The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP011245	Bordetella pertussis strain J199, complete genome	4109686	27282	122073	4109686	coat,tRNA,transposase,integrase	Planktothrix_phage(25.0%)	94	44518:44577	122465:122480
AUR64932.1|27282_28152_-|integrase	integrase	integrase	NA	NA	NA	NA
AUR64933.1|28314_28614_-	hypothetical protein	NA	NA	NA	NA	NA
AUR64934.1|28674_29109_-	hypothetical protein	NA	NA	NA	NA	NA
AUR68270.1|29141_30359_-	thiolase	NA	NA	NA	NA	NA
AUR64935.1|30364_30862_-	dehydratase	NA	NA	NA	NA	NA
AUR64936.1|31069_32005_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUR64937.1|32214_33006_+	enoyl-CoA hydratase	NA	NA	NA	NA	NA
AUR64938.1|33048_34470_+	2-methylcitrate dehydratase	NA	NA	NA	NA	NA
AUR64939.1|34706_35576_+|integrase	integrase	integrase	NA	NA	NA	NA
AUR64940.1|35572_36763_-	transporter	NA	NA	NA	NA	NA
AUR64941.1|37012_37924_+|tRNA	glycyl-tRNA synthetase	tRNA	NA	NA	NA	NA
AUR64942.1|37925_40064_+|tRNA	glycyl-tRNA synthetase subunit beta	tRNA	NA	NA	NA	NA
AUR64943.1|40060_40600_+	D,D-heptose 1,7-bisphosphate phosphatase	NA	NA	NA	NA	NA
AUR64944.1|40603_41332_+	acyl-phosphate glycerol 3-phosphate acyltransferase	NA	NA	NA	NA	NA
AUR64945.1|41318_42212_+	hypothetical protein	NA	NA	NA	NA	NA
AUR64946.1|42282_42678_+	glyoxalase I	NA	NA	NA	NA	NA
AUR64947.1|42687_43218_+	peptide deformylase	NA	E3SLL2	Synechococcus_phage	35.4	3.7e-12
AUR64948.1|43346_43526_-	hypothetical protein	NA	NA	NA	NA	NA
AUR64949.1|43744_44614_+|integrase	integrase	integrase	NA	NA	NA	NA
44518:44577	attL	CTACAACTGGCATCGACCCCACCAAGGCATCGGGCGCGCTGTACCCATCTCCAGACTCAA	NA	NA	NA	NA
AUR68271.1|45224_45749_+	hypothetical protein	NA	NA	NA	NA	NA
44518:44577	attL	CTACAACTGGCATCGACCCCACCAAGGCATCGGGCGCGCTGTACCCATCTCCAGACTCAA	NA	NA	NA	NA
AUR64950.1|45720_45957_-	LuxR family transcriptional regulator	NA	NA	NA	NA	NA
AUR64951.1|46084_46978_+	membrane protein	NA	NA	NA	NA	NA
AUR64952.1|48147_49395_+	homoserine acetyltransferase	NA	NA	NA	NA	NA
AUR64953.1|49391_50006_+	methionine biosynthesis protein MetW	NA	NA	NA	NA	NA
AUR64954.1|50141_51092_+|integrase	integrase	integrase	NA	NA	NA	NA
AUR64955.1|51134_52391_+	muropeptide transporter	NA	NA	NA	NA	NA
AUR64956.1|53622_54357_-	glutamate racemase	NA	NA	NA	NA	NA
AUR64957.1|54362_54953_-	arginine transporter ATP-binding subunit	NA	G9BWD6	Planktothrix_phage	33.6	3.2e-20
AUR64958.1|54977_55667_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
AUR64959.1|55663_56425_-	glutamate ABC transporter permease	NA	NA	NA	NA	NA
AUR64960.1|56504_57404_-	ABC transporter	NA	NA	NA	NA	NA
AUR64961.1|57497_58448_-|integrase	integrase	integrase	NA	NA	NA	NA
AUR64962.1|59248_60475_-	serine kinase HipA	NA	NA	NA	NA	NA
AUR68272.1|60474_60888_-	DNA-binding protein	NA	NA	NA	NA	NA
AUR68273.1|61077_62019_-	hypothetical protein	NA	NA	NA	NA	NA
AUR64963.1|63473_64055_-	glutamine amidotransferase	NA	NA	NA	NA	NA
AUR68274.1|64067_64370_-	ferredoxin	NA	NA	NA	NA	NA
AUR64964.1|64488_65547_-	oxidoreductase	NA	NA	NA	NA	NA
AUR64965.1|65581_66853_-	membrane protein	NA	NA	NA	NA	NA
AUR64966.1|66883_67138_-	hypothetical protein	NA	NA	NA	NA	NA
AUR64967.1|67482_68664_-	hypothetical protein	NA	NA	NA	NA	NA
AUR64968.1|69166_70036_+|integrase	integrase	integrase	NA	NA	NA	NA
AUR64969.1|70129_70444_+|transposase	transposase	transposase	NA	NA	NA	NA
AUR64970.1|71636_73544_+	heat shock protein 90	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	37.2	1.1e-117
AUR64971.1|73705_74326_-	glutathione S-transferase	NA	NA	NA	NA	NA
AUR64972.1|74357_74939_-	N-acetyl-anhydromuranmyl-L-alanine amidase	NA	A0A1W6DX33	Sphingobium_phage	54.3	1.7e-05
AUR64973.1|75027_75279_-	hypothetical protein	NA	NA	NA	NA	NA
AUR64974.1|75280_76123_-	membrane protein	NA	NA	NA	NA	NA
AUR64975.1|76228_77638_+	signal recognition particle	NA	NA	NA	NA	NA
AUR64976.1|77634_78585_-|integrase	integrase	integrase	NA	NA	NA	NA
AUR68275.1|78659_79604_+|integrase	integrase	integrase	NA	NA	NA	NA
79508:79600	attR	CTACAACTGGCATCGACCCCACCAAGGCATCGGGCGCGCTGTACCCATCTCCAGACTCAACCTGGACGAATACAACCTATTGACAGTTCACAG	NA	NA	NA	NA
AUR64977.1|79600_81475_-	capsular biosynthesis protein	NA	A0A2P1ELS8	Moumouvirus	26.9	2.0e-23
79508:79600	attR	CTACAACTGGCATCGACCCCACCAAGGCATCGGGCGCGCTGTACCCATCTCCAGACTCAACCTGGACGAATACAACCTATTGACAGTTCACAG	NA	NA	NA	NA
AUR64978.1|82822_83527_-	lipopolysaccharide biosynthesis protein	NA	NA	NA	NA	NA
AUR64979.1|83523_84630_-	glycosyl transferase	NA	NA	NA	NA	NA
AUR64980.1|84891_85485_-	sugar transferase	NA	NA	NA	NA	NA
AUR64981.1|85481_86669_-	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
AUR64982.1|86731_87991_-	glycosyl transferase	NA	NA	NA	NA	NA
AUR64983.1|88014_89103_-	UDP-N-acetylglucosamine 2-epimerase	NA	A0A0N9R0B2	Chrysochromulina_ericina_virus	36.3	4.8e-46
AUR64984.1|89110_90211_-	aminotransferase DegT	NA	A0A2K9L0G1	Tupanvirus	29.7	3.3e-31
AUR64985.1|90214_90790_-	serine acetyltransferase	NA	NA	NA	NA	NA
AUR64986.1|90793_91846_-	oxidoreductase	NA	NA	NA	NA	NA
AUR64987.1|91976_92984_+	heptosyltransferase	NA	NA	NA	NA	NA
AUR64988.1|92985_94272_+	3-deoxy-D-manno-octulosonic acid transferase	NA	NA	NA	NA	NA
AUR64989.1|94288_94444_-	hypothetical protein	NA	NA	NA	NA	NA
AUR64990.1|94468_95272_-	pantothenate kinase	NA	NA	NA	NA	NA
AUR64991.1|95268_96135_-	biotin--protein ligase	NA	NA	NA	NA	NA
AUR64992.1|96209_97340_+	ABC transporter permease	NA	NA	NA	NA	NA
AUR64993.1|97339_98179_+	iron ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.4	9.1e-21
AUR68276.1|98332_98800_-	hypothetical protein	NA	NA	NA	NA	NA
AUR64994.1|98889_99111_+	hypothetical protein	NA	NA	NA	NA	NA
AUR64995.1|99111_99714_+	hypothetical protein	NA	NA	NA	NA	NA
AUR64996.1|99743_100397_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
AUR68277.1|100607_101786_+	cytochrome C550	NA	B6DZZ7	Stx2-converting_phage	40.5	5.8e-66
AUR64997.1|101866_102733_+	cytochrome C550	NA	NA	NA	NA	NA
AUR64998.1|102808_103084_+	hypothetical protein	NA	NA	NA	NA	NA
AUR64999.1|103091_103754_+	lipoate--protein ligase	NA	NA	NA	NA	NA
AUR65000.1|103815_104817_+	lipoyl synthase	NA	NA	NA	NA	NA
AUR65001.1|104831_105380_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	53.4	3.7e-47
AUR65002.1|105437_106334_-	dTDP-4-dehydrorhamnose reductase	NA	NA	NA	NA	NA
AUR65003.1|106330_107392_-|coat	spore coat protein	coat	A0A1D7XFE8	Escherichia_phage	44.8	1.6e-78
AUR65004.1|107427_108297_-|integrase	integrase	integrase	NA	NA	NA	NA
AUR65005.1|109277_110471_+	cystathionine beta-lyase	NA	NA	NA	NA	NA
AUR65006.1|110552_111182_-	thiol:disulfide interchange protein	NA	NA	NA	NA	NA
AUR65007.1|111243_111927_-	cell division protein	NA	NA	NA	NA	NA
AUR65008.1|111936_113619_-|tRNA	arginine--tRNA ligase	tRNA	NA	NA	NA	NA
AUR68278.1|113906_114254_+	hypothetical protein	NA	NA	NA	NA	NA
AUR65009.1|114344_114662_+	hypothetical protein	NA	NA	NA	NA	NA
AUR65010.1|114944_115961_+|transposase	transposase	transposase	NA	NA	NA	NA
AUR65011.1|116036_116837_-	ABC transporter permease	NA	NA	NA	NA	NA
AUR65012.1|116833_117709_-	ABC transporter permease	NA	NA	NA	NA	NA
AUR65013.1|117719_119012_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUR65014.1|119054_120095_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	33.7	6.0e-22
AUR65015.1|120200_121022_-	metallophosphatase	NA	NA	NA	NA	NA
AUR65016.1|121122_122073_-|integrase	integrase	integrase	NA	NA	NA	NA
122465:122480	attR	GCATCATGGCCTCGTC	NA	NA	NA	NA
>prophage 2
CP011245	Bordetella pertussis strain J199, complete genome	4109686	164893	301503	4109686	tRNA,integrase	Klosneuvirus(10.53%)	118	173193:173211	305581:305598
AUR65052.1|164893_165844_-|integrase	integrase	integrase	NA	NA	NA	NA
AUR65053.1|167287_168190_-	membrane protein	NA	NA	NA	NA	NA
AUR65054.1|168167_168797_-	LemA	NA	NA	NA	NA	NA
AUR65055.1|169079_170510_+	RNA helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	29.8	5.8e-44
AUR65056.1|170543_171173_+	threonine transporter RhtB	NA	NA	NA	NA	NA
AUR65057.1|171221_172829_+	peptide chain release factor 3	NA	A0A2K9L6L3	Tupanvirus	37.8	9.3e-14
AUR65058.1|172865_173537_+	hypothetical protein	NA	NA	NA	NA	NA
173193:173211	attL	GCGCGCGAGATCGCCGCCA	NA	NA	NA	NA
AUR68281.1|173618_174095_-	bacterioferritin	NA	NA	NA	NA	NA
173193:173211	attL	GCGCGCGAGATCGCCGCCA	NA	NA	NA	NA
AUR65059.1|174382_175252_+|integrase	integrase	integrase	NA	NA	NA	NA
AUR65060.1|176367_176895_+	lipoprotein	NA	NA	NA	NA	NA
AUR65061.1|176986_177802_+	lipoprotein	NA	NA	NA	NA	NA
AUR65062.1|177862_178597_+	hypothetical protein	NA	NA	NA	NA	NA
AUR65063.1|178634_180713_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SHR2	Klosneuvirus	23.6	1.5e-27
AUR65064.1|180962_181235_-	hypothetical protein	NA	NA	NA	NA	NA
AUR65065.1|181336_182422_+	ATP-binding protein	NA	NA	NA	NA	NA
AUR65066.1|182425_184330_+	surface antigen	NA	NA	NA	NA	NA
AUR65067.1|184326_188001_+	hypothetical protein	NA	NA	NA	NA	NA
AUR65068.1|188061_188625_+	deoxycytidine triphosphate deaminase	NA	S5VM63	Pseudomonas_phage	75.3	2.6e-72
AUR65069.1|188632_189055_-	glyoxalase	NA	NA	NA	NA	NA
AUR65070.1|189082_189502_-	glyoxalase	NA	NA	NA	NA	NA
AUR65071.1|189530_189878_-	hypothetical protein	NA	NA	NA	NA	NA
AUR68282.1|190151_190601_+	hypothetical protein	NA	NA	NA	NA	NA
AUR65072.1|190755_193026_+	lysine decarboxylase	NA	NA	NA	NA	NA
AUR65073.1|193101_194307_+	membrane protein	NA	NA	NA	NA	NA
AUR65074.1|194486_195356_+|integrase	integrase	integrase	NA	NA	NA	NA
AUR65075.1|195458_196094_+	superoxide dismutase	NA	Q56AR7	Bacillus_thuringiensis_phage	73.8	2.8e-83
AUR65076.1|196090_196984_+	divalent cation transporter	NA	NA	NA	NA	NA
AUR65077.1|197378_198479_+	glycine cleavage system protein T	NA	NA	NA	NA	NA
AUR65078.1|198560_198935_+	glycine cleavage system protein H	NA	NA	NA	NA	NA
AUR65079.1|198994_201859_+	glycine dehydrogenase	NA	E3SN07	Prochlorococcus_phage	51.4	1.2e-261
AUR65080.1|202003_202744_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AUR65081.1|202813_204025_+	formyl-CoA transferase	NA	NA	NA	NA	NA
AUR65082.1|204053_205022_+	hypothetical protein	NA	NA	NA	NA	NA
AUR65083.1|205716_206586_+|integrase	integrase	integrase	NA	NA	NA	NA
AUR65084.1|206742_207066_+	PsiF repeat family protein	NA	NA	NA	NA	NA
AUR68283.1|207170_208211_-	cyclase	NA	NA	NA	NA	NA
AUR65085.1|208216_208996_-	3-oxoadipate enol-lactonase	NA	NA	NA	NA	NA
AUR65086.1|209041_209338_-	hypothetical protein	NA	NA	NA	NA	NA
AUR65087.1|209363_209639_-	muconolactone delta-isomerase	NA	NA	NA	NA	NA
AUR65088.1|209695_210340_-	3-oxoadipate CoA-transferase	NA	NA	NA	NA	NA
AUR65089.1|210339_211026_-	3-oxoadipate CoA-transferase	NA	NA	NA	NA	NA
AUR68284.1|211224_212007_+	IclR family transcriptional regulator	NA	NA	NA	NA	NA
AUR65090.1|212057_212783_-	short-chain dehydrogenase	NA	NA	NA	NA	NA
AUR65091.1|212814_214164_-	short-chain fatty acid transporter	NA	NA	NA	NA	NA
AUR65092.1|214275_215208_-	3-hydroxybutyryl-CoA dehydrogenase	NA	NA	NA	NA	NA
AUR65093.1|215665_218461_-	peptidase S8	NA	NA	NA	NA	NA
AUR65094.1|219054_221898_-	phosphoenolpyruvate carboxylase	NA	NA	NA	NA	NA
AUR65095.1|222068_222788_+	7-cyano-7-deazaguanine synthase	NA	A0A0A0RPC6	Escherichia_phage	43.9	8.0e-50
AUR65096.1|222826_223375_-	GCN5 family acetyltransferase	NA	A0A2H4J136	uncultured_Caudovirales_phage	41.7	1.2e-21
AUR65097.1|223529_224429_+	virginiamycin B lyase	NA	NA	NA	NA	NA
AUR65098.1|224453_225404_-|integrase	integrase	integrase	NA	NA	NA	NA
AUR65099.1|225622_226318_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AUR65100.1|226334_227747_+	2-hydroxyacid dehydrogenase	NA	NA	NA	NA	NA
AUR65101.1|227859_229290_+	aldehyde dehydrogenase	NA	NA	NA	NA	NA
AUR65102.1|229331_231245_-	thiamine biosynthesis protein ThiC	NA	NA	NA	NA	NA
AUR65103.1|231563_232130_+	preprotein translocase subunit SecD	NA	NA	NA	NA	NA
AUR65104.1|232220_233222_+	restriction endonuclease	NA	NA	NA	NA	NA
AUR65105.1|233336_234287_+|integrase	integrase	integrase	NA	NA	NA	NA
AUR65106.1|234373_235324_+|integrase	integrase	integrase	NA	NA	NA	NA
AUR65107.1|235320_236271_-|integrase	integrase	integrase	NA	NA	NA	NA
AUR65108.1|236369_237167_-	beta-D-hydroxybutyrate dehydrogenase	NA	NA	NA	NA	NA
AUR65109.1|238116_238527_+	4-carboxymuconolactone decarboxylase	NA	NA	NA	NA	NA
AUR65110.1|238776_239532_+	gamma-hydroxybutyrate dehydrogenase	NA	D2K0C8	Staphylococcus_phage	55.0	4.6e-32
AUR65111.1|239548_240292_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AUR65112.1|240335_241379_-	C4-dicarboxylate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUR65113.1|241549_243652_+	membrane protein	NA	NA	NA	NA	NA
241662:241680	attR	TGGCGGCGATCTCGCGCGC	NA	NA	NA	NA
AUR65114.1|245062_246019_+	hypothetical protein	NA	NA	NA	NA	NA
241662:241680	attR	TGGCGGCGATCTCGCGCGC	NA	NA	NA	NA
AUR65115.1|246037_246529_-	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine pyrophosphokinase	NA	NA	NA	NA	NA
AUR65116.1|246525_247881_-	PcnB	NA	A0A1B1IVF3	uncultured_Mediterranean_phage	36.8	3.4e-25
AUR65117.1|247881_248580_-	hypothetical protein	NA	NA	NA	NA	NA
AUR65118.1|248576_249278_-	DnaA regulatory inactivator Hda	NA	NA	NA	NA	NA
AUR65119.1|249530_250580_+	phosphoribosylaminoimidazole synthetase	NA	Q58MH8	Prochlorococcus_phage	43.6	5.6e-68
AUR65120.1|250685_251627_-|tRNA	tRNA delta(2)-isopentenylpyrophosphate transferase	tRNA	NA	NA	NA	NA
AUR65121.1|251623_253513_-	DNA mismatch repair protein	NA	A0A1B2LRQ5	Wolbachia_phage	32.8	3.3e-79
AUR68285.1|253617_254238_+	membrane protein	NA	NA	NA	NA	NA
AUR65122.1|254380_255766_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A2H4JCM7	uncultured_Caudovirales_phage	30.3	4.5e-17
AUR65123.1|255696_256233_-	ATPase	NA	NA	NA	NA	NA
AUR65124.1|256384_257776_+	fumarate hydratase	NA	NA	NA	NA	NA
AUR65125.1|257792_258773_-	membrane protein	NA	NA	NA	NA	NA
AUR65126.1|258908_259892_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUR65127.1|259956_260856_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUR65128.1|260962_262717_+	gamma-glutamyltransferase	NA	NA	NA	NA	NA
AUR65129.1|262724_263849_-	carnitine dehydratase	NA	NA	NA	NA	NA
AUR65130.1|263862_264843_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUR65131.1|265573_266524_+|integrase	integrase	integrase	NA	NA	NA	NA
AUR65132.1|266538_266910_+	hypothetical protein	NA	NA	NA	NA	NA
AUR65133.1|267083_267629_+	ArsR family transcriptional regulator	NA	NA	NA	NA	NA
AUR65134.1|267754_269332_+	cytochrome d terminal oxidase subunit 1	NA	NA	NA	NA	NA
AUR65135.1|269347_270502_+	cytochrome d ubiquinol oxidase subunit 2	NA	NA	NA	NA	NA
AUR65136.1|270515_270641_+	cytochrome bd biosynthesis protein	NA	NA	NA	NA	NA
AUR65137.1|270637_272389_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	23.8	3.4e-09
AUR65138.1|272385_274065_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.6	3.6e-16
AUR65139.1|274127_274676_+	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	43.1	1.3e-28
AUR65140.1|275818_276097_+	hypothetical protein	NA	NA	NA	NA	NA
AUR65141.1|277140_278091_-|integrase	integrase	integrase	NA	NA	NA	NA
AUR65142.1|278368_278530_+	hypothetical protein	NA	NA	NA	NA	NA
AUR65143.1|278537_278678_+	hypothetical protein	NA	NA	NA	NA	NA
AUR65144.1|279196_279646_-	peptidase	NA	NA	NA	NA	NA
AUR65145.1|279655_280267_-	glutathione S-transferase	NA	NA	NA	NA	NA
AUR68286.1|280425_281274_-	cytochrome C	NA	NA	NA	NA	NA
AUR65146.1|281299_282682_-	cytochrome B	NA	NA	NA	NA	NA
AUR65147.1|282746_283388_-	ubiquinol-cytochrome C reductase	NA	NA	NA	NA	NA
AUR65148.1|283527_283986_+	large-conductance mechanosensitive channel	NA	NA	NA	NA	NA
AUR65149.1|284010_284787_-	metal-binding protein	NA	NA	NA	NA	NA
AUR65150.1|284807_285977_+	2-alkenal reductase	NA	W5SAB9	Pithovirus	31.2	1.2e-07
AUR65151.1|285973_286924_-|integrase	integrase	integrase	NA	NA	NA	NA
AUR65152.1|287022_287649_-	regulatory protein	NA	NA	NA	NA	NA
AUR65153.1|287671_288598_-	2-hydroxyacid dehydrogenase	NA	NA	NA	NA	NA
AUR65154.1|288606_290193_-	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUR65155.1|290189_291194_-	acetyl esterase	NA	A0A2L2DMU8	Acanthamoeba_polyphaga_mimivirus	31.5	7.5e-30
AUR65156.1|291393_292254_+	cupin	NA	NA	NA	NA	NA
AUR65157.1|292285_293287_-	hypothetical protein	NA	NA	NA	NA	NA
AUR65158.1|293357_294167_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AUR65159.1|294244_296104_+	dihydroxy-acid dehydratase	NA	NA	NA	NA	NA
AUR65160.1|296232_297435_-	arabinose transporter permease	NA	NA	NA	NA	NA
AUR65161.1|297548_298430_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUR65162.1|299932_300493_-	5'-3'-deoxyribonucleotidase	NA	A0A1E1EUN3	Acanthamoeba_castellanii_mimivirus	30.8	3.2e-14
AUR65163.1|300552_301503_-|integrase	integrase	integrase	NA	NA	NA	NA
305581:305598	attR	CGCGCGCCGCGCCGGCGG	NA	NA	NA	NA
>prophage 3
CP011245	Bordetella pertussis strain J199, complete genome	4109686	365304	431273	4109686	tRNA,integrase	Streptococcus_phage(28.57%)	60	429365:429381	431594:431610
AUR65226.1|365304_366174_-|integrase	integrase	integrase	NA	NA	NA	NA
AUR65227.1|367303_367942_+	membrane protein	NA	NA	NA	NA	NA
AUR65228.1|367978_369322_-	glutamate dehydrogenase	NA	NA	NA	NA	NA
AUR65229.1|369744_370533_-	exodeoxyribonuclease III	NA	M1PSC0	Streptococcus_phage	25.7	1.2e-19
AUR65230.1|370670_371345_+	orotate phosphoribosyltransferase	NA	NA	NA	NA	NA
AUR65231.1|371458_372913_-|tRNA	glutamyl-tRNA amidotransferase	tRNA	NA	NA	NA	NA
AUR65232.1|372915_374454_-|tRNA	glutamyl-tRNA amidotransferase	tRNA	NA	NA	NA	NA
AUR65233.1|374456_374765_-|tRNA	glutamyl-tRNA amidotransferase	tRNA	NA	NA	NA	NA
AUR65234.1|374995_376039_+	rod shape-determining protein MreB	NA	NA	NA	NA	NA
AUR65235.1|376127_377012_+	rod shape-determining protein MreC	NA	NA	NA	NA	NA
AUR65236.1|376998_377562_+	rod shape-determining protein MreD	NA	NA	NA	NA	NA
AUR65237.1|377575_379528_+	penicillin-binding protein	NA	NA	NA	NA	NA
AUR65238.1|379524_380661_+	ADP-ribosylglycohydrolase	NA	NA	NA	NA	NA
AUR65239.1|380686_381742_-	lactate dehydrogenase	NA	NA	NA	NA	NA
AUR65240.1|381752_383246_-	membrane protein	NA	NA	NA	NA	NA
AUR65241.1|383458_384034_-	dihydroorotate oxidase	NA	NA	NA	NA	NA
AUR65242.1|384083_384830_-	hydrolase	NA	NA	NA	NA	NA
AUR65243.1|384829_385732_-	acetylglutamate kinase	NA	NA	NA	NA	NA
AUR65244.1|385993_386782_+	methionine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUR65245.1|386922_387414_-	thioredoxin	NA	NA	NA	NA	NA
AUR65246.1|387410_388154_-	phospholipid-binding protein	NA	NA	NA	NA	NA
AUR68291.1|388150_388744_-	phosphoheptose isomerase	NA	A0A067XQR2	Caulobacter_phage	34.8	5.6e-17
AUR65247.1|388752_389052_-	hypothetical protein	NA	NA	NA	NA	NA
AUR65248.1|389353_390292_+	tetrapyrrole methylase	NA	NA	NA	NA	NA
AUR65249.1|390288_390861_+	cysteine methyltransferase	NA	M1PFU9	Streptococcus_phage	42.5	3.2e-25
AUR65250.1|390857_391808_-|integrase	integrase	integrase	NA	NA	NA	NA
AUR68292.1|391950_392862_+	reductase	NA	NA	NA	NA	NA
AUR65251.1|392858_393107_+	glutaredoxin	NA	NA	NA	NA	NA
AUR65252.1|393103_394309_+	acetyl-CoA acetyltransferase	NA	NA	NA	NA	NA
AUR65253.1|394381_395377_-	membrane protein	NA	NA	NA	NA	NA
AUR65254.1|395399_396620_-	dehydratase	NA	NA	NA	NA	NA
AUR65255.1|396616_397261_-	hypothetical protein	NA	NA	NA	NA	NA
AUR65256.1|397257_397650_-	hypothetical protein	NA	NA	NA	NA	NA
AUR65257.1|398991_399801_-	IclR family transcriptional regulator	NA	NA	NA	NA	NA
AUR65258.1|400105_401059_+	thioredoxin reductase	NA	A0A2I2L5E1	Orpheovirus	42.5	5.6e-59
AUR65259.1|401157_402141_+|integrase	integrase	integrase	NA	NA	NA	NA
AUR65260.1|402817_403588_-	enoyl-CoA hydratase	NA	NA	NA	NA	NA
AUR65261.1|403584_404763_-	carnitine dehydratase	NA	NA	NA	NA	NA
AUR65262.1|404930_406637_-	thiamine pyrophosphate-binding protein	NA	NA	NA	NA	NA
AUR65263.1|406633_407530_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUR65264.1|407570_409160_-	sulfurtransferase	NA	NA	NA	NA	NA
AUR65265.1|409209_410202_-	hypothetical protein	NA	NA	NA	NA	NA
AUR65266.1|410270_410870_-	hypothetical protein	NA	NA	NA	NA	NA
AUR68293.1|411330_412269_-	hypothetical protein	NA	NA	NA	NA	NA
AUR65267.1|412386_413256_-|integrase	integrase	integrase	NA	NA	NA	NA
AUR65268.1|413425_414340_+	transporter	NA	NA	NA	NA	NA
AUR65269.1|414336_414996_+	membrane protein	NA	NA	NA	NA	NA
AUR65270.1|415085_416009_+	peptidase	NA	A0A1C9C5K3	Heterosigma_akashiwo_virus	27.2	4.8e-07
AUR65271.1|416014_416470_-	membrane protein	NA	NA	NA	NA	NA
AUR65272.1|416466_417570_-	hypothetical protein	NA	NA	NA	NA	NA
AUR65273.1|417757_419377_-	dolichyl-phosphate-mannose-protein mannosyltransferase	NA	NA	NA	NA	NA
AUR65274.1|419373_420432_-	glycosyl transferase family 2	NA	I1TED8	Salmonella_phage	40.5	2.8e-59
AUR65275.1|420561_421056_+	acetyltransferase	NA	NA	NA	NA	NA
AUR65276.1|421148_422126_+|integrase	integrase	integrase	NA	NA	NA	NA
AUR65277.1|422321_423527_+	ABC transporter permease	NA	NA	NA	NA	NA
AUR65278.1|423523_425035_+	TRAP ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUR68294.1|425050_426364_-	short-chain fatty acid transporter	NA	NA	NA	NA	NA
AUR65279.1|426554_426734_-	membrane protein	NA	NA	NA	NA	NA
AUR65280.1|427143_427878_-	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	43.8	1.4e-41
429365:429381	attL	CGGCCGCCACCACGGCG	NA	NA	NA	NA
AUR65281.1|430322_431273_+|integrase	integrase	integrase	NA	NA	NA	NA
AUR65281.1|430322_431273_+|integrase	integrase	integrase	NA	NA	NA	NA
431594:431610	attR	CGCCGTGGTGGCGGCCG	NA	NA	NA	NA
>prophage 4
CP011245	Bordetella pertussis strain J199, complete genome	4109686	620982	721446	4109686	terminase,tRNA,tail,integrase	uncultured_Caudovirales_phage(14.29%)	110	665974:665988	724261:724279
AUR65448.1|620982_621933_+|integrase	integrase	integrase	NA	NA	NA	NA
AUR65449.1|622631_623015_+	membrane protein	NA	NA	NA	NA	NA
AUR65450.1|623072_623675_+	hypothetical protein	NA	NA	NA	NA	NA
AUR68303.1|623692_624094_-	membrane protein	NA	NA	NA	NA	NA
AUR65451.1|624209_625121_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUR65452.1|625117_625699_+	NUDIX hydrolase	NA	NA	NA	NA	NA
AUR68304.1|626502_627228_+|tRNA	arginyl-tRNA-protein transferase	tRNA	NA	NA	NA	NA
AUR65453.1|627268_628318_+	dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
AUR65454.1|628465_629044_-	Phasin (PHA-granule associated protein)	NA	NA	NA	NA	NA
AUR65455.1|629430_630408_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUR65456.1|630501_634896_-	dermonecrotic toxin	NA	NA	NA	NA	NA
AUR65457.1|635096_635945_-	IclR family transcriptional regulator	NA	NA	NA	NA	NA
AUR65458.1|636103_636916_-	damage-inducible protein	NA	NA	NA	NA	NA
AUR65459.1|636971_637922_-|integrase	integrase	integrase	NA	NA	NA	NA
AUR65460.1|638020_638821_-	membrane protein	NA	NA	NA	NA	NA
AUR65461.1|638882_639266_+	thiol-disulfide isomerase	NA	NA	NA	NA	NA
AUR68305.1|639277_640630_-	ATP-dependent RNA helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	34.4	2.1e-51
AUR65462.1|640917_641247_-	membrane protein	NA	NA	NA	NA	NA
AUR65463.1|641249_641999_-	membrane protein	NA	NA	NA	NA	NA
AUR65464.1|642181_643102_+	branched-chain amino acid aminotransferase	NA	NA	NA	NA	NA
AUR65465.1|643148_643361_+	hypothetical protein	NA	NA	NA	NA	NA
AUR65466.1|643383_643806_+	ketosteroid isomerase	NA	NA	NA	NA	NA
AUR65467.1|643822_644923_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
AUR65468.1|645019_646537_-	exported peptidase	NA	NA	NA	NA	NA
AUR65469.1|646612_647452_+	UTP--glucose-1-phosphate uridylyltransferase	NA	A0A127AW70	Bacillus_phage	48.9	1.1e-66
AUR68306.1|647473_648346_-	membrane protein	NA	NA	NA	NA	NA
AUR65470.1|648436_649531_-	porin	NA	NA	NA	NA	NA
AUR65471.1|649824_650694_-|integrase	integrase	integrase	NA	NA	NA	NA
AUR68307.1|650849_651791_+|integrase	integrase	integrase	NA	NA	NA	NA
AUR65472.1|651874_652234_-	hypothetical protein	NA	NA	NA	NA	NA
AUR65473.1|652615_653653_-	membrane protein	NA	NA	NA	NA	NA
AUR65474.1|653969_655310_+	Xaa-Pro aminopeptidase	NA	NA	NA	NA	NA
AUR65475.1|655319_655772_-	membrane protein	NA	NA	NA	NA	NA
AUR65476.1|655877_657050_+	monooxygenase	NA	NA	NA	NA	NA
AUR68308.1|657115_658141_+|tRNA	tRNA-dihydrouridine synthase B	tRNA	NA	NA	NA	NA
AUR65477.1|658181_658421_+	Fis family transcriptional regulator	NA	NA	NA	NA	NA
AUR65478.1|658490_660080_+	phosphoribosylaminoimidazolecarboxamide formyltransferase	NA	Q58MG4	Prochlorococcus_phage	47.2	8.7e-65
AUR65479.1|660079_660628_+	Holliday junction resolvase	NA	NA	NA	NA	NA
AUR65480.1|660708_661281_+	ATP-dependent DNA helicase RuvA	NA	NA	NA	NA	NA
AUR65481.1|661299_662211_-	NAD-dependent dehydratase	NA	NA	NA	NA	NA
AUR65482.1|662284_663253_-	serine dehydratase	NA	NA	NA	NA	NA
AUR65483.1|663375_664449_+	ATP-dependent DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	25.7	2.3e-08
AUR65484.1|664453_666274_-	ATP-dependent DNA helicase RecQ	NA	L7RCS0	Acanthamoeba_polyphaga_moumouvirus	35.3	3.1e-74
665974:665988	attL	CGACCTCGCGCGCCA	NA	NA	NA	NA
AUR65485.1|666350_667301_-|integrase	integrase	integrase	NA	NA	NA	NA
665974:665988	attL	CGACCTCGCGCGCCA	NA	NA	NA	NA
AUR65486.1|667389_667725_+	hypothetical protein	NA	NA	NA	NA	NA
AUR65487.1|667858_668509_+	carbonate dehydratase	NA	NA	NA	NA	NA
AUR68309.1|668530_669949_-	amidase	NA	NA	NA	NA	NA
AUR65488.1|670018_670774_-	hypothetical protein	NA	NA	NA	NA	NA
AUR68310.1|670742_671501_+	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
AUR65489.1|671511_672393_+	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
AUR65490.1|672409_673117_+	branched-chain amino acid ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	25.4	8.2e-07
AUR65491.1|673119_673878_+	branched-chain amino acid ABC transporter ATPase	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	24.4	4.4e-14
AUR65492.1|674087_675830_+	sulfite reductase	NA	NA	NA	NA	NA
AUR65493.1|675822_676347_+	hypothetical protein	NA	NA	NA	NA	NA
AUR65494.1|676386_677181_-	dioxygenase	NA	NA	NA	NA	NA
AUR65495.1|677348_678422_+	hypothetical protein	NA	NA	NA	NA	NA
AUR65496.1|678520_679471_+|integrase	integrase	integrase	NA	NA	NA	NA
AUR65497.1|679722_679929_-	hypothetical protein	NA	NA	NA	NA	NA
AUR68311.1|680000_680612_-	repressor	NA	NA	NA	NA	NA
AUR65498.1|681091_681412_-	hypothetical protein	NA	NA	NA	NA	NA
681219:681233	attR	TGGCGCGCGAGGTCG	NA	NA	NA	NA
AUR65499.1|681404_682103_-	membrane protein	NA	NA	NA	NA	NA
681219:681233	attR	TGGCGCGCGAGGTCG	NA	NA	NA	NA
AUR65500.1|682117_682339_-	hypothetical protein	NA	NA	NA	NA	NA
AUR65501.1|682356_683307_+|integrase	integrase	integrase	NA	NA	NA	NA
AUR65502.1|683946_684432_+|terminase	terminase	terminase	C7U0W1	Enterobacteria_phage	61.5	7.3e-39
AUR65503.1|684418_685696_+|terminase	terminase	terminase	A0A1B1P9C9	Acinetobacter_phage	64.7	2.4e-150
AUR65504.1|685698_687117_+	hypothetical protein	NA	R9TF43	Synechococcus_phage	42.1	2.2e-99
AUR65505.1|687088_688201_+	phage Mu F like family protein	NA	A0A0H5BBX3	Pseudomonas_phage	49.7	2.1e-102
AUR65506.1|688206_688449_+	hypothetical protein	NA	A0A0H5AUE5	Pseudomonas_phage	53.2	5.6e-16
AUR65507.1|688571_689174_+	hypothetical protein	NA	R9TF81	Synechococcus_phage	43.6	7.9e-27
AUR65508.1|689602_690553_-|integrase	integrase	integrase	NA	NA	NA	NA
AUR65509.1|691227_691479_+	hypothetical protein	NA	NA	NA	NA	NA
AUR65510.1|691541_692024_+	hypothetical protein	NA	A0A2H4JE38	uncultured_Caudovirales_phage	37.1	1.8e-13
AUR65511.1|692025_692226_+	hypothetical protein	NA	NA	NA	NA	NA
AUR65512.1|692225_692621_+	hypothetical protein	NA	A0A2D2W284	Stenotrophomonas_phage	35.0	7.8e-07
AUR65513.1|692617_693016_+	hypothetical protein	NA	I6PCW1	Cronobacter_phage	38.0	4.2e-16
AUR65514.1|693012_693435_+	hypothetical protein	NA	NA	NA	NA	NA
AUR65515.1|693442_693943_+	hypothetical protein	NA	A0A1I9SEX5	Klebsiella_phage	45.1	4.4e-31
AUR65516.1|694197_694716_+	hypothetical protein	NA	A0A1S5R1H0	Pseudomonas_phage	38.3	5.4e-24
AUR65517.1|694725_695055_+	hypothetical protein	NA	A0A2H4J121	uncultured_Caudovirales_phage	44.0	2.9e-15
AUR65518.1|695072_695363_+	hypothetical protein	NA	A0A2H4JBP7	uncultured_Caudovirales_phage	45.2	3.7e-14
AUR65519.1|695388_698001_+|tail	tail protein	tail	A0A2H4J107	uncultured_Caudovirales_phage	38.6	4.9e-105
AUR65520.1|698010_698370_+	hypothetical protein	NA	NA	NA	NA	NA
AUR65521.1|698437_698971_+	hypothetical protein	NA	A5A3Q9	Burkholderia_phage	46.9	1.1e-40
AUR65522.1|698967_699357_+	hypothetical protein	NA	A0A0G3EYJ9	Achromobacter_phage	50.0	3.0e-35
AUR65523.1|699349_703306_+	hypothetical protein	NA	A0A0B5A1N2	Achromobacter_phage	40.8	3.9e-215
AUR65524.1|703310_703727_+	hypothetical protein	NA	NA	NA	NA	NA
AUR65525.1|703945_704209_+	hypothetical protein	NA	A0A1B0V3F2	Roseobacter_phage	41.8	7.2e-09
AUR65526.1|704208_705021_+	hypothetical protein	NA	NA	NA	NA	NA
AUR65527.1|705025_705268_+	hypothetical protein	NA	NA	NA	NA	NA
AUR65528.1|705246_705798_+	lysozyme	NA	NA	NA	NA	NA
AUR65529.1|705797_706313_+	hypothetical protein	NA	NA	NA	NA	NA
AUR68312.1|706309_706591_-	hypothetical protein	NA	NA	NA	NA	NA
AUR65530.1|706590_706812_-	hypothetical protein	NA	NA	NA	NA	NA
AUR65531.1|707140_707812_-	hypothetical protein	NA	Q5QF62	Pseudomonas_virus	39.9	4.7e-36
AUR65532.1|707739_708108_-	hypothetical protein	NA	NA	NA	NA	NA
AUR68313.1|708167_708854_-	transcriptional regulator	NA	NA	NA	NA	NA
AUR65533.1|708834_709407_-	RNA pyrophosphohydrolase	NA	NA	NA	NA	NA
AUR65534.1|709472_711203_+|tRNA	proline--tRNA ligase	tRNA	A0A2K9L3R9	Tupanvirus	29.4	4.6e-11
AUR65535.1|711255_711684_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
AUR65536.1|711686_712367_+	protein tolQ	NA	NA	NA	NA	NA
AUR65537.1|712366_712825_+	biopolymer transporter ExbD	NA	NA	NA	NA	NA
AUR65538.1|712861_713836_+	energy transducer TonB	NA	NA	NA	NA	NA
AUR65539.1|713852_715169_+	translocation protein TolB	NA	NA	NA	NA	NA
AUR65540.1|715200_715698_+	membrane protein	NA	NA	NA	NA	NA
AUR65541.1|715784_716474_+	hypothetical protein	NA	NA	NA	NA	NA
AUR65542.1|716473_717523_+	iron-siderophore ABC transporter permease	NA	NA	NA	NA	NA
AUR65543.1|717519_718314_+	iron ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.6	2.4e-15
AUR65544.1|718482_718833_+	hypothetical protein	NA	NA	NA	NA	NA
AUR65545.1|718808_719366_+	hypothetical protein	NA	NA	NA	NA	NA
AUR65546.1|720495_721446_+|integrase	integrase	integrase	NA	NA	NA	NA
724261:724279	attR	GGCCGCCGCGATCGCCGCG	NA	NA	NA	NA
>prophage 5
CP011245	Bordetella pertussis strain J199, complete genome	4109686	748371	821533	4109686	integrase	Streptococcus_phage(16.67%)	60	752428:752487	821577:821679
AUR65566.1|748371_749322_-|integrase	integrase	integrase	NA	NA	NA	NA
AUR65567.1|749976_751074_+	carboxynorspermidine decarboxylase	NA	NA	NA	NA	NA
AUR65568.1|751107_752373_+	saccharopine dehydrogenase	NA	NA	NA	NA	NA
752428:752487	attL	GCTAGGTGTGAAGATTCAATAGGTTGTATGCATGGTTCATCCGAACCGGATTTGAGAAAC	NA	NA	NA	NA
AUR65569.1|752611_753481_+|integrase	integrase	integrase	NA	NA	NA	NA
AUR65570.1|753522_753678_+	hypothetical protein	NA	NA	NA	NA	NA
AUR65571.1|753724_754315_+	polyisoprenoid-binding protein	NA	NA	NA	NA	NA
AUR65572.1|754330_756775_-	ligand-gated channel	NA	NA	NA	NA	NA
AUR65573.1|756894_757866_-	membrane protein	NA	NA	NA	NA	NA
AUR65574.1|757997_758522_+	RNA polymerase sigma factor	NA	NA	NA	NA	NA
AUR65575.1|758481_759432_-|integrase	integrase	integrase	NA	NA	NA	NA
AUR65576.1|759653_761849_-	DNA methylase	NA	NA	NA	NA	NA
AUR68316.1|761921_762269_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AUR65577.1|762451_763402_+|integrase	integrase	integrase	NA	NA	NA	NA
AUR65578.1|763517_763940_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AUR65579.1|764023_764818_+	transcriptional regulator	NA	NA	NA	NA	NA
AUR65580.1|764983_766120_-	gamma-glutamyl kinase	NA	A0A1X9I5D0	Streptococcus_phage	44.8	5.8e-63
AUR65581.1|766190_767324_-	GTPase CgtA	NA	NA	NA	NA	NA
AUR65582.1|767473_767734_-	50S ribosomal protein L27	NA	NA	NA	NA	NA
AUR65583.1|767767_768079_-	50S ribosomal protein L21	NA	NA	NA	NA	NA
AUR65584.1|768503_769652_+	fumarylacetoacetate hydrolase	NA	NA	NA	NA	NA
AUR65585.1|769766_770732_+	octaprenyl diphosphate synthase	NA	NA	NA	NA	NA
AUR65586.1|771000_771867_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUR65587.1|771997_774046_+	hydantoinase	NA	NA	NA	NA	NA
AUR65588.1|774063_776061_+	hydantoin utilization protein B	NA	NA	NA	NA	NA
AUR65589.1|776095_777433_+	amino acid deaminase	NA	NA	NA	NA	NA
AUR65590.1|777695_779549_+	hypothetical protein	NA	NA	NA	NA	NA
AUR65591.1|779603_781085_+	succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
AUR65592.1|781100_781658_-	lysine acyltransferase	NA	NA	NA	NA	NA
AUR65593.1|781770_781950_+	hypothetical protein	NA	NA	NA	NA	NA
AUR65594.1|782034_787257_+	hemolysin	NA	NA	NA	NA	NA
AUR65595.1|787334_789473_+	peptidase C39	NA	W8CYL7	Bacillus_phage	29.2	2.7e-45
AUR65596.1|789469_790792_+	hemolysin D	NA	NA	NA	NA	NA
AUR65597.1|790793_792218_+	CyaE	NA	NA	NA	NA	NA
AUR65598.1|792308_793217_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUR65599.1|793281_794196_+	ABC transporter	NA	NA	NA	NA	NA
AUR65600.1|794602_794836_-	hypothetical protein	NA	NA	NA	NA	NA
AUR65601.1|795033_795717_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
AUR65602.1|795748_796477_+	arginine transporter ATP-binding subunit	NA	G9BWD6	Planktothrix_phage	42.4	3.4e-32
AUR65603.1|796506_797367_+	D-amino acid aminotransferase	NA	NA	NA	NA	NA
AUR65604.1|797374_797941_-	membrane protein	NA	NA	NA	NA	NA
AUR65605.1|798029_798986_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUR65606.1|799030_799783_-	3-ketoacyl-ACP reductase	NA	NA	NA	NA	NA
AUR65607.1|799779_801525_-	acetolactate synthase catalytic subunit	NA	NA	NA	NA	NA
AUR65608.1|801609_802344_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AUR65609.1|802660_803683_+	autotransporter	NA	NA	NA	NA	NA
AUR68317.1|803698_804334_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AUR65610.1|804565_805573_-	zinc-binding dehydrogenase	NA	NA	NA	NA	NA
AUR65611.1|805613_807146_-	acetyl-CoA synthetase	NA	NA	NA	NA	NA
AUR65612.1|807142_808261_-	deacylase	NA	NA	NA	NA	NA
AUR65613.1|808257_809040_-	ABC transporter permease	NA	NA	NA	NA	NA
AUR65614.1|809051_809915_-	ABC transporter	NA	G3M9Y6	Bacillus_virus	38.9	9.6e-34
AUR68318.1|809933_811031_-	hypothetical protein	NA	NA	NA	NA	NA
AUR65615.1|811099_812026_-	dioxygenase	NA	NA	NA	NA	NA
AUR65616.1|812060_813755_-	acetolactate synthase	NA	NA	NA	NA	NA
AUR65617.1|813954_814848_-	mechanosensitive ion channel protein	NA	NA	NA	NA	NA
AUR65618.1|814995_815865_-|integrase	integrase	integrase	NA	NA	NA	NA
AUR65619.1|816044_816701_-	hypothetical protein	NA	NA	NA	NA	NA
AUR65620.1|816848_819557_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	24.0	2.8e-15
AUR65621.1|819566_820586_+	fructose 1,6-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	35.7	1.5e-49
AUR65622.1|820582_821533_-|integrase	integrase	integrase	NA	NA	NA	NA
821577:821679	attR	GTTTCTCAAATCCGGTTCGGATGAACCATGCATACAACCTATTGAATCTTCACACCTAGCCGGCGCGCGCCAGCAGCACCACCACGTTGGCGGCAATCCCTTC	NA	NA	NA	NA
>prophage 6
CP011245	Bordetella pertussis strain J199, complete genome	4109686	859976	914107	4109686	transposase,holin,integrase	Vibrio_phage(25.0%)	44	868267:868286	917382:917401
AUR65654.1|859976_861935_-|holin	choline transporter	holin	A0A2I7QNT1	Vibrio_phage	30.3	8.0e-28
AUR65655.1|862017_862968_-|integrase	integrase	integrase	NA	NA	NA	NA
AUR65656.1|863188_863857_+	transcriptional regulator	NA	NA	NA	NA	NA
AUR65657.1|863980_865087_+	hemolysin secretion protein D	NA	NA	NA	NA	NA
AUR65658.1|865099_868213_+	acriflavine resistance protein B	NA	S5VTK5	Leptospira_phage	21.5	4.5e-57
AUR65659.1|868209_869703_+	RND transporter	NA	NA	NA	NA	NA
868267:868286	attL	CTGGCGCTGGCCGGCTGCGC	NA	NA	NA	NA
AUR65660.1|869717_870389_+	transcriptional regulator	NA	NA	NA	NA	NA
AUR68323.1|870432_870885_-	azurin	NA	NA	NA	NA	NA
AUR65661.1|871067_871715_-	IclR family transcriptional regulator	NA	NA	NA	NA	NA
AUR68324.1|871818_873867_+	hydantoinase	NA	NA	NA	NA	NA
AUR65662.1|873863_875876_+	hydantoin utilization protein B	NA	NA	NA	NA	NA
AUR68325.1|875901_877236_+	hypothetical protein	NA	NA	NA	NA	NA
AUR65663.1|877344_878337_+	hypothetical protein	NA	NA	NA	NA	NA
AUR65664.1|878403_880488_-	hypothetical protein	NA	NA	NA	NA	NA
AUR65665.1|880512_881484_-	hypothetical protein	NA	NA	NA	NA	NA
AUR65666.1|881612_882614_-	peptidase M14	NA	NA	NA	NA	NA
AUR65667.1|882647_883799_-	cystathionine beta-lyase	NA	NA	NA	NA	NA
AUR65668.1|884002_884893_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUR65669.1|884970_885795_+	3-oxoacyl-ACP reductase	NA	NA	NA	NA	NA
AUR65670.1|885991_887008_-|transposase	transposase	transposase	NA	NA	NA	NA
AUR65671.1|887204_888188_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUR68326.1|888246_889374_-	argininosuccinate lyase	NA	NA	NA	NA	NA
AUR65672.1|889364_889739_-	hypothetical protein	NA	NA	NA	NA	NA
AUR65673.1|889786_891175_-	hypothetical protein	NA	NA	NA	NA	NA
AUR65674.1|891205_892195_-	hypothetical protein	NA	NA	NA	NA	NA
AUR65675.1|892305_893538_-	methylaspartate ammonia-lyase	NA	NA	NA	NA	NA
AUR65676.1|893819_894620_+	IclR family transcriptional regulator	NA	NA	NA	NA	NA
AUR65677.1|894642_896874_-|holin	choline transporter	holin	NA	NA	NA	NA
AUR65678.1|897661_898108_-	preprotein translocase subunit SecG	NA	NA	NA	NA	NA
AUR65679.1|898129_898876_-	triosephosphate isomerase	NA	NA	NA	NA	NA
AUR65680.1|899019_899997_-	NAD(P)H-quinone oxidoreductase	NA	NA	NA	NA	NA
AUR65681.1|900696_901242_+	hypothetical protein	NA	K4HZX4	Acidithiobacillus_phage	30.5	3.0e-09
AUR65682.1|901235_902453_-	threonine dehydratase	NA	NA	NA	NA	NA
AUR65683.1|902593_903544_+|integrase	integrase	integrase	NA	NA	NA	NA
AUR65684.1|903540_904260_-	lipoprotein	NA	NA	NA	NA	NA
AUR65685.1|904380_906540_-	polynucleotide phosphorylase/polyadenylase	NA	NA	NA	NA	NA
AUR65686.1|906630_906900_-	30S ribosomal protein S15	NA	NA	NA	NA	NA
AUR65687.1|907193_907721_+	lipoprotein	NA	NA	NA	NA	NA
AUR65688.1|907739_908519_-	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
AUR65689.1|908686_909703_-	ketol-acid reductoisomerase	NA	NA	NA	NA	NA
AUR65690.1|909775_910267_-	acetolactate synthase	NA	NA	NA	NA	NA
AUR65691.1|910277_911993_-	acetolactate synthase 3 catalytic subunit	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	30.3	3.1e-60
AUR65692.1|912469_913075_+	hypothetical protein	NA	NA	NA	NA	NA
AUR65693.1|913156_914107_+|integrase	integrase	integrase	NA	NA	NA	NA
917382:917401	attR	CTGGCGCTGGCCGGCTGCGC	NA	NA	NA	NA
>prophage 7
CP011245	Bordetella pertussis strain J199, complete genome	4109686	934854	998447	4109686	integrase	Bacillus_virus(16.67%)	60	930363:930381	1004132:1004150
930363:930381	attL	CGCCCGCCTGCTGGGCGTG	NA	NA	NA	NA
AUR65708.1|934854_935805_+|integrase	integrase	integrase	NA	NA	NA	NA
AUR65709.1|935869_936079_+	hypothetical protein	NA	NA	NA	NA	NA
AUR65710.1|936238_936451_+	hypothetical protein	NA	NA	NA	NA	NA
AUR65711.1|936570_937689_+	N-acylglucosamine 2-epimerase	NA	NA	NA	NA	NA
AUR65712.1|937785_938001_+	hypothetical protein	NA	NA	NA	NA	NA
AUR65713.1|938194_938446_+	hypothetical protein	NA	NA	NA	NA	NA
AUR65714.1|938639_939509_+|integrase	integrase	integrase	NA	NA	NA	NA
AUR65715.1|939505_939889_-	Rieske (2Fe-2S) protein	NA	NA	NA	NA	NA
AUR65716.1|939943_941758_-	metal ABC transporter permease	NA	W8CYL7	Bacillus_phage	27.9	5.7e-44
AUR65717.1|941907_942735_+	oxidoreductase	NA	A0A2H4PQR8	Staphylococcus_phage	47.4	1.7e-67
AUR68328.1|942780_943761_+	alcohol dehydrogenase	NA	NA	NA	NA	NA
AUR65718.1|943757_943970_-	membrane protein	NA	NA	NA	NA	NA
AUR65719.1|943966_945148_-	membrane protein	NA	NA	NA	NA	NA
AUR65720.1|945311_946046_+	serine/threonine protein phosphatase	NA	A0A2H4J0P0	uncultured_Caudovirales_phage	49.2	1.9e-62
AUR65721.1|946047_948660_-	penicillin-binding protein	NA	NA	NA	NA	NA
AUR65722.1|948795_950709_-	peptidase	NA	NA	NA	NA	NA
AUR65723.1|951324_951735_-	phenylacetic acid degradation protein	NA	NA	NA	NA	NA
AUR65724.1|951832_952918_+	DNA polymerase IV	NA	NA	NA	NA	NA
AUR65725.1|953016_953967_+|integrase	integrase	integrase	NA	NA	NA	NA
AUR65726.1|953963_954938_-	hypothetical protein	NA	NA	NA	NA	NA
AUR68329.1|955083_955974_+	LysR family transcriptional regulator	NA	Q6JIH3	Burkholderia_virus	27.6	4.3e-05
AUR68330.1|956250_956643_-	phage-like protein	NA	A0A0R6PJ17	Moraxella_phage	45.0	4.8e-25
AUR65727.1|956772_957723_+|integrase	integrase	integrase	NA	NA	NA	NA
AUR65728.1|957752_957935_-	hypothetical protein	NA	A0A1L2JY37	Aeribacillus_phage	56.1	3.7e-12
AUR65729.1|958707_959889_-	MFS transporter	NA	NA	NA	NA	NA
AUR65730.1|960104_960782_-	phosphoglycolate phosphatase	NA	NA	NA	NA	NA
AUR65731.1|960778_961504_-	3-demethylubiquinone-9 3-methyltransferase	NA	NA	NA	NA	NA
AUR65732.1|961629_962211_-	membrane protein	NA	NA	NA	NA	NA
AUR65733.1|962581_965263_+	DNA gyrase subunit A	NA	G3M9Z5	Bacillus_virus	33.5	3.2e-104
AUR68331.1|965265_966396_+	3-phosphoserine/phosphohydroxythreonine aminotransferase	NA	M1Q1P2	Streptococcus_phage	44.0	4.9e-78
AUR65734.1|966388_967474_+	chorismate mutase	NA	NA	NA	NA	NA
AUR65735.1|967560_968460_+	prephenate dehydrogenase	NA	NA	NA	NA	NA
AUR65736.1|968456_969785_+	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
AUR65737.1|969799_970471_+	cytidylate kinase	NA	NA	NA	NA	NA
AUR65738.1|970658_972374_+	30S ribosomal protein S1	NA	NA	NA	NA	NA
AUR65739.1|972375_972735_+	integration host factor subunit beta	NA	NA	NA	NA	NA
AUR65740.1|972926_973241_+	membrane protein	NA	NA	NA	NA	NA
AUR65741.1|973283_974504_+	membrane protein	NA	NA	NA	NA	NA
AUR65742.1|975438_976428_+	ADP-L-glycero-D-manno-heptose-6-epimerase	NA	E3SJ87	Synechococcus_phage	34.4	2.2e-26
AUR68332.1|976717_977047_+	hypothetical protein	NA	NA	NA	NA	NA
AUR65743.1|977145_978096_+|integrase	integrase	integrase	NA	NA	NA	NA
AUR65744.1|978176_979088_+	cysteine synthase	NA	A0A1X9I5K7	Streptococcus_phage	38.8	8.0e-47
AUR65745.1|979148_980294_-	murein transglycosylase	NA	NA	NA	NA	NA
AUR65746.1|980313_981228_+	deacetylase	NA	A0A2K9KZC4	Tupanvirus	34.7	9.8e-45
AUR65747.1|981299_982049_+	electron transporter RnfB	NA	NA	NA	NA	NA
AUR65748.1|982048_982978_+	electron transfer flavoprotein subunit beta	NA	NA	NA	NA	NA
AUR65749.1|983221_985048_+	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
AUR65750.1|985130_985772_+	peroxidase	NA	NA	NA	NA	NA
AUR65751.1|985961_986996_+	sulfate transporter subunit	NA	NA	NA	NA	NA
AUR65752.1|987011_987215_+	hypothetical protein	NA	NA	NA	NA	NA
AUR65753.1|987236_987911_+	sulfate ABC transporter permease	NA	NA	NA	NA	NA
AUR65754.1|988025_988808_+	sulfate ABC transporter permease	NA	NA	NA	NA	NA
AUR65755.1|988832_989897_+	sulfate ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.3	3.8e-24
AUR68333.1|990694_991603_+	sulfate adenylyltransferase subunit 2	NA	NA	NA	NA	NA
AUR68334.1|993090_994365_+	radical SAM protein	NA	NA	NA	NA	NA
AUR65756.1|994518_994899_+	membrane protein	NA	NA	NA	NA	NA
AUR65757.1|994906_995779_-	multidrug DMT transporter permease	NA	NA	NA	NA	NA
AUR65758.1|996084_996465_+	50S ribosomal protein L19	NA	NA	NA	NA	NA
AUR65759.1|996714_997401_+	NUDIX hydrolase	NA	NA	NA	NA	NA
AUR65760.1|997496_998447_-|integrase	integrase	integrase	NA	NA	NA	NA
1004132:1004150	attR	CACGCCCAGCAGGCGGGCG	NA	NA	NA	NA
>prophage 8
CP011245	Bordetella pertussis strain J199, complete genome	4109686	1024559	1082644	4109686	tRNA,transposase,integrase	uncultured_Mediterranean_phage(37.5%)	50	1066092:1066111	1091722:1091741
AUR65777.1|1024559_1025429_-|integrase	integrase	integrase	NA	NA	NA	NA
AUR65778.1|1025608_1026349_-	16S rRNA methyltransferase	NA	NA	NA	NA	NA
AUR65779.1|1026543_1028580_+	transketolase	NA	NA	NA	NA	NA
AUR65780.1|1028597_1029608_+	glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
AUR65781.1|1029725_1030919_+	phosphoglycerate kinase	NA	NA	NA	NA	NA
AUR65782.1|1030948_1031722_-	short-chain dehydrogenase	NA	NA	NA	NA	NA
AUR65783.1|1031718_1032909_-	acetate kinase	NA	NA	NA	NA	NA
AUR65784.1|1032934_1033873_-	phosphate acetyltransferase	NA	NA	NA	NA	NA
AUR68336.1|1033869_1036218_-	3-hydroxyalkanoate synthetase	NA	NA	NA	NA	NA
AUR65785.1|1036372_1037014_-	glutathione S-transferase	NA	NA	NA	NA	NA
AUR65786.1|1038527_1039076_-	diguanylate cyclase	NA	NA	NA	NA	NA
AUR65787.1|1039094_1039580_-	GNAT family acetyltransferase	NA	NA	NA	NA	NA
AUR65788.1|1039757_1040696_+	cytochrome C biogenesis protein	NA	A0A0P0YMJ9	Yellowstone_lake_phycodnavirus	24.1	5.6e-11
AUR65789.1|1040698_1041016_+	MerR family transcriptional regulator	NA	NA	NA	NA	NA
AUR65790.1|1041061_1042006_+	hypothetical protein	NA	NA	NA	NA	NA
AUR65791.1|1043686_1044337_+	molybdenum cofactor biosynthesis protein MogA	NA	NA	NA	NA	NA
AUR65792.1|1044390_1044726_+	hypothetical protein	NA	NA	NA	NA	NA
AUR68337.1|1044740_1045583_+	peptidase	NA	A0A292GJG6	Xanthomonas_phage	36.1	2.6e-15
AUR65793.1|1045599_1045881_-	hypothetical protein	NA	NA	NA	NA	NA
AUR65794.1|1045954_1046218_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
AUR65795.1|1046461_1047412_+|integrase	integrase	integrase	NA	NA	NA	NA
AUR65796.1|1047710_1048448_-	flagellar biosynthesis sigma factor	NA	NA	NA	NA	NA
AUR65797.1|1048883_1049207_+	transcriptional regulator	NA	NA	NA	NA	NA
AUR65798.1|1049241_1049802_+	transcriptional regulator	NA	NA	NA	NA	NA
AUR65799.1|1049922_1050798_+	flagellar motor protein MotA	NA	NA	NA	NA	NA
AUR65800.1|1050810_1051758_+	flagellar motor protein MotB	NA	NA	NA	NA	NA
AUR65801.1|1051859_1052153_+	chemotaxis protein CheY	NA	NA	NA	NA	NA
AUR65802.1|1052179_1054237_+	chemotaxis protein CheA	NA	NA	NA	NA	NA
AUR65803.1|1054251_1054752_+	chemotaxis protein CheW	NA	NA	NA	NA	NA
AUR65804.1|1054825_1056532_+	chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	41.7	1.4e-12
AUR65805.1|1057395_1058448_+	chemotaxis protein	NA	NA	NA	NA	NA
AUR65806.1|1058500_1058890_+	chemotaxis protein CheY	NA	Q56AR1	Bacillus_thuringiensis_phage	33.3	5.7e-10
AUR65807.1|1058898_1059531_+	chemotaxis protein CheZ	NA	NA	NA	NA	NA
AUR65808.1|1059630_1060647_-|transposase	transposase	transposase	NA	NA	NA	NA
AUR68338.1|1061477_1062485_+	aldo/keto reductase	NA	NA	NA	NA	NA
AUR65809.1|1062481_1064125_-	acyltransferase	NA	NA	NA	NA	NA
AUR65810.1|1064121_1065009_-	magnesium transporter	NA	NA	NA	NA	NA
AUR65811.1|1065149_1065623_-	heat-shock protein	NA	NA	NA	NA	NA
AUR65812.1|1065612_1066635_-	phoH-like protein	NA	A0A0S0MVD6	Pseudomonas_phage	45.4	8.7e-50
1066092:1066111	attL	GCACCAGGCGCTGCACCGTG	NA	NA	NA	NA
AUR65813.1|1066631_1068059_-|tRNA	(dimethylallyl)adenosine tRNA methylthiotransferase	tRNA	NA	NA	NA	NA
AUR65814.1|1068996_1070013_-|transposase	transposase	transposase	NA	NA	NA	NA
AUR65815.1|1070345_1071281_-	preprotein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	35.5	3.0e-41
AUR65816.1|1071330_1073211_-	preprotein translocase subunit SecD	NA	NA	NA	NA	NA
AUR65817.1|1073277_1073622_-	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	40.4	1.0e-10
AUR65818.1|1073766_1074903_-|tRNA	queuine tRNA-ribosyltransferase	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	44.4	1.9e-85
AUR65819.1|1074899_1075973_-|tRNA	S-adenosylmethionine tRNA ribosyltransferase	tRNA	NA	NA	NA	NA
AUR65820.1|1076130_1077567_+	peptidase M15	NA	NA	NA	NA	NA
AUR68339.1|1077657_1078299_+	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
AUR65821.1|1078634_1079651_+|transposase	transposase	transposase	NA	NA	NA	NA
AUR68340.1|1081693_1082644_+|integrase	integrase	integrase	NA	NA	NA	NA
1091722:1091741	attR	CACGGTGCAGCGCCTGGTGC	NA	NA	NA	NA
>prophage 9
CP011245	Bordetella pertussis strain J199, complete genome	4109686	1143620	1218984	4109686	integrase,tRNA,protease	Erysipelothrix_phage(33.33%)	57	1179706:1179765	1219973:1220698
AUR65870.1|1143620_1146851_+|protease	serine protease	protease	NA	NA	NA	NA
AUR65871.1|1147119_1147296_+	hypothetical protein	NA	NA	NA	NA	NA
AUR65872.1|1147619_1151513_+	membrane protein	NA	NA	NA	NA	NA
AUR65873.1|1155208_1156177_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
AUR65874.1|1156246_1157092_+	phosphoesterase	NA	NA	NA	NA	NA
AUR65875.1|1157159_1157714_+	transcription elongation factor GreB	NA	NA	NA	NA	NA
AUR65876.1|1157760_1158630_-|integrase	integrase	integrase	NA	NA	NA	NA
AUR65877.1|1158809_1159433_-	fimbrial protein	NA	NA	NA	NA	NA
AUR65878.1|1159606_1161889_-	malic enzyme	NA	NA	NA	NA	NA
AUR65879.1|1162043_1164740_-	pyruvate dehydrogenase	NA	NA	NA	NA	NA
AUR65880.1|1164865_1165354_+	ArsR family transcriptional regulator	NA	NA	NA	NA	NA
AUR65881.1|1165389_1167252_+	peptide transporter	NA	NA	NA	NA	NA
AUR65882.1|1167230_1167440_+	membrane protein	NA	NA	NA	NA	NA
AUR65883.1|1167764_1170635_+	2-oxoglutarate dehydrogenase	NA	NA	NA	NA	NA
AUR65884.1|1170680_1171895_+	dihydrolipoamide succinyltransferase	NA	NA	NA	NA	NA
AUR65885.1|1172124_1173552_+	dihydrolipoamide dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	28.1	2.1e-41
AUR65886.1|1173649_1174741_+	ATPase	NA	NA	NA	NA	NA
AUR65887.1|1174753_1175512_-	3-oxoacyl-ACP reductase	NA	NA	NA	NA	NA
AUR65888.1|1175599_1176502_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUR65889.1|1176498_1177449_-|integrase	integrase	integrase	NA	NA	NA	NA
AUR65890.1|1177578_1178562_-	LacI family transcriptional regulator	NA	NA	NA	NA	NA
AUR65891.1|1178616_1179339_-	short-chain dehydrogenase	NA	NA	NA	NA	NA
1179706:1179765	attL	TAGCTGTGAAGATTCAATAGGTTGTATGCATGGTTCATCCGAACCGGATTTGAGAAACTG	NA	NA	NA	NA
AUR65892.1|1180817_1182173_+|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
AUR65893.1|1182253_1184629_-	transcription accessory protein	NA	NA	NA	NA	NA
AUR65894.1|1184793_1186869_+	helicase	NA	A0A127AW80	Bacillus_phage	30.0	2.4e-75
AUR68345.1|1186930_1187725_-	competence protein ComL	NA	NA	NA	NA	NA
AUR65895.1|1187832_1188795_+	pseudouridine synthase	NA	NA	NA	NA	NA
AUR65896.1|1188782_1189538_+	hypothetical protein	NA	NA	NA	NA	NA
AUR65897.1|1189645_1191283_+	poly(3-hydroxyalkanoate) polymerase	NA	NA	NA	NA	NA
AUR65898.1|1191350_1192088_+	3-ketoacyl-ACP reductase	NA	NA	NA	NA	NA
AUR65899.1|1192190_1192766_+	polyhydroxyalkanoate synthesis repressor PhaR	NA	NA	NA	NA	NA
AUR65900.1|1192938_1193475_+	membrane protein	NA	NA	NA	NA	NA
AUR68346.1|1193507_1193822_+	periplasmic lipoprotein involved in iron transport	NA	NA	NA	NA	NA
AUR65901.1|1193837_1194683_+	FTR1 family iron permease	NA	NA	NA	NA	NA
AUR65902.1|1194721_1196101_+	membrane protein	NA	NA	NA	NA	NA
AUR65903.1|1196178_1197060_+	phenazine biosynthesis protein PhzC/PhzF	NA	NA	NA	NA	NA
AUR65904.1|1197158_1198109_+|integrase	integrase	integrase	NA	NA	NA	NA
AUR65905.1|1198105_1198516_-	lactoylglutathione lyase	NA	NA	NA	NA	NA
AUR65906.1|1198623_1199478_-	2-pyrone-4,6-dicarboxylate hydrolase	NA	NA	NA	NA	NA
AUR65907.1|1199470_1200433_-	lipoprotein	NA	NA	NA	NA	NA
AUR65908.1|1200478_1201603_-	racemase	NA	Q6A202	Oenococcus_phage	28.3	1.5e-31
AUR65909.1|1201708_1202587_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUR65910.1|1202711_1203491_+	short-chain dehydrogenase	NA	NA	NA	NA	NA
AUR65911.1|1203644_1205066_+	multidrug MFS transporter	NA	NA	NA	NA	NA
AUR65912.1|1205500_1207198_+	sodium:proline symporter	NA	NA	NA	NA	NA
AUR65913.1|1207226_1207349_+	hypothetical protein	NA	NA	NA	NA	NA
AUR68347.1|1207424_1208366_-	peptidase S66	NA	NA	NA	NA	NA
AUR65914.1|1208692_1209439_+	hypothetical protein	NA	NA	NA	NA	NA
AUR65915.1|1209446_1210373_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUR65916.1|1210494_1211412_+	oxidoreductase	NA	NA	NA	NA	NA
AUR65917.1|1211451_1212405_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUR65918.1|1212429_1213008_+	hypothetical protein	NA	NA	NA	NA	NA
AUR65919.1|1214681_1215290_+	hypothetical protein	NA	NA	NA	NA	NA
AUR68348.1|1215367_1215721_-	hypothetical protein	NA	NA	NA	NA	NA
AUR68349.1|1215804_1216737_-	succinylglutamate desuccinylase	NA	NA	NA	NA	NA
AUR65920.1|1217077_1217947_+|integrase	integrase	integrase	NA	NA	NA	NA
AUR65921.1|1218033_1218984_+|integrase	integrase	integrase	NA	NA	NA	NA
1219973:1220698	attR	CAGTTTCTCAAATCCGGTTCGGATGAACCATGCATACAACCTATTGAATCTTCACAGCTAGCGTTCGTGGCGTGTGACGGGGAGCCTGTCCCCGTGGGGACAGGCTCCGGGAGGAAAAAGAAACGGACGCCAGCTTTTGGCCGGCGTCCGTTGGGTTGGAGGGTTGTGCGCCCCTGCCTTGCGTGGCGGCTTGCGCCGCCGTTCCCCTTGGGCTGCTGCTTATTTCTTGCGGGCCGCGATCGATTTCTCGGCCAGGTCGACCAGTTCGGCGCCGATCTGCTTCTTCCACTTTTCATAGACCGGCTTGGTGGCCGCCACGAATTCGGCGTGTTGGCCGGCGTCCAGGCTGCTGACGGTAACGCCGTGGCCGGCGATTTCCTTCAGCAGCGATGGGTCTTCGGGCGTGACGCCCTTGCGGGCGATGACGATCTGCTGCTTGCCGGCGTCCAGCGCGGCCTGGCGGACGATCTCGCGATCCTTCTCGGACCAGGAGTTCCATACCTCGCGGTTGACCACGTAGATCAGCGGGTCGGCGACGTAGTTCCACAGGGTGAGGTACTTCTGGCCCACCGTGTACAGCTTGGAGCCGGTGTAGATAGACAGCGGGTTCTCCTGGCCGTTCACCGCGCCGCTGGCCAGCGCCGGCTGGGCGTCGGCCCAGCTCATCTGCGTGGGGTTGGCGCCCAGCGCCGTGAAGGTGTCGATGTACAGCGGCGAGCCCACGAC	NA	NA	NA	NA
>prophage 10
CP011245	Bordetella pertussis strain J199, complete genome	4109686	1292894	1329660	4109686	integrase	Salmonella_phage(50.0%)	34	1284653:1284669	1332393:1332409
1284653:1284669	attL	ACGCTGGCCGGCACGCT	NA	NA	NA	NA
AUR65975.1|1292894_1293845_+|integrase	integrase	integrase	NA	NA	NA	NA
AUR65976.1|1294466_1296194_-	transporter	NA	NA	NA	NA	NA
AUR65977.1|1296305_1297664_+	mRNA 3'-end processing factor	NA	NA	NA	NA	NA
AUR65978.1|1297956_1298907_+|integrase	integrase	integrase	NA	NA	NA	NA
AUR65979.1|1298947_1300018_+	membrane protein	NA	NA	NA	NA	NA
AUR65980.1|1300040_1300919_-	hypothetical protein	NA	NA	NA	NA	NA
AUR65981.1|1301090_1302062_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AUR65982.1|1302224_1303067_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUR65983.1|1303228_1303909_+	anti-ECFsigma factor ChrR	NA	NA	NA	NA	NA
AUR65984.1|1303902_1305072_+	amine oxidase	NA	NA	NA	NA	NA
AUR65985.1|1305068_1306100_+	alcohol dehydrogenase	NA	A0A2K9L339	Tupanvirus	27.8	1.8e-26
AUR65986.1|1306167_1307385_+	MFS transporter	NA	NA	NA	NA	NA
AUR65987.1|1307419_1308952_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AUR65988.1|1309032_1309656_+	transcriptional regulator	NA	NA	NA	NA	NA
AUR65989.1|1309686_1310298_+	RhtB family transporter	NA	NA	NA	NA	NA
AUR65990.1|1310333_1310804_+	histidine kinase	NA	NA	NA	NA	NA
AUR65991.1|1311235_1312240_+	peptidase M20	NA	NA	NA	NA	NA
AUR65992.1|1312276_1313791_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUR65993.1|1313794_1314754_+	ABC transporter	NA	NA	NA	NA	NA
AUR65994.1|1314731_1315586_+	peptide ABC transporter permease	NA	NA	NA	NA	NA
AUR65995.1|1315587_1317222_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.1	2.9e-15
AUR65996.1|1317305_1318367_+	LacI family transcriptional regulator	NA	NA	NA	NA	NA
AUR65997.1|1318838_1319363_+	DNA-binding protein	NA	J9Q7G7	Salmonella_phage	32.9	6.5e-09
AUR65998.1|1319859_1320729_+|integrase	integrase	integrase	NA	NA	NA	NA
AUR65999.1|1320725_1321760_-	hydrolase	NA	NA	NA	NA	NA
AUR66000.1|1321868_1322507_+	membrane protein	NA	NA	NA	NA	NA
AUR66001.1|1322801_1323029_+	GCN5 family acetyltransferase	NA	NA	NA	NA	NA
AUR66002.1|1323151_1323865_+	methyltransferase type 11	NA	NA	NA	NA	NA
AUR66003.1|1324109_1325060_-|integrase	integrase	integrase	NA	NA	NA	NA
AUR66004.1|1325199_1325445_+	hypothetical protein	NA	NA	NA	NA	NA
AUR66005.1|1325559_1327008_-	2-aminoadipate aminotransferase	NA	NA	NA	NA	NA
AUR66006.1|1327118_1328069_+|integrase	integrase	integrase	NA	NA	NA	NA
AUR66007.1|1328065_1328515_-	deoxyuridine 5'-triphosphate nucleotidohydrolase	NA	S4TNT3	Salmonella_phage	67.2	3.7e-45
AUR66008.1|1328790_1329660_+|integrase	integrase	integrase	NA	NA	NA	NA
1332393:1332409	attR	AGCGTGCCGGCCAGCGT	NA	NA	NA	NA
>prophage 11
CP011245	Bordetella pertussis strain J199, complete genome	4109686	1383563	1438839	4109686	protease,integrase	Enterococcus_phage(16.67%)	49	1432763:1432779	1439381:1439397
AUR66058.1|1383563_1384514_+|integrase	integrase	integrase	NA	NA	NA	NA
AUR66059.1|1384516_1385470_+	hypothetical protein	NA	NA	NA	NA	NA
AUR66060.1|1385497_1386349_+	methenyltetrahydrofolate cyclohydrolase	NA	A0A249XZQ2	Enterococcus_phage	37.6	2.1e-33
AUR66061.1|1386354_1387383_-	lactate dehydrogenase	NA	NA	NA	NA	NA
AUR66062.1|1387379_1388423_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUR66063.1|1388490_1389516_-	peptidase M19	NA	NA	NA	NA	NA
AUR66064.1|1389797_1391051_+	sarcosine oxidase subunit beta	NA	NA	NA	NA	NA
AUR66065.1|1391061_1391334_+	sarcosine oxidase subunit delta	NA	NA	NA	NA	NA
AUR66066.1|1391330_1394270_+	(2Fe-2S)-binding protein	NA	NA	NA	NA	NA
AUR66067.1|1394277_1394877_+	sarcosine oxidase subunit gamma	NA	NA	NA	NA	NA
AUR66068.1|1394877_1395726_+	formyltetrahydrofolate deformylase	NA	NA	NA	NA	NA
AUR66069.1|1395763_1396750_+	hypothetical protein	NA	NA	NA	NA	NA
AUR66070.1|1396765_1398202_+	hypothetical protein	NA	NA	NA	NA	NA
AUR66071.1|1398214_1399006_+	hydrolase	NA	NA	NA	NA	NA
AUR66072.1|1399324_1400380_+	UDP-N-acetylenolpyruvoylglucosamine reductase	NA	NA	NA	NA	NA
AUR66073.1|1400416_1401226_-	4-hydroxy-tetrahydrodipicolinate reductase	NA	NA	NA	NA	NA
AUR66074.1|1401226_1401775_-	membrane protein	NA	NA	NA	NA	NA
AUR68360.1|1401925_1402345_+	Fur family transcriptional regulator	NA	NA	NA	NA	NA
AUR66075.1|1402419_1404081_-	DNA repair protein	NA	NA	NA	NA	NA
AUR66076.1|1404096_1404996_-	inorganic polyphosphate kinase	NA	NA	NA	NA	NA
AUR66077.1|1405110_1406115_+	HrcA family transcriptional regulator	NA	NA	NA	NA	NA
AUR66078.1|1406172_1407261_+	ferrochelatase	NA	NA	NA	NA	NA
AUR68361.1|1407342_1407585_+	hypothetical protein	NA	NA	NA	NA	NA
AUR66079.1|1407726_1408281_+	molecular chaperone GrpE	NA	NA	NA	NA	NA
AUR66080.1|1408288_1408669_+	thioredoxin	NA	NA	NA	NA	NA
AUR66081.1|1408759_1410685_+	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	50.3	1.1e-146
AUR66082.1|1410785_1411919_+	molecular chaperone DnaJ	NA	A0A1V0SBY2	Catovirus	60.8	3.9e-19
AUR66083.1|1412087_1414838_-|protease	zinc protease	protease	A0A2K9LA15	Tupanvirus	28.1	1.5e-19
AUR66084.1|1415170_1415545_+	hypothetical protein	NA	NA	NA	NA	NA
AUR66085.1|1415582_1416125_+	acetyltransferase	NA	NA	NA	NA	NA
AUR66086.1|1416128_1417301_-	von Willebrand factor A	NA	NA	NA	NA	NA
AUR68362.1|1417322_1418210_-	ATP-binding protein	NA	NA	NA	NA	NA
AUR66087.1|1418302_1419253_-|integrase	integrase	integrase	NA	NA	NA	NA
AUR66088.1|1419419_1419773_+	cytochrome C	NA	NA	NA	NA	NA
AUR66089.1|1419785_1420148_+	cytochrome	NA	NA	NA	NA	NA
AUR66090.1|1420189_1420615_-	hypothetical protein	NA	NA	NA	NA	NA
AUR66091.1|1420817_1422074_+	isocitrate dehydrogenase	NA	Q77Z09	Phage_21	64.8	1.2e-11
AUR66092.1|1422293_1423253_+	hypothetical protein	NA	NA	NA	NA	NA
AUR66093.1|1423402_1424644_+	membrane protein	NA	NA	NA	NA	NA
AUR66094.1|1424742_1425693_+|integrase	integrase	integrase	NA	NA	NA	NA
AUR66095.1|1425701_1426397_-	transcriptional regulator	NA	NA	NA	NA	NA
AUR66096.1|1426438_1429153_-	histidine kinase	NA	NA	NA	NA	NA
AUR66097.1|1429218_1429818_-	potassium-transporting ATPase subunit C	NA	NA	NA	NA	NA
AUR66098.1|1429828_1431994_-	potassium-transporting ATPase subunit B	NA	M1HBF8	Paramecium_bursaria_Chlorella_virus	27.1	1.2e-24
AUR66099.1|1432017_1433802_-	ATPase	NA	NA	NA	NA	NA
1432763:1432779	attL	GCTTCGGCCTGGCGCAG	NA	NA	NA	NA
AUR66100.1|1434585_1434858_+	membrane protein	NA	NA	NA	NA	NA
AUR66101.1|1434857_1436924_+	sodium:solute symporter	NA	NA	NA	NA	NA
AUR66102.1|1436920_1437790_-|integrase	integrase	integrase	NA	NA	NA	NA
AUR66103.1|1437969_1438839_-|integrase	integrase	integrase	NA	NA	NA	NA
1439381:1439397	attR	GCTTCGGCCTGGCGCAG	NA	NA	NA	NA
>prophage 12
CP011245	Bordetella pertussis strain J199, complete genome	4109686	1516218	1582383	4109686	integrase	Streptococcus_virus(11.11%)	56	1521812:1521830	1584705:1584723
AUR66181.1|1516218_1517088_+|integrase	integrase	integrase	NA	NA	NA	NA
AUR66182.1|1517094_1518207_-	hypothetical protein	NA	NA	NA	NA	NA
AUR66183.1|1518893_1520096_+	MFS transporter	NA	NA	NA	NA	NA
AUR66184.1|1520299_1522960_+	hypothetical protein	NA	NA	NA	NA	NA
1521812:1521830	attL	CTGCTGCCGCTGGCCGTGC	NA	NA	NA	NA
AUR66185.1|1522972_1526377_+	nuclease	NA	NA	NA	NA	NA
AUR68364.1|1527178_1529269_+	DNA polymerase III subunit gamma/tau	NA	A0A1U9WR94	Streptococcus_virus	38.5	1.1e-43
AUR66186.1|1529315_1529642_+	nucleoid-associated protein	NA	NA	NA	NA	NA
AUR66187.1|1529692_1530301_+	recombination protein RecR	NA	NA	NA	NA	NA
AUR66188.1|1530399_1531350_+|integrase	integrase	integrase	NA	NA	NA	NA
AUR66189.1|1531419_1532184_-	hypothetical protein	NA	NA	NA	NA	NA
AUR68365.1|1532180_1532717_-	hypothetical protein	NA	NA	NA	NA	NA
AUR66190.1|1532883_1533735_-	membrane protein	NA	A0A1I9SA48	Rhodococcus_phage	35.3	7.0e-37
AUR66191.1|1533794_1534421_+	translation factor Sua5	NA	NA	NA	NA	NA
AUR66192.1|1534417_1535287_-|integrase	integrase	integrase	NA	NA	NA	NA
AUR66193.1|1535466_1536579_-	Tat pathway signal protein	NA	NA	NA	NA	NA
AUR66194.1|1536568_1537570_-	aminopeptidase	NA	NA	NA	NA	NA
AUR66195.1|1537675_1539187_-	thiol oxidoreductase	NA	NA	NA	NA	NA
AUR66196.1|1539183_1540488_-	peptidase	NA	NA	NA	NA	NA
AUR68366.1|1540599_1541157_-	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
AUR66197.1|1541427_1541982_+	NADPH-dependent FMN reductase	NA	A0A2P0ZL82	Lactobacillus_phage	32.0	1.7e-15
AUR66198.1|1542437_1542653_-	hypothetical protein	NA	NA	NA	NA	NA
AUR68367.1|1542907_1545505_+	DNA mismatch repair protein MutS	NA	A0A1V0SDQ0	Indivirus	22.6	1.5e-21
AUR66199.1|1545501_1546689_+	cupin	NA	NA	NA	NA	NA
AUR66200.1|1547346_1547961_+	fimbrial protein	NA	NA	NA	NA	NA
AUR66201.1|1548049_1549171_-	lipoprotein	NA	NA	NA	NA	NA
AUR66202.1|1549188_1550094_-	dihydrodipicolinate synthase	NA	NA	NA	NA	NA
AUR66203.1|1551067_1551937_+|integrase	integrase	integrase	NA	NA	NA	NA
AUR66204.1|1552118_1552871_+	glutamine ABC transporter substrate-bindnig protein	NA	NA	NA	NA	NA
AUR66205.1|1552939_1553599_+	glutamine ABC transporter permease	NA	NA	NA	NA	NA
AUR66206.1|1553595_1554324_+	glutamine ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	39.3	3.3e-35
AUR66207.1|1554336_1556616_-	guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	A0A1B1IUF0	uncultured_Mediterranean_phage	32.1	5.9e-06
AUR66208.1|1556640_1556844_-	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
AUR68368.1|1556885_1557491_-	guanylate kinase	NA	U5J9X2	Bacillus_phage	29.6	2.0e-09
AUR66209.1|1557653_1558571_-	cytochrome C	NA	NA	NA	NA	NA
AUR66210.1|1558567_1559281_-	cytochrome C	NA	NA	NA	NA	NA
AUR66211.1|1559518_1560289_+	3-oxoacyl-ACP reductase	NA	NA	NA	NA	NA
AUR66212.1|1560293_1560893_-	NlpC/P60 family protein 2	NA	A0A0A8WF62	Clostridium_phage	41.6	1.4e-20
AUR66213.1|1561137_1562628_+	AMP nucleosidase	NA	NA	NA	NA	NA
AUR66214.1|1562686_1562971_-	DNA-binding protein	NA	NA	NA	NA	NA
AUR66215.1|1562967_1563096_-	hypothetical protein	NA	NA	NA	NA	NA
AUR66216.1|1563108_1563264_-	hypothetical protein	NA	NA	NA	NA	NA
AUR66217.1|1563536_1564463_-	hypothetical protein	NA	NA	NA	NA	NA
AUR66218.1|1564599_1565340_+	ribonuclease PH	NA	NA	NA	NA	NA
AUR66219.1|1565506_1566883_-	2-methylcitrate dehydratase	NA	NA	NA	NA	NA
AUR66220.1|1567064_1567970_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUR66221.1|1569621_1571424_-	diguanylate phosphodiesterase	NA	NA	NA	NA	NA
AUR66222.1|1571550_1572192_+	nucleoside-triphosphate diphosphatase	NA	NA	NA	NA	NA
AUR66223.1|1572290_1573241_+|integrase	integrase	integrase	NA	NA	NA	NA
AUR66224.1|1573262_1574483_+	coproporphyrinogen III oxidase	NA	NA	NA	NA	NA
AUR66225.1|1574668_1576081_+	glutamine synthetase	NA	NA	NA	NA	NA
AUR66226.1|1576144_1577212_+	histidine kinase	NA	Q8QKV7	Ectocarpus_siliculosus_virus	23.5	1.1e-05
AUR66227.1|1577211_1578699_+	chemotaxis protein CheY	NA	NA	NA	NA	NA
AUR68369.1|1578708_1579653_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUR66228.1|1579812_1580511_+	quercetin 2,3-dioxygenase	NA	NA	NA	NA	NA
AUR66229.1|1580588_1581494_+	pirin	NA	NA	NA	NA	NA
AUR66230.1|1581513_1582383_-|integrase	integrase	integrase	NA	NA	NA	NA
1584705:1584723	attR	GCACGGCCAGCGGCAGCAG	NA	NA	NA	NA
>prophage 13
CP011245	Bordetella pertussis strain J199, complete genome	4109686	1618413	1674004	4109686	integrase	Brazilian_cedratvirus(25.0%)	50	1630898:1630915	1674488:1674505
AUR66254.1|1618413_1619364_+|integrase	integrase	integrase	NA	NA	NA	NA
AUR66255.1|1619422_1620196_+	short-chain dehydrogenase	NA	NA	NA	NA	NA
AUR66256.1|1620188_1621745_+	capsular biosynthesis protein	NA	NA	NA	NA	NA
AUR66257.1|1621741_1622692_-|integrase	integrase	integrase	NA	NA	NA	NA
AUR66258.1|1624018_1624621_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
AUR66259.1|1624860_1625562_-	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
AUR66260.1|1625555_1626338_-	leucine/isoleucine/valine transporter ATP-binding subunit	NA	A0A2R8FG22	Brazilian_cedratvirus	25.8	2.0e-09
AUR66261.1|1626522_1627473_-|integrase	integrase	integrase	NA	NA	NA	NA
AUR66262.1|1627571_1628309_-	membrane protein	NA	A0A0S4KZH7	Pseudomonas_phage	46.6	4.1e-41
AUR66263.1|1628498_1629257_-	short-chain dehydrogenase	NA	NA	NA	NA	NA
AUR66264.1|1629303_1630305_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUR66265.1|1630470_1631439_-	phenol degradation protein meta	NA	NA	NA	NA	NA
1630898:1630915	attL	TTGGCCAGCGCGTCGGCG	NA	NA	NA	NA
AUR66266.1|1632978_1633947_+	ATPase AAA	NA	NA	NA	NA	NA
AUR66267.1|1633955_1634897_+	MoxR protein	NA	NA	NA	NA	NA
AUR68372.1|1635370_1636381_+	membrane protein	NA	NA	NA	NA	NA
AUR68373.1|1636371_1637886_+	hypothetical protein	NA	NA	NA	NA	NA
AUR66268.1|1637882_1639229_+	hypothetical protein	NA	NA	NA	NA	NA
AUR68374.1|1639231_1640266_+	haloacid dehalogenase	NA	NA	NA	NA	NA
AUR66269.1|1640315_1641941_+	arylsulfatase	NA	A0A2P0VMN7	Tetraselmis_virus	52.2	2.0e-149
AUR66270.1|1642034_1642514_+	hypothetical protein	NA	NA	NA	NA	NA
AUR66271.1|1642493_1643363_-|integrase	integrase	integrase	NA	NA	NA	NA
AUR66272.1|1643548_1644496_+	hypothetical protein	NA	NA	NA	NA	NA
AUR68375.1|1644549_1646364_-	histidine kinase	NA	NA	NA	NA	NA
AUR66273.1|1646356_1647031_-	LuxR family transcriptional regulator	NA	NA	NA	NA	NA
AUR66274.1|1647160_1650235_+	autotransporter	NA	NA	NA	NA	NA
AUR66275.1|1650248_1650548_-	DNA-binding protein	NA	NA	NA	NA	NA
AUR66276.1|1650862_1651486_-	glutathione S-transferase	NA	NA	NA	NA	NA
AUR66277.1|1651729_1652599_+	alpha-ketoglutarate-dependent 2,4-dichlorophenoxyacetate dioxygenase	NA	NA	NA	NA	NA
AUR68376.1|1652576_1653389_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUR66278.1|1653606_1654533_-	hypothetical protein	NA	NA	NA	NA	NA
AUR66279.1|1654645_1655425_-	short-chain dehydrogenase	NA	NA	NA	NA	NA
AUR66280.1|1655415_1656612_-	lactate dehydrogenase	NA	NA	NA	NA	NA
AUR66281.1|1656642_1657593_-	hydrolase	NA	NA	NA	NA	NA
AUR66282.1|1657814_1658504_+	short-chain dehydrogenase	NA	NA	NA	NA	NA
AUR66283.1|1658568_1659324_+	3-oxoacyl-ACP reductase	NA	NA	NA	NA	NA
AUR66284.1|1659375_1660368_+	MFS transporter	NA	NA	NA	NA	NA
AUR66285.1|1660377_1661331_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUR68377.1|1661446_1662409_+	hypothetical protein	NA	NA	NA	NA	NA
AUR66286.1|1663810_1664239_+	hypothetical protein	NA	NA	NA	NA	NA
AUR66287.1|1664235_1665186_-|integrase	integrase	integrase	NA	NA	NA	NA
AUR66288.1|1665291_1665483_+	hypothetical protein	NA	NA	NA	NA	NA
AUR66289.1|1665479_1666202_-	NADPH-dependent FMN reductase	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	68.2	1.3e-87
AUR66290.1|1666640_1667828_-	membrane protein	NA	NA	NA	NA	NA
AUR68378.1|1667831_1668182_-	ArsR family transcriptional regulator	NA	NA	NA	NA	NA
AUR66291.1|1668415_1669828_-	hypothetical protein	NA	NA	NA	NA	NA
AUR66292.1|1669931_1670903_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUR66293.1|1670916_1671630_+	short-chain dehydrogenase	NA	NA	NA	NA	NA
AUR66294.1|1671634_1672552_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUR66295.1|1672658_1672955_+	membrane protein	NA	NA	NA	NA	NA
AUR66296.1|1673053_1674004_+|integrase	integrase	integrase	NA	NA	NA	NA
1674488:1674505	attR	TTGGCCAGCGCGTCGGCG	NA	NA	NA	NA
>prophage 14
CP011245	Bordetella pertussis strain J199, complete genome	4109686	1862589	1922269	4109686	tRNA,integrase	Klosneuvirus(30.0%)	57	1870006:1870065	1922298:1922385
AUR66435.1|1862589_1865214_+|tRNA	alanyl-tRNA synthetase	tRNA	A0A1V0SK38	Klosneuvirus	39.4	1.7e-81
AUR66436.1|1865200_1865455_+	hypothetical protein	NA	NA	NA	NA	NA
AUR66437.1|1865521_1866103_-	hypothetical protein	NA	NA	NA	NA	NA
AUR66438.1|1866406_1866667_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
AUR66439.1|1866832_1867456_+	16S rRNA processing protein RimM	NA	NA	NA	NA	NA
AUR66440.1|1867455_1868229_+|tRNA	tRNA (guanine-N1)-methyltransferase	tRNA	NA	NA	NA	NA
AUR66441.1|1868225_1869434_-	class V aminotransferase	NA	NA	NA	NA	NA
AUR66442.1|1869459_1869933_-	endoribonuclease	NA	NA	NA	NA	NA
1870006:1870065	attL	GCTAGCTGTGAACTGTCAATAGGTTGTATTCGTCCAGGTTGAGTCTGGAGATGGGTACAG	NA	NA	NA	NA
AUR66443.1|1870006_1870957_-|integrase	integrase	integrase	NA	NA	NA	NA
AUR66444.1|1871055_1871925_-|integrase	integrase	integrase	NA	NA	NA	NA
AUR66445.1|1872104_1873454_-	histidine kinase	NA	NA	NA	NA	NA
AUR66446.1|1874219_1874975_+	membrane protein	NA	NA	NA	NA	NA
AUR66447.1|1875067_1877950_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	37.1	3.7e-138
AUR66448.1|1878272_1878698_+	nucleoside diphosphate kinase	NA	D2E8E1	Anguillid_herpesvirus	43.2	2.1e-21
AUR66449.1|1878725_1879874_+	50S rRNA methyltransferase	NA	NA	NA	NA	NA
AUR66450.1|1879870_1880377_+	membrane protein	NA	NA	NA	NA	NA
AUR66451.1|1880392_1881679_+	4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase	NA	NA	NA	NA	NA
AUR66452.1|1881728_1883024_+|tRNA	histidine--tRNA ligase	tRNA	NA	NA	NA	NA
AUR66453.1|1883025_1883664_+	membrane protein	NA	NA	NA	NA	NA
AUR68393.1|1883669_1884827_+	quinoprotein	NA	NA	NA	NA	NA
AUR66454.1|1884853_1886209_+	GTP-binding protein Der	NA	NA	NA	NA	NA
AUR66455.1|1886212_1887283_+	histidinol-phosphate aminotransferase	NA	A0A1X6WGT4	Pacmanvirus	25.7	2.5e-15
AUR66456.1|1887421_1887658_+	RNA-binding protein Hfq	NA	NA	NA	NA	NA
AUR66457.1|1887745_1888852_+	GTP-binding protein HflX	NA	NA	NA	NA	NA
AUR66458.1|1888817_1890122_+	membrane protein	NA	NA	NA	NA	NA
AUR66459.1|1890140_1891040_+	membrane protein	NA	NA	NA	NA	NA
AUR66460.1|1891223_1892381_+	ATP phosphoribosyltransferase regulatory subunit	NA	NA	NA	NA	NA
AUR66461.1|1892457_1893753_+	adenylosuccinate synthetase	NA	A0A160ER07	Powai_lake_megavirus	33.5	3.0e-63
AUR66462.1|1893866_1894406_+	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
AUR66463.1|1894683_1894896_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
AUR66464.1|1894915_1896946_+	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	41.9	1.0e-65
AUR66465.1|1897631_1899914_+	RNA polymerase sigma factor 70	NA	A0A2I7SAT0	Vibrio_phage	30.1	3.2e-36
AUR66466.1|1900323_1900623_-	hypothetical protein	NA	NA	NA	NA	NA
AUR66467.1|1900907_1901321_+	transcriptional regulator	NA	A0A222YXG1	Escherichia_phage	59.0	3.8e-36
AUR66468.1|1901280_1902231_-|integrase	integrase	integrase	NA	NA	NA	NA
AUR66469.1|1902329_1903280_-|integrase	integrase	integrase	NA	NA	NA	NA
AUR68394.1|1903482_1904565_+	membrane protein	NA	NA	NA	NA	NA
AUR66470.1|1904580_1905342_-	sugar ABC transporter permease	NA	NA	NA	NA	NA
AUR66471.1|1905338_1906262_-	multidrug ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	33.6	1.6e-23
AUR68395.1|1906360_1906861_-	GCN5 family acetyltransferase	NA	NA	NA	NA	NA
AUR66472.1|1906893_1907637_-	permease	NA	NA	NA	NA	NA
AUR66473.1|1907732_1907972_-	membrane protein	NA	NA	NA	NA	NA
AUR66474.1|1907985_1908138_-	hypothetical protein	NA	NA	NA	NA	NA
AUR66475.1|1908223_1909714_-	cytochrome C oxidase	NA	NA	NA	NA	NA
AUR66476.1|1909805_1910744_-	cytochrome oxidase subunit III	NA	NA	NA	NA	NA
AUR66477.1|1910740_1910917_-	cytochrome oxidase	NA	NA	NA	NA	NA
AUR66478.1|1910919_1911582_-	peptidase S41	NA	NA	NA	NA	NA
AUR68396.1|1913203_1913347_-	membrane protein	NA	NA	NA	NA	NA
AUR66479.1|1913343_1914318_-	membrane protein	NA	NA	NA	NA	NA
AUR66480.1|1914565_1915435_+|integrase	integrase	integrase	NA	NA	NA	NA
AUR66481.1|1915431_1916706_-	adenosylmethionine-8-amino-7-oxononanoate aminotransferase	NA	A0A1V0SKB7	Klosneuvirus	28.9	9.6e-14
AUR66482.1|1916809_1918003_+	8-amino-7-oxononanoate synthase	NA	NA	NA	NA	NA
AUR66483.1|1917999_1918653_+	biotin synthase	NA	NA	NA	NA	NA
AUR66484.1|1918649_1920086_+	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
AUR66485.1|1920073_1920433_+	murein hydrolase transporter LrgA	NA	NA	NA	NA	NA
AUR66486.1|1920518_1921169_+	membrane protein	NA	NA	NA	NA	NA
AUR66487.1|1921405_1922269_+|integrase	integrase	integrase	NA	NA	NA	NA
1922298:1922385	attR	CTGTACCCATCTCCAGACTCAACCTGGACGAATACAACCTATTGACAGTTCACAGCTAGCCGCGCTGGCGCGCCAGGTGGCGGTACAG	NA	NA	NA	NA
>prophage 15
CP011245	Bordetella pertussis strain J199, complete genome	4109686	1942000	1976450	4109686	transposase,integrase	Mycobacterium_phage(33.33%)	35	1964824:1964844	1976857:1976877
AUR66504.1|1942000_1942951_-|integrase	integrase	integrase	NA	NA	NA	NA
AUR68400.1|1943049_1943529_-	acetyltransferase	NA	NA	NA	NA	NA
AUR66505.1|1943684_1944554_+|integrase	integrase	integrase	NA	NA	NA	NA
AUR66506.1|1944572_1944920_-	aldehyde-activating protein	NA	NA	NA	NA	NA
AUR66507.1|1944948_1946388_-	DSBA oxidoreductase	NA	A0A0M3UL24	Mycobacterium_phage	37.4	7.4e-55
AUR66508.1|1946406_1946802_-	3-demethylubiquinone-9 3-methyltransferase	NA	NA	NA	NA	NA
AUR66509.1|1946976_1947585_+	peptidase S16	NA	NA	NA	NA	NA
AUR66510.1|1947597_1948416_+	hypothetical protein	NA	A0A1B1INV8	uncultured_Mediterranean_phage	28.8	2.3e-16
AUR66511.1|1948367_1949342_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AUR66512.1|1949370_1950417_-	lipoprotein	NA	NA	NA	NA	NA
AUR66513.1|1950428_1952645_-	aldehyde oxidase	NA	NA	NA	NA	NA
AUR66514.1|1952658_1953117_-	(2Fe-2S)-binding protein	NA	NA	NA	NA	NA
AUR66515.1|1953274_1953619_-	lipoprotein	NA	NA	NA	NA	NA
AUR66516.1|1953775_1954681_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUR68401.1|1954767_1955781_+	pyridoxamine 5'-phosphate oxidase	NA	NA	NA	NA	NA
AUR66517.1|1957760_1958777_+|transposase	transposase	transposase	NA	NA	NA	NA
AUR66518.1|1958919_1960272_-	glutathione reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.6	2.9e-45
AUR66519.1|1960446_1960743_+	MFS transporter	NA	NA	NA	NA	NA
AUR66520.1|1960922_1961894_+|integrase	integrase	integrase	NA	NA	NA	NA
AUR66521.1|1961961_1962831_+|integrase	integrase	integrase	NA	NA	NA	NA
AUR66522.1|1963464_1964103_+	hypothetical protein	NA	NA	NA	NA	NA
AUR66523.1|1964177_1965149_+	hypothetical protein	NA	NA	NA	NA	NA
1964824:1964844	attL	GCAAGCTGCGCGCGCTGGCGG	NA	NA	NA	NA
AUR66524.1|1965152_1966007_+	polysaccharide deacetylase	NA	NA	NA	NA	NA
AUR66525.1|1966025_1966847_+	hydrolase	NA	NA	NA	NA	NA
AUR66526.1|1966878_1967673_+	hypothetical protein	NA	NA	NA	NA	NA
AUR66527.1|1967751_1968327_+	hypothetical protein	NA	NA	NA	NA	NA
AUR68402.1|1968323_1969118_+	oxidoreductase	NA	NA	NA	NA	NA
AUR66528.1|1969403_1970909_-	microcystin degradation protein MlrC	NA	NA	NA	NA	NA
AUR66529.1|1970950_1971733_-	exodeoxyribonuclease III	NA	NA	NA	NA	NA
AUR66530.1|1971802_1972249_-	membrane protein	NA	NA	NA	NA	NA
AUR66531.1|1972245_1973472_-	NnrS family protein	NA	NA	NA	NA	NA
AUR66532.1|1973464_1973869_-	preprotein translocase subunit TatC	NA	NA	NA	NA	NA
AUR66533.1|1974028_1974331_+	SelT/selW/selH domain protein	NA	NA	NA	NA	NA
AUR66534.1|1974327_1975197_-|integrase	integrase	integrase	NA	NA	NA	NA
AUR66535.1|1975499_1976450_-|integrase	integrase	integrase	NA	NA	NA	NA
1976857:1976877	attR	CCGCCAGCGCGCGCAGCTTGC	NA	NA	NA	NA
>prophage 16
CP011245	Bordetella pertussis strain J199, complete genome	4109686	2148068	2212926	4109686	integrase,tRNA,transposase,protease	Lake_Baikal_phage(13.33%)	56	2194921:2194940	2211654:2211673
AUR66663.1|2148068_2149373_-|protease	Clp protease ATP-binding protein	protease	G3M9Z9	Bacillus_virus	53.8	3.2e-129
AUR66664.1|2149477_2150131_-|protease	Clp protease ClpP	protease	A0A223W000	Agrobacterium_phage	57.5	6.8e-56
AUR66665.1|2150133_2151444_-	trigger factor	NA	NA	NA	NA	NA
AUR66666.1|2151640_2152201_+	hypothetical protein	NA	K4K6D8	Caulobacter_phage	33.7	1.0e-23
AUR66667.1|2152312_2152513_-	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.4	7.4e-14
AUR66668.1|2152858_2153425_-	hypothetical protein	NA	NA	NA	NA	NA
AUR66669.1|2153508_2153712_-	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	62.1	1.6e-16
AUR66670.1|2154018_2154339_-	hypothetical protein	NA	NA	NA	NA	NA
AUR66671.1|2154380_2154662_-	hypothetical protein	NA	NA	NA	NA	NA
AUR66672.1|2154736_2155993_-	autotransporter	NA	NA	NA	NA	NA
AUR66673.1|2156375_2156705_+	hypothetical protein	NA	NA	NA	NA	NA
AUR66674.1|2158275_2159097_+	2,3,4,5-tetrahydropyridine-2,6-carboxylate N-succinyltransferase	NA	NA	NA	NA	NA
AUR66675.1|2159096_2160236_+	succinyl-diaminopimelate desuccinylase	NA	NA	NA	NA	NA
AUR66676.1|2160242_2161139_+	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AUR66677.1|2161153_2163061_+	ABC transporter	NA	A0A2K9L0W2	Tupanvirus	31.8	1.1e-66
AUR66678.1|2163420_2166033_+	TonB-dependent receptor	NA	NA	NA	NA	NA
AUR66679.1|2166085_2168386_-	DNA helicase	NA	A7KV33	Bacillus_phage	35.9	9.9e-110
AUR66680.1|2168382_2169591_-	aminotransferase	NA	NA	NA	NA	NA
AUR66681.1|2169852_2170227_+	hypothetical protein	NA	NA	NA	NA	NA
AUR66682.1|2170223_2171093_-|integrase	integrase	integrase	NA	NA	NA	NA
AUR68414.1|2171272_2172670_-	rRNA methyltransferase	NA	NA	NA	NA	NA
AUR66683.1|2173326_2174292_+	riboflavin kinase	NA	NA	NA	NA	NA
AUR66684.1|2174281_2177143_+|tRNA	isoleucine--tRNA ligase	tRNA	A0A1V0SJ93	Klosneuvirus	25.5	1.0e-71
AUR66685.1|2177145_2177652_+	peptidase A8	NA	NA	NA	NA	NA
AUR66686.1|2177756_2178965_+	phosphopantothenate synthase	NA	Q9HH70	Methanothermobacter_phage	30.0	3.8e-36
AUR66687.1|2178966_2179905_-	membrane protein	NA	NA	NA	NA	NA
AUR66688.1|2180066_2180540_+	AsnC family transcriptional regulator	NA	NA	NA	NA	NA
AUR66689.1|2180536_2181487_-|integrase	integrase	integrase	NA	NA	NA	NA
AUR66690.1|2181597_2182038_-	hypothetical protein	NA	NA	NA	NA	NA
AUR66691.1|2182166_2183396_-	lytic transglycosylase	NA	NA	NA	NA	NA
AUR66692.1|2183434_2184256_-	hypothetical protein	NA	NA	NA	NA	NA
AUR68415.1|2184309_2185461_+	hypothetical protein	NA	NA	NA	NA	NA
AUR66693.1|2185552_2186023_-	hypothetical protein	NA	NA	NA	NA	NA
AUR66694.1|2188591_2191141_+	cyanophycin synthetase	NA	NA	NA	NA	NA
AUR66695.1|2191211_2193785_+	cyanophycin synthetase	NA	NA	NA	NA	NA
AUR66696.1|2194050_2194251_+	general stress protein CsbD	NA	NA	NA	NA	NA
AUR66697.1|2194282_2194444_+	membrane protein	NA	NA	NA	NA	NA
AUR66698.1|2194501_2194840_+	phospholipid-binding protein	NA	NA	NA	NA	NA
2194921:2194940	attL	GCCTGTCCCGGCGGGGACAG	NA	NA	NA	NA
AUR66699.1|2194988_2195858_-|integrase	integrase	integrase	NA	NA	NA	NA
AUR66700.1|2196713_2197382_+	GDSL family lipase	NA	NA	NA	NA	NA
AUR68416.1|2197363_2199319_-	peptidylprolyl isomerase	NA	NA	NA	NA	NA
AUR66701.1|2199561_2200311_+	membrane protein	NA	A0A2H4PGQ5	Escherichia_phage	27.8	1.5e-14
AUR66702.1|2200323_2201187_+	competence protein ComJ	NA	NA	NA	NA	NA
AUR66703.1|2201190_2202606_-	dihydrolipoamide dehydrogenase	NA	NA	NA	NA	NA
AUR66704.1|2202739_2203468_-	glutathione peroxidase	NA	A0A1D8KSL1	Synechococcus_phage	56.8	9.6e-43
AUR66705.1|2203606_2203807_-	heavy metal transporter	NA	NA	NA	NA	NA
AUR66706.1|2203982_2204381_+	MerR family transcriptional regulator	NA	NA	NA	NA	NA
AUR66707.1|2204404_2205805_-	23S rRNA methyltransferase	NA	A0A2K5B251	Erysipelothrix_phage	26.5	7.3e-31
AUR66708.1|2205923_2206676_-	hypothetical protein	NA	NA	NA	NA	NA
AUR66709.1|2206964_2207564_-	hypothetical protein	NA	NA	NA	NA	NA
AUR66710.1|2207668_2208448_-	3'-5' exonuclease	NA	NA	NA	NA	NA
AUR66711.1|2208444_2209329_-	peptidase	NA	A0A292GJG6	Xanthomonas_phage	49.5	4.6e-15
AUR66712.1|2209346_2210126_-	protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	46.9	4.8e-32
AUR66713.1|2210110_2210869_-	stationary phase survival protein SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	51.2	1.4e-68
AUR68417.1|2211006_2211642_+	glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
AUR66714.1|2211909_2212926_+|transposase	transposase	transposase	NA	NA	NA	NA
2211654:2211673	attR	GCCTGTCCCGGCGGGGACAG	NA	NA	NA	NA
>prophage 17
CP011245	Bordetella pertussis strain J199, complete genome	4109686	2217876	2276787	4109686	integrase	Klosneuvirus(33.33%)	58	2228546:2228605	2276913:2277097
AUR66719.1|2217876_2218746_-|integrase	integrase	integrase	NA	NA	NA	NA
AUR66720.1|2218925_2219876_-|integrase	integrase	integrase	NA	NA	NA	NA
AUR66721.1|2219974_2220535_-	L-2,4-diaminobutyric acid acetyltransferase	NA	NA	NA	NA	NA
AUR66722.1|2220531_2221077_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
AUR66723.1|2221272_2222301_+	silent information regulator protein Sir2	NA	NA	NA	NA	NA
AUR66724.1|2222341_2223682_+	hypothetical protein	NA	A0A1V0SKB7	Klosneuvirus	22.8	8.8e-18
AUR66725.1|2223790_2224795_+	C4-dicarboxylate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUR66726.1|2224901_2227502_+	C4-dicarboxylate ABC transporter	NA	NA	NA	NA	NA
AUR66727.1|2227681_2228551_+|integrase	integrase	integrase	NA	NA	NA	NA
2228546:2228605	attL	AGCTAGCTGTGAAGATTCAATAGGTTGTATGCATGGTTCATCCGAACCGGATTTGAGAAA	NA	NA	NA	NA
AUR66728.1|2228730_2229600_+|integrase	integrase	integrase	NA	NA	NA	NA
AUR66729.1|2229596_2229869_-	hypothetical protein	NA	NA	NA	NA	NA
AUR68418.1|2230127_2232839_-	autotransporter	NA	NA	NA	NA	NA
AUR68419.1|2233493_2234951_+	cardiolipin synthetase	NA	NA	NA	NA	NA
AUR66730.1|2234947_2235298_-	anti-sigma factor antagonist	NA	NA	NA	NA	NA
AUR66731.1|2235441_2235870_+	serine/threonine protein kinase	NA	NA	NA	NA	NA
AUR66732.1|2235953_2237117_+	alanine racemase	NA	NA	NA	NA	NA
AUR66733.1|2237113_2239555_-	MFS transporter	NA	NA	NA	NA	NA
AUR66734.1|2239639_2241661_+	regulator	NA	NA	NA	NA	NA
AUR66735.1|2241657_2242845_+	hypothetical protein	NA	NA	NA	NA	NA
AUR68420.1|2244408_2245107_+	hypothetical protein	NA	NA	NA	NA	NA
AUR66736.1|2245281_2245884_+	RNA polymerase sigma factor	NA	NA	NA	NA	NA
AUR66737.1|2245904_2247707_-	type III secretion protein	NA	NA	NA	NA	NA
AUR66738.1|2247697_2248096_-	hypothetical protein	NA	NA	NA	NA	NA
AUR66739.1|2248092_2249142_-	type III secretion protein	NA	NA	NA	NA	NA
AUR66740.1|2249138_2249939_-	type III secretion system protein	NA	NA	NA	NA	NA
AUR68421.1|2249950_2250217_-	type III secretion protein HrpO	NA	NA	NA	NA	NA
AUR66741.1|2250222_2250894_-	type III secretion system protein SsaR	NA	NA	NA	NA	NA
AUR68422.1|2250890_2251970_-	type III secretion system protein	NA	NA	NA	NA	NA
AUR66742.1|2251966_2252515_-	hypothetical protein	NA	NA	NA	NA	NA
AUR66743.1|2252511_2253021_-	type III secretion protein	NA	NA	NA	NA	NA
AUR66744.1|2253020_2254355_-	ATP synthase	NA	NA	NA	NA	NA
AUR68423.1|2254359_2254923_-	type III secretion system protein	NA	NA	NA	NA	NA
AUR66745.1|2254967_2255630_-	hypothetical protein	NA	NA	NA	NA	NA
AUR66746.1|2255622_2256447_-	type III secretion system protein	NA	NA	NA	NA	NA
AUR66747.1|2256443_2256851_-	type III secretion protein	NA	NA	NA	NA	NA
AUR66748.1|2256847_2257369_-	hypothetical protein	NA	NA	NA	NA	NA
AUR66749.1|2257373_2257835_-	regulatory protein	NA	NA	NA	NA	NA
AUR66750.1|2257858_2259061_-	membrane protein	NA	NA	NA	NA	NA
AUR66751.1|2259090_2260032_-	membrane protein	NA	NA	NA	NA	NA
AUR66752.1|2260079_2260565_-	regulatory protein	NA	NA	NA	NA	NA
AUR66753.1|2260580_2260856_-	hypothetical protein	NA	NA	NA	NA	NA
AUR66754.1|2260877_2261495_-	hypothetical protein	NA	NA	NA	NA	NA
AUR66755.1|2261658_2262756_+	membrane protein	NA	NA	NA	NA	NA
AUR66756.1|2262752_2263130_+	hypothetical protein	NA	NA	NA	NA	NA
AUR66757.1|2263134_2263545_+	hypothetical protein	NA	NA	NA	NA	NA
AUR66758.1|2263541_2263910_+	hypothetical protein	NA	NA	NA	NA	NA
AUR68424.1|2263906_2266006_+	Low calcium response locus protein D	NA	NA	NA	NA	NA
AUR66759.1|2266002_2267283_+	type III secretion protein	NA	NA	NA	NA	NA
AUR66760.1|2267323_2267623_+	hypothetical protein	NA	NA	NA	NA	NA
AUR66761.1|2267612_2267879_+	type III secretion protein	NA	NA	NA	NA	NA
AUR66762.1|2267914_2268370_-	hypothetical protein	NA	NA	NA	NA	NA
AUR66763.1|2268713_2269664_+|integrase	integrase	integrase	NA	NA	NA	NA
AUR66764.1|2269965_2270442_-	transcription elongation factor GreA	NA	NA	NA	NA	NA
AUR66765.1|2271065_2272703_+	chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	30.2	8.8e-12
AUR66766.1|2272733_2274047_-	uracil transporter	NA	Q9KX94	Enterobacteria_phage	67.1	2.1e-149
AUR68425.1|2274207_2274498_+	hypothetical protein	NA	NA	NA	NA	NA
AUR66767.1|2274598_2275921_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUR66768.1|2275917_2276787_-|integrase	integrase	integrase	NA	NA	NA	NA
2276913:2277097	attR	TTTCTCAAATCCGGTTCGGATGAACCATGCATACAACCTATTGAATCTTCACAGCTAGCTCGCGGCCCGACAACAGTTCGGCGCGGTACCCTTCGGCCTGCAGGCGCGCGGCGGCGAACTCCTCCAGCACGTCCTGCTCCAGGGCGCTGCGCGCCAGCACCAGGCTGCCGTTGGCGCGCACATGG	NA	NA	NA	NA
>prophage 18
CP011245	Bordetella pertussis strain J199, complete genome	4109686	2577834	2644253	4109686	transposase,integrase	uncultured_Caudovirales_phage(40.0%)	58	2573929:2573947	2648099:2648117
2573929:2573947	attL	GCGCCGCCTGGCGCCGCTG	NA	NA	NA	NA
AUR67013.1|2577834_2578704_+|integrase	integrase	integrase	NA	NA	NA	NA
AUR67014.1|2578719_2578932_+	hypothetical protein	NA	NA	NA	NA	NA
AUR67015.1|2579073_2579646_+	flagellar basal body protein FliL	NA	NA	NA	NA	NA
AUR67016.1|2579648_2580659_+	flagellar motor switch protein FliM	NA	NA	NA	NA	NA
AUR67017.1|2580651_2581152_+	flagellar motor switch protein FliN	NA	NA	NA	NA	NA
AUR67018.1|2581162_2581504_+	flagellar assembly protein FliO	NA	NA	NA	NA	NA
AUR68445.1|2581572_2582307_+	flagellar biosynthesis protein flip	NA	NA	NA	NA	NA
AUR67019.1|2582323_2582593_+	flagellar biosynthetic protein FliQ	NA	NA	NA	NA	NA
AUR67020.1|2582615_2583404_+	flagellar biosynthesis protein FliR	NA	NA	NA	NA	NA
AUR67021.1|2583450_2584467_-|transposase	transposase	transposase	NA	NA	NA	NA
AUR67022.1|2584683_2586126_-	chemotaxis protein	NA	A0A1B0V854	Salmonella_phage	41.8	1.0e-35
AUR67023.1|2586304_2587924_-	chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	45.3	1.5e-08
AUR67024.1|2588044_2589865_-	chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	52.6	6.4e-11
AUR67025.1|2589943_2591476_-	flagellar hook protein FlgL	NA	NA	NA	NA	NA
AUR67026.1|2591509_2593156_-	flagellar hook protein FlgK	NA	NA	NA	NA	NA
AUR67027.1|2593225_2594248_-	flagellar rod assembly protein FlgJ	NA	A0A088F6W1	Sulfitobacter_phage	31.4	1.9e-12
AUR67028.1|2594265_2595399_-	flagellar P-ring protein FlgI	NA	NA	NA	NA	NA
AUR67029.1|2595401_2596091_-	flagellar L-ring protein FlgH	NA	NA	NA	NA	NA
AUR67030.1|2596090_2596876_-	flagellar basal body rod protein FlgG	NA	NA	NA	NA	NA
AUR67031.1|2596919_2597684_-	flagellar basal body rod protein FlgF	NA	NA	NA	NA	NA
AUR67032.1|2597722_2599144_-	flagellar hook protein FlgE	NA	NA	NA	NA	NA
AUR67033.1|2599209_2599914_-	flagellar basal body rod modification protein	NA	NA	NA	NA	NA
AUR67034.1|2599961_2600381_-	flagellar basal body rod protein FlgC	NA	NA	NA	NA	NA
AUR67035.1|2600393_2600801_-	flagellar basal-body rod protein FlgB	NA	NA	NA	NA	NA
AUR68446.1|2600984_2601695_+	flagellar basal body P-ring biosynthesis protein FlgA	NA	NA	NA	NA	NA
AUR67036.1|2601821_2602112_+	flagellar biosynthesis anti-sigma factor FlgM	NA	NA	NA	NA	NA
AUR67037.1|2602129_2602612_+	hypothetical protein	NA	NA	NA	NA	NA
AUR67038.1|2607117_2608272_-	flagellar biosynthesis protein FlhB	NA	NA	NA	NA	NA
AUR67039.1|2608577_2609594_+|transposase	transposase	transposase	NA	NA	NA	NA
AUR67040.1|2609840_2610629_+	amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUR67041.1|2610695_2611376_+	cysteine ABC transporter permease	NA	NA	NA	NA	NA
AUR67042.1|2611372_2612143_+	ATP-binding protein	NA	G9BWD6	Planktothrix_phage	39.1	9.8e-30
AUR67043.1|2612241_2613192_+|integrase	integrase	integrase	NA	NA	NA	NA
AUR67044.1|2613247_2614165_-	2-dehydropantoate 2-reductase	NA	NA	NA	NA	NA
AUR67045.1|2614175_2615354_-	mandelate racemase	NA	NA	NA	NA	NA
AUR67046.1|2615373_2616369_-	hypothetical protein	NA	NA	NA	NA	NA
AUR67047.1|2617957_2618566_+	isopropylmalate isomerase	NA	NA	NA	NA	NA
AUR67048.1|2618553_2619594_+	LacI family transcriptional regulator	NA	NA	NA	NA	NA
AUR67049.1|2619611_2620574_-	hypothetical protein	NA	NA	NA	NA	NA
AUR67050.1|2620570_2621764_-	formyl-CoA transferase	NA	NA	NA	NA	NA
AUR67051.1|2621760_2622558_-	citrate synthase	NA	NA	NA	NA	NA
AUR67052.1|2622583_2623570_-	hypothetical protein	NA	NA	NA	NA	NA
AUR67053.1|2623588_2625628_-	acetyl-CoA synthetase	NA	NA	NA	NA	NA
AUR68447.1|2625829_2626510_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AUR67054.1|2626523_2627435_-	malyl-CoA thiolesterase	NA	NA	NA	NA	NA
AUR67055.1|2627431_2628010_-	NADPH-dependent FMN reductase	NA	NA	NA	NA	NA
AUR67056.1|2628148_2629054_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUR67057.1|2629061_2632481_+	nuclease	NA	NA	NA	NA	NA
AUR67058.1|2632468_2635069_-	autotransporter	NA	NA	NA	NA	NA
AUR67059.1|2636024_2636633_-	PadR family transcriptional regulator	NA	NA	NA	NA	NA
AUR67060.1|2637050_2637809_+	hypothetical protein	NA	NA	NA	NA	NA
AUR67061.1|2637805_2639008_+	cardiolipin synthase 2	NA	NA	NA	NA	NA
AUR67062.1|2639004_2639205_+	hypothetical protein	NA	NA	NA	NA	NA
AUR67063.1|2639195_2640146_-|integrase	integrase	integrase	NA	NA	NA	NA
AUR67064.1|2641053_2642199_+	hypothetical protein	NA	NA	NA	NA	NA
AUR67065.1|2642185_2642941_+	permease	NA	NA	NA	NA	NA
AUR67066.1|2643057_2643237_+	hypothetical protein	NA	NA	NA	NA	NA
AUR67067.1|2643302_2644253_-|integrase	integrase	integrase	NA	NA	NA	NA
2648099:2648117	attR	GCGCCGCCTGGCGCCGCTG	NA	NA	NA	NA
>prophage 19
CP011245	Bordetella pertussis strain J199, complete genome	4109686	2672449	2710829	4109686	integrase	Planktothrix_phage(33.33%)	41	2665208:2665227	2712975:2712994
2665208:2665227	attL	GCGCCAGCTGGCGCAGGCGC	NA	NA	NA	NA
AUR67085.1|2672449_2673319_+|integrase	integrase	integrase	NA	NA	NA	NA
AUR67086.1|2673417_2674368_+|integrase	integrase	integrase	NA	NA	NA	NA
AUR67087.1|2674460_2675000_+	peroxiredoxin	NA	NA	NA	NA	NA
AUR67088.1|2675106_2675451_-	arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	58.4	3.0e-31
AUR67089.1|2675508_2676957_-	carnitine dehydratase	NA	NA	NA	NA	NA
AUR68450.1|2677144_2677471_-	hypothetical protein	NA	NA	NA	NA	NA
AUR67090.1|2679107_2680286_+	hypothetical protein	NA	NA	NA	NA	NA
AUR67091.1|2680368_2680869_+	glutathione peroxidase	NA	Q6VZR0	Canarypox_virus	38.4	4.7e-25
AUR67092.1|2680978_2681680_+	glutathione S-transferase	NA	NA	NA	NA	NA
AUR67093.1|2681691_2682156_+	GNAT family acetyltransferase	NA	NA	NA	NA	NA
AUR68451.1|2682170_2682446_+	biotin--protein ligase	NA	NA	NA	NA	NA
AUR67094.1|2682442_2683219_+	lipoate--protein ligase	NA	NA	NA	NA	NA
AUR67095.1|2683247_2684075_+	lipoprotein	NA	NA	NA	NA	NA
AUR67096.1|2684200_2684671_+	hypothetical protein	NA	NA	NA	NA	NA
AUR67097.1|2684797_2685691_+	phosphatidylserine decarboxylase	NA	NA	NA	NA	NA
AUR67098.1|2685738_2686920_+	(S)-2-hydroxy-acid oxidase	NA	NA	NA	NA	NA
AUR67099.1|2686932_2687748_-	iron ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUR67100.1|2687881_2688409_-	hypothetical protein	NA	NA	NA	NA	NA
AUR68452.1|2688405_2688903_-	hypothetical protein	NA	NA	NA	NA	NA
AUR67101.1|2689050_2689428_+	membrane protein	NA	NA	NA	NA	NA
AUR67102.1|2689385_2689670_+	hypothetical protein	NA	NA	NA	NA	NA
AUR67103.1|2689649_2690600_-|integrase	integrase	integrase	NA	NA	NA	NA
AUR67104.1|2690698_2691568_-|integrase	integrase	integrase	NA	NA	NA	NA
AUR68453.1|2691747_2692359_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
AUR67105.1|2692593_2693721_+	leucine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUR67106.1|2693831_2694920_-	glycerol-3-phosphate transporter ATP-binding subunit	NA	G9BWD6	Planktothrix_phage	31.2	2.2e-19
AUR67107.1|2694972_2695824_-	glycerol-3-phosphate transporter membrane protein	NA	NA	NA	NA	NA
AUR67108.1|2695843_2696725_-	glycerol-3-phosphate transporter permease	NA	NA	NA	NA	NA
AUR68454.1|2696901_2698215_-	glycerol-3-phosphate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUR67109.1|2698425_2699259_+	pyrroline-5-carboxylate reductase	NA	NA	NA	NA	NA
AUR67110.1|2699255_2699837_+	membrane protein	NA	A0A2I7SAW6	Vibrio_phage	37.3	9.4e-17
AUR67111.1|2700190_2701141_+|integrase	integrase	integrase	NA	NA	NA	NA
AUR67112.1|2701156_2702272_+	leucine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUR67113.1|2702374_2703301_+	branched-chain amino acid transporter permease subunit LivH	NA	NA	NA	NA	NA
AUR67114.1|2703300_2704539_+	leucine/isoleucine/valine transporter permease subunit	NA	NA	NA	NA	NA
AUR67115.1|2704535_2705303_+	leucine/isoleucine/valine transporter ATP-binding subunit	NA	A0A2H4PQG7	Staphylococcus_phage	26.4	1.2e-14
AUR67116.1|2705303_2706005_+	leucine/isoleucine/valine transporter ATP-binding subunit	NA	G9BWD6	Planktothrix_phage	30.4	1.3e-17
AUR68455.1|2706086_2706533_-	glutamate racemase	NA	NA	NA	NA	NA
AUR67117.1|2707422_2708061_+	glutathione S-transferase	NA	NA	NA	NA	NA
AUR67118.1|2708829_2709780_+|integrase	integrase	integrase	NA	NA	NA	NA
AUR67119.1|2709878_2710829_+|integrase	integrase	integrase	NA	NA	NA	NA
2712975:2712994	attR	GCGCCAGCTGGCGCAGGCGC	NA	NA	NA	NA
>prophage 20
CP011245	Bordetella pertussis strain J199, complete genome	4109686	2809956	2864473	4109686	transposase,integrase	Diachasmimorpha_longicaudata_entomopoxvirus(20.0%)	49	2831576:2831594	2868036:2868054
AUR67201.1|2809956_2810826_-|integrase	integrase	integrase	NA	NA	NA	NA
AUR67202.1|2811235_2811841_+	fimbrial protein	NA	NA	NA	NA	NA
AUR67203.1|2811894_2813208_-	phenylacetate--CoA ligase	NA	NA	NA	NA	NA
AUR67204.1|2813282_2813753_-	phenylacetic acid degradation protein	NA	NA	NA	NA	NA
AUR67205.1|2813752_2814541_-	enoyl-CoA hydratase	NA	NA	NA	NA	NA
AUR67206.1|2814551_2816204_-	aldehyde dehydrogenase	NA	NA	NA	NA	NA
AUR67207.1|2816291_2817242_-|integrase	integrase	integrase	NA	NA	NA	NA
AUR68463.1|2818403_2818910_-	phenylacetate-CoA oxygenase	NA	NA	NA	NA	NA
AUR67208.1|2818906_2819671_-	phenylacetic acid degradation protein	NA	NA	NA	NA	NA
AUR67209.1|2819686_2819971_-	phenylacetate-CoA oxygenase	NA	NA	NA	NA	NA
AUR67210.1|2820035_2821025_-	phenylacetate-CoA oxygenase	NA	NA	NA	NA	NA
AUR67211.1|2821196_2822126_+	phenylacetic acid degradation protein	NA	NA	NA	NA	NA
AUR67212.1|2822097_2822784_-	NAD(P)H-hydrate epimerase	NA	NA	NA	NA	NA
AUR67213.1|2822817_2823363_-	oligoribonuclease	NA	Q8B5Y0	Diachasmimorpha_longicaudata_entomopoxvirus	37.7	2.1e-26
AUR67214.1|2823407_2824673_+	peptidase M48	NA	NA	NA	NA	NA
AUR67215.1|2824669_2825572_+	GTPase RsgA	NA	NA	NA	NA	NA
AUR67216.1|2826753_2827698_-	peptide ABC transporter	NA	NA	NA	NA	NA
AUR67217.1|2827792_2829310_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUR67218.1|2829351_2830980_-	gamma-glutamyltransferase	NA	NA	NA	NA	NA
AUR67219.1|2831087_2831969_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
2831576:2831594	attL	GCCGCTGGTCGTGCTGGCG	NA	NA	NA	NA
AUR67220.1|2832229_2832457_+	hypothetical protein	NA	NA	NA	NA	NA
AUR67221.1|2835081_2835456_+	endonuclease	NA	F4YXR7	Roseobacter_phage	54.4	2.1e-25
AUR67222.1|2835480_2835819_-	hypothetical protein	NA	NA	NA	NA	NA
AUR67223.1|2835862_2837497_-	NAD synthetase	NA	A0A2L0UZF5	Agrobacterium_phage	36.6	8.3e-87
AUR67224.1|2837535_2838882_-	mechanosensitive ion channel protein MscS	NA	NA	NA	NA	NA
AUR68464.1|2838989_2840411_+	argininosuccinate lyase	NA	NA	NA	NA	NA
AUR67225.1|2840480_2841065_-	nitroreductase	NA	NA	NA	NA	NA
AUR67226.1|2841167_2842118_-|integrase	integrase	integrase	NA	NA	NA	NA
AUR67227.1|2842252_2843359_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUR67228.1|2843369_2844467_+	molybdenum cofactor biosynthesis protein MoeA	NA	NA	NA	NA	NA
AUR67229.1|2844611_2845817_-	molybdopterin biosynthesis protein MoeA	NA	NA	NA	NA	NA
AUR67230.1|2845823_2846345_-	molybdopterin biosynthesis protein B	NA	NA	NA	NA	NA
AUR68465.1|2846341_2846824_-	molybdenum cofactor biosynthesis protein MoaE	NA	NA	NA	NA	NA
AUR67231.1|2846829_2847081_-	molybdopterin converting factor	NA	NA	NA	NA	NA
AUR68466.1|2847061_2847547_-	molybdenum cofactor biosynthesis protein C	NA	NA	NA	NA	NA
AUR67232.1|2847682_2851144_+	hypothetical protein	NA	NA	NA	NA	NA
AUR67233.1|2851161_2852046_+	carboxymethylenebutenolidase	NA	NA	NA	NA	NA
AUR67234.1|2852055_2852487_-	lipoprotein	NA	NA	NA	NA	NA
AUR68467.1|2852733_2853237_+	peroxiredoxin	NA	M1I839	Pelagibacter_phage	44.1	1.8e-24
AUR67235.1|2853314_2854715_+	MFS transporter	NA	NA	NA	NA	NA
AUR67236.1|2854789_2855665_-	membrane protein	NA	NA	NA	NA	NA
AUR68468.1|2855661_2856669_-	biotin synthase	NA	NA	NA	NA	NA
AUR67237.1|2857136_2857442_+	hypothetical protein	NA	NA	NA	NA	NA
AUR67238.1|2857532_2858123_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
AUR67239.1|2858313_2859330_-|transposase	transposase	transposase	NA	NA	NA	NA
AUR67240.1|2859521_2861858_-	ATPase P	NA	E4ZFI9	Streptococcus_phage	42.8	3.2e-124
AUR67241.1|2861940_2862375_+	MerR family transcriptional regulator	NA	NA	NA	NA	NA
AUR67242.1|2862554_2863424_+|integrase	integrase	integrase	NA	NA	NA	NA
AUR67243.1|2863603_2864473_+|integrase	integrase	integrase	NA	NA	NA	NA
2868036:2868054	attR	CGCCAGCACGACCAGCGGC	NA	NA	NA	NA
>prophage 21
CP011245	Bordetella pertussis strain J199, complete genome	4109686	2872498	2929284	4109686	protease,integrase	uncultured_Mediterranean_phage(28.57%)	41	2873450:2873509	2929285:2929387
AUR67251.1|2872498_2873368_-|integrase	integrase	integrase	NA	NA	NA	NA
2873450:2873509	attL	CCGGCCGGGCTCCTTGAGTGAACTGGGGGGGTGGCGATTTCCAGTTTCTCAAATCCGGTT	NA	NA	NA	NA
AUR67252.1|2875155_2875422_-	hypothetical protein	NA	NA	NA	NA	NA
AUR67253.1|2876129_2876468_+	nitrogen regulatory protein P-II 1	NA	NA	NA	NA	NA
AUR67254.1|2877796_2880076_-	autotransporter	NA	NA	NA	NA	NA
AUR67255.1|2881021_2881624_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
AUR67256.1|2881720_2883010_+	MFS transporter	NA	NA	NA	NA	NA
AUR67257.1|2883067_2883799_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.0	1.4e-12
AUR67258.1|2883795_2884599_-	ABC transporter	NA	A0A2H4PQG7	Staphylococcus_phage	23.5	7.9e-14
AUR67259.1|2884595_2885684_-	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
AUR67260.1|2885680_2886610_-	ABC transporter permease	NA	NA	NA	NA	NA
AUR67261.1|2886758_2887904_-	amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUR67262.1|2887925_2888795_-|integrase	integrase	integrase	NA	NA	NA	NA
AUR67263.1|2889206_2893028_-	transcriptional regulator	NA	NA	NA	NA	NA
AUR67264.1|2893184_2893853_-	lipoprotein	NA	NA	NA	NA	NA
AUR67265.1|2893857_2895531_-	paraquat-inducible protein B	NA	NA	NA	NA	NA
AUR67266.1|2895549_2896869_-	paraquat-inducible protein A	NA	NA	NA	NA	NA
AUR67267.1|2896873_2899189_-|protease	Clp protease ClpX	protease	A0A223W0B1	Agrobacterium_phage	41.9	4.1e-164
AUR68469.1|2899244_2901413_-	penicillin-binding protein	NA	NA	NA	NA	NA
AUR68470.1|2901409_2905975_-	alpha-2-macroglobulin	NA	NA	NA	NA	NA
AUR67268.1|2906688_2907003_-|protease	Clp protease ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	43.8	1.2e-10
AUR67269.1|2907230_2907476_+	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	76.6	1.3e-20
AUR67270.1|2907597_2908089_+	hypothetical protein	NA	A0A1B1IUW8	uncultured_Mediterranean_phage	42.2	4.8e-14
AUR67271.1|2908188_2909394_-	beta-ketoadipyl CoA thiolase	NA	NA	NA	NA	NA
AUR67272.1|2909509_2910907_-	chloride channel protein EriC	NA	NA	NA	NA	NA
AUR67273.1|2911023_2911602_-	superoxide dismutase	NA	NA	NA	NA	NA
AUR67274.1|2911674_2913066_-	exodeoxyribonuclease VII large subunit	NA	A0A1V0SD82	Indivirus	32.0	1.4e-29
AUR67275.1|2913233_2914184_-|integrase	integrase	integrase	NA	NA	NA	NA
AUR67276.1|2914464_2915085_+	flagellar motor protein MotA	NA	NA	NA	NA	NA
AUR67277.1|2915081_2915495_+	biopolymer transporter ExbD	NA	NA	NA	NA	NA
AUR67278.1|2915491_2916535_+	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
AUR67279.1|2916590_2916779_+	hypothetical protein	NA	NA	NA	NA	NA
AUR67280.1|2916788_2917553_+	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
AUR67281.1|2917643_2918300_+	adenylate kinase	NA	NA	NA	NA	NA
AUR67282.1|2918391_2919150_+	3-hydroxy-2-methylbutyryl-CoA dehydrogenase	NA	NA	NA	NA	NA
AUR67283.1|2919175_2920777_+	membrane protein	NA	NA	NA	NA	NA
AUR67284.1|2920977_2921982_+	iron dicitrate transport regulator FecR	NA	NA	NA	NA	NA
AUR67285.1|2922082_2922346_+	30S ribosomal protein S20	NA	NA	NA	NA	NA
AUR67286.1|2922463_2923240_-	alpha-dehydro-beta-deoxy-D-glucarate aldolase	NA	NA	NA	NA	NA
AUR67287.1|2923830_2924781_+|integrase	integrase	integrase	NA	NA	NA	NA
AUR67288.1|2927164_2928277_-	malate dehydrogenase	NA	NA	NA	NA	NA
AUR67289.1|2928333_2929284_-|integrase	integrase	integrase	NA	NA	NA	NA
2929285:2929387	attR	CCGGCCGGGCTCCTTGAGTGAACTGGGGGGGTGGCGATTTCCAGTTTCTCAAATCCGGTTCGGATGAACCATGCATACAACCTATTGAATCTTCACAGCTAGG	NA	NA	NA	NA
>prophage 22
CP011245	Bordetella pertussis strain J199, complete genome	4109686	2951663	3003361	4109686	integrase	Staphylococcus_phage(25.0%)	45	2952528:2952587	3003362:3003458
AUR67313.1|2951663_2952527_-|integrase	integrase	integrase	NA	NA	NA	NA
2952528:2952587	attL	CCGGCCGGGCTCCTTGAGTGAACTGGGGGGTTGGCGATTTCCAGTTTCTCAAATCCGGTT	NA	NA	NA	NA
AUR67314.1|2952722_2954195_-	magnesium transporter	NA	NA	NA	NA	NA
AUR67315.1|2954205_2954616_-	acyl-CoA hydrolase	NA	NA	NA	NA	NA
AUR67316.1|2954679_2955726_-	membrane protein	NA	NA	NA	NA	NA
AUR67317.1|2955832_2956711_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUR67318.1|2956724_2957921_-	amidohydrolase	NA	NA	NA	NA	NA
AUR67319.1|2957982_2959674_+	long-chain fatty acid--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	28.1	9.4e-33
AUR67320.1|2959670_2960540_-|integrase	integrase	integrase	NA	NA	NA	NA
AUR67321.1|2960741_2961638_-	inositol phosphatase	NA	NA	NA	NA	NA
AUR67322.1|2963915_2966141_+	glycosyl hydrolase	NA	NA	NA	NA	NA
AUR67323.1|2966305_2967394_+	phosphate ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.4	8.7e-32
AUR67324.1|2967350_2968004_+	DL-methionine transporter permease subunit	NA	NA	NA	NA	NA
AUR67325.1|2968051_2968849_+	dioxygenase	NA	NA	NA	NA	NA
AUR67326.1|2969461_2970331_+|integrase	integrase	integrase	NA	NA	NA	NA
AUR67327.1|2970411_2971560_+	alcohol dehydrogenase	NA	NA	NA	NA	NA
AUR67328.1|2971616_2972567_-|integrase	integrase	integrase	NA	NA	NA	NA
AUR67329.1|2972665_2972971_-	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
AUR67330.1|2972999_2973434_-	hypothetical protein	NA	NA	NA	NA	NA
AUR67331.1|2973435_2974680_-	hypothetical protein	NA	NA	NA	NA	NA
AUR67332.1|2974676_2975387_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AUR68471.1|2975401_2976313_-	hypothetical protein	NA	NA	NA	NA	NA
AUR67333.1|2976675_2977080_+	hypothetical protein	NA	NA	NA	NA	NA
AUR67334.1|2977076_2977535_+	hypothetical protein	NA	NA	NA	NA	NA
AUR67335.1|2977541_2978450_+	hypothetical protein	NA	NA	NA	NA	NA
AUR68472.1|2978446_2979313_+	ABC transporter permease	NA	NA	NA	NA	NA
AUR67336.1|2979299_2980127_+	sugar ABC transporter permease	NA	NA	NA	NA	NA
AUR67337.1|2980137_2981265_+	phosphate ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	32.3	1.2e-23
AUR67338.1|2983622_2984885_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUR67339.1|2984891_2985644_+	DNA-binding protein	NA	NA	NA	NA	NA
AUR67340.1|2985695_2985881_-	hypothetical protein	NA	NA	NA	NA	NA
AUR67341.1|2986156_2986621_+	MerR family transcriptional regulator	NA	NA	NA	NA	NA
AUR67342.1|2986700_2987312_+	3-methyladenine DNA glycosylase	NA	NA	NA	NA	NA
AUR67343.1|2987456_2989565_+	hypothetical protein	NA	NA	NA	NA	NA
AUR67344.1|2989561_2990512_-|integrase	integrase	integrase	NA	NA	NA	NA
AUR67345.1|2990615_2991236_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
AUR68473.1|2991339_2992080_+	oxidoreductase	NA	NA	NA	NA	NA
AUR67346.1|2993214_2994339_-	hypothetical protein	NA	NA	NA	NA	NA
AUR67347.1|2994384_2994753_-	hypothetical protein	NA	NA	NA	NA	NA
AUR67348.1|2994994_2995864_-|integrase	integrase	integrase	NA	NA	NA	NA
AUR67349.1|2996980_2997523_-	hypothetical protein	NA	NA	NA	NA	NA
AUR67350.1|2997989_2998859_+|integrase	integrase	integrase	NA	NA	NA	NA
AUR67351.1|2998855_2999764_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUR67352.1|2999890_3000727_+	3-methyl-2-oxobutanoate hydroxymethyltransferase	NA	A0A0P0BXC9	Ostreococcus_lucimarinus_virus	33.3	1.6e-33
AUR67353.1|3001239_3002349_+	porin	NA	NA	NA	NA	NA
AUR67354.1|3002410_3003361_-|integrase	integrase	integrase	NA	NA	NA	NA
3003362:3003458	attR	CCGGCCGGGCTCCTTGAGTGAACTGGGGGGTTGGCGATTTCCAGTTTCTCAAATCCGGTTCGGATGAACCATGCATACAACCTATTGAATCTTCACA	NA	NA	NA	NA
>prophage 24
CP011245	Bordetella pertussis strain J199, complete genome	4109686	3383387	3436966	4109686	transposase,integrase	Staphylococcus_phage(33.33%)	48	3412382:3412411	3451051:3451080
AUR67654.1|3383387_3384257_+|integrase	integrase	integrase	NA	NA	NA	NA
AUR67655.1|3384661_3385306_-	urease accessory protein UreG	NA	NA	NA	NA	NA
AUR67656.1|3385330_3385915_-	Urease accessory protein UreF	NA	NA	NA	NA	NA
AUR67657.1|3386015_3386633_-	urease accessory protein UreE	NA	NA	NA	NA	NA
AUR67658.1|3386635_3388351_-	urease subunit alpha	NA	NA	NA	NA	NA
AUR67659.1|3388347_3388656_-	urease subunit beta	NA	NA	NA	NA	NA
AUR67660.1|3388672_3389290_-	urease accessory protein UreJ	NA	NA	NA	NA	NA
AUR67661.1|3389334_3389637_-	urease subunit gamma	NA	NA	NA	NA	NA
AUR67662.1|3389737_3390592_-	urease accessory protein ureD	NA	NA	NA	NA	NA
AUR67663.1|3391863_3392271_-	aldehyde-activating protein	NA	NA	NA	NA	NA
AUR67664.1|3392640_3393435_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AUR67665.1|3393535_3394771_+	methylaspartate ammonia-lyase	NA	NA	NA	NA	NA
AUR67666.1|3394839_3395856_+	LacI family transcriptional regulator	NA	NA	NA	NA	NA
AUR67667.1|3395867_3397244_+	hypothetical protein	NA	NA	NA	NA	NA
AUR67668.1|3397240_3398437_+	membrane protein	NA	NA	NA	NA	NA
AUR67669.1|3398433_3399972_-	SpoVR family protein	NA	NA	NA	NA	NA
AUR67670.1|3399968_3401228_-	hypothetical protein	NA	NA	NA	NA	NA
AUR67671.1|3403168_3404038_-|integrase	integrase	integrase	NA	NA	NA	NA
AUR67672.1|3404885_3405980_-	hypothetical protein	NA	NA	NA	NA	NA
AUR67673.1|3405972_3407307_-	CoA ligase	NA	NA	NA	NA	NA
AUR67674.1|3407260_3407944_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
AUR67675.1|3407969_3409133_-	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
AUR67676.1|3409129_3410131_-	ABC transporter permease	NA	NA	NA	NA	NA
AUR67677.1|3410130_3411003_-	ABC transporter permease	NA	NA	NA	NA	NA
AUR67678.1|3410999_3411749_-	branched-chain amino acid ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.8	1.9e-09
AUR67679.1|3411745_3412537_-	ABC transporter ATP-binding protein	NA	A0A1M7XV31	Cedratvirus	29.4	1.7e-08
3412382:3412411	attL	CTTGCCCGCGCCGTTGGGGCCGATGATGCC	NA	NA	NA	NA
AUR67680.1|3412533_3413673_-	ABC transporter	NA	NA	NA	NA	NA
AUR67681.1|3413948_3414734_+	3-hydroxy-2-methylbutyryl-CoA dehydrogenase	NA	NA	NA	NA	NA
AUR67682.1|3414767_3415550_+	enoyl-CoA hydratase	NA	NA	NA	NA	NA
AUR67683.1|3415553_3415943_+	DNA-binding protein	NA	NA	NA	NA	NA
AUR67684.1|3417082_3417946_+	3-alpha,7-alpha, 12-alpha-trihydroxy-5-beta-cholest-24-enoyl-CoA hydratase	NA	NA	NA	NA	NA
AUR67685.1|3417981_3419070_+	hypothetical protein	NA	NA	NA	NA	NA
AUR67686.1|3419066_3419936_-|integrase	integrase	integrase	NA	NA	NA	NA
AUR67687.1|3420370_3423349_+	hypothetical protein	NA	NA	NA	NA	NA
AUR67688.1|3424275_3425154_+	fatty acid desaturase	NA	NA	NA	NA	NA
AUR67689.1|3425189_3425522_+	hypothetical protein	NA	NA	NA	NA	NA
AUR67690.1|3425500_3427021_+	hypothetical protein	NA	NA	NA	NA	NA
AUR67691.1|3427183_3428053_+|integrase	integrase	integrase	NA	NA	NA	NA
AUR67692.1|3428049_3428517_-	ribonuclease H	NA	J9Q745	Salmonella_phage	50.7	5.6e-36
AUR67693.1|3428559_3429330_-	methyltransferase type 11	NA	NA	NA	NA	NA
AUR67694.1|3429350_3430151_+	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
AUR67695.1|3430161_3431571_+	murein transglycosylase	NA	NA	NA	NA	NA
AUR67696.1|3431665_3432451_+	enoyl-ACP reductase	NA	NA	NA	NA	NA
AUR67697.1|3432690_3433707_+|transposase	transposase	transposase	NA	NA	NA	NA
AUR67698.1|3433814_3434207_-	OsmC family protein	NA	NA	NA	NA	NA
AUR67699.1|3434344_3435025_+	membrane protein	NA	NA	NA	NA	NA
AUR67700.1|3435029_3436001_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUR67701.1|3436096_3436966_-|integrase	integrase	integrase	NA	NA	NA	NA
3451051:3451080	attR	CTTGCCCGCGCCGTTGGGGCCGATGATGCC	NA	NA	NA	NA
>prophage 25
CP011245	Bordetella pertussis strain J199, complete genome	4109686	3444236	3503534	4109686	tRNA,transposase,integrase	Acinetobacter_phage(27.27%)	50	3484896:3484912	3505122:3505138
AUR67705.1|3444236_3446000_+|tRNA	glutaminyl-tRNA synthetase	tRNA	A0A222YZ70	Escherichia_phage	50.0	5.0e-162
AUR67706.1|3446111_3446990_+	septum formation inhibitor	NA	NA	NA	NA	NA
AUR67707.1|3447102_3447918_+	cell division inhibitor MinD	NA	NA	NA	NA	NA
AUR67708.1|3447921_3448173_+	cell division topological specificity factor MinE	NA	NA	NA	NA	NA
AUR67709.1|3448257_3449274_-|transposase	transposase	transposase	NA	NA	NA	NA
AUR67710.1|3449604_3449826_-	ornithine carbamoyltransferase	NA	NA	NA	NA	NA
AUR68495.1|3452186_3453053_-	multidrug DMT transporter	NA	NA	NA	NA	NA
AUR67711.1|3453601_3454810_-	ABC transporter permease	NA	NA	NA	NA	NA
AUR67712.1|3454889_3456461_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUR67713.1|3456578_3457514_-	glycosyl transferase	NA	NA	NA	NA	NA
AUR67714.1|3457702_3458647_+	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	23.2	8.4e-07
AUR67715.1|3458715_3458886_-	hypothetical protein	NA	NA	NA	NA	NA
AUR67716.1|3459214_3464932_+	excinuclease ABC subunit A	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	39.5	1.0e-195
AUR67717.1|3464937_3466065_+	aminodeoxychorismate synthase	NA	S4VT78	Pandoravirus	37.8	3.8e-38
AUR67718.1|3466120_3466747_+	aminobenzoate synthetase	NA	NA	NA	NA	NA
AUR67719.1|3467018_3468035_+|transposase	transposase	transposase	NA	NA	NA	NA
AUR67720.1|3468130_3468841_-	short-chain dehydrogenase	NA	NA	NA	NA	NA
AUR68496.1|3468837_3469827_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUR67721.1|3469922_3471554_+	acyl-CoA synthetase	NA	NA	NA	NA	NA
AUR67722.1|3471556_3472294_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AUR67723.1|3472449_3473322_-	heme biosynthesis protein HemY	NA	NA	NA	NA	NA
AUR67724.1|3473671_3474811_+	MFS transporter	NA	NA	NA	NA	NA
AUR67725.1|3474807_3475467_+	gamma-glutamyl cyclotransferase	NA	NA	NA	NA	NA
AUR67726.1|3475538_3476171_+	pyridoxine 5'-phosphate oxidase	NA	NA	NA	NA	NA
AUR67727.1|3476200_3476719_+	flavin reductase	NA	NA	NA	NA	NA
AUR67728.1|3476729_3477839_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
AUR67729.1|3477885_3478740_+	formyltetrahydrofolate deformylase	NA	NA	NA	NA	NA
AUR67730.1|3478741_3479644_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUR67731.1|3480866_3481817_-|integrase	integrase	integrase	NA	NA	NA	NA
AUR67732.1|3481913_3483047_-	hypothetical protein	NA	NA	NA	NA	NA
AUR67733.1|3483083_3483332_-	hypothetical protein	NA	NA	NA	NA	NA
AUR67734.1|3483571_3484561_+|integrase	integrase	integrase	NA	NA	NA	NA
AUR67735.1|3484736_3485525_-	indole-3-glycerol-phosphate synthase	NA	A0A0P0IR83	Acinetobacter_phage	53.0	5.1e-66
3484896:3484912	attL	CGGCAGCAGGTCCAGCG	NA	NA	NA	NA
AUR67736.1|3485521_3486553_-	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	42.7	7.4e-73
AUR67737.1|3486571_3487135_-	anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	62.1	1.1e-65
AUR67738.1|3487190_3488711_-	anthranilate synthase component I	NA	S4VT78	Pandoravirus	32.1	9.0e-43
AUR67739.1|3488974_3489679_-	phosphoglycolate phosphatase	NA	NA	NA	NA	NA
AUR67740.1|3489686_3490415_-	ribulose-phosphate 3-epimerase	NA	NA	NA	NA	NA
AUR67741.1|3490529_3490904_+	magnesium transporter ApaG	NA	NA	NA	NA	NA
AUR67742.1|3490946_3492236_+	membrane protein	NA	NA	NA	NA	NA
AUR67743.1|3492232_3493402_+	ubiquinone biosynthesis protein UbiH	NA	NA	NA	NA	NA
AUR67744.1|3493428_3494238_+	thiol:disulfide interchange protein DsbC	NA	NA	NA	NA	NA
AUR67745.1|3494297_3495233_+	2-hydroxyacid dehydrogenase	NA	A0A1J0F959	Only_Syngen_Nebraska_virus	27.7	6.4e-15
AUR67746.1|3495245_3496196_-|integrase	integrase	integrase	NA	NA	NA	NA
AUR67747.1|3496294_3497257_-	potassium ABC transporter ATPase	NA	A0A0U2S5Z2	Escherichia_phage	64.5	4.6e-93
AUR67748.1|3497288_3497648_-	dihydroneopterin aldolase	NA	NA	NA	NA	NA
AUR67749.1|3497772_3498675_+	oxidoreductase	NA	G3MA85	Bacillus_virus	24.0	1.9e-08
AUR68497.1|3498676_3500443_-	peptidase M61	NA	NA	NA	NA	NA
AUR67750.1|3500483_3501260_+	enoyl-CoA hydratase	NA	NA	NA	NA	NA
AUR67751.1|3502583_3503534_-|integrase	integrase	integrase	NA	NA	NA	NA
3505122:3505138	attR	CGCTGGACCTGCTGCCG	NA	NA	NA	NA
>prophage 26
CP011245	Bordetella pertussis strain J199, complete genome	4109686	3518472	3576545	4109686	tRNA,integrase	Planktothrix_phage(12.5%)	49	3516273:3516290	3580677:3580694
3516273:3516290	attL	CGCCGGCGCTCGAACCCG	NA	NA	NA	NA
AUR67764.1|3518472_3519423_+|integrase	integrase	integrase	NA	NA	NA	NA
AUR67765.1|3519551_3520685_-	peptidase	NA	NA	NA	NA	NA
AUR67766.1|3520728_3521634_-	hydrolase	NA	NA	NA	NA	NA
AUR67767.1|3521636_3523337_-	hypothetical protein	NA	G9BWD6	Planktothrix_phage	32.7	1.0e-15
AUR67768.1|3523333_3524254_-	peptide ABC transporter permease	NA	NA	NA	NA	NA
AUR67769.1|3524261_3525239_-	ABC transporter permease	NA	NA	NA	NA	NA
AUR67770.1|3525297_3526257_-	succinylglutamate desuccinylase	NA	NA	NA	NA	NA
AUR67771.1|3528306_3528543_-	hypothetical protein	NA	NA	NA	NA	NA
AUR67772.1|3528669_3529533_-	ADP-dependent (S)-NAD(P)H-hydrate dehydratase	NA	NA	NA	NA	NA
AUR67773.1|3529621_3530443_+	enoyl-CoA hydratase	NA	NA	NA	NA	NA
AUR67774.1|3530522_3531260_-	enoyl-CoA hydratase	NA	NA	NA	NA	NA
AUR67775.1|3531256_3532249_-	2-nitropropane dioxygenase	NA	NA	NA	NA	NA
AUR68500.1|3532401_3533025_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
AUR67776.1|3533069_3534218_+	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
AUR67777.1|3536622_3537492_+|integrase	integrase	integrase	NA	NA	NA	NA
AUR67778.1|3537832_3538783_+|integrase	integrase	integrase	NA	NA	NA	NA
AUR67779.1|3538962_3539832_+|integrase	integrase	integrase	NA	NA	NA	NA
AUR67780.1|3540128_3540626_+	blue copper protein	NA	NA	NA	NA	NA
AUR67781.1|3540668_3542444_+	hypothetical protein	NA	NA	NA	NA	NA
AUR67782.1|3542451_3543318_+	copper resistance protein	NA	NA	NA	NA	NA
AUR68501.1|3543324_3544050_-	enoyl-CoA hydratase	NA	NA	NA	NA	NA
AUR67783.1|3544219_3544450_+	hypothetical protein	NA	NA	NA	NA	NA
AUR67784.1|3544514_3544709_+	hypothetical protein	NA	NA	NA	NA	NA
AUR67785.1|3545228_3545999_-	IclR family transcriptional regulator	NA	NA	NA	NA	NA
AUR67786.1|3546312_3546903_+	cysteine dioxygenase	NA	NA	NA	NA	NA
AUR67787.1|3546936_3548265_-	amidase	NA	NA	NA	NA	NA
AUR67788.1|3548339_3549485_-	transporter	NA	NA	NA	NA	NA
AUR67789.1|3549596_3550595_+|integrase	integrase	integrase	NA	NA	NA	NA
AUR67790.1|3550557_3550992_+	carbon monoxide dehydrogenase	NA	NA	NA	NA	NA
AUR67791.1|3552508_3553393_+	membrane protein	NA	NA	NA	NA	NA
AUR67792.1|3553389_3554595_-	phospholipase	NA	NA	NA	NA	NA
AUR67793.1|3554591_3555452_-	endonuclease	NA	NA	NA	NA	NA
AUR67794.1|3555564_3557355_-|tRNA	aspartyl-tRNA synthetase	tRNA	A0A1V0SAC0	Catovirus	25.5	6.5e-08
AUR68502.1|3557395_3558040_-	membrane protein	NA	A0A2I7S9X1	Vibrio_phage	28.4	8.5e-11
AUR67795.1|3558061_3558370_-	FmdB family transcriptional regulator	NA	NA	NA	NA	NA
AUR68503.1|3558535_3559822_-	membrane protein	NA	NA	NA	NA	NA
AUR67796.1|3564157_3565372_-	phosphoribosylglycinamide formyltransferase	NA	NA	NA	NA	NA
AUR67797.1|3565477_3566467_+	D-arabinose 5-phosphate isomerase	NA	A0A2P0VNK5	Tetraselmis_virus	37.7	4.3e-38
AUR67798.1|3566463_3567072_+	3-deoxy-D-manno-octulosonate 8-phosphate phosphatase	NA	E3T535	Cafeteria_roenbergensis_virus	26.1	5.2e-10
AUR67799.1|3567084_3567714_+	hypothetical protein	NA	NA	NA	NA	NA
AUR67800.1|3567710_3568331_+	sugar ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUR67801.1|3568362_3569154_+	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.4	9.5e-20
AUR67802.1|3569507_3569729_+	hypothetical protein	NA	NA	NA	NA	NA
AUR67803.1|3570005_3570461_+	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
AUR67804.1|3570479_3571406_+	serine kinase	NA	NA	NA	NA	NA
AUR67805.1|3571459_3572746_-	alcohol dehydrogenase	NA	NA	NA	NA	NA
AUR67806.1|3573676_3574549_+	nucleotide-binding protein	NA	A0A1P8D5W0	Corynebacterium_phage	34.5	2.4e-08
AUR67807.1|3574545_3575496_+	lipoprotein	NA	F5B3X9	Synechococcus_phage	47.2	6.9e-17
AUR67808.1|3575594_3576545_+|integrase	integrase	integrase	NA	NA	NA	NA
3580677:3580694	attR	CGGGTTCGAGCGCCGGCG	NA	NA	NA	NA
>prophage 27
CP011245	Bordetella pertussis strain J199, complete genome	4109686	3708748	3751886	4109686	tRNA,integrase	Streptococcus_phage(11.11%)	41	3746725:3746743	3752509:3752527
AUR67916.1|3708748_3709618_+|integrase	integrase	integrase	NA	NA	NA	NA
AUR67917.1|3709798_3710668_+|integrase	integrase	integrase	NA	NA	NA	NA
AUR67918.1|3710664_3711300_-	lysine transporter LysE	NA	NA	NA	NA	NA
AUR67919.1|3711429_3712329_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUR67920.1|3712424_3712916_+	membrane protein	NA	NA	NA	NA	NA
AUR67921.1|3712962_3713928_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUR67922.1|3715061_3716303_+	2-aminoadipate aminotransferase	NA	A0A1X9I5H2	Streptococcus_phage	24.9	1.9e-14
AUR67923.1|3716416_3717433_+	amino acid ABC transporter substrate-binding protein	NA	A0A1B1IT51	uncultured_Mediterranean_phage	43.8	3.5e-75
AUR67924.1|3717467_3717944_-	membrane protein	NA	NA	NA	NA	NA
AUR67925.1|3718086_3718995_-	hydroxymethylglutaryl-CoA lyase	NA	NA	NA	NA	NA
AUR67926.1|3719108_3720221_-	DNA processing protein DprA	NA	S6BFL3	Thermus_phage	35.0	1.9e-21
AUR68513.1|3720321_3720807_-	AsnC family transcriptional regulator	NA	NA	NA	NA	NA
AUR67927.1|3720943_3722194_+	kynureninase	NA	NA	NA	NA	NA
AUR67928.1|3722295_3722808_+	peptide deformylase	NA	E3SLL2	Synechococcus_phage	43.3	8.5e-22
AUR67929.1|3722987_3723857_+|integrase	integrase	integrase	NA	NA	NA	NA
AUR67930.1|3723922_3724861_+|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	35.7	1.4e-09
AUR67931.1|3724883_3725510_-	pyridoxamine 5'-phosphate oxidase	NA	NA	NA	NA	NA
AUR67932.1|3725506_3726163_-	HAD family hydrolase	NA	NA	NA	NA	NA
AUR67933.1|3726159_3726762_-	hypothetical protein	NA	NA	NA	NA	NA
AUR67934.1|3726768_3727356_-	LOG family protein	NA	A0A2I2L3F0	Orpheovirus	23.3	1.1e-07
AUR67935.1|3727536_3728106_+	bacterioferritin	NA	NA	NA	NA	NA
AUR67936.1|3728176_3729496_-	ribosomal protein S12 methylthiotransferase	NA	NA	NA	NA	NA
AUR68514.1|3729602_3729794_-	4-oxalocrotonate tautomerase	NA	NA	NA	NA	NA
AUR67937.1|3730045_3731335_+	glycine/D-amino acid oxidase	NA	NA	NA	NA	NA
AUR67938.1|3731489_3732485_+	hypothetical protein	NA	NA	NA	NA	NA
AUR67939.1|3732569_3733244_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AUR67940.1|3733240_3734110_-|integrase	integrase	integrase	NA	NA	NA	NA
AUR67941.1|3734352_3735594_+	ornithine--oxo-acid aminotransferase	NA	A0A1V0SKB7	Klosneuvirus	25.2	4.0e-25
AUR67942.1|3735590_3736535_+	arginase	NA	A0A0N9R043	Chrysochromulina_ericina_virus	33.3	9.5e-27
AUR67943.1|3736653_3737604_+|integrase	integrase	integrase	NA	NA	NA	NA
AUR67944.1|3737563_3738493_-	hypothetical protein	NA	NA	NA	NA	NA
AUR67945.1|3738546_3738882_-	alkylhydroperoxidase	NA	NA	NA	NA	NA
AUR67946.1|3738926_3739691_-	enoyl-CoA hydratase	NA	NA	NA	NA	NA
AUR67947.1|3739714_3740455_-	IclR family transcriptional regulator	NA	NA	NA	NA	NA
AUR67948.1|3740462_3742016_-	long-chain fatty acid--CoA ligase	NA	A0A2K9L3I8	Tupanvirus	22.6	1.5e-13
AUR67949.1|3742050_3743028_-	hypothetical protein	NA	NA	NA	NA	NA
AUR67950.1|3743300_3743882_-	ureidoglycolate hydrolase	NA	NA	NA	NA	NA
AUR67951.1|3743933_3751067_-	autotransporter	NA	NA	NA	NA	NA
3746725:3746743	attL	GCGACCCGCAGCGTGCCGG	NA	NA	NA	NA
AUR67952.1|3751282_3751414_-	entericidin	NA	NA	NA	NA	NA
AUR68515.1|3751445_3751571_-	hypothetical protein	NA	NA	NA	NA	NA
AUR67953.1|3751679_3751886_-|integrase	integrase	integrase	NA	NA	NA	NA
3752509:3752527	attR	GCGACCCGCAGCGTGCCGG	NA	NA	NA	NA
>prophage 28
CP011245	Bordetella pertussis strain J199, complete genome	4109686	3757854	3793496	4109686	integrase	Burkholderia_phage(11.11%)	37	3789412:3789471	3793535:3793632
AUR67960.1|3757854_3758724_+|integrase	integrase	integrase	NA	NA	NA	NA
AUR67961.1|3758734_3759376_+	hypothetical protein	NA	NA	NA	NA	NA
AUR67962.1|3759542_3759785_+	hypothetical protein	NA	NA	NA	NA	NA
AUR67963.1|3759964_3760834_+|integrase	integrase	integrase	NA	NA	NA	NA
AUR67964.1|3760869_3761337_+	hypothetical protein	NA	Q3HQX1	Burkholderia_phage	71.3	2.1e-43
AUR67965.1|3761570_3761948_+	hypothetical protein	NA	NA	NA	NA	NA
AUR67966.1|3761944_3762127_+	membrane protein	NA	NA	NA	NA	NA
AUR67967.1|3762130_3763117_+	DNA recombinase	NA	H9C0R8	Aeromonas_phage	57.3	2.0e-67
AUR67968.1|3763113_3763761_+	exonuclease	NA	A0A0U2BXF3	Paracoccus_phage	41.4	2.0e-31
AUR67969.1|3763818_3764346_+	hypothetical protein	NA	NA	NA	NA	NA
AUR67970.1|3764382_3765567_+	hypothetical protein	NA	A0A291L9X3	Bordetella_phage	37.8	1.5e-24
AUR67971.1|3765577_3765919_+	hypothetical protein	NA	A0A0H5ARN8	Pseudomonas_phage	45.3	1.0e-10
AUR67972.1|3765911_3766031_+	membrane protein	NA	NA	NA	NA	NA
AUR67973.1|3766031_3766232_+	hypothetical protein	NA	NA	NA	NA	NA
AUR67974.1|3766228_3767218_-|integrase	integrase	integrase	A0A1B1P9F9	Acinetobacter_phage	44.4	4.4e-75
AUR67975.1|3768704_3770675_-	hypothetical protein	NA	NA	NA	NA	NA
AUR67976.1|3770916_3771315_+	hypothetical protein	NA	NA	NA	NA	NA
AUR67977.1|3771323_3772247_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUR67978.1|3772785_3773655_+|integrase	integrase	integrase	NA	NA	NA	NA
AUR67979.1|3773885_3775577_-	insertase	NA	NA	NA	NA	NA
AUR67980.1|3775625_3775898_-	membrane protein insertion efficiency factor	NA	A0A2H4PQM5	Staphylococcus_phage	52.2	7.0e-15
AUR67981.1|3775894_3776266_-	ribonuclease P	NA	NA	NA	NA	NA
AUR67982.1|3776361_3776496_-	50S ribosomal protein L34	NA	NA	NA	NA	NA
AUR68516.1|3776901_3778311_+	chromosomal replication initiator protein DnaA	NA	NA	NA	NA	NA
AUR67983.1|3778313_3779423_+	DNA polymerase III subunit beta	NA	B4UTW9	Rhizobium_phage	32.6	1.2e-41
AUR67984.1|3779517_3781971_+	DNA gyrase subunit B	NA	G3M9Z3	Bacillus_virus	34.8	2.3e-112
AUR67985.1|3782089_3782881_-	IclR family transcriptional regulator	NA	NA	NA	NA	NA
AUR67986.1|3783024_3784428_+	amidase	NA	NA	NA	NA	NA
AUR68517.1|3784466_3785438_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUR67987.1|3785522_3785726_+	hypothetical protein	NA	NA	NA	NA	NA
AUR67988.1|3785856_3787020_+	lactate dehydrogenase	NA	NA	NA	NA	NA
AUR67989.1|3787107_3787953_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
3789412:3789471	attL	CTGTGAAGATTCAATAGGTTGTATGCATGGTTCATCCGAACCGGATTTGAGAAACTGGAA	NA	NA	NA	NA
AUR67990.1|3789590_3790460_+|integrase	integrase	integrase	NA	NA	NA	NA
AUR67991.1|3790456_3790801_-	hypothetical protein	NA	NA	NA	NA	NA
AUR67992.1|3791014_3791389_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
AUR67993.1|3791463_3792522_+	Zn-dependent hydrolase	NA	NA	NA	NA	NA
AUR67994.1|3792545_3793496_-|integrase	integrase	integrase	NA	NA	NA	NA
3793535:3793632	attR	TTCCAGTTTCTCAAATCCGGTTCGGATGAACCATGCATACAACCTATTGAATCTTCACAGCTACCTGCCCAAGCTGGTCAGCGGCGAACACGTGGGCG	NA	NA	NA	NA
