, complete genome	2343999	803452	895218	2343999	transposase,tRNA,integrase	unidentified_phage(37.5%)	59	800566:800583	895787:895804
800566:800583	attL	GTATTCTTCCACAATGTG	NA	NA	NA	NA
AUR46546.1|803452_804211_+|tRNA	tRNA pseudouridine synthase A	tRNA	NA	NA	NA	NA
AUR45899.1|804410_805763_-	PF09903 family protein	NA	NA	NA	NA	NA
AUR46700.1|805812_806460_-	inner membrane protein unknown function	NA	NA	NA	NA	NA
AUR45609.1|806556_808683_-	dipeptidyl carboxypeptidase	NA	A0A1V0SID3	Klosneuvirus	21.9	1.2e-24
AUR45607.1|808721_810860_-	tetratricopeptide repeat-containing protein	NA	NA	NA	NA	NA
AUR45872.1|812898_814275_+	trigger factor	NA	NA	NA	NA	NA
AUR45590.1|816263_818495_-	polyribonucleotide nucleotidyltransferase	NA	NA	NA	NA	NA
AUR45524.1|818646_821340_-	4-alpha-glucanotransferase	NA	NA	NA	NA	NA
AUR46151.1|821364_822471_-	hypothetical protein	NA	NA	NA	NA	NA
AUR46008.1|825786_827031_-	hypothetical protein	NA	NA	NA	NA	NA
AUR45710.1|827521_829243_-	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
AUR46243.1|829254_830274_-	electron transfer flavoprotein alpha subunit	NA	NA	NA	NA	NA
AUR46428.1|830282_831149_-	electron transfer flavoprotein beta subunit	NA	NA	NA	NA	NA
AUR46595.1|831239_831959_-|tRNA	tRNA threonylcarbamoyladenosine	tRNA	NA	NA	NA	NA
AUR46926.1|832189_832663_-	biopolymer transport protein	NA	NA	NA	NA	NA
AUR46736.1|832678_833293_-	biopolymer transport protein	NA	NA	NA	NA	NA
AUR46935.1|833328_833799_-	inner membrane protein unknown function	NA	NA	NA	NA	NA
AUR46483.1|833807_834620_-	motA/TolQ/ExbB proton channel	NA	NA	NA	NA	NA
AUR46492.1|834967_835771_-|tRNA	D-aminoacyl-tRNA deacylase	tRNA	NA	NA	NA	NA
AUR46299.1|835841_836819_-	geranyltranstransferase	NA	NA	NA	NA	NA
AUR46636.1|836989_837682_-	ferric siderophore transport system	NA	NA	NA	NA	NA
AUR45533.1|838132_840751_-	outer membrane porin CarboxypepD_reg-like domain	NA	NA	NA	NA	NA
AUR46599.1|840791_841508_-|tRNA	phenylalanine--tRNA ligase beta subunit	tRNA	NA	NA	NA	NA
AUR46066.1|841488_842673_-	GTPase Obg	NA	NA	NA	NA	NA
AUR46786.1|842682_843267_-	adenylate kinase	NA	NA	NA	NA	NA
AUR46864.1|843267_843804_-	hypoxanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
AUR45644.1|844397_846395_+	fructose-16-bisphosphatase	NA	NA	NA	NA	NA
AUR45567.1|846550_848911_+	monofunctional biosynthetic peptidoglycan transglycosylase	NA	NA	NA	NA	NA
AUR46607.1|848952_849663_+	ftsH-interacting integral membrane protein	NA	NA	NA	NA	NA
AUR45519.1|849762_852540_-|tRNA	leucyl-tRNA synthetase	tRNA	A0A2H4PQS0	Staphylococcus_phage	43.2	6.1e-207
AUR46384.1|852984_853887_+|transposase	transposase in IS195	transposase	NA	NA	NA	NA
AUR45760.1|854808_856368_-	NAD-utilizing dehydrogenase	NA	NA	NA	NA	NA
AUR45825.1|856352_857804_-|tRNA	tRNA nucleotidyltransferase	tRNA	A0A2I2MPB1	Mycobacterium_phage	28.8	1.2e-31
AUR45901.1|858462_859812_-	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	26.5	9.1e-31
AUR46498.1|859816_860608_-	glucosamine-6-phosphate deaminase	NA	NA	NA	NA	NA
AUR46038.1|860646_861858_-	flavodoxin	NA	NA	NA	NA	NA
AUR46444.1|861888_862740_-	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
AUR46376.1|862776_863682_-	meso-diaminopimelate D-dehydrogenase	NA	NA	NA	NA	NA
AUR46215.1|863719_864766_-	transcription termination protein	NA	NA	NA	NA	NA
AUR46747.1|872690_873299_-	holliday junction ATP-dependent DNA helicase	NA	NA	NA	NA	NA
AUR46930.1|876475_876949_-	hypothetical protein	NA	NA	NA	NA	NA
AUR47184.1|876982_877150_-|integrase	bacteriophage integrase	integrase	H7BUI8	unidentified_phage	50.0	6.8e-05
AUR46018.1|877465_878695_+|integrase	bacteriophage integrase	integrase	H7BUI8	unidentified_phage	31.6	9.2e-22
AUR46042.1|878720_879923_+|integrase	bacteriophage integrase	integrase	NA	NA	NA	NA
AUR47051.1|879929_880292_+	virulence protein RhuM family	NA	NA	NA	NA	NA
AUR47007.1|880417_880825_-	SnoaL-like polyketide cyclase	NA	NA	NA	NA	NA
AUR47092.1|880957_881272_+	HTH-type transcriptional activator HxlR	NA	NA	NA	NA	NA
AUR46652.1|881309_881990_+	inner membrane protein	NA	NA	NA	NA	NA
AUR46197.1|882175_883237_-|transposase	transposase in ISPg8	transposase	A0A077K814	Ralstonia_phage	28.9	8.8e-21
AUR46448.1|883359_884208_+	transcriptional activator	NA	NA	NA	NA	NA
AUR45889.1|884304_885663_+	multidrug export protein	NA	NA	NA	NA	NA
AUR47138.1|885674_885926_+	tetracycline resistance element mobilization regulatory protein	NA	NA	NA	NA	NA
AUR47082.1|885948_886275_+	tetracycline resistance element mobilization regulatory protein	NA	NA	NA	NA	NA
AUR47002.1|886358_886775_-	hypothetical protein	NA	NA	NA	NA	NA
AUR46985.1|887540_887969_+	hypothetical protein	NA	NA	NA	NA	NA
AUR46940.1|888456_888921_+	hypothetical protein	NA	NA	NA	NA	NA
AUR45619.1|888910_890986_+	hypothetical protein	NA	NA	NA	NA	NA
AUR45620.1|891846_893922_-	ATPase-like ATP-binding domain	NA	NA	NA	NA	NA
AUR46021.1|893991_895218_-|integrase	bacteriophage integrase	integrase	H7BUI8	unidentified_phage	33.7	1.1e-17
895787:895804	attR	GTATTCTTCCACAATGTG	NA	NA	NA	NA
>prophage 3
CP025932	Porphyromonas gingivalis strain W83 chromosome, complete genome	2343999	1074936	1140096	2343999	transposase,integrase,tRNA,protease	Ralstonia_phage(21.43%)	49	1087759:1087788	1150971:1151000
AUR46385.1|1074936_1075839_+|transposase	transposase in IS195	transposase	NA	NA	NA	NA
AUR46096.1|1075992_1077150_-|transposase	transposase in ISPg4	transposase	NA	NA	NA	NA
AUR45564.1|1077676_1080073_+	anaerobic ribonucleoside-triphosphate reductase	NA	A0A0A8WEK0	Clostridium_phage	43.7	2.6e-182
AUR46953.1|1080141_1080597_+	anaerobic ribonucleoside-triphosphate reductase-activating protein	NA	A0A1W5P0X3	Cronobacter_phage	42.7	1.3e-26
AUR47116.1|1080708_1080987_+	Nucleoid-associated protein	NA	NA	NA	NA	NA
AUR45788.1|1081308_1082823_+	ribonuclease G	NA	NA	NA	NA	NA
AUR46727.1|1082819_1083443_+	recombination protein	NA	NA	NA	NA	NA
AUR46869.1|1083449_1083977_+	ribosomal N-acetyltransferase	NA	NA	NA	NA	NA
AUR45640.1|1083964_1085974_+	DNA ligase	NA	A0A0A8J9A9	Ralstonia_phage	35.9	4.9e-105
AUR46015.1|1085986_1087222_+	lipoprotein-releasing system	NA	NA	NA	NA	NA
1087759:1087788	attL	ACACAAGCATTGATTTGACGAAGAAAGGAG	NA	NA	NA	NA
AUR47127.1|1087966_1088233_-	membrane protein involved in tellurium resistance	NA	NA	NA	NA	NA
AUR46507.1|1088238_1089024_+	hemolysin A 1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
AUR46587.1|1089038_1089770_+	DNA alkylation repair enzyme	NA	NA	NA	NA	NA
AUR46274.1|1090015_1091020_-	3-dehydroquinate synthase	NA	NA	NA	NA	NA
AUR45530.1|1091091_1093722_-|tRNA	alanine--tRNA ligase	tRNA	A0A2K9L1X7	Tupanvirus	41.9	1.2e-95
AUR46173.1|1094901_1095987_-|transposase	transposase in ISPg8	transposase	A0A077K814	Ralstonia_phage	27.4	7.6e-20
AUR45752.1|1096499_1098086_-	replicative DNA helicase	NA	A0A0F7L6J1	uncultured_marine_virus	43.7	3.2e-91
AUR45695.1|1098120_1099908_-	elongation factor 4	NA	A0A2K9L6L3	Tupanvirus	45.5	3.1e-26
AUR46712.1|1100482_1101118_+	transcriptional repressor	NA	NA	NA	NA	NA
AUR46563.1|1101201_1101948_+	3-oxoacyl-[acyl-carrier-protein] reductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	31.2	3.2e-17
AUR46648.1|1101991_1102675_+|tRNA	tRNA pseudouridine synthase C	tRNA	NA	NA	NA	NA
AUR46764.1|1102692_1103292_-	transcriptional regulator of hmuYR	NA	NA	NA	NA	NA
AUR46608.1|1103288_1103999_-	iron-sulfur cluster repair protein	NA	NA	NA	NA	NA
AUR46317.1|1104314_1105271_+	L-threonine 3-dehydrogenase	NA	NA	NA	NA	NA
AUR45916.1|1105959_1107297_+	NAD-specific glutamate dehydrogenase	NA	NA	NA	NA	NA
AUR45612.1|1107502_1109611_+	hypothetical protein	NA	NA	NA	NA	NA
AUR46670.1|1111552_1112218_-	peptidyl-prolyl cis-trans isomerase	NA	A0A076FI46	Aureococcus_anophage	27.7	1.5e-10
AUR45673.1|1112264_1114136_-	efflux pump complex or subunit confering antibiotic resistance	NA	A0A2K9L3Z8	Tupanvirus	30.6	3.1e-53
AUR45841.1|1114161_1115580_-	membrane-bound lytic murein transglycosylase F precursor	NA	NA	NA	NA	NA
AUR47169.1|1115856_1116060_-	hypothetical protein	NA	NA	NA	NA	NA
AUR46592.1|1116666_1117392_-	oxidoreductase short chain dehydrogenase/reductase family	NA	NA	NA	NA	NA
AUR46122.1|1117401_1118535_-	erythronate-4-phosphate dehydrogenase	NA	NA	NA	NA	NA
AUR47097.1|1118538_1118850_-	hypothetical protein	NA	NA	NA	NA	NA
AUR46950.1|1119125_1119584_-	hypothetical protein	NA	NA	NA	NA	NA
AUR47079.1|1119613_1119946_-	RNA polymerase	NA	NA	NA	NA	NA
AUR46484.1|1120087_1120900_-	outer membrane protein assembly factor	NA	NA	NA	NA	NA
AUR46079.1|1121250_1122423_-	hypothetical protein	NA	NA	NA	NA	NA
AUR46689.1|1122437_1123088_-	ribonuclease H	NA	NA	NA	NA	NA
AUR46256.1|1123115_1124129_-|protease	Beta-barrel assembly-enhancing protease	protease	NA	NA	NA	NA
AUR46861.1|1124141_1124681_-	acetyltransferase	NA	NA	NA	NA	NA
AUR45696.1|1124689_1126477_-	xaa-Pro aminopeptidase metallopeptidase family M24	NA	A0A0P0I8D7	Acinetobacter_phage	40.4	2.1e-128
AUR45770.1|1126525_1128073_-	ribosylnicotinamide kinase	NA	NA	NA	NA	NA
AUR45664.1|1128655_1130578_+	chaperone	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	48.8	5.9e-140
AUR46933.1|1131097_1131568_-	Nucleoid-associated protein	NA	NA	NA	NA	NA
AUR47158.1|1132112_1132334_+	transcriptional regulator	NA	A0A0A0RNR0	Bacillus_phage	46.8	2.4e-05
AUR45487.1|1132556_1135979_+	tetratricopeptide-like helical	NA	NA	NA	NA	NA
AUR46891.1|1137587_1138091_+|integrase	bacteriophage integrase	integrase	NA	NA	NA	NA
AUR46992.1|1138202_1138628_-	inner membrane protein unknown function	NA	NA	NA	NA	NA
AUR46174.1|1139010_1140096_+|transposase	transposase in ISPg8	transposase	A0A077K814	Ralstonia_phage	28.7	2.0e-20
1150971:1151000	attR	CTCCTTTCTTCGTCAAATCAATGCTTGTGT	NA	NA	NA	NA
>prophage 4
CP025932	Porphyromonas gingivalis strain W83 chromosome, complete genome	2343999	1474764	1536940	2343999	transposase,tRNA,integrase	Bacteroides_phage(12.5%)	49	1470499:1470513	1541426:1541440
1470499:1470513	attL	TTGGATACCTCCGAA	NA	NA	NA	NA
AUR45761.1|1474764_1476321_+|tRNA	tRNA modification GTPase	tRNA	NA	NA	NA	NA
AUR46387.1|1476566_1477469_+	DNA-binding helix-turn-helix regulator	NA	NA	NA	NA	NA
AUR46155.1|1477557_1478661_+|transposase	transposase IS4 family	transposase	NA	NA	NA	NA
AUR46631.1|1478762_1479461_+	mobilizable transposon tnpC protein	NA	NA	NA	NA	NA
AUR47055.1|1480365_1480725_+	excisionase	NA	NA	NA	NA	NA
AUR45874.1|1480734_1482111_+	hypothetical protein	NA	NA	NA	NA	NA
AUR46200.1|1482208_1483267_+	hypothetical protein	NA	NA	NA	NA	NA
AUR47068.1|1483373_1483721_+	mobilization protein	NA	NA	NA	NA	NA
AUR46355.1|1483717_1484641_+	relaxase/mobilization protein	NA	NA	NA	NA	NA
AUR46635.1|1484637_1485333_+	structural maintenance of chromosome protein	NA	NA	NA	NA	NA
AUR46113.1|1485392_1486538_-	hypothetical protein	NA	NA	NA	NA	NA
AUR46128.1|1486674_1487805_+|transposase	transposase in ISPg2	transposase	NA	NA	NA	NA
AUR46733.1|1487901_1488522_+	invertase	NA	H2A0H0	Bacteroides_phage	73.3	1.9e-71
AUR45490.1|1489382_1492781_-	type IIS restriction endonuclease	NA	Q8V6N5	Halorubrum_phage	21.6	1.3e-25
AUR45485.1|1492791_1496274_-	ATP-dependent helicase	NA	A0A2K5B2B9	Erysipelothrix_phage	23.4	5.4e-35
AUR47088.1|1496327_1496648_-	transcriptional regulator	NA	NA	NA	NA	NA
AUR46339.1|1496717_1497656_-	Serine/threonine-protein kinase HipA	NA	NA	NA	NA	NA
AUR47076.1|1497645_1497981_-	Serine/threonine-protein kinase HipA	NA	NA	NA	NA	NA
AUR47155.1|1497977_1498202_-	transcriptional regulator	NA	NA	NA	NA	NA
AUR46377.1|1498425_1499331_-	hypothetical protein	NA	NA	NA	NA	NA
AUR46515.1|1499832_1500615_-	hypothetical protein	NA	A0A1S5SAN8	Streptococcus_phage	26.1	3.4e-14
AUR46912.1|1500651_1501137_-	Nucleoid-associated protein	NA	NA	NA	NA	NA
AUR47101.1|1503992_1504301_+	DNA-binding helix-turn-helix regulator	NA	NA	NA	NA	NA
AUR46617.1|1504391_1505099_+	hypothetical protein	NA	NA	NA	NA	NA
AUR46279.1|1505083_1506082_+	Nucleotidyl transferase AbiEii toxin Type IV TA system	NA	NA	NA	NA	NA
AUR45756.1|1506186_1507767_-	helicase C-terminal domain protein	NA	H2DE57	Erwinia_phage	28.3	2.6e-37
AUR46791.1|1508058_1508643_+|integrase	Phage integrase SAM-like domain	integrase	NA	NA	NA	NA
AUR47096.1|1510388_1510700_+	hypothetical protein	NA	NA	NA	NA	NA
AUR46194.1|1510696_1511761_+	P-loop_NTPase super family protein	NA	NA	NA	NA	NA
AUR46390.1|1511896_1512790_+	conjugative transposon primase TraP DNA primase	NA	NA	NA	NA	NA
AUR45475.1|1513117_1517149_-	trypsin_2	NA	A0A2H4PQV1	Staphylococcus_phage	25.0	1.8e-10
AUR46075.1|1517126_1518305_-	competence protein	NA	NA	NA	NA	NA
AUR45958.1|1518745_1520044_-|integrase	phage integrase	integrase	S0A3I4	Cellulophaga_phage	29.8	1.8e-20
AUR47166.1|1522058_1522271_+	transcriptional regulator	NA	NA	NA	NA	NA
AUR45994.1|1522310_1523573_+	hypothetical protein	NA	NA	NA	NA	NA
AUR45675.1|1523997_1525863_+	hypothetical protein	NA	NA	NA	NA	NA
AUR46233.1|1525862_1526891_+	nucleoid-associated protein NdpA	NA	NA	NA	NA	NA
AUR46986.1|1527689_1528118_-	hypothetical protein	NA	NA	NA	NA	NA
AUR47003.1|1528884_1529301_+	hypothetical protein	NA	NA	NA	NA	NA
AUR47083.1|1529384_1529711_-	tetracycline resistance element mobilization regulatory protein	NA	NA	NA	NA	NA
AUR47139.1|1529733_1529985_-	tetracycline resistance element mobilization regulatory protein	NA	NA	NA	NA	NA
AUR45890.1|1529996_1531355_-	multidrug export protein	NA	NA	NA	NA	NA
AUR46449.1|1531451_1532300_-	transcriptional activator	NA	NA	NA	NA	NA
AUR46177.1|1532422_1533508_+|transposase	transposase in ISPg8	transposase	A0A077K814	Ralstonia_phage	28.7	2.0e-20
AUR46653.1|1533670_1534351_-	inner membrane protein	NA	NA	NA	NA	NA
AUR47095.1|1534388_1534703_-	HTH-type transcriptional activator HxlR	NA	NA	NA	NA	NA
AUR47008.1|1534835_1535243_+	SnoaL-like polyketide cyclase	NA	NA	NA	NA	NA
AUR47052.1|1535368_1535731_-	virulence protein RhuM family	NA	NA	NA	NA	NA
AUR46044.1|1535737_1536940_-|integrase	bacteriophage integrase	integrase	NA	NA	NA	NA
1541426:1541440	attR	TTGGATACCTCCGAA	NA	NA	NA	NA
