The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP012135	Bordetella pertussis strain J014, complete genome	4107409	27282	122073	4107409	transposase,integrase,coat,tRNA	Planktothrix_phage(25.0%)	94	44518:44577	122465:122480
AUR57696.1|27282_28185_-|integrase	integrase	integrase	NA	NA	NA	NA
AUR57697.1|28314_28614_-	hypothetical protein	NA	NA	NA	NA	NA
AUR57698.1|28674_29109_-	hypothetical protein	NA	NA	NA	NA	NA
AUR57699.1|29141_30359_-	thiolase	NA	NA	NA	NA	NA
AUR57700.1|30364_30862_-	dehydratase	NA	NA	NA	NA	NA
AUR57701.1|31069_32005_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUR61039.1|32214_33006_+	enoyl-CoA hydratase	NA	NA	NA	NA	NA
AUR57702.1|33048_34470_+	2-methylcitrate dehydratase	NA	NA	NA	NA	NA
AUR57703.1|34673_35576_+|integrase	integrase	integrase	NA	NA	NA	NA
AUR57704.1|35572_36763_-	transporter	NA	NA	NA	NA	NA
AUR57705.1|37012_37924_+|tRNA	glycyl-tRNA synthetase	tRNA	NA	NA	NA	NA
AUR57706.1|37925_40064_+|tRNA	glycyl-tRNA synthetase subunit beta	tRNA	NA	NA	NA	NA
AUR57707.1|40060_40600_+	D,D-heptose 1,7-bisphosphate phosphatase	NA	NA	NA	NA	NA
AUR57708.1|40603_41332_+	acyl-phosphate glycerol 3-phosphate acyltransferase	NA	NA	NA	NA	NA
AUR57709.1|41318_42212_+	hypothetical protein	NA	NA	NA	NA	NA
AUR57710.1|42282_42678_+	glyoxalase I	NA	NA	NA	NA	NA
AUR57711.1|42687_43218_+	peptide deformylase	NA	E3SLL2	Synechococcus_phage	35.4	3.7e-12
AUR57712.1|43346_43526_-	hypothetical protein	NA	NA	NA	NA	NA
AUR57713.1|43711_44614_+|integrase	integrase	integrase	NA	NA	NA	NA
44518:44577	attL	CTACAACTGGCATCGACCCCACCAAGGCATCGGGCGCGCTGTACCCATCTCCAGACTCAA	NA	NA	NA	NA
AUR61040.1|45224_45749_+	hypothetical protein	NA	NA	NA	NA	NA
44518:44577	attL	CTACAACTGGCATCGACCCCACCAAGGCATCGGGCGCGCTGTACCCATCTCCAGACTCAA	NA	NA	NA	NA
AUR57714.1|45720_45957_-	LuxR family transcriptional regulator	NA	NA	NA	NA	NA
AUR57715.1|46084_46978_+	membrane protein	NA	NA	NA	NA	NA
AUR57716.1|48147_49395_+	homoserine acetyltransferase	NA	NA	NA	NA	NA
AUR57717.1|49391_50006_+	methionine biosynthesis protein MetW	NA	NA	NA	NA	NA
AUR57718.1|50189_51092_+|integrase	integrase	integrase	NA	NA	NA	NA
AUR57719.1|51134_52391_+	muropeptide transporter	NA	NA	NA	NA	NA
AUR57720.1|53622_54357_-	glutamate racemase	NA	NA	NA	NA	NA
AUR57721.1|54362_54953_-	arginine transporter ATP-binding subunit	NA	G9BWD6	Planktothrix_phage	33.6	3.2e-20
AUR57722.1|54977_55667_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
AUR57723.1|55663_56425_-	glutamate ABC transporter permease	NA	NA	NA	NA	NA
AUR57724.1|56504_57404_-	ABC transporter	NA	NA	NA	NA	NA
AUR57725.1|57497_58448_-|integrase	integrase	integrase	NA	NA	NA	NA
AUR57726.1|59248_60475_-	serine kinase HipA	NA	NA	NA	NA	NA
AUR57727.1|60474_60888_-	DNA-binding protein	NA	NA	NA	NA	NA
AUR61041.1|61077_62019_-	hypothetical protein	NA	NA	NA	NA	NA
AUR57728.1|63473_64055_-	glutamine amidotransferase	NA	NA	NA	NA	NA
AUR57729.1|64067_64370_-	ferredoxin	NA	NA	NA	NA	NA
AUR57730.1|64488_65547_-	oxidoreductase	NA	NA	NA	NA	NA
AUR57731.1|65581_66853_-	membrane protein	NA	NA	NA	NA	NA
AUR57732.1|66883_67138_-	hypothetical protein	NA	NA	NA	NA	NA
AUR57733.1|67482_68664_-	hypothetical protein	NA	NA	NA	NA	NA
AUR57734.1|69085_70036_+|integrase	integrase	integrase	NA	NA	NA	NA
AUR57735.1|70129_70444_+|transposase	transposase	transposase	NA	NA	NA	NA
AUR57736.1|71636_73544_+	heat shock protein 90	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	37.2	1.1e-117
AUR57737.1|73705_74326_-	glutathione S-transferase	NA	NA	NA	NA	NA
AUR57738.1|74357_74939_-	N-acetyl-anhydromuranmyl-L-alanine amidase	NA	A0A1W6DX33	Sphingobium_phage	54.3	1.7e-05
AUR57739.1|75027_75279_-	hypothetical protein	NA	NA	NA	NA	NA
AUR57740.1|75280_76123_-	membrane protein	NA	NA	NA	NA	NA
AUR57741.1|76228_77638_+	signal recognition particle	NA	NA	NA	NA	NA
AUR57742.1|77634_78585_-|integrase	integrase	integrase	NA	NA	NA	NA
AUR61042.1|78659_79604_+|integrase	integrase	integrase	NA	NA	NA	NA
79508:79600	attR	CTACAACTGGCATCGACCCCACCAAGGCATCGGGCGCGCTGTACCCATCTCCAGACTCAACCTGGACGAATACAACCTATTGACAGTTCACAG	NA	NA	NA	NA
AUR57743.1|79600_81475_-	capsular biosynthesis protein	NA	A0A2P1ELS8	Moumouvirus	26.9	2.0e-23
79508:79600	attR	CTACAACTGGCATCGACCCCACCAAGGCATCGGGCGCGCTGTACCCATCTCCAGACTCAACCTGGACGAATACAACCTATTGACAGTTCACAG	NA	NA	NA	NA
AUR57744.1|82822_83527_-	lipopolysaccharide biosynthesis protein	NA	NA	NA	NA	NA
AUR57745.1|83523_84630_-	glycosyl transferase	NA	NA	NA	NA	NA
AUR57746.1|84891_85485_-	sugar transferase	NA	NA	NA	NA	NA
AUR57747.1|85481_86669_-	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
AUR57748.1|86731_87991_-	glycosyl transferase	NA	NA	NA	NA	NA
AUR57749.1|88014_89103_-	UDP-N-acetylglucosamine 2-epimerase	NA	A0A0N9R0B2	Chrysochromulina_ericina_virus	36.3	4.8e-46
AUR57750.1|89110_90211_-	aminotransferase DegT	NA	A0A2K9L0G1	Tupanvirus	29.7	3.3e-31
AUR57751.1|90214_90790_-	serine acetyltransferase	NA	NA	NA	NA	NA
AUR57752.1|90793_91846_-	oxidoreductase	NA	NA	NA	NA	NA
AUR61043.1|91976_92984_+	heptosyltransferase	NA	NA	NA	NA	NA
AUR57753.1|92985_94272_+	3-deoxy-D-manno-octulosonic acid transferase	NA	NA	NA	NA	NA
AUR57754.1|94288_94444_-	hypothetical protein	NA	NA	NA	NA	NA
AUR57755.1|94468_95272_-	pantothenate kinase	NA	NA	NA	NA	NA
AUR57756.1|95268_96135_-	biotin--protein ligase	NA	NA	NA	NA	NA
AUR57757.1|96209_97340_+	ABC transporter permease	NA	NA	NA	NA	NA
AUR57758.1|97339_98179_+	iron ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.4	9.1e-21
AUR57759.1|98332_98800_-	hypothetical protein	NA	NA	NA	NA	NA
AUR57760.1|98889_99111_+	hypothetical protein	NA	NA	NA	NA	NA
AUR57761.1|99111_99714_+	hypothetical protein	NA	NA	NA	NA	NA
AUR57762.1|99743_100397_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
AUR61044.1|100607_101786_+	cytochrome C550	NA	B6DZZ7	Stx2-converting_phage	40.5	5.8e-66
AUR57763.1|101866_102733_+	cytochrome C550	NA	NA	NA	NA	NA
AUR57764.1|102808_103084_+	hypothetical protein	NA	NA	NA	NA	NA
AUR57765.1|103091_103754_+	lipoate--protein ligase	NA	NA	NA	NA	NA
AUR57766.1|103815_104817_+	lipoyl synthase	NA	NA	NA	NA	NA
AUR57767.1|104831_105380_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	53.4	3.7e-47
AUR57768.1|105437_106334_-	dTDP-4-dehydrorhamnose reductase	NA	NA	NA	NA	NA
AUR57769.1|106330_107392_-|coat	spore coat protein	coat	A0A1D7XFE8	Escherichia_phage	44.8	1.6e-78
AUR57770.1|107427_108330_-|integrase	integrase	integrase	NA	NA	NA	NA
AUR57771.1|109277_110471_+	cystathionine beta-lyase	NA	NA	NA	NA	NA
AUR57772.1|110552_111182_-	thiol:disulfide interchange protein	NA	NA	NA	NA	NA
AUR57773.1|111243_111927_-	cell division protein	NA	NA	NA	NA	NA
AUR57774.1|111936_113619_-|tRNA	arginine--tRNA ligase	tRNA	NA	NA	NA	NA
AUR61045.1|113906_114254_+	hypothetical protein	NA	NA	NA	NA	NA
AUR57775.1|114344_114662_+	hypothetical protein	NA	NA	NA	NA	NA
AUR61046.1|114944_115961_+|transposase	transposase	transposase	NA	NA	NA	NA
AUR57776.1|116036_116837_-	ABC transporter permease	NA	NA	NA	NA	NA
AUR57777.1|116833_117709_-	ABC transporter permease	NA	NA	NA	NA	NA
AUR57778.1|117719_119012_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUR57779.1|119054_120095_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	33.7	6.0e-22
AUR57780.1|120200_121022_-	metallophosphatase	NA	NA	NA	NA	NA
AUR57781.1|121122_122073_-|integrase	integrase	integrase	NA	NA	NA	NA
122465:122480	attR	GCATCATGGCCTCGTC	NA	NA	NA	NA
>prophage 2
CP012135	Bordetella pertussis strain J014, complete genome	4107409	164893	301503	4107409	integrase,tRNA	Klosneuvirus(10.53%)	118	173193:173211	305581:305598
AUR57816.1|164893_165844_-|integrase	integrase	integrase	NA	NA	NA	NA
AUR57817.1|167287_168190_-	membrane protein	NA	NA	NA	NA	NA
AUR57818.1|168167_168797_-	LemA	NA	NA	NA	NA	NA
AUR57819.1|169079_170510_+	RNA helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	29.8	5.8e-44
AUR57820.1|170543_171173_+	threonine transporter RhtB	NA	NA	NA	NA	NA
AUR57821.1|171221_172829_+	peptide chain release factor 3	NA	A0A2K9L6L3	Tupanvirus	37.8	9.3e-14
AUR57822.1|172865_173537_+	hypothetical protein	NA	NA	NA	NA	NA
173193:173211	attL	GCGCGCGAGATCGCCGCCA	NA	NA	NA	NA
AUR61050.1|173618_174095_-	bacterioferritin	NA	NA	NA	NA	NA
173193:173211	attL	GCGCGCGAGATCGCCGCCA	NA	NA	NA	NA
AUR57823.1|174349_175252_+|integrase	integrase	integrase	NA	NA	NA	NA
AUR57824.1|176367_176895_+	lipoprotein	NA	NA	NA	NA	NA
AUR57825.1|176986_177802_+	lipoprotein	NA	NA	NA	NA	NA
AUR57826.1|177862_178597_+	hypothetical protein	NA	NA	NA	NA	NA
AUR57827.1|178634_180713_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SHR2	Klosneuvirus	23.6	1.5e-27
AUR57828.1|180962_181235_-	hypothetical protein	NA	NA	NA	NA	NA
AUR57829.1|181336_182422_+	ATP-binding protein	NA	NA	NA	NA	NA
AUR57830.1|182425_184330_+	surface antigen	NA	NA	NA	NA	NA
AUR57831.1|184326_188001_+	hypothetical protein	NA	NA	NA	NA	NA
AUR57832.1|188061_188625_+	deoxycytidine triphosphate deaminase	NA	S5VM63	Pseudomonas_phage	75.3	2.6e-72
AUR57833.1|188632_189055_-	glyoxalase	NA	NA	NA	NA	NA
AUR57834.1|189082_189502_-	glyoxalase	NA	NA	NA	NA	NA
AUR57835.1|189530_189878_-	hypothetical protein	NA	NA	NA	NA	NA
AUR61051.1|190151_190601_+	hypothetical protein	NA	NA	NA	NA	NA
AUR57836.1|190755_193026_+	lysine decarboxylase	NA	NA	NA	NA	NA
AUR57837.1|193101_194307_+	membrane protein	NA	NA	NA	NA	NA
AUR57838.1|194453_195356_+|integrase	integrase	integrase	NA	NA	NA	NA
AUR57839.1|195458_196094_+	superoxide dismutase	NA	Q56AR7	Bacillus_thuringiensis_phage	73.8	2.8e-83
AUR57840.1|196090_196984_+	divalent cation transporter	NA	NA	NA	NA	NA
AUR57841.1|197378_198479_+	glycine cleavage system protein T	NA	NA	NA	NA	NA
AUR57842.1|198560_198935_+	glycine cleavage system protein H	NA	NA	NA	NA	NA
AUR57843.1|198994_201859_+	glycine dehydrogenase	NA	E3SN07	Prochlorococcus_phage	51.4	1.2e-261
AUR57844.1|202003_202744_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AUR57845.1|202813_204025_+	formyl-CoA transferase	NA	NA	NA	NA	NA
AUR57846.1|204053_205022_+	hypothetical protein	NA	NA	NA	NA	NA
AUR57847.1|205683_206586_+|integrase	integrase	integrase	NA	NA	NA	NA
AUR57848.1|206742_207066_+	PsiF repeat family protein	NA	NA	NA	NA	NA
AUR61052.1|207170_208211_-	cyclase	NA	NA	NA	NA	NA
AUR57849.1|208216_208996_-	3-oxoadipate enol-lactonase	NA	NA	NA	NA	NA
AUR57850.1|209041_209338_-	hypothetical protein	NA	NA	NA	NA	NA
AUR57851.1|209363_209639_-	muconolactone delta-isomerase	NA	NA	NA	NA	NA
AUR57852.1|209695_210340_-	3-oxoadipate CoA-transferase	NA	NA	NA	NA	NA
AUR57853.1|210339_211026_-	3-oxoadipate CoA-transferase	NA	NA	NA	NA	NA
AUR61053.1|211224_212007_+	IclR family transcriptional regulator	NA	NA	NA	NA	NA
AUR57854.1|212057_212783_-	short-chain dehydrogenase	NA	NA	NA	NA	NA
AUR57855.1|212814_214164_-	short-chain fatty acid transporter	NA	NA	NA	NA	NA
AUR57856.1|214275_215208_-	3-hydroxybutyryl-CoA dehydrogenase	NA	NA	NA	NA	NA
AUR57857.1|215665_218461_-	peptidase S8	NA	NA	NA	NA	NA
AUR57858.1|219054_221898_-	phosphoenolpyruvate carboxylase	NA	NA	NA	NA	NA
AUR57859.1|222068_222788_+	7-cyano-7-deazaguanine synthase	NA	A0A0A0RPC6	Escherichia_phage	43.9	8.0e-50
AUR57860.1|222826_223375_-	GCN5 family acetyltransferase	NA	A0A2H4J136	uncultured_Caudovirales_phage	41.7	1.2e-21
AUR57861.1|223529_224429_+	virginiamycin B lyase	NA	NA	NA	NA	NA
AUR57862.1|224453_225404_-|integrase	integrase	integrase	NA	NA	NA	NA
AUR57863.1|225622_226318_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AUR57864.1|226334_227747_+	2-hydroxyacid dehydrogenase	NA	NA	NA	NA	NA
AUR57865.1|227859_229290_+	aldehyde dehydrogenase	NA	NA	NA	NA	NA
AUR57866.1|229331_231245_-	thiamine biosynthesis protein ThiC	NA	NA	NA	NA	NA
AUR57867.1|231563_232130_+	preprotein translocase subunit SecD	NA	NA	NA	NA	NA
AUR57868.1|232220_233222_+	restriction endonuclease	NA	NA	NA	NA	NA
AUR57869.1|233336_234287_+|integrase	integrase	integrase	NA	NA	NA	NA
AUR57870.1|234373_235324_+|integrase	integrase	integrase	NA	NA	NA	NA
AUR57871.1|235320_236271_-|integrase	integrase	integrase	NA	NA	NA	NA
AUR57872.1|236369_237167_-	beta-D-hydroxybutyrate dehydrogenase	NA	NA	NA	NA	NA
AUR57873.1|238116_238527_+	4-carboxymuconolactone decarboxylase	NA	NA	NA	NA	NA
AUR57874.1|238776_239532_+	gamma-hydroxybutyrate dehydrogenase	NA	D2K0C8	Staphylococcus_phage	55.0	4.6e-32
AUR57875.1|239548_240292_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AUR57876.1|240335_241379_-	C4-dicarboxylate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUR57877.1|241549_243652_+	membrane protein	NA	NA	NA	NA	NA
241662:241680	attR	TGGCGGCGATCTCGCGCGC	NA	NA	NA	NA
AUR57878.1|245062_246019_+	hypothetical protein	NA	NA	NA	NA	NA
241662:241680	attR	TGGCGGCGATCTCGCGCGC	NA	NA	NA	NA
AUR57879.1|246037_246529_-	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine pyrophosphokinase	NA	NA	NA	NA	NA
AUR57880.1|246525_247881_-	PcnB	NA	A0A1B1IVF3	uncultured_Mediterranean_phage	36.8	3.4e-25
AUR57881.1|247881_248580_-	hypothetical protein	NA	NA	NA	NA	NA
AUR57882.1|248576_249278_-	DnaA regulatory inactivator Hda	NA	NA	NA	NA	NA
AUR57883.1|249530_250580_+	phosphoribosylaminoimidazole synthetase	NA	Q58MH8	Prochlorococcus_phage	43.6	5.6e-68
AUR57884.1|250685_251627_-|tRNA	tRNA delta(2)-isopentenylpyrophosphate transferase	tRNA	NA	NA	NA	NA
AUR57885.1|251623_253513_-	DNA mismatch repair protein	NA	A0A1B2LRQ5	Wolbachia_phage	32.8	3.3e-79
AUR61054.1|253617_254238_+	membrane protein	NA	NA	NA	NA	NA
AUR57886.1|254380_255766_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A2H4JCM7	uncultured_Caudovirales_phage	30.3	4.5e-17
AUR57887.1|255696_256233_-	ATPase	NA	NA	NA	NA	NA
AUR57888.1|256384_257776_+	fumarate hydratase	NA	NA	NA	NA	NA
AUR57889.1|257792_258773_-	membrane protein	NA	NA	NA	NA	NA
AUR57890.1|258908_259892_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUR57891.1|259956_260856_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUR57892.1|260962_262717_+	gamma-glutamyltransferase	NA	NA	NA	NA	NA
AUR57893.1|262724_263849_-	carnitine dehydratase	NA	NA	NA	NA	NA
AUR57894.1|263862_264843_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUR57895.1|265573_266524_+|integrase	integrase	integrase	NA	NA	NA	NA
AUR57896.1|266538_266910_+	hypothetical protein	NA	NA	NA	NA	NA
AUR57897.1|267083_267629_+	ArsR family transcriptional regulator	NA	NA	NA	NA	NA
AUR57898.1|267754_269332_+	cytochrome d terminal oxidase subunit 1	NA	NA	NA	NA	NA
AUR57899.1|269347_270502_+	cytochrome d ubiquinol oxidase subunit 2	NA	NA	NA	NA	NA
AUR57900.1|270515_270641_+	cytochrome bd biosynthesis protein	NA	NA	NA	NA	NA
AUR57901.1|270637_272389_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	23.8	3.4e-09
AUR57902.1|272385_274065_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.6	3.6e-16
AUR57903.1|274127_274676_+	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	43.1	1.3e-28
AUR57904.1|275818_276097_+	hypothetical protein	NA	NA	NA	NA	NA
AUR57905.1|277140_278091_-|integrase	integrase	integrase	NA	NA	NA	NA
AUR57906.1|278368_278530_+	hypothetical protein	NA	NA	NA	NA	NA
AUR57907.1|278537_278678_+	hypothetical protein	NA	NA	NA	NA	NA
AUR57908.1|279196_279646_-	peptidase	NA	NA	NA	NA	NA
AUR57909.1|279655_280267_-	glutathione S-transferase	NA	NA	NA	NA	NA
AUR57910.1|280425_281274_-	cytochrome C	NA	NA	NA	NA	NA
AUR57911.1|281299_282682_-	cytochrome B	NA	NA	NA	NA	NA
AUR57912.1|282746_283388_-	ubiquinol-cytochrome C reductase	NA	NA	NA	NA	NA
AUR57913.1|283527_283986_+	large-conductance mechanosensitive channel	NA	NA	NA	NA	NA
AUR57914.1|284010_284787_-	metal-binding protein	NA	NA	NA	NA	NA
AUR57915.1|284807_285977_+	2-alkenal reductase	NA	W5SAB9	Pithovirus	31.2	1.2e-07
AUR57916.1|285973_286924_-|integrase	integrase	integrase	NA	NA	NA	NA
AUR57917.1|287022_287649_-	hypothetical protein	NA	NA	NA	NA	NA
AUR57918.1|287671_288598_-	2-hydroxyacid dehydrogenase	NA	NA	NA	NA	NA
AUR57919.1|288606_290193_-	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUR57920.1|290189_291194_-	acetyl esterase	NA	A0A2L2DMU8	Acanthamoeba_polyphaga_mimivirus	31.5	7.5e-30
AUR57921.1|291393_292254_+	cupin	NA	NA	NA	NA	NA
AUR57922.1|292285_293287_-	hypothetical protein	NA	NA	NA	NA	NA
AUR57923.1|293357_294167_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AUR57924.1|294244_296104_+	dihydroxy-acid dehydratase	NA	NA	NA	NA	NA
AUR57925.1|296232_297435_-	arabinose transporter permease	NA	NA	NA	NA	NA
AUR57926.1|297548_298430_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUR57927.1|299932_300493_-	5'-3'-deoxyribonucleotidase	NA	A0A1E1EUN3	Acanthamoeba_castellanii_mimivirus	30.8	3.2e-14
AUR57928.1|300552_301503_-|integrase	integrase	integrase	NA	NA	NA	NA
305581:305598	attR	CGCGCGCCGCGCCGGCGG	NA	NA	NA	NA
>prophage 3
CP012135	Bordetella pertussis strain J014, complete genome	4107409	365304	431273	4107409	integrase,tRNA	Streptococcus_phage(28.57%)	60	429365:429381	431594:431610
AUR57991.1|365304_366207_-|integrase	integrase	integrase	NA	NA	NA	NA
AUR57992.1|367303_367942_+	membrane protein	NA	NA	NA	NA	NA
AUR57993.1|367978_369322_-	glutamate dehydrogenase	NA	NA	NA	NA	NA
AUR57994.1|369744_370533_-	exodeoxyribonuclease III	NA	M1PSC0	Streptococcus_phage	25.7	1.2e-19
AUR57995.1|370670_371345_+	orotate phosphoribosyltransferase	NA	NA	NA	NA	NA
AUR57996.1|371458_372913_-|tRNA	glutamyl-tRNA amidotransferase	tRNA	NA	NA	NA	NA
AUR57997.1|372915_374454_-|tRNA	glutamyl-tRNA amidotransferase	tRNA	NA	NA	NA	NA
AUR57998.1|374456_374765_-|tRNA	glutamyl-tRNA amidotransferase	tRNA	NA	NA	NA	NA
AUR57999.1|374995_376039_+	rod shape-determining protein MreB	NA	NA	NA	NA	NA
AUR58000.1|376127_377012_+	rod shape-determining protein MreC	NA	NA	NA	NA	NA
AUR58001.1|376998_377562_+	rod shape-determining protein MreD	NA	NA	NA	NA	NA
AUR58002.1|377575_379528_+	penicillin-binding protein	NA	NA	NA	NA	NA
AUR58003.1|379524_380661_+	ADP-ribosylglycohydrolase	NA	NA	NA	NA	NA
AUR58004.1|380686_381742_-	lactate dehydrogenase	NA	NA	NA	NA	NA
AUR58005.1|381752_383246_-	membrane protein	NA	NA	NA	NA	NA
AUR58006.1|383458_384034_-	dihydroorotate oxidase	NA	NA	NA	NA	NA
AUR58007.1|384083_384830_-	hydrolase	NA	NA	NA	NA	NA
AUR58008.1|384829_385732_-	acetylglutamate kinase	NA	NA	NA	NA	NA
AUR58009.1|385993_386782_+	methionine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUR58010.1|386922_387414_-	thioredoxin	NA	NA	NA	NA	NA
AUR58011.1|387410_388154_-	phospholipid-binding protein	NA	NA	NA	NA	NA
AUR61059.1|388150_388744_-	phosphoheptose isomerase	NA	A0A067XQR2	Caulobacter_phage	34.8	5.6e-17
AUR58012.1|388752_389052_-	hypothetical protein	NA	NA	NA	NA	NA
AUR58013.1|389353_390292_+	tetrapyrrole methylase	NA	NA	NA	NA	NA
AUR58014.1|390288_390861_+	cysteine methyltransferase	NA	M1PFU9	Streptococcus_phage	42.5	3.2e-25
AUR58015.1|390857_391808_-|integrase	integrase	integrase	NA	NA	NA	NA
AUR58016.1|391950_392862_+	reductase	NA	NA	NA	NA	NA
AUR58017.1|392858_393107_+	glutaredoxin	NA	NA	NA	NA	NA
AUR58018.1|393103_394309_+	acetyl-CoA acetyltransferase	NA	NA	NA	NA	NA
AUR58019.1|394381_395377_-	membrane protein	NA	NA	NA	NA	NA
AUR58020.1|395399_396620_-	dehydratase	NA	NA	NA	NA	NA
AUR58021.1|396616_397261_-	hypothetical protein	NA	NA	NA	NA	NA
AUR58022.1|397257_397650_-	hypothetical protein	NA	NA	NA	NA	NA
AUR58023.1|398991_399801_-	IclR family transcriptional regulator	NA	NA	NA	NA	NA
AUR61060.1|400105_401059_+	thioredoxin reductase	NA	A0A2I2L5E1	Orpheovirus	42.5	5.6e-59
AUR58024.1|401157_402141_+|integrase	integrase	integrase	NA	NA	NA	NA
AUR58025.1|402817_403588_-	enoyl-CoA hydratase	NA	NA	NA	NA	NA
AUR58026.1|403584_404763_-	carnitine dehydratase	NA	NA	NA	NA	NA
AUR58027.1|404930_406637_-	thiamine pyrophosphate-binding protein	NA	NA	NA	NA	NA
AUR58028.1|406633_407530_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUR58029.1|407570_409160_-	sulfurtransferase	NA	NA	NA	NA	NA
AUR58030.1|409209_410202_-	hypothetical protein	NA	NA	NA	NA	NA
AUR58031.1|410270_410870_-	hypothetical protein	NA	NA	NA	NA	NA
AUR61061.1|411330_412269_-	hypothetical protein	NA	NA	NA	NA	NA
AUR58032.1|412386_413289_-|integrase	integrase	integrase	NA	NA	NA	NA
AUR58033.1|413425_414340_+	transporter	NA	NA	NA	NA	NA
AUR58034.1|414336_414996_+	membrane protein	NA	NA	NA	NA	NA
AUR58035.1|415085_416009_+	peptidase	NA	A0A1C9C5K3	Heterosigma_akashiwo_virus	27.2	4.8e-07
AUR58036.1|416014_416470_-	membrane protein	NA	NA	NA	NA	NA
AUR58037.1|416466_417570_-	hypothetical protein	NA	NA	NA	NA	NA
AUR58038.1|417757_419377_-	dolichyl-phosphate-mannose-protein mannosyltransferase	NA	NA	NA	NA	NA
AUR58039.1|419373_420432_-	glycosyl transferase family 2	NA	I1TED8	Salmonella_phage	40.5	2.8e-59
AUR58040.1|420561_421056_+	acetyltransferase	NA	NA	NA	NA	NA
AUR58041.1|421148_422126_+|integrase	integrase	integrase	NA	NA	NA	NA
AUR58042.1|422321_423527_+	ABC transporter permease	NA	NA	NA	NA	NA
AUR58043.1|423523_425035_+	TRAP ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUR61062.1|425050_426364_-	short-chain fatty acid transporter	NA	NA	NA	NA	NA
AUR58044.1|426554_426734_-	membrane protein	NA	NA	NA	NA	NA
AUR58045.1|427143_427878_-	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	43.8	1.4e-41
429365:429381	attL	CGGCCGCCACCACGGCG	NA	NA	NA	NA
AUR58046.1|430322_431273_+|integrase	integrase	integrase	NA	NA	NA	NA
AUR58046.1|430322_431273_+|integrase	integrase	integrase	NA	NA	NA	NA
431594:431610	attR	CGCCGTGGTGGCGGCCG	NA	NA	NA	NA
>prophage 4
CP012135	Bordetella pertussis strain J014, complete genome	4107409	620802	721266	4107409	integrase,tRNA,tail,terminase	uncultured_Caudovirales_phage(14.29%)	110	665794:665808	724081:724099
AUR58213.1|620802_621753_+|integrase	integrase	integrase	NA	NA	NA	NA
AUR58214.1|622451_622835_+	membrane protein	NA	NA	NA	NA	NA
AUR58215.1|622892_623495_+	hypothetical protein	NA	NA	NA	NA	NA
AUR61070.1|623512_623914_-	membrane protein	NA	NA	NA	NA	NA
AUR58216.1|624029_624941_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUR58217.1|624937_625519_+	NUDIX hydrolase	NA	NA	NA	NA	NA
AUR61071.1|626322_627048_+|tRNA	arginyl-tRNA-protein transferase	tRNA	NA	NA	NA	NA
AUR58218.1|627088_628138_+	dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
AUR58219.1|628285_628864_-	Phasin (PHA-granule associated protein)	NA	NA	NA	NA	NA
AUR58220.1|629250_630228_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUR58221.1|630321_634716_-	dermonecrotic toxin	NA	NA	NA	NA	NA
AUR58222.1|634916_635765_-	IclR family transcriptional regulator	NA	NA	NA	NA	NA
AUR58223.1|635923_636736_-	damage-inducible protein	NA	NA	NA	NA	NA
AUR58224.1|636791_637742_-|integrase	integrase	integrase	NA	NA	NA	NA
AUR58225.1|637840_638641_-	membrane protein	NA	NA	NA	NA	NA
AUR58226.1|638702_639086_+	thiol-disulfide isomerase	NA	NA	NA	NA	NA
AUR61072.1|639097_640450_-	ATP-dependent RNA helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	34.4	2.1e-51
AUR58227.1|640737_641067_-	membrane protein	NA	NA	NA	NA	NA
AUR58228.1|641069_641819_-	membrane protein	NA	NA	NA	NA	NA
AUR58229.1|642001_642922_+	branched-chain amino acid aminotransferase	NA	NA	NA	NA	NA
AUR58230.1|642968_643181_+	hypothetical protein	NA	NA	NA	NA	NA
AUR58231.1|643203_643626_+	ketosteroid isomerase	NA	NA	NA	NA	NA
AUR58232.1|643642_644743_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
AUR58233.1|644839_646357_-	exported peptidase	NA	NA	NA	NA	NA
AUR58234.1|646432_647272_+	UTP--glucose-1-phosphate uridylyltransferase	NA	A0A127AW70	Bacillus_phage	48.9	1.1e-66
AUR61073.1|647293_648166_-	membrane protein	NA	NA	NA	NA	NA
AUR58235.1|648256_649351_-	porin	NA	NA	NA	NA	NA
AUR58236.1|649644_650547_-|integrase	integrase	integrase	NA	NA	NA	NA
AUR61074.1|650669_651611_+|integrase	integrase	integrase	NA	NA	NA	NA
AUR58237.1|651694_652054_-	hypothetical protein	NA	NA	NA	NA	NA
AUR58238.1|652435_653473_-	membrane protein	NA	NA	NA	NA	NA
AUR58239.1|653789_655130_+	Xaa-Pro aminopeptidase	NA	NA	NA	NA	NA
AUR58240.1|655139_655592_-	membrane protein	NA	NA	NA	NA	NA
AUR58241.1|655697_656870_+	monooxygenase	NA	NA	NA	NA	NA
AUR58242.1|656935_657961_+|tRNA	tRNA-dihydrouridine synthase B	tRNA	NA	NA	NA	NA
AUR58243.1|658001_658241_+	Fis family transcriptional regulator	NA	NA	NA	NA	NA
AUR58244.1|658310_659900_+	phosphoribosylaminoimidazolecarboxamide formyltransferase	NA	Q58MG4	Prochlorococcus_phage	47.2	8.7e-65
AUR58245.1|659899_660448_+	Holliday junction resolvase	NA	NA	NA	NA	NA
AUR58246.1|660528_661101_+	ATP-dependent DNA helicase RuvA	NA	NA	NA	NA	NA
AUR58247.1|661119_662031_-	NAD-dependent dehydratase	NA	NA	NA	NA	NA
AUR58248.1|662104_663073_-	serine dehydratase	NA	NA	NA	NA	NA
AUR58249.1|663195_664269_+	ATP-dependent DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	25.7	2.3e-08
AUR58250.1|664273_666094_-	ATP-dependent DNA helicase RecQ	NA	L7RCS0	Acanthamoeba_polyphaga_moumouvirus	35.3	3.1e-74
665794:665808	attL	CGACCTCGCGCGCCA	NA	NA	NA	NA
AUR58251.1|666170_667121_-|integrase	integrase	integrase	NA	NA	NA	NA
665794:665808	attL	CGACCTCGCGCGCCA	NA	NA	NA	NA
AUR58252.1|667209_667545_+	hypothetical protein	NA	NA	NA	NA	NA
AUR58253.1|667678_668329_+	carbonate dehydratase	NA	NA	NA	NA	NA
AUR58254.1|668350_669769_-	amidase	NA	NA	NA	NA	NA
AUR58255.1|669838_670594_-	hypothetical protein	NA	NA	NA	NA	NA
AUR61075.1|670562_671321_+	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
AUR58256.1|671331_672213_+	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
AUR58257.1|672229_672937_+	branched-chain amino acid ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	25.4	8.2e-07
AUR58258.1|672939_673698_+	branched-chain amino acid ABC transporter ATPase	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	24.4	4.4e-14
AUR58259.1|673907_675650_+	sulfite reductase	NA	NA	NA	NA	NA
AUR58260.1|675642_676167_+	hypothetical protein	NA	NA	NA	NA	NA
AUR58261.1|676206_677001_-	dioxygenase	NA	NA	NA	NA	NA
AUR58262.1|677168_678242_+	hypothetical protein	NA	NA	NA	NA	NA
AUR58263.1|678340_679291_+|integrase	integrase	integrase	NA	NA	NA	NA
AUR58264.1|679542_679749_-	hypothetical protein	NA	NA	NA	NA	NA
AUR61076.1|679820_680432_-	repressor	NA	NA	NA	NA	NA
AUR58265.1|680911_681232_-	hypothetical protein	NA	NA	NA	NA	NA
681039:681053	attR	TGGCGCGCGAGGTCG	NA	NA	NA	NA
AUR58266.1|681224_681923_-	membrane protein	NA	NA	NA	NA	NA
681039:681053	attR	TGGCGCGCGAGGTCG	NA	NA	NA	NA
AUR58267.1|681937_682159_-	hypothetical protein	NA	NA	NA	NA	NA
AUR58268.1|682176_683127_+|integrase	integrase	integrase	NA	NA	NA	NA
AUR58269.1|683766_684252_+|terminase	terminase	terminase	C7U0W1	Enterobacteria_phage	61.5	7.3e-39
AUR58270.1|684238_685516_+|terminase	terminase	terminase	A0A1B1P9C9	Acinetobacter_phage	64.7	2.4e-150
AUR58271.1|685518_686937_+	hypothetical protein	NA	R9TF43	Synechococcus_phage	42.1	2.2e-99
AUR58272.1|686908_688021_+	phage Mu F like family protein	NA	A0A0H5BBX3	Pseudomonas_phage	49.7	2.1e-102
AUR58273.1|688026_688269_+	hypothetical protein	NA	A0A0H5AUE5	Pseudomonas_phage	53.2	5.6e-16
AUR58274.1|688391_688994_+	hypothetical protein	NA	R9TF81	Synechococcus_phage	43.6	7.9e-27
AUR58275.1|689422_690373_-|integrase	integrase	integrase	NA	NA	NA	NA
AUR58276.1|691047_691299_+	hypothetical protein	NA	NA	NA	NA	NA
AUR58277.1|691361_691844_+	hypothetical protein	NA	A0A2H4JE38	uncultured_Caudovirales_phage	37.1	1.8e-13
AUR58278.1|691845_692046_+	hypothetical protein	NA	NA	NA	NA	NA
AUR58279.1|692045_692441_+	hypothetical protein	NA	A0A2D2W284	Stenotrophomonas_phage	35.0	7.8e-07
AUR58280.1|692437_692836_+	hypothetical protein	NA	I6PCW1	Cronobacter_phage	38.0	4.2e-16
AUR58281.1|692832_693255_+	hypothetical protein	NA	NA	NA	NA	NA
AUR58282.1|693262_693763_+	hypothetical protein	NA	A0A1I9SEX5	Klebsiella_phage	45.1	4.4e-31
AUR58283.1|694017_694536_+	hypothetical protein	NA	A0A1S5R1H0	Pseudomonas_phage	38.3	5.4e-24
AUR58284.1|694545_694875_+	hypothetical protein	NA	A0A2H4J121	uncultured_Caudovirales_phage	44.0	2.9e-15
AUR58285.1|694892_695183_+	hypothetical protein	NA	A0A2H4JBP7	uncultured_Caudovirales_phage	45.2	3.7e-14
AUR58286.1|695208_697821_+|tail	tail protein	tail	A0A2H4J107	uncultured_Caudovirales_phage	38.6	4.9e-105
AUR58287.1|697830_698190_+	hypothetical protein	NA	NA	NA	NA	NA
AUR58288.1|698257_698791_+	hypothetical protein	NA	A5A3Q9	Burkholderia_phage	46.9	1.1e-40
AUR58289.1|698787_699177_+	hypothetical protein	NA	A0A0G3EYJ9	Achromobacter_phage	50.0	3.0e-35
AUR58290.1|699169_703126_+	hypothetical protein	NA	A0A0B5A1N2	Achromobacter_phage	40.8	3.9e-215
AUR58291.1|703130_703547_+	hypothetical protein	NA	NA	NA	NA	NA
AUR58292.1|703765_704029_+	hypothetical protein	NA	A0A1B0V3F2	Roseobacter_phage	41.8	7.2e-09
AUR58293.1|704028_704841_+	hypothetical protein	NA	NA	NA	NA	NA
AUR58294.1|704845_705088_+	hypothetical protein	NA	NA	NA	NA	NA
AUR58295.1|705066_705618_+	lysozyme	NA	NA	NA	NA	NA
AUR58296.1|705617_706133_+	hypothetical protein	NA	NA	NA	NA	NA
AUR58297.1|706129_706411_-	hypothetical protein	NA	NA	NA	NA	NA
AUR58298.1|706410_706632_-	hypothetical protein	NA	NA	NA	NA	NA
AUR58299.1|706960_707632_-	hypothetical protein	NA	Q5QF62	Pseudomonas_virus	39.9	4.7e-36
AUR58300.1|707559_707928_-	hypothetical protein	NA	NA	NA	NA	NA
AUR58301.1|707987_708674_-	transcriptional regulator	NA	NA	NA	NA	NA
AUR58302.1|708654_709227_-	RNA pyrophosphohydrolase	NA	NA	NA	NA	NA
AUR58303.1|709292_711023_+|tRNA	proline--tRNA ligase	tRNA	A0A2K9L3R9	Tupanvirus	29.4	4.6e-11
AUR58304.1|711075_711504_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
AUR58305.1|711506_712187_+	protein tolQ	NA	NA	NA	NA	NA
AUR58306.1|712186_712645_+	biopolymer transporter ExbD	NA	NA	NA	NA	NA
AUR58307.1|712681_713656_+	energy transducer TonB	NA	NA	NA	NA	NA
AUR58308.1|713672_714989_+	translocation protein TolB	NA	NA	NA	NA	NA
AUR58309.1|715020_715518_+	membrane protein	NA	NA	NA	NA	NA
AUR58310.1|715604_716294_+	hypothetical protein	NA	NA	NA	NA	NA
AUR58311.1|716293_717343_+	iron-siderophore ABC transporter permease	NA	NA	NA	NA	NA
AUR58312.1|717339_718134_+	iron ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.6	2.4e-15
AUR58313.1|718302_718653_+	hypothetical protein	NA	NA	NA	NA	NA
AUR58314.1|718628_719186_+	hypothetical protein	NA	NA	NA	NA	NA
AUR58315.1|720315_721266_+|integrase	integrase	integrase	NA	NA	NA	NA
724081:724099	attR	GGCCGCCGCGATCGCCGCG	NA	NA	NA	NA
>prophage 5
CP012135	Bordetella pertussis strain J014, complete genome	4107409	748191	821353	4107409	integrase	Streptococcus_phage(16.67%)	59	752248:752307	821397:821499
AUR58336.1|748191_749142_-|integrase	integrase	integrase	NA	NA	NA	NA
AUR58337.1|749796_750894_+	carboxynorspermidine decarboxylase	NA	NA	NA	NA	NA
AUR58338.1|750927_752193_+	saccharopine dehydrogenase	NA	NA	NA	NA	NA
752248:752307	attL	GCTAGGTGTGAAGATTCAATAGGTTGTATGCATGGTTCATCCGAACCGGATTTGAGAAAC	NA	NA	NA	NA
AUR58339.1|752398_753301_+|integrase	integrase	integrase	NA	NA	NA	NA
AUR58340.1|753342_753498_+	hypothetical protein	NA	NA	NA	NA	NA
AUR58341.1|753544_754135_+	polyisoprenoid-binding protein	NA	NA	NA	NA	NA
AUR61078.1|754150_756595_-	ligand-gated channel	NA	NA	NA	NA	NA
AUR58342.1|756714_757686_-	membrane protein	NA	NA	NA	NA	NA
AUR58343.1|757817_758342_+	RNA polymerase sigma factor	NA	NA	NA	NA	NA
AUR58344.1|758301_759252_-|integrase	integrase	integrase	NA	NA	NA	NA
AUR58345.1|759473_761669_-	DNA methylase	NA	NA	NA	NA	NA
AUR61079.1|761741_762089_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AUR58346.1|762271_763222_+|integrase	integrase	integrase	NA	NA	NA	NA
AUR58347.1|763337_763760_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AUR58348.1|763843_764638_+	transcriptional regulator	NA	NA	NA	NA	NA
AUR58349.1|764803_765940_-	gamma-glutamyl kinase	NA	A0A1X9I5D0	Streptococcus_phage	44.8	5.8e-63
AUR58350.1|766010_767144_-	GTPase CgtA	NA	NA	NA	NA	NA
AUR58351.1|767293_767554_-	50S ribosomal protein L27	NA	NA	NA	NA	NA
AUR58352.1|767587_767899_-	50S ribosomal protein L21	NA	NA	NA	NA	NA
AUR58353.1|768323_769472_+	fumarylacetoacetate hydrolase	NA	NA	NA	NA	NA
AUR58354.1|769586_770552_+	octaprenyl diphosphate synthase	NA	NA	NA	NA	NA
AUR58355.1|770820_771687_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUR58356.1|771817_773866_+	hydantoinase	NA	NA	NA	NA	NA
AUR58357.1|773883_775881_+	hydantoin utilization protein B	NA	NA	NA	NA	NA
AUR58358.1|775915_777253_+	amino acid deaminase	NA	NA	NA	NA	NA
AUR58359.1|779423_780905_+	succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
AUR58360.1|780920_781478_-	lysine acyltransferase	NA	NA	NA	NA	NA
AUR61080.1|781590_781770_+	hypothetical protein	NA	NA	NA	NA	NA
AUR58361.1|781854_787077_+	hemolysin	NA	NA	NA	NA	NA
AUR58362.1|787154_789293_+	peptidase C39	NA	W8CYL7	Bacillus_phage	29.2	2.7e-45
AUR58363.1|789289_790612_+	hemolysin D	NA	NA	NA	NA	NA
AUR58364.1|790613_792038_+	CyaE	NA	NA	NA	NA	NA
AUR58365.1|792128_793037_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUR58366.1|793101_794016_+	ABC transporter	NA	NA	NA	NA	NA
AUR58367.1|794422_794656_-	hypothetical protein	NA	NA	NA	NA	NA
AUR58368.1|794853_795537_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
AUR58369.1|795568_796297_+	arginine transporter ATP-binding subunit	NA	G9BWD6	Planktothrix_phage	42.4	3.4e-32
AUR58370.1|796326_797187_+	D-amino acid aminotransferase	NA	NA	NA	NA	NA
AUR58371.1|797194_797761_-	membrane protein	NA	NA	NA	NA	NA
AUR58372.1|797849_798806_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUR58373.1|798850_799603_-	3-ketoacyl-ACP reductase	NA	NA	NA	NA	NA
AUR58374.1|799599_801345_-	acetolactate synthase catalytic subunit	NA	NA	NA	NA	NA
AUR58375.1|801429_802164_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AUR58376.1|802480_803503_+	autotransporter	NA	NA	NA	NA	NA
AUR61081.1|803518_804154_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AUR58377.1|804385_805393_-	zinc-binding dehydrogenase	NA	NA	NA	NA	NA
AUR58378.1|805433_806966_-	acetyl-CoA synthetase	NA	NA	NA	NA	NA
AUR58379.1|806962_808081_-	deacylase	NA	NA	NA	NA	NA
AUR58380.1|808077_808860_-	ABC transporter permease	NA	NA	NA	NA	NA
AUR58381.1|808871_809735_-	ABC transporter	NA	G3M9Y6	Bacillus_virus	38.9	9.6e-34
AUR61082.1|809753_810851_-	hypothetical protein	NA	NA	NA	NA	NA
AUR58382.1|810919_811846_-	dioxygenase	NA	NA	NA	NA	NA
AUR58383.1|811880_813575_-	acetolactate synthase	NA	NA	NA	NA	NA
AUR58384.1|813774_814668_-	mechanosensitive ion channel protein	NA	NA	NA	NA	NA
AUR58385.1|814815_815766_-|integrase	integrase	integrase	NA	NA	NA	NA
AUR58386.1|815864_816521_-	hypothetical protein	NA	NA	NA	NA	NA
AUR58387.1|816668_819377_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	24.0	2.8e-15
AUR58388.1|819386_820406_+	fructose 1,6-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	35.7	1.5e-49
AUR58389.1|820402_821353_-|integrase	integrase	integrase	NA	NA	NA	NA
821397:821499	attR	GTTTCTCAAATCCGGTTCGGATGAACCATGCATACAACCTATTGAATCTTCACACCTAGCCGGCGCGCGCCAGCAGCACCACCACGTTGGCGGCAATCCCTTC	NA	NA	NA	NA
>prophage 6
CP012135	Bordetella pertussis strain J014, complete genome	4107409	859796	913927	4107409	holin,integrase,transposase	Vibrio_phage(25.0%)	44	868087:868106	917202:917221
AUR58422.1|859796_861755_-|holin	choline transporter	holin	A0A2I7QNT1	Vibrio_phage	30.3	8.0e-28
AUR58423.1|861837_862788_-|integrase	integrase	integrase	NA	NA	NA	NA
AUR58424.1|863008_863677_+	transcriptional regulator	NA	NA	NA	NA	NA
AUR58425.1|863800_864907_+	hemolysin secretion protein D	NA	NA	NA	NA	NA
AUR58426.1|864919_868033_+	acriflavine resistance protein B	NA	S5VTK5	Leptospira_phage	21.5	4.5e-57
AUR58427.1|868029_869523_+	RND transporter	NA	NA	NA	NA	NA
868087:868106	attL	CTGGCGCTGGCCGGCTGCGC	NA	NA	NA	NA
AUR58428.1|869537_870209_+	transcriptional regulator	NA	NA	NA	NA	NA
AUR61086.1|870252_870705_-	azurin	NA	NA	NA	NA	NA
AUR58429.1|870887_871535_-	IclR family transcriptional regulator	NA	NA	NA	NA	NA
AUR61087.1|871638_873687_+	hydantoinase	NA	NA	NA	NA	NA
AUR58430.1|873683_875696_+	hydantoin utilization protein B	NA	NA	NA	NA	NA
AUR58431.1|875721_877056_+	hypothetical protein	NA	NA	NA	NA	NA
AUR58432.1|877164_878157_+	hypothetical protein	NA	NA	NA	NA	NA
AUR58433.1|878223_880308_-	hypothetical protein	NA	NA	NA	NA	NA
AUR58434.1|880332_881304_-	hypothetical protein	NA	NA	NA	NA	NA
AUR58435.1|881432_882434_-	peptidase M14	NA	NA	NA	NA	NA
AUR58436.1|882467_883619_-	cystathionine beta-lyase	NA	NA	NA	NA	NA
AUR58437.1|883822_884713_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUR58438.1|884790_885615_+	3-oxoacyl-ACP reductase	NA	NA	NA	NA	NA
AUR61088.1|885811_886828_-|transposase	transposase	transposase	NA	NA	NA	NA
AUR58439.1|887024_888008_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUR58440.1|888066_889194_-	argininosuccinate lyase	NA	NA	NA	NA	NA
AUR58441.1|889184_889559_-	hypothetical protein	NA	NA	NA	NA	NA
AUR58442.1|889606_890995_-	hypothetical protein	NA	NA	NA	NA	NA
AUR58443.1|891025_892015_-	hypothetical protein	NA	NA	NA	NA	NA
AUR58444.1|892125_893358_-	methylaspartate ammonia-lyase	NA	NA	NA	NA	NA
AUR58445.1|893639_894440_+	IclR family transcriptional regulator	NA	NA	NA	NA	NA
AUR58446.1|894462_896694_-|holin	choline transporter	holin	NA	NA	NA	NA
AUR58447.1|897481_897928_-	preprotein translocase subunit SecG	NA	NA	NA	NA	NA
AUR58448.1|897949_898696_-	triosephosphate isomerase	NA	NA	NA	NA	NA
AUR58449.1|898839_899817_-	NAD(P)H-quinone oxidoreductase	NA	NA	NA	NA	NA
AUR58450.1|900516_901062_+	hypothetical protein	NA	K4HZX4	Acidithiobacillus_phage	30.5	3.0e-09
AUR58451.1|901055_902273_-	threonine dehydratase	NA	NA	NA	NA	NA
AUR58452.1|902413_903364_+|integrase	integrase	integrase	NA	NA	NA	NA
AUR58453.1|903360_904080_-	lipoprotein	NA	NA	NA	NA	NA
AUR58454.1|904200_906360_-	polynucleotide phosphorylase/polyadenylase	NA	NA	NA	NA	NA
AUR58455.1|906450_906720_-	30S ribosomal protein S15	NA	NA	NA	NA	NA
AUR61089.1|907013_907541_+	lipoprotein	NA	NA	NA	NA	NA
AUR58456.1|907559_908339_-	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
AUR58457.1|908506_909523_-	ketol-acid reductoisomerase	NA	NA	NA	NA	NA
AUR58458.1|909595_910087_-	acetolactate synthase	NA	NA	NA	NA	NA
AUR58459.1|910097_911813_-	acetolactate synthase 3 catalytic subunit	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	30.3	3.1e-60
AUR58460.1|912283_912895_+	hypothetical protein	NA	NA	NA	NA	NA
AUR58461.1|912976_913927_+|integrase	integrase	integrase	NA	NA	NA	NA
917202:917221	attR	CTGGCGCTGGCCGGCTGCGC	NA	NA	NA	NA
>prophage 7
CP012135	Bordetella pertussis strain J014, complete genome	4107409	934674	978965	4107409	integrase	Bacillus_phage(11.11%)	42	928063:928080	981451:981468
928063:928080	attL	CGGCGCTGCGCGCCGCCG	NA	NA	NA	NA
AUR58477.1|934674_935625_+|integrase	integrase	integrase	NA	NA	NA	NA
AUR58478.1|935689_935899_+	hypothetical protein	NA	NA	NA	NA	NA
AUR58479.1|936058_936271_+	hypothetical protein	NA	NA	NA	NA	NA
AUR58480.1|936390_937509_+	N-acylglucosamine 2-epimerase	NA	NA	NA	NA	NA
AUR58481.1|937605_937821_+	hypothetical protein	NA	NA	NA	NA	NA
AUR58482.1|938014_938266_+	hypothetical protein	NA	NA	NA	NA	NA
AUR58483.1|938426_939329_+|integrase	integrase	integrase	NA	NA	NA	NA
AUR58484.1|939325_939709_-	Rieske (2Fe-2S) protein	NA	NA	NA	NA	NA
AUR61090.1|939763_941578_-	metal ABC transporter permease	NA	W8CYL7	Bacillus_phage	27.9	5.7e-44
AUR61091.1|941727_942555_+	oxidoreductase	NA	A0A2H4PQR8	Staphylococcus_phage	47.4	1.7e-67
AUR58485.1|942600_943581_+	alcohol dehydrogenase	NA	NA	NA	NA	NA
AUR58486.1|943577_943790_-	membrane protein	NA	NA	NA	NA	NA
AUR58487.1|943786_944968_-	membrane protein	NA	NA	NA	NA	NA
AUR58488.1|945131_945866_+	serine/threonine protein phosphatase	NA	A0A2H4J0P0	uncultured_Caudovirales_phage	49.2	1.9e-62
AUR58489.1|945867_948480_-	penicillin-binding protein	NA	NA	NA	NA	NA
AUR58490.1|948615_950529_-	peptidase	NA	NA	NA	NA	NA
AUR58491.1|951144_951555_-	phenylacetic acid degradation protein	NA	NA	NA	NA	NA
AUR58492.1|951652_952738_+	DNA polymerase IV	NA	NA	NA	NA	NA
AUR58493.1|952836_953787_+|integrase	integrase	integrase	NA	NA	NA	NA
AUR58494.1|953783_954758_-	hypothetical protein	NA	NA	NA	NA	NA
AUR58495.1|954903_955794_+	LysR family transcriptional regulator	NA	Q6JIH3	Burkholderia_virus	27.6	4.3e-05
AUR58496.1|956070_956463_-	phage-like protein	NA	A0A0R6PJ17	Moraxella_phage	45.0	4.8e-25
AUR58497.1|956592_957543_+|integrase	integrase	integrase	NA	NA	NA	NA
AUR58498.1|957572_957755_-	hypothetical protein	NA	A0A1L2JY37	Aeribacillus_phage	56.1	3.7e-12
AUR58499.1|958527_959709_-	MFS transporter	NA	NA	NA	NA	NA
AUR58500.1|959924_960602_-	phosphoglycolate phosphatase	NA	NA	NA	NA	NA
AUR58501.1|960598_961324_-	3-demethylubiquinone-9 3-methyltransferase	NA	NA	NA	NA	NA
AUR58502.1|961539_962490_+|integrase	integrase	integrase	NA	NA	NA	NA
AUR58503.1|962498_963080_-	membrane protein	NA	NA	NA	NA	NA
AUR58504.1|963450_966132_+	DNA gyrase subunit A	NA	G3M9Z5	Bacillus_virus	33.5	3.2e-104
AUR61092.1|966134_967265_+	3-phosphoserine/phosphohydroxythreonine aminotransferase	NA	M1Q1P2	Streptococcus_phage	44.0	4.9e-78
AUR58505.1|967257_968343_+	chorismate mutase	NA	NA	NA	NA	NA
AUR58506.1|968429_969329_+	prephenate dehydrogenase	NA	NA	NA	NA	NA
AUR58507.1|969325_970654_+	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
AUR58508.1|970668_971340_+	cytidylate kinase	NA	NA	NA	NA	NA
AUR58509.1|971527_973243_+	30S ribosomal protein S1	NA	NA	NA	NA	NA
AUR58510.1|973244_973604_+	integration host factor subunit beta	NA	NA	NA	NA	NA
AUR58511.1|973795_974110_+	membrane protein	NA	NA	NA	NA	NA
AUR58512.1|974152_975373_+	membrane protein	NA	NA	NA	NA	NA
AUR58513.1|976307_977297_+	ADP-L-glycero-D-manno-heptose-6-epimerase	NA	E3SJ87	Synechococcus_phage	34.4	2.2e-26
AUR61093.1|977586_977916_+	hypothetical protein	NA	NA	NA	NA	NA
AUR58514.1|978014_978965_+|integrase	integrase	integrase	NA	NA	NA	NA
981451:981468	attR	CGGCGCTGCGCGCCGCCG	NA	NA	NA	NA
>prophage 8
CP012135	Bordetella pertussis strain J014, complete genome	4107409	998365	1070882	4107409	transposase,integrase,tRNA	Enterococcus_phage(14.29%)	59	1012062:1012091	1048502:1048531
AUR58532.1|998365_999316_-|integrase	integrase	integrase	NA	NA	NA	NA
AUR58533.1|999420_1000470_+	aldo/keto reductase	NA	NA	NA	NA	NA
AUR61095.1|1000607_1001624_-|transposase	transposase	transposase	NA	NA	NA	NA
AUR58534.1|1003132_1003705_-	chorismate--pyruvate lyase	NA	NA	NA	NA	NA
AUR58535.1|1003764_1004496_+	pseudouridylate synthase	NA	NA	NA	NA	NA
AUR61096.1|1004547_1005465_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUR58536.1|1006272_1009452_+	multidrug transporter	NA	NA	NA	NA	NA
AUR58537.1|1009448_1010831_+	multidrug transporter	NA	NA	NA	NA	NA
AUR58538.1|1010900_1011152_-	hypothetical protein	NA	NA	NA	NA	NA
AUR58539.1|1011297_1011912_-	electron transporter	NA	NA	NA	NA	NA
1012062:1012091	attL	GGTGCCAGTCCCCCTGCGGGGACAGGCACC	NA	NA	NA	NA
AUR58540.1|1012098_1014159_-	oligopeptidase A	NA	NA	NA	NA	NA
AUR58541.1|1014288_1015140_-	methenyltetrahydrofolate cyclohydrolase	NA	A0A249XZQ2	Enterococcus_phage	39.8	2.1e-33
AUR58542.1|1015136_1015763_-	LuxR family transcriptional regulator	NA	NA	NA	NA	NA
AUR58543.1|1015759_1017514_-	histidine kinase	NA	NA	NA	NA	NA
AUR58544.1|1017806_1020512_+	pyruvate dehydrogenase	NA	NA	NA	NA	NA
AUR58545.1|1020524_1022186_+	dihydrolipoamide acetyltransferase	NA	NA	NA	NA	NA
AUR58546.1|1022198_1023989_+	dihydrolipoamide dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	25.2	2.4e-39
AUR58547.1|1024210_1025386_-	flagellin	NA	NA	NA	NA	NA
AUR58548.1|1025428_1026331_-|integrase	integrase	integrase	NA	NA	NA	NA
AUR58549.1|1026477_1027218_-	16S rRNA methyltransferase	NA	NA	NA	NA	NA
AUR58550.1|1027412_1029449_+	transketolase	NA	NA	NA	NA	NA
AUR58551.1|1029466_1030477_+	glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
AUR58552.1|1030594_1031788_+	phosphoglycerate kinase	NA	NA	NA	NA	NA
AUR58553.1|1031817_1032591_-	short-chain dehydrogenase	NA	NA	NA	NA	NA
AUR58554.1|1032587_1033778_-	acetate kinase	NA	NA	NA	NA	NA
AUR58555.1|1033803_1034742_-	phosphate acetyltransferase	NA	NA	NA	NA	NA
AUR61097.1|1034738_1037087_-	3-hydroxyalkanoate synthetase	NA	NA	NA	NA	NA
AUR58556.1|1037241_1037883_-	glutathione S-transferase	NA	NA	NA	NA	NA
AUR58557.1|1039396_1039945_-	diguanylate cyclase	NA	NA	NA	NA	NA
AUR58558.1|1039963_1040449_-	GNAT family acetyltransferase	NA	NA	NA	NA	NA
AUR58559.1|1040626_1041565_+	cytochrome C biogenesis protein	NA	A0A0P0YMJ9	Yellowstone_lake_phycodnavirus	24.1	5.6e-11
AUR58560.1|1041567_1041885_+	MerR family transcriptional regulator	NA	NA	NA	NA	NA
AUR58561.1|1041930_1042875_+	hypothetical protein	NA	NA	NA	NA	NA
AUR58562.1|1044555_1045206_+	molybdenum cofactor biosynthesis protein MogA	NA	NA	NA	NA	NA
AUR58563.1|1045259_1045595_+	hypothetical protein	NA	NA	NA	NA	NA
AUR61098.1|1045609_1046452_+	peptidase	NA	A0A292GJG6	Xanthomonas_phage	36.1	2.6e-15
AUR58564.1|1046468_1046750_-	hypothetical protein	NA	NA	NA	NA	NA
AUR58565.1|1046823_1047087_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
AUR58566.1|1047330_1048281_+|integrase	integrase	integrase	NA	NA	NA	NA
AUR58567.1|1048579_1049317_-	flagellar biosynthesis sigma factor	NA	NA	NA	NA	NA
1048502:1048531	attR	GGTGCCTGTCCCCGCAGGGGGACTGGCACC	NA	NA	NA	NA
AUR58568.1|1049752_1050076_+	transcriptional regulator	NA	NA	NA	NA	NA
AUR58569.1|1050110_1050671_+	transcriptional regulator	NA	NA	NA	NA	NA
AUR58570.1|1050791_1051667_+	flagellar motor protein MotA	NA	NA	NA	NA	NA
AUR58571.1|1051679_1052627_+	flagellar motor protein MotB	NA	NA	NA	NA	NA
AUR58572.1|1052728_1053022_+	chemotaxis protein CheY	NA	NA	NA	NA	NA
AUR58573.1|1053048_1055106_+	chemotaxis protein CheA	NA	NA	NA	NA	NA
AUR58574.1|1055120_1055621_+	chemotaxis protein CheW	NA	NA	NA	NA	NA
AUR58575.1|1055694_1057401_+	chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	41.7	1.4e-12
AUR58576.1|1058264_1059317_+	chemotaxis protein	NA	NA	NA	NA	NA
AUR58577.1|1059369_1059759_+	chemotaxis protein CheY	NA	Q56AR1	Bacillus_thuringiensis_phage	33.3	5.7e-10
AUR58578.1|1059767_1060400_+	chemotaxis protein CheZ	NA	NA	NA	NA	NA
AUR61099.1|1060499_1061516_-|transposase	transposase	transposase	NA	NA	NA	NA
AUR61100.1|1062346_1063354_+	aldo/keto reductase	NA	NA	NA	NA	NA
AUR58579.1|1063350_1064994_-	acyltransferase	NA	NA	NA	NA	NA
AUR58580.1|1064990_1065878_-	magnesium transporter	NA	NA	NA	NA	NA
AUR58581.1|1066018_1066492_-	heat-shock protein	NA	NA	NA	NA	NA
AUR58582.1|1066481_1067504_-	phoH-like protein	NA	A0A0S0MVD6	Pseudomonas_phage	45.4	8.7e-50
AUR58583.1|1067500_1068928_-|tRNA	(dimethylallyl)adenosine tRNA methylthiotransferase	tRNA	NA	NA	NA	NA
AUR61101.1|1069865_1070882_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 9
CP012135	Bordetella pertussis strain J014, complete genome	4107409	1074635	1147704	4107409	transposase,integrase,tRNA,protease	Planktothrix_phage(16.67%)	59	1116050:1116069	1141213:1141232
AUR58587.1|1074635_1075772_-|tRNA	queuine tRNA-ribosyltransferase	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	44.4	1.9e-85
AUR58588.1|1075768_1076842_-|tRNA	S-adenosylmethionine tRNA ribosyltransferase	tRNA	NA	NA	NA	NA
AUR58589.1|1076999_1078436_+	peptidase M15	NA	NA	NA	NA	NA
AUR61102.1|1078526_1079168_+	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
AUR61103.1|1079503_1080520_+|transposase	transposase	transposase	NA	NA	NA	NA
AUR61104.1|1082546_1083497_+|integrase	integrase	integrase	NA	NA	NA	NA
AUR61105.1|1084699_1086121_-	sirohydrochlorin ferrochelatase	NA	NA	NA	NA	NA
AUR61106.1|1086387_1087101_+	membrane protein	NA	NA	NA	NA	NA
AUR58590.1|1087185_1087503_+	membrane protein	NA	NA	NA	NA	NA
AUR58591.1|1087543_1087957_+	membrane protein	NA	NA	NA	NA	NA
AUR58592.1|1087958_1088318_+	hypothetical protein	NA	NA	NA	NA	NA
AUR58593.1|1088360_1089905_-	3-octaprenyl-4-hydroxybenzoate carboxy-lyase	NA	NA	NA	NA	NA
AUR58594.1|1089988_1090819_+	lytic transglycosylase	NA	NA	NA	NA	NA
AUR58595.1|1090853_1092008_-	aminotransferase	NA	NA	NA	NA	NA
AUR58596.1|1092050_1092923_+	hypothetical protein	NA	NA	NA	NA	NA
AUR58597.1|1093039_1095328_+	malate dehydrogenase	NA	NA	NA	NA	NA
AUR58598.1|1096534_1096999_+	barstar family protein 2	NA	NA	NA	NA	NA
AUR58599.1|1097025_1097976_-|integrase	integrase	integrase	NA	NA	NA	NA
AUR61107.1|1098343_1099120_-	phosphate ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.7	4.3e-17
AUR58600.1|1099164_1100001_-	hypothetical protein	NA	NA	NA	NA	NA
AUR58601.1|1100043_1101060_-	phosphate ABC transporter permease	NA	NA	NA	NA	NA
AUR58602.1|1101194_1102235_-	phosphate ABC transporter substrate-binding protein	NA	M4QHS4	Cyanophage	40.2	2.1e-51
AUR58603.1|1102429_1104511_-	polyphosphate kinase	NA	NA	NA	NA	NA
AUR58604.1|1104746_1106240_+	exopolyphosphatase	NA	NA	NA	NA	NA
AUR58605.1|1106470_1107265_-	hypothetical protein	NA	NA	NA	NA	NA
AUR58606.1|1107485_1108844_-	phosphoglucosamine mutase	NA	NA	NA	NA	NA
AUR58607.1|1108840_1109683_-	dihydropteroate synthase	NA	A0A0B5J4J5	Pandoravirus	32.5	3.2e-26
AUR58608.1|1109701_1111588_-	cell division protein FtsH	NA	M4QMW8	Micromonas_pusilla_virus	41.5	1.4e-109
AUR58609.1|1111825_1112458_-	ribosomal RNA large subunit methyltransferase E	NA	NA	NA	NA	NA
AUR58610.1|1112476_1113079_+	hypothetical protein	NA	NA	NA	NA	NA
AUR58611.1|1113524_1113926_-	hypothetical protein	NA	NA	NA	NA	NA
AUR58612.1|1114983_1115784_-	membrane protein	NA	NA	NA	NA	NA
AUR58613.1|1115827_1116814_-	serine kinase	NA	NA	NA	NA	NA
1116050:1116069	attL	GGCCTGCAGCCAGCCGTGCA	NA	NA	NA	NA
AUR58614.1|1116989_1117967_+|tRNA	tRNA-dihydrouridine synthase A	tRNA	NA	NA	NA	NA
AUR58615.1|1117963_1118914_-|integrase	integrase	integrase	NA	NA	NA	NA
AUR58616.1|1119026_1119485_-	hypothetical protein	NA	NA	NA	NA	NA
AUR58617.1|1119521_1120835_-	membrane protein	NA	NA	NA	NA	NA
AUR58618.1|1120852_1121224_+	membrane protein	NA	NA	NA	NA	NA
AUR58619.1|1121220_1122684_+	hypothetical protein	NA	A0A075BSJ0	Microcystis_phage	32.5	1.7e-43
AUR58620.1|1122824_1123553_+	chemotaxis protein CheY	NA	NA	NA	NA	NA
AUR58621.1|1123534_1126384_-	diguanylate phosphodiesterase	NA	NA	NA	NA	NA
AUR58622.1|1126644_1127547_+|integrase	integrase	integrase	NA	NA	NA	NA
AUR58623.1|1127714_1128539_+	ABC transporter	NA	A0A2R8FG22	Brazilian_cedratvirus	22.7	1.0e-08
AUR58624.1|1128538_1129417_+	ABC transporter permease	NA	NA	NA	NA	NA
AUR58625.1|1129668_1129911_-	hypothetical protein	NA	NA	NA	NA	NA
AUR58626.1|1130321_1131437_+	amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUR58627.1|1131465_1132260_+	branched-chain amino acid ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	23.3	1.2e-11
AUR58628.1|1132256_1134122_+	long-chain fatty acid--CoA ligase	NA	A0A1V0SBX8	Catovirus	23.3	9.3e-50
AUR58629.1|1134200_1134833_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
AUR58630.1|1134829_1135132_-	membrane protein	NA	NA	NA	NA	NA
AUR58631.1|1135174_1136695_-|tRNA	lysyl-tRNA synthetase	tRNA	A0A1V0SAC0	Catovirus	36.0	1.2e-82
AUR58632.1|1136701_1137457_-	short-chain dehydrogenase	NA	NA	NA	NA	NA
AUR58633.1|1137486_1138419_-	peptide chain release factor 2	NA	NA	NA	NA	NA
AUR61108.1|1138693_1140394_-	single-stranded DNA exonuclease	NA	A7KV88	Bacillus_phage	28.3	1.3e-50
AUR58634.1|1140375_1141317_-	hypothetical protein	NA	NA	NA	NA	NA
1141213:1141232	attR	GGCCTGCAGCCAGCCGTGCA	NA	NA	NA	NA
AUR61109.1|1141410_1142643_+	cell division protein FtsX	NA	NA	NA	NA	NA
AUR58635.1|1142635_1143331_+	lipoprotein ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.6	7.0e-35
AUR58636.1|1143364_1144192_+	DNAase	NA	NA	NA	NA	NA
AUR58637.1|1144473_1147704_+|protease	serine protease	protease	NA	NA	NA	NA
>prophage 10
CP012135	Bordetella pertussis strain J014, complete genome	4107409	1158613	1220784	4107409	integrase,tRNA	Erysipelothrix_phage(33.33%)	52	1217746:1217805	1220829:1220932
AUR58643.1|1158613_1159516_-|integrase	integrase	integrase	NA	NA	NA	NA
AUR58644.1|1159662_1160286_-	fimbrial protein	NA	NA	NA	NA	NA
AUR58645.1|1160459_1162742_-	malic enzyme	NA	NA	NA	NA	NA
AUR58646.1|1162896_1165593_-	pyruvate dehydrogenase	NA	NA	NA	NA	NA
AUR58647.1|1165718_1166207_+	ArsR family transcriptional regulator	NA	NA	NA	NA	NA
AUR58648.1|1166242_1168105_+	peptide transporter	NA	NA	NA	NA	NA
AUR58649.1|1168083_1168293_+	membrane protein	NA	NA	NA	NA	NA
AUR58650.1|1168617_1171488_+	2-oxoglutarate dehydrogenase	NA	NA	NA	NA	NA
AUR58651.1|1171533_1172748_+	dihydrolipoamide succinyltransferase	NA	NA	NA	NA	NA
AUR58652.1|1172977_1174405_+	dihydrolipoamide dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	28.1	2.1e-41
AUR58653.1|1174502_1175594_+	ATPase	NA	NA	NA	NA	NA
AUR58654.1|1175606_1176365_-	3-oxoacyl-ACP reductase	NA	NA	NA	NA	NA
AUR58655.1|1176452_1177355_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUR58656.1|1177351_1178302_-|integrase	integrase	integrase	NA	NA	NA	NA
AUR58657.1|1178431_1179415_-	LacI family transcriptional regulator	NA	NA	NA	NA	NA
AUR58658.1|1179469_1180192_-	short-chain dehydrogenase	NA	NA	NA	NA	NA
AUR58659.1|1181670_1183026_+|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
AUR58660.1|1183106_1185482_-	transcription accessory protein	NA	NA	NA	NA	NA
AUR58661.1|1185646_1187722_+	helicase	NA	A0A127AW80	Bacillus_phage	30.0	2.4e-75
AUR61110.1|1187783_1188578_-	competence protein ComL	NA	NA	NA	NA	NA
AUR58662.1|1188685_1189648_+	pseudouridine synthase	NA	NA	NA	NA	NA
AUR58663.1|1189635_1190391_+	hypothetical protein	NA	NA	NA	NA	NA
AUR58664.1|1190498_1192136_+	poly(3-hydroxyalkanoate) polymerase	NA	NA	NA	NA	NA
AUR58665.1|1192203_1192941_+	3-ketoacyl-ACP reductase	NA	NA	NA	NA	NA
AUR58666.1|1193043_1193619_+	polyhydroxyalkanoate synthesis repressor PhaR	NA	NA	NA	NA	NA
AUR58667.1|1193791_1194328_+	membrane protein	NA	NA	NA	NA	NA
AUR61111.1|1194360_1194675_+	periplasmic lipoprotein involved in iron transport	NA	NA	NA	NA	NA
AUR58668.1|1194690_1195536_+	FTR1 family iron permease	NA	NA	NA	NA	NA
AUR58669.1|1195574_1196954_+	membrane protein	NA	NA	NA	NA	NA
AUR58670.1|1197031_1197913_+	phenazine biosynthesis protein PhzC/PhzF	NA	NA	NA	NA	NA
AUR58671.1|1198011_1198962_+|integrase	integrase	integrase	NA	NA	NA	NA
AUR58672.1|1198958_1199369_-	lactoylglutathione lyase	NA	NA	NA	NA	NA
AUR58673.1|1199476_1200331_-	2-pyrone-4,6-dicarboxylate hydrolase	NA	NA	NA	NA	NA
AUR58674.1|1200323_1201286_-	lipoprotein	NA	NA	NA	NA	NA
AUR58675.1|1201331_1202456_-	racemase	NA	Q6A202	Oenococcus_phage	28.3	1.5e-31
AUR58676.1|1202561_1203440_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUR58677.1|1203564_1204344_+	short-chain dehydrogenase	NA	NA	NA	NA	NA
AUR58678.1|1204497_1205919_+	multidrug MFS transporter	NA	NA	NA	NA	NA
AUR58679.1|1206353_1208051_+	sodium:proline symporter	NA	NA	NA	NA	NA
AUR58680.1|1208079_1208202_+	hypothetical protein	NA	NA	NA	NA	NA
AUR61112.1|1208277_1209219_-	peptidase S66	NA	NA	NA	NA	NA
AUR58681.1|1209545_1210292_+	hypothetical protein	NA	NA	NA	NA	NA
AUR58682.1|1210299_1211226_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUR58683.1|1211347_1212265_+	oxidoreductase	NA	NA	NA	NA	NA
AUR58684.1|1212304_1213258_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUR58685.1|1213282_1213861_+	hypothetical protein	NA	NA	NA	NA	NA
AUR58686.1|1215534_1216143_+	hypothetical protein	NA	NA	NA	NA	NA
AUR58687.1|1216220_1216574_-	hypothetical protein	NA	NA	NA	NA	NA
AUR61113.1|1216657_1217590_-	succinylglutamate desuccinylase	NA	NA	NA	NA	NA
1217746:1217805	attL	CGCTAGCTGTGAAGATTCAATAGGTTGTATGCATGGTTCATCCGAACCGGATTTGAGAAA	NA	NA	NA	NA
AUR58688.1|1217897_1218800_+|integrase	integrase	integrase	NA	NA	NA	NA
AUR58689.1|1218886_1219837_+|integrase	integrase	integrase	NA	NA	NA	NA
AUR58690.1|1219833_1220784_-|integrase	integrase	integrase	NA	NA	NA	NA
1220829:1220932	attR	TTTCTCAAATCCGGTTCGGATGAACCATGCATACAACCTATTGAATCTTCACAGCTAGCGTTCGTGGCGTGTGACGGGGAGCCTGTCCCCGTGGGGACAGGCTC	NA	NA	NA	NA
>prophage 11
CP012135	Bordetella pertussis strain J014, complete genome	4107409	1271759	1328922	4107409	integrase	Klosneuvirus(16.67%)	51	1285506:1285522	1333246:1333262
AUR58725.1|1271759_1272662_+|integrase	integrase	integrase	NA	NA	NA	NA
AUR58726.1|1272847_1273117_-	hypothetical protein	NA	NA	NA	NA	NA
AUR58727.1|1273355_1273994_+	hypothetical protein	NA	NA	NA	NA	NA
AUR58728.1|1274243_1274780_+	hypothetical protein	NA	NA	NA	NA	NA
AUR58729.1|1274798_1276412_+	autotransporter	NA	NA	NA	NA	NA
AUR58730.1|1276408_1277020_-	hypothetical protein	NA	NA	NA	NA	NA
AUR58731.1|1277242_1278703_+	inosine-5-monophosphate dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	41.3	1.6e-97
AUR58732.1|1278799_1280392_+	GMP synthase	NA	A0A1V0SH76	Hokovirus	33.3	1.0e-17
AUR58733.1|1280745_1281003_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AUR58734.1|1281004_1282345_+	toxin HipA	NA	NA	NA	NA	NA
AUR58735.1|1282440_1283130_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
AUR58736.1|1283142_1284573_+	MFS transporter	NA	NA	NA	NA	NA
1285506:1285522	attL	ACGCTGGCCGGCACGCT	NA	NA	NA	NA
AUR58737.1|1286297_1287119_+	transcriptional regulator	NA	NA	NA	NA	NA
AUR58738.1|1287129_1288701_+	hypothetical protein	NA	NA	NA	NA	NA
AUR58739.1|1288729_1289707_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUR58740.1|1289733_1290537_+	nitrate ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.2	2.7e-30
AUR58741.1|1290533_1291328_+	ABC transporter permease	NA	NA	NA	NA	NA
AUR58742.1|1291335_1292571_+	hypothetical protein	NA	NA	NA	NA	NA
AUR61117.1|1292563_1292998_+	aconitase subunit 2	NA	NA	NA	NA	NA
AUR58743.1|1293747_1294698_+|integrase	integrase	integrase	NA	NA	NA	NA
AUR58744.1|1295319_1297047_-	transporter	NA	NA	NA	NA	NA
AUR58745.1|1297158_1298517_+	mRNA 3'-end processing factor	NA	NA	NA	NA	NA
AUR58746.1|1298809_1299760_+|integrase	integrase	integrase	NA	NA	NA	NA
AUR58747.1|1299800_1300871_+	membrane protein	NA	NA	NA	NA	NA
AUR58748.1|1300893_1301772_-	hypothetical protein	NA	NA	NA	NA	NA
AUR58749.1|1301943_1302915_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AUR58750.1|1303077_1303920_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUR58751.1|1304081_1304762_+	anti-ECFsigma factor ChrR	NA	NA	NA	NA	NA
AUR58752.1|1304755_1305925_+	amine oxidase	NA	NA	NA	NA	NA
AUR58753.1|1305921_1306953_+	alcohol dehydrogenase	NA	A0A2K9L339	Tupanvirus	27.8	1.8e-26
AUR58754.1|1307020_1308238_+	MFS transporter	NA	NA	NA	NA	NA
AUR58755.1|1308272_1309805_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AUR58756.1|1309885_1310509_+	transcriptional regulator	NA	NA	NA	NA	NA
AUR58757.1|1310539_1311151_+	RhtB family transporter	NA	NA	NA	NA	NA
AUR58758.1|1311186_1311657_+	histidine kinase	NA	NA	NA	NA	NA
AUR58759.1|1312088_1313093_+	peptidase M20	NA	NA	NA	NA	NA
AUR58760.1|1313129_1314644_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUR58761.1|1314647_1315607_+	ABC transporter	NA	NA	NA	NA	NA
AUR58762.1|1315584_1316439_+	peptide ABC transporter permease	NA	NA	NA	NA	NA
AUR58763.1|1316440_1318075_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.1	2.9e-15
AUR58764.1|1318158_1319220_+	LacI family transcriptional regulator	NA	NA	NA	NA	NA
AUR58765.1|1319691_1320216_+	DNA-binding protein	NA	J9Q7G7	Salmonella_phage	32.9	6.5e-09
AUR58766.1|1320679_1321582_+|integrase	integrase	integrase	NA	NA	NA	NA
AUR58767.1|1321578_1322613_-	hydrolase	NA	NA	NA	NA	NA
AUR58768.1|1322721_1323360_+	membrane protein	NA	NA	NA	NA	NA
AUR58769.1|1323654_1323882_+	GCN5 family acetyltransferase	NA	NA	NA	NA	NA
AUR58770.1|1324004_1324718_+	methyltransferase type 11	NA	NA	NA	NA	NA
AUR58771.1|1324962_1325913_-|integrase	integrase	integrase	NA	NA	NA	NA
AUR58772.1|1326052_1326298_+	hypothetical protein	NA	NA	NA	NA	NA
AUR58773.1|1326412_1327861_-	2-aminoadipate aminotransferase	NA	NA	NA	NA	NA
AUR58774.1|1327971_1328922_+|integrase	integrase	integrase	NA	NA	NA	NA
1333246:1333262	attR	AGCGTGCCGGCCAGCGT	NA	NA	NA	NA
>prophage 12
CP012135	Bordetella pertussis strain J014, complete genome	4107409	1384416	1439725	4107409	integrase,protease	Enterococcus_phage(16.67%)	49	1433616:1433632	1440234:1440250
AUR58828.1|1384416_1385367_+|integrase	integrase	integrase	NA	NA	NA	NA
AUR58829.1|1385369_1386323_+	hypothetical protein	NA	NA	NA	NA	NA
AUR58830.1|1386350_1387202_+	methenyltetrahydrofolate cyclohydrolase	NA	A0A249XZQ2	Enterococcus_phage	37.6	2.1e-33
AUR58831.1|1387207_1388236_-	lactate dehydrogenase	NA	NA	NA	NA	NA
AUR58832.1|1388232_1389276_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUR58833.1|1389343_1390369_-	peptidase M19	NA	NA	NA	NA	NA
AUR58834.1|1390650_1391904_+	sarcosine oxidase subunit beta	NA	NA	NA	NA	NA
AUR58835.1|1391914_1392187_+	sarcosine oxidase subunit delta	NA	NA	NA	NA	NA
AUR58836.1|1392183_1395123_+	(2Fe-2S)-binding protein	NA	NA	NA	NA	NA
AUR58837.1|1395130_1395730_+	sarcosine oxidase subunit gamma	NA	NA	NA	NA	NA
AUR58838.1|1395730_1396579_+	formyltetrahydrofolate deformylase	NA	NA	NA	NA	NA
AUR58839.1|1396616_1397603_+	hypothetical protein	NA	NA	NA	NA	NA
AUR58840.1|1397618_1399055_+	hypothetical protein	NA	NA	NA	NA	NA
AUR58841.1|1399067_1399859_+	hydrolase	NA	NA	NA	NA	NA
AUR58842.1|1400177_1401233_+	UDP-N-acetylenolpyruvoylglucosamine reductase	NA	NA	NA	NA	NA
AUR58843.1|1401269_1402079_-	4-hydroxy-tetrahydrodipicolinate reductase	NA	NA	NA	NA	NA
AUR58844.1|1402079_1402628_-	membrane protein	NA	NA	NA	NA	NA
AUR61122.1|1402778_1403198_+	Fur family transcriptional regulator	NA	NA	NA	NA	NA
AUR58845.1|1403272_1404934_-	DNA repair protein	NA	NA	NA	NA	NA
AUR58846.1|1404949_1405849_-	inorganic polyphosphate kinase	NA	NA	NA	NA	NA
AUR58847.1|1405963_1406968_+	HrcA family transcriptional regulator	NA	NA	NA	NA	NA
AUR58848.1|1407025_1408114_+	ferrochelatase	NA	NA	NA	NA	NA
AUR61123.1|1408195_1408438_+	hypothetical protein	NA	NA	NA	NA	NA
AUR58849.1|1408579_1409134_+	molecular chaperone GrpE	NA	NA	NA	NA	NA
AUR58850.1|1409141_1409522_+	thioredoxin	NA	NA	NA	NA	NA
AUR58851.1|1409612_1411538_+	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	50.3	1.1e-146
AUR58852.1|1411638_1412772_+	molecular chaperone DnaJ	NA	A0A1V0SBY2	Catovirus	60.8	3.9e-19
AUR58853.1|1412940_1415691_-|protease	zinc protease	protease	A0A2K9LA15	Tupanvirus	28.1	1.5e-19
AUR58854.1|1416023_1416398_+	hypothetical protein	NA	NA	NA	NA	NA
AUR58855.1|1416435_1416978_+	acetyltransferase	NA	NA	NA	NA	NA
AUR58856.1|1416981_1418154_-	von Willebrand factor A	NA	NA	NA	NA	NA
AUR61124.1|1418175_1419063_-	ATP-binding protein	NA	NA	NA	NA	NA
AUR58857.1|1419155_1420106_-|integrase	integrase	integrase	NA	NA	NA	NA
AUR58858.1|1420272_1420626_+	cytochrome C	NA	NA	NA	NA	NA
AUR58859.1|1420638_1421001_+	cytochrome	NA	NA	NA	NA	NA
AUR58860.1|1421042_1421468_-	hypothetical protein	NA	NA	NA	NA	NA
AUR58861.1|1421670_1422927_+	isocitrate dehydrogenase	NA	Q77Z09	Phage_21	64.8	1.2e-11
AUR58862.1|1423146_1424106_+	hypothetical protein	NA	NA	NA	NA	NA
AUR58863.1|1424255_1425497_+	membrane protein	NA	NA	NA	NA	NA
AUR58864.1|1425595_1426546_+|integrase	integrase	integrase	NA	NA	NA	NA
AUR58865.1|1426554_1427250_-	transcriptional regulator	NA	NA	NA	NA	NA
AUR58866.1|1427291_1430006_-	histidine kinase	NA	NA	NA	NA	NA
AUR58867.1|1430071_1430671_-	potassium-transporting ATPase subunit C	NA	NA	NA	NA	NA
AUR58868.1|1430681_1432847_-	potassium-transporting ATPase subunit B	NA	M1HBF8	Paramecium_bursaria_Chlorella_virus	27.1	1.2e-24
AUR58869.1|1432870_1434655_-	ATPase	NA	NA	NA	NA	NA
1433616:1433632	attL	GCTTCGGCCTGGCGCAG	NA	NA	NA	NA
AUR58870.1|1435438_1435711_+	membrane protein	NA	NA	NA	NA	NA
AUR58871.1|1435710_1437777_+	sodium:solute symporter	NA	NA	NA	NA	NA
AUR58872.1|1437773_1438676_-|integrase	integrase	integrase	NA	NA	NA	NA
AUR58873.1|1438822_1439725_-|integrase	integrase	integrase	NA	NA	NA	NA
1440234:1440250	attR	GCTTCGGCCTGGCGCAG	NA	NA	NA	NA
>prophage 13
CP012135	Bordetella pertussis strain J014, complete genome	4107409	1517038	1583271	4107409	integrase	Streptococcus_virus(11.11%)	56	1522665:1522683	1585560:1585578
AUR58950.1|1517038_1517941_+|integrase	integrase	integrase	NA	NA	NA	NA
AUR58951.1|1517947_1519060_-	hypothetical protein	NA	NA	NA	NA	NA
AUR58952.1|1519746_1520949_+	MFS transporter	NA	NA	NA	NA	NA
AUR58953.1|1521152_1523813_+	hypothetical protein	NA	NA	NA	NA	NA
1522665:1522683	attL	CTGCTGCCGCTGGCCGTGC	NA	NA	NA	NA
AUR58954.1|1523825_1527230_+	nuclease	NA	NA	NA	NA	NA
AUR61127.1|1528032_1530123_+	DNA polymerase III subunit gamma/tau	NA	A0A1U9WR94	Streptococcus_virus	38.5	1.1e-43
AUR58955.1|1530169_1530496_+	nucleoid-associated protein	NA	NA	NA	NA	NA
AUR58956.1|1530546_1531155_+	recombination protein RecR	NA	NA	NA	NA	NA
AUR58957.1|1531253_1532204_+|integrase	integrase	integrase	NA	NA	NA	NA
AUR58958.1|1532273_1533038_-	hypothetical protein	NA	NA	NA	NA	NA
AUR61128.1|1533034_1533571_-	hypothetical protein	NA	NA	NA	NA	NA
AUR58959.1|1533737_1534589_-	membrane protein	NA	A0A1I9SA48	Rhodococcus_phage	35.3	7.0e-37
AUR58960.1|1534648_1535275_+	translation factor Sua5	NA	NA	NA	NA	NA
AUR58961.1|1535271_1536174_-|integrase	integrase	integrase	NA	NA	NA	NA
AUR58962.1|1536320_1537433_-	Tat pathway signal protein	NA	NA	NA	NA	NA
AUR58963.1|1537422_1538424_-	aminopeptidase	NA	NA	NA	NA	NA
AUR58964.1|1538529_1540041_-	thiol oxidoreductase	NA	NA	NA	NA	NA
AUR58965.1|1540037_1541342_-	peptidase	NA	NA	NA	NA	NA
AUR61129.1|1541453_1542011_-	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
AUR58966.1|1542281_1542836_+	NADPH-dependent FMN reductase	NA	A0A2P0ZL82	Lactobacillus_phage	32.0	1.7e-15
AUR58967.1|1543291_1543507_-	hypothetical protein	NA	NA	NA	NA	NA
AUR61130.1|1543761_1546359_+	DNA mismatch repair protein MutS	NA	A0A1V0SDQ0	Indivirus	22.6	1.5e-21
AUR58968.1|1546355_1547543_+	cupin	NA	NA	NA	NA	NA
AUR58969.1|1548201_1548816_+	fimbrial protein	NA	NA	NA	NA	NA
AUR58970.1|1548904_1550026_-	lipoprotein	NA	NA	NA	NA	NA
AUR58971.1|1550043_1550949_-	dihydrodipicolinate synthase	NA	NA	NA	NA	NA
AUR58972.1|1551889_1552792_+|integrase	integrase	integrase	NA	NA	NA	NA
AUR58973.1|1552973_1553726_+	glutamine ABC transporter substrate-bindnig protein	NA	NA	NA	NA	NA
AUR58974.1|1553794_1554454_+	glutamine ABC transporter permease	NA	NA	NA	NA	NA
AUR58975.1|1554450_1555179_+	glutamine ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	39.3	3.3e-35
AUR58976.1|1555191_1557471_-	guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	A0A1B1IUF0	uncultured_Mediterranean_phage	32.1	5.9e-06
AUR58977.1|1557495_1557699_-	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
AUR61131.1|1557740_1558346_-	guanylate kinase	NA	U5J9X2	Bacillus_phage	29.6	2.0e-09
AUR58978.1|1558508_1559426_-	cytochrome C	NA	NA	NA	NA	NA
AUR58979.1|1559422_1560136_-	cytochrome C	NA	NA	NA	NA	NA
AUR58980.1|1560373_1561144_+	3-oxoacyl-ACP reductase	NA	NA	NA	NA	NA
AUR58981.1|1561148_1561748_-	NlpC/P60 family protein 2	NA	A0A0A8WF62	Clostridium_phage	41.6	1.4e-20
AUR58982.1|1561992_1563483_+	AMP nucleosidase	NA	NA	NA	NA	NA
AUR58983.1|1563541_1563826_-	DNA-binding protein	NA	NA	NA	NA	NA
AUR58984.1|1563822_1563951_-	hypothetical protein	NA	NA	NA	NA	NA
AUR58985.1|1563963_1564119_-	hypothetical protein	NA	NA	NA	NA	NA
AUR58986.1|1564391_1565318_-	hypothetical protein	NA	NA	NA	NA	NA
AUR58987.1|1565454_1566195_+	ribonuclease PH	NA	NA	NA	NA	NA
AUR58988.1|1566361_1567738_-	2-methylcitrate dehydratase	NA	NA	NA	NA	NA
AUR58989.1|1567919_1568825_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUR58990.1|1570476_1572279_-	diguanylate phosphodiesterase	NA	NA	NA	NA	NA
AUR58991.1|1572405_1573047_+	nucleoside-triphosphate diphosphatase	NA	NA	NA	NA	NA
AUR58992.1|1573145_1574096_+|integrase	integrase	integrase	NA	NA	NA	NA
AUR58993.1|1574117_1575338_+	coproporphyrinogen III oxidase	NA	NA	NA	NA	NA
AUR58994.1|1575523_1576936_+	glutamine synthetase	NA	NA	NA	NA	NA
AUR58995.1|1576999_1578067_+	histidine kinase	NA	Q8QKV7	Ectocarpus_siliculosus_virus	23.5	1.1e-05
AUR58996.1|1578066_1579554_+	chemotaxis protein CheY	NA	NA	NA	NA	NA
AUR61132.1|1579563_1580508_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUR58997.1|1580667_1581366_+	quercetin 2,3-dioxygenase	NA	NA	NA	NA	NA
AUR58998.1|1581443_1582349_+	pirin	NA	NA	NA	NA	NA
AUR58999.1|1582368_1583271_-|integrase	integrase	integrase	NA	NA	NA	NA
1585560:1585578	attR	GCACGGCCAGCGGCAGCAG	NA	NA	NA	NA
>prophage 14
CP012135	Bordetella pertussis strain J014, complete genome	4107409	1619268	1674855	4107409	integrase	Brazilian_cedratvirus(25.0%)	50	1631753:1631770	1675339:1675356
AUR59023.1|1619268_1620219_+|integrase	integrase	integrase	NA	NA	NA	NA
AUR59024.1|1620277_1621051_+	short-chain dehydrogenase	NA	NA	NA	NA	NA
AUR59025.1|1621043_1622600_+	capsular biosynthesis protein	NA	NA	NA	NA	NA
AUR59026.1|1622596_1623547_-|integrase	integrase	integrase	NA	NA	NA	NA
AUR59027.1|1624873_1625476_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
AUR59028.1|1625715_1626417_-	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
AUR59029.1|1626410_1627193_-	leucine/isoleucine/valine transporter ATP-binding subunit	NA	A0A2R8FG22	Brazilian_cedratvirus	25.8	2.0e-09
AUR59030.1|1627377_1628328_-|integrase	integrase	integrase	NA	NA	NA	NA
AUR59031.1|1628426_1629164_-	membrane protein	NA	A0A0S4KZH7	Pseudomonas_phage	46.6	4.1e-41
AUR59032.1|1629353_1630112_-	short-chain dehydrogenase	NA	NA	NA	NA	NA
AUR59033.1|1630158_1631160_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUR59034.1|1631325_1632294_-	phenol degradation protein meta	NA	NA	NA	NA	NA
1631753:1631770	attL	TTGGCCAGCGCGTCGGCG	NA	NA	NA	NA
AUR59035.1|1633833_1634802_+	ATPase AAA	NA	NA	NA	NA	NA
AUR59036.1|1634810_1635752_+	MoxR protein	NA	NA	NA	NA	NA
AUR61135.1|1636225_1637236_+	membrane protein	NA	NA	NA	NA	NA
AUR61136.1|1637226_1638741_+	hypothetical protein	NA	NA	NA	NA	NA
AUR59037.1|1638737_1640084_+	hypothetical protein	NA	NA	NA	NA	NA
AUR61137.1|1640086_1641121_+	haloacid dehalogenase	NA	NA	NA	NA	NA
AUR59038.1|1641170_1642796_+	arylsulfatase	NA	A0A2P0VMN7	Tetraselmis_virus	52.2	2.0e-149
AUR59039.1|1642885_1643365_+	hypothetical protein	NA	NA	NA	NA	NA
AUR59040.1|1643344_1644247_-|integrase	integrase	integrase	NA	NA	NA	NA
AUR59041.1|1644399_1645347_+	hypothetical protein	NA	NA	NA	NA	NA
AUR61138.1|1645400_1647215_-	histidine kinase	NA	NA	NA	NA	NA
AUR59042.1|1647207_1647882_-	LuxR family transcriptional regulator	NA	NA	NA	NA	NA
AUR59043.1|1648011_1651086_+	autotransporter	NA	NA	NA	NA	NA
AUR59044.1|1651099_1651399_-	DNA-binding protein	NA	NA	NA	NA	NA
AUR61139.1|1651713_1652337_-	glutathione S-transferase	NA	NA	NA	NA	NA
AUR59045.1|1652580_1653450_+	alpha-ketoglutarate-dependent 2,4-dichlorophenoxyacetate dioxygenase	NA	NA	NA	NA	NA
AUR59046.1|1653427_1654240_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUR59047.1|1654457_1655384_-	hypothetical protein	NA	NA	NA	NA	NA
AUR59048.1|1655496_1656276_-	short-chain dehydrogenase	NA	NA	NA	NA	NA
AUR59049.1|1656266_1657463_-	lactate dehydrogenase	NA	NA	NA	NA	NA
AUR59050.1|1657493_1658444_-	hydrolase	NA	NA	NA	NA	NA
AUR59051.1|1658665_1659355_+	short-chain dehydrogenase	NA	NA	NA	NA	NA
AUR59052.1|1659419_1660175_+	3-oxoacyl-ACP reductase	NA	NA	NA	NA	NA
AUR59053.1|1660226_1661219_+	MFS transporter	NA	NA	NA	NA	NA
AUR59054.1|1661228_1662182_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUR59055.1|1662297_1663260_+	hypothetical protein	NA	NA	NA	NA	NA
AUR59056.1|1664661_1665090_+	hypothetical protein	NA	NA	NA	NA	NA
AUR59057.1|1665086_1666037_-|integrase	integrase	integrase	NA	NA	NA	NA
AUR59058.1|1666145_1666334_+	hypothetical protein	NA	NA	NA	NA	NA
AUR61140.1|1666330_1667053_-	NADPH-dependent FMN reductase	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	68.2	1.3e-87
AUR59059.1|1667491_1668679_-	membrane protein	NA	NA	NA	NA	NA
AUR61141.1|1668682_1669033_-	ArsR family transcriptional regulator	NA	NA	NA	NA	NA
AUR59060.1|1669266_1670679_-	hypothetical protein	NA	NA	NA	NA	NA
AUR59061.1|1670782_1671754_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUR59062.1|1671767_1672481_+	short-chain dehydrogenase	NA	NA	NA	NA	NA
AUR59063.1|1672485_1673403_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUR59064.1|1673509_1673806_+	membrane protein	NA	NA	NA	NA	NA
AUR59065.1|1673904_1674855_+|integrase	integrase	integrase	NA	NA	NA	NA
1675339:1675356	attR	TTGGCCAGCGCGTCGGCG	NA	NA	NA	NA
>prophage 15
CP012135	Bordetella pertussis strain J014, complete genome	4107409	1863440	1978350	4107409	transposase,integrase,tRNA	Klosneuvirus(20.0%)	112	1883644:1883662	1978757:1978777
AUR59209.1|1863440_1866065_+|tRNA	alanyl-tRNA synthetase	tRNA	A0A1V0SK38	Klosneuvirus	39.4	1.7e-81
AUR59210.1|1866051_1866306_+	hypothetical protein	NA	NA	NA	NA	NA
AUR59211.1|1866372_1866954_-	hypothetical protein	NA	NA	NA	NA	NA
AUR59212.1|1867257_1867518_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
AUR59213.1|1867683_1868307_+	16S rRNA processing protein RimM	NA	NA	NA	NA	NA
AUR59214.1|1868306_1869080_+|tRNA	tRNA (guanine-N1)-methyltransferase	tRNA	NA	NA	NA	NA
AUR59215.1|1869076_1870285_-	class V aminotransferase	NA	NA	NA	NA	NA
AUR59216.1|1870310_1870784_-	endoribonuclease	NA	NA	NA	NA	NA
AUR59217.1|1870857_1871808_-|integrase	integrase	integrase	NA	NA	NA	NA
AUR59218.1|1871906_1872809_-|integrase	integrase	integrase	NA	NA	NA	NA
AUR59219.1|1872955_1874305_-	histidine kinase	NA	NA	NA	NA	NA
AUR59220.1|1875070_1875826_+	membrane protein	NA	NA	NA	NA	NA
AUR59221.1|1875918_1878801_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	37.1	3.7e-138
AUR59222.1|1879123_1879549_+	nucleoside diphosphate kinase	NA	D2E8E1	Anguillid_herpesvirus	43.2	2.1e-21
AUR59223.1|1879576_1880725_+	50S rRNA methyltransferase	NA	NA	NA	NA	NA
AUR59224.1|1880721_1881228_+	membrane protein	NA	NA	NA	NA	NA
AUR59225.1|1881243_1882530_+	4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase	NA	NA	NA	NA	NA
AUR61153.1|1882579_1883875_+|tRNA	histidine--tRNA ligase	tRNA	NA	NA	NA	NA
1883644:1883662	attL	GCTGCGCGACGCCGGCCTG	NA	NA	NA	NA
AUR59226.1|1883876_1884515_+	membrane protein	NA	NA	NA	NA	NA
1883644:1883662	attL	GCTGCGCGACGCCGGCCTG	NA	NA	NA	NA
AUR61154.1|1884520_1885678_+	quinoprotein	NA	NA	NA	NA	NA
AUR59227.1|1885704_1887060_+	GTP-binding protein Der	NA	NA	NA	NA	NA
AUR59228.1|1887063_1888134_+	histidinol-phosphate aminotransferase	NA	A0A1X6WGT4	Pacmanvirus	25.7	2.5e-15
AUR59229.1|1888272_1888509_+	RNA-binding protein Hfq	NA	NA	NA	NA	NA
AUR59230.1|1888596_1889703_+	GTP-binding protein HflX	NA	NA	NA	NA	NA
AUR59231.1|1889668_1890973_+	membrane protein	NA	NA	NA	NA	NA
AUR59232.1|1890991_1891891_+	membrane protein	NA	NA	NA	NA	NA
AUR59233.1|1892074_1893232_+	ATP phosphoribosyltransferase regulatory subunit	NA	NA	NA	NA	NA
AUR59234.1|1893308_1894604_+	adenylosuccinate synthetase	NA	A0A160ER07	Powai_lake_megavirus	33.5	3.0e-63
AUR59235.1|1894717_1895257_+	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
AUR59236.1|1895534_1895747_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
AUR59237.1|1895766_1897797_+	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	41.9	1.0e-65
AUR59238.1|1898482_1900765_+	RNA polymerase sigma factor 70	NA	A0A2I7SAT0	Vibrio_phage	30.1	3.2e-36
AUR59239.1|1901174_1901474_-	hypothetical protein	NA	NA	NA	NA	NA
AUR59240.1|1901758_1902172_+	transcriptional regulator	NA	A0A222YXG1	Escherichia_phage	59.0	3.8e-36
AUR59241.1|1902131_1903082_-|integrase	integrase	integrase	NA	NA	NA	NA
AUR59242.1|1903180_1904131_-|integrase	integrase	integrase	NA	NA	NA	NA
AUR61155.1|1904333_1905416_+	membrane protein	NA	NA	NA	NA	NA
AUR59243.1|1905431_1906193_-	sugar ABC transporter permease	NA	NA	NA	NA	NA
AUR59244.1|1906189_1907113_-	multidrug ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	33.6	1.6e-23
AUR61156.1|1907211_1907712_-	GCN5 family acetyltransferase	NA	NA	NA	NA	NA
AUR59245.1|1907744_1908488_-	permease	NA	NA	NA	NA	NA
AUR59246.1|1908583_1908823_-	membrane protein	NA	NA	NA	NA	NA
AUR59247.1|1908836_1908989_-	hypothetical protein	NA	NA	NA	NA	NA
AUR59248.1|1909074_1910565_-	cytochrome C oxidase	NA	NA	NA	NA	NA
AUR59249.1|1910656_1911595_-	cytochrome oxidase subunit III	NA	NA	NA	NA	NA
AUR59250.1|1911591_1911768_-	cytochrome oxidase	NA	NA	NA	NA	NA
AUR59251.1|1911770_1912433_-	peptidase S41	NA	NA	NA	NA	NA
AUR61157.1|1914054_1914198_-	membrane protein	NA	NA	NA	NA	NA
AUR59252.1|1914194_1915169_-	membrane protein	NA	NA	NA	NA	NA
AUR59253.1|1915383_1916286_+|integrase	integrase	integrase	NA	NA	NA	NA
AUR59254.1|1916282_1917557_-	adenosylmethionine-8-amino-7-oxononanoate aminotransferase	NA	A0A1V0SKB7	Klosneuvirus	28.9	9.6e-14
AUR59255.1|1917660_1918854_+	8-amino-7-oxononanoate synthase	NA	NA	NA	NA	NA
AUR59256.1|1918850_1919504_+	biotin synthase	NA	NA	NA	NA	NA
AUR59257.1|1919500_1920937_+	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
AUR59258.1|1920924_1921284_+	murein hydrolase transporter LrgA	NA	NA	NA	NA	NA
AUR59259.1|1921369_1922020_+	membrane protein	NA	NA	NA	NA	NA
AUR59260.1|1922304_1923207_+|integrase	integrase	integrase	NA	NA	NA	NA
AUR59261.1|1923305_1924169_+|integrase	integrase	integrase	NA	NA	NA	NA
AUR59262.1|1924252_1926118_-	ATPase AAA	NA	NA	NA	NA	NA
1924367:1924385	attR	CAGGCCGGCGTCGCGCAGC	NA	NA	NA	NA
AUR61158.1|1926375_1927896_+	aldehyde dehydrogenase	NA	NA	NA	NA	NA
1924367:1924385	attR	CAGGCCGGCGTCGCGCAGC	NA	NA	NA	NA
AUR59263.1|1927983_1928634_-	NAD(P)H dehydrogenase	NA	NA	NA	NA	NA
AUR59264.1|1929582_1930878_+	membrane protein	NA	NA	NA	NA	NA
AUR59265.1|1930899_1931784_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUR61159.1|1931882_1932758_+	PhzF family phenazine biosynthesis protein	NA	NA	NA	NA	NA
AUR59266.1|1932747_1933104_-	RNA signal recognition particle 4.5S RNA	NA	NA	NA	NA	NA
AUR59267.1|1933234_1934209_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AUR59268.1|1934338_1934518_-	hypothetical protein	NA	NA	NA	NA	NA
AUR59269.1|1934660_1935140_+	hypothetical protein	NA	NA	NA	NA	NA
AUR59270.1|1935150_1935987_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
AUR59271.1|1936099_1936471_+	ArsR family transcriptional regulator	NA	NA	NA	NA	NA
AUR59272.1|1936467_1937019_+	ATPase	NA	NA	NA	NA	NA
AUR59273.1|1937034_1938726_-	sulfate transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	27.3	5.0e-42
AUR59274.1|1938774_1939455_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AUR59275.1|1939702_1940167_-	hypothetical protein	NA	NA	NA	NA	NA
AUR59276.1|1940336_1941266_+	membrane protein	NA	NA	NA	NA	NA
AUR61160.1|1941278_1941872_-	lipoprotein	NA	NA	NA	NA	NA
AUR59277.1|1941999_1943817_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.4	2.3e-37
AUR59278.1|1943900_1944851_-|integrase	integrase	integrase	NA	NA	NA	NA
AUR61161.1|1944949_1945429_-	acetyltransferase	NA	NA	NA	NA	NA
AUR59279.1|1945551_1946454_+|integrase	integrase	integrase	NA	NA	NA	NA
AUR59280.1|1946472_1946820_-	aldehyde-activating protein	NA	NA	NA	NA	NA
AUR59281.1|1946848_1948288_-	DSBA oxidoreductase	NA	A0A0M3UL24	Mycobacterium_phage	37.4	7.4e-55
AUR59282.1|1948306_1948702_-	3-demethylubiquinone-9 3-methyltransferase	NA	NA	NA	NA	NA
AUR59283.1|1948876_1949485_+	peptidase S16	NA	NA	NA	NA	NA
AUR59284.1|1949497_1950316_+	hypothetical protein	NA	A0A1B1INV8	uncultured_Mediterranean_phage	28.8	2.3e-16
AUR59285.1|1950267_1951242_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AUR59286.1|1951270_1952317_-	lipoprotein	NA	NA	NA	NA	NA
AUR59287.1|1952328_1954545_-	aldehyde oxidase	NA	NA	NA	NA	NA
AUR59288.1|1954558_1955017_-	(2Fe-2S)-binding protein	NA	NA	NA	NA	NA
AUR59289.1|1955174_1955519_-	lipoprotein	NA	NA	NA	NA	NA
AUR59290.1|1955675_1956581_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUR61162.1|1956667_1957681_+	pyridoxamine 5'-phosphate oxidase	NA	NA	NA	NA	NA
AUR61163.1|1959660_1960677_+|transposase	transposase	transposase	NA	NA	NA	NA
AUR59291.1|1960819_1962172_-	glutathione reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.6	2.9e-45
AUR59292.1|1962346_1962643_+	MFS transporter	NA	NA	NA	NA	NA
AUR59293.1|1962789_1963794_+|integrase	integrase	integrase	NA	NA	NA	NA
AUR59294.1|1963828_1964731_+|integrase	integrase	integrase	NA	NA	NA	NA
AUR59295.1|1965364_1966003_+	hypothetical protein	NA	NA	NA	NA	NA
AUR59296.1|1966077_1967049_+	hypothetical protein	NA	NA	NA	NA	NA
AUR59297.1|1967052_1967907_+	polysaccharide deacetylase	NA	NA	NA	NA	NA
AUR59298.1|1967925_1968747_+	hydrolase	NA	NA	NA	NA	NA
AUR59299.1|1968778_1969573_+	hypothetical protein	NA	NA	NA	NA	NA
AUR59300.1|1969651_1970227_+	hypothetical protein	NA	NA	NA	NA	NA
AUR61164.1|1970223_1971018_+	oxidoreductase	NA	NA	NA	NA	NA
AUR59301.1|1971303_1972809_-	microcystin degradation protein MlrC	NA	NA	NA	NA	NA
AUR59302.1|1972850_1973633_-	exodeoxyribonuclease III	NA	NA	NA	NA	NA
AUR59303.1|1973702_1974149_-	membrane protein	NA	NA	NA	NA	NA
AUR59304.1|1974145_1975372_-	NnrS family protein	NA	NA	NA	NA	NA
AUR59305.1|1975364_1975769_-	preprotein translocase subunit TatC	NA	NA	NA	NA	NA
AUR59306.1|1975928_1976231_+	SelT/selW/selH domain protein	NA	NA	NA	NA	NA
AUR59307.1|1976227_1977130_-|integrase	integrase	integrase	NA	NA	NA	NA
AUR59308.1|1977399_1978350_-|integrase	integrase	integrase	NA	NA	NA	NA
1978757:1978777	attR	CCGCCAGCGCGCGCAGCTTGC	NA	NA	NA	NA
>prophage 16
CP012135	Bordetella pertussis strain J014, complete genome	4107409	2149977	2214835	4107409	transposase,protease,integrase,tRNA	Lake_Baikal_phage(13.33%)	56	2196830:2196849	2213563:2213582
AUR59437.1|2149977_2151282_-|protease	Clp protease ATP-binding protein	protease	G3M9Z9	Bacillus_virus	53.8	3.2e-129
AUR59438.1|2151386_2152040_-|protease	Clp protease ClpP	protease	A0A223W000	Agrobacterium_phage	57.5	6.8e-56
AUR59439.1|2152042_2153353_-	trigger factor	NA	NA	NA	NA	NA
AUR59440.1|2153549_2154110_+	hypothetical protein	NA	K4K6D8	Caulobacter_phage	33.7	1.0e-23
AUR59441.1|2154221_2154422_-	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.4	7.4e-14
AUR59442.1|2154767_2155334_-	hypothetical protein	NA	NA	NA	NA	NA
AUR59443.1|2155417_2155621_-	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	62.1	1.6e-16
AUR59444.1|2155927_2156248_-	hypothetical protein	NA	NA	NA	NA	NA
AUR59445.1|2156289_2156571_-	hypothetical protein	NA	NA	NA	NA	NA
AUR59446.1|2156645_2157902_-	autotransporter	NA	NA	NA	NA	NA
AUR59447.1|2158284_2158614_+	hypothetical protein	NA	NA	NA	NA	NA
AUR59448.1|2160184_2161006_+	2,3,4,5-tetrahydropyridine-2,6-carboxylate N-succinyltransferase	NA	NA	NA	NA	NA
AUR59449.1|2161005_2162145_+	succinyl-diaminopimelate desuccinylase	NA	NA	NA	NA	NA
AUR59450.1|2162151_2163048_+	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AUR59451.1|2163062_2164970_+	ABC transporter	NA	A0A2K9L0W2	Tupanvirus	31.8	1.1e-66
AUR59452.1|2165329_2167942_+	TonB-dependent receptor	NA	NA	NA	NA	NA
AUR59453.1|2167994_2170295_-	DNA helicase	NA	A7KV33	Bacillus_phage	35.9	9.9e-110
AUR59454.1|2170291_2171500_-	aminotransferase	NA	NA	NA	NA	NA
AUR59455.1|2171761_2172136_+	hypothetical protein	NA	NA	NA	NA	NA
AUR59456.1|2172132_2173035_-|integrase	integrase	integrase	NA	NA	NA	NA
AUR61176.1|2173181_2174579_-	rRNA methyltransferase	NA	NA	NA	NA	NA
AUR59457.1|2175235_2176201_+	riboflavin kinase	NA	NA	NA	NA	NA
AUR59458.1|2176190_2179052_+|tRNA	isoleucine--tRNA ligase	tRNA	A0A1V0SJ93	Klosneuvirus	25.5	1.0e-71
AUR59459.1|2179054_2179561_+	peptidase A8	NA	NA	NA	NA	NA
AUR59460.1|2179665_2180874_+	phosphopantothenate synthase	NA	Q9HH70	Methanothermobacter_phage	30.0	3.8e-36
AUR59461.1|2180875_2181814_-	membrane protein	NA	NA	NA	NA	NA
AUR59462.1|2181975_2182449_+	AsnC family transcriptional regulator	NA	NA	NA	NA	NA
AUR59463.1|2182445_2183396_-|integrase	integrase	integrase	NA	NA	NA	NA
AUR59464.1|2183506_2183947_-	hypothetical protein	NA	NA	NA	NA	NA
AUR59465.1|2184075_2185305_-	lytic transglycosylase	NA	NA	NA	NA	NA
AUR59466.1|2185343_2186165_-	hypothetical protein	NA	NA	NA	NA	NA
AUR59467.1|2186218_2187370_+	hypothetical protein	NA	NA	NA	NA	NA
AUR59468.1|2187461_2187932_-	hypothetical protein	NA	NA	NA	NA	NA
AUR59469.1|2190500_2193050_+	cyanophycin synthetase	NA	NA	NA	NA	NA
AUR59470.1|2193120_2195694_+	cyanophycin synthetase	NA	NA	NA	NA	NA
AUR59471.1|2195959_2196160_+	general stress protein CsbD	NA	NA	NA	NA	NA
AUR59472.1|2196191_2196353_+	membrane protein	NA	NA	NA	NA	NA
AUR59473.1|2196410_2196749_+	phospholipid-binding protein	NA	NA	NA	NA	NA
2196830:2196849	attL	GCCTGTCCCGGCGGGGACAG	NA	NA	NA	NA
AUR59474.1|2196897_2197800_-|integrase	integrase	integrase	NA	NA	NA	NA
AUR59475.1|2198622_2199291_+	GDSL family lipase	NA	NA	NA	NA	NA
AUR61177.1|2199272_2201228_-	peptidylprolyl isomerase	NA	NA	NA	NA	NA
AUR59476.1|2201470_2202220_+	membrane protein	NA	A0A2H4PGQ5	Escherichia_phage	27.8	1.5e-14
AUR59477.1|2202232_2203096_+	competence protein ComJ	NA	NA	NA	NA	NA
AUR59478.1|2203099_2204515_-	dihydrolipoamide dehydrogenase	NA	NA	NA	NA	NA
AUR59479.1|2204648_2205377_-	glutathione peroxidase	NA	A0A1D8KSL1	Synechococcus_phage	56.8	9.6e-43
AUR59480.1|2205515_2205716_-	heavy metal transporter	NA	NA	NA	NA	NA
AUR59481.1|2205891_2206290_+	MerR family transcriptional regulator	NA	NA	NA	NA	NA
AUR59482.1|2206313_2207714_-	23S rRNA methyltransferase	NA	A0A2K5B251	Erysipelothrix_phage	26.5	7.3e-31
AUR59483.1|2207832_2208585_-	hypothetical protein	NA	NA	NA	NA	NA
AUR59484.1|2208873_2209473_-	hypothetical protein	NA	NA	NA	NA	NA
AUR59485.1|2209577_2210357_-	3'-5' exonuclease	NA	NA	NA	NA	NA
AUR59486.1|2210353_2211238_-	peptidase	NA	A0A292GJG6	Xanthomonas_phage	49.5	4.6e-15
AUR59487.1|2211255_2212035_-	protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	46.9	4.8e-32
AUR59488.1|2212019_2212778_-	stationary phase survival protein SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	51.2	1.4e-68
AUR61178.1|2212915_2213551_+	glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
AUR61179.1|2213818_2214835_+|transposase	transposase	transposase	NA	NA	NA	NA
2213563:2213582	attR	GCCTGTCCCGGCGGGGACAG	NA	NA	NA	NA
>prophage 17
CP012135	Bordetella pertussis strain J014, complete genome	4107409	2219785	2278728	4107409	integrase	Klosneuvirus(33.33%)	59	2230455:2230514	2278821:2278972
AUR59493.1|2219785_2220688_-|integrase	integrase	integrase	NA	NA	NA	NA
AUR59494.1|2220834_2221785_-|integrase	integrase	integrase	NA	NA	NA	NA
AUR59495.1|2221883_2222444_-	L-2,4-diaminobutyric acid acetyltransferase	NA	NA	NA	NA	NA
AUR59496.1|2222440_2222986_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
AUR59497.1|2223181_2224210_+	silent information regulator protein Sir2	NA	NA	NA	NA	NA
AUR59498.1|2224250_2225591_+	hypothetical protein	NA	A0A1V0SKB7	Klosneuvirus	22.8	8.8e-18
AUR59499.1|2225699_2226704_+	C4-dicarboxylate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUR59500.1|2226810_2229411_+	C4-dicarboxylate ABC transporter	NA	NA	NA	NA	NA
AUR59501.1|2229557_2230460_+|integrase	integrase	integrase	NA	NA	NA	NA
2230455:2230514	attL	AGCTAGCTGTGAAGATTCAATAGGTTGTATGCATGGTTCATCCGAACCGGATTTGAGAAA	NA	NA	NA	NA
AUR59502.1|2230606_2231509_+|integrase	integrase	integrase	NA	NA	NA	NA
AUR59503.1|2231505_2231778_-	hypothetical protein	NA	NA	NA	NA	NA
AUR61180.1|2232036_2234748_-	autotransporter	NA	NA	NA	NA	NA
AUR59504.1|2235402_2236860_+	cardiolipin synthetase	NA	NA	NA	NA	NA
AUR59505.1|2236856_2237207_-	anti-sigma factor antagonist	NA	NA	NA	NA	NA
AUR59506.1|2237350_2237779_+	serine/threonine protein kinase	NA	NA	NA	NA	NA
AUR59507.1|2237862_2239026_+	alanine racemase	NA	NA	NA	NA	NA
AUR59508.1|2239022_2241464_-	MFS transporter	NA	NA	NA	NA	NA
AUR59509.1|2241548_2243570_+	regulator	NA	NA	NA	NA	NA
AUR59510.1|2243566_2244754_+	hypothetical protein	NA	NA	NA	NA	NA
AUR59511.1|2246080_2246281_-	hypothetical protein	NA	NA	NA	NA	NA
AUR61181.1|2246317_2247016_+	hypothetical protein	NA	NA	NA	NA	NA
AUR59512.1|2247190_2247793_+	RNA polymerase sigma factor	NA	NA	NA	NA	NA
AUR59513.1|2247813_2249616_-	type III secretion protein	NA	NA	NA	NA	NA
AUR59514.1|2249606_2250005_-	hypothetical protein	NA	NA	NA	NA	NA
AUR59515.1|2250001_2251051_-	type III secretion protein	NA	NA	NA	NA	NA
AUR59516.1|2251047_2251848_-	type III secretion system protein	NA	NA	NA	NA	NA
AUR61182.1|2251859_2252126_-	type III secretion protein HrpO	NA	NA	NA	NA	NA
AUR59517.1|2252131_2252803_-	type III secretion system protein SsaR	NA	NA	NA	NA	NA
AUR61183.1|2252799_2253879_-	type III secretion system protein	NA	NA	NA	NA	NA
AUR59518.1|2253875_2254424_-	hypothetical protein	NA	NA	NA	NA	NA
AUR59519.1|2254420_2254930_-	type III secretion protein	NA	NA	NA	NA	NA
AUR59520.1|2254929_2256264_-	ATP synthase	NA	NA	NA	NA	NA
AUR61184.1|2256268_2256832_-	type III secretion system protein	NA	NA	NA	NA	NA
AUR59521.1|2256876_2257539_-	hypothetical protein	NA	NA	NA	NA	NA
AUR59522.1|2257531_2258356_-	type III secretion system protein	NA	NA	NA	NA	NA
AUR59523.1|2258352_2258760_-	type III secretion protein	NA	NA	NA	NA	NA
AUR59524.1|2258756_2259278_-	hypothetical protein	NA	NA	NA	NA	NA
AUR59525.1|2259282_2259744_-	hypothetical protein	NA	NA	NA	NA	NA
AUR59526.1|2259767_2260970_-	membrane protein	NA	NA	NA	NA	NA
AUR59527.1|2260999_2261941_-	membrane protein	NA	NA	NA	NA	NA
AUR59528.1|2261988_2262474_-	hypothetical protein	NA	NA	NA	NA	NA
AUR59529.1|2262489_2262765_-	hypothetical protein	NA	NA	NA	NA	NA
AUR59530.1|2262786_2263404_-	hypothetical protein	NA	NA	NA	NA	NA
AUR59531.1|2263567_2264665_+	membrane protein	NA	NA	NA	NA	NA
AUR59532.1|2264661_2265039_+	hypothetical protein	NA	NA	NA	NA	NA
AUR59533.1|2265043_2265454_+	hypothetical protein	NA	NA	NA	NA	NA
AUR59534.1|2265450_2265819_+	hypothetical protein	NA	NA	NA	NA	NA
AUR61185.1|2265815_2267915_+	Low calcium response locus protein D	NA	NA	NA	NA	NA
AUR59535.1|2267911_2269192_+	type III secretion protein	NA	NA	NA	NA	NA
AUR59536.1|2269232_2269532_+	hypothetical protein	NA	NA	NA	NA	NA
AUR59537.1|2269521_2269788_+	type III secretion protein	NA	NA	NA	NA	NA
AUR59538.1|2269823_2270279_-	hypothetical protein	NA	NA	NA	NA	NA
AUR59539.1|2270669_2271572_+|integrase	integrase	integrase	NA	NA	NA	NA
AUR59540.1|2271873_2272350_-	transcription elongation factor GreA	NA	NA	NA	NA	NA
AUR59541.1|2272973_2274611_+	chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	30.2	8.8e-12
AUR59542.1|2274641_2275955_-	uracil transporter	NA	Q9KX94	Enterobacteria_phage	67.1	2.1e-149
AUR61186.1|2276115_2276406_+	hypothetical protein	NA	NA	NA	NA	NA
AUR59543.1|2276506_2277829_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUR59544.1|2277825_2278728_-|integrase	integrase	integrase	NA	NA	NA	NA
2278821:2278972	attR	TTTCTCAAATCCGGTTCGGATGAACCATGCATACAACCTATTGAATCTTCACAGCTAGCTCGCGGCCCGACAACAGTTCGGCGCGGTACCCTTCGGCCTGCAGGCGCGCGGCGGCGAACTCCTCCAGCACGTCCTGCTCCAGGGCGCTGCGC	NA	NA	NA	NA
>prophage 18
CP012135	Bordetella pertussis strain J014, complete genome	4107409	2577612	2644064	4107409	transposase,integrase	uncultured_Caudovirales_phage(40.0%)	58	2573740:2573758	2647910:2647928
2573740:2573758	attL	GCGCCGCCTGGCGCCGCTG	NA	NA	NA	NA
AUR59787.1|2577612_2578515_+|integrase	integrase	integrase	NA	NA	NA	NA
AUR59788.1|2578530_2578743_+	hypothetical protein	NA	NA	NA	NA	NA
AUR59789.1|2578884_2579457_+	flagellar basal body protein FliL	NA	NA	NA	NA	NA
AUR59790.1|2579459_2580470_+	flagellar motor switch protein FliM	NA	NA	NA	NA	NA
AUR59791.1|2580462_2580963_+	flagellar motor switch protein FliN	NA	NA	NA	NA	NA
AUR59792.1|2580973_2581315_+	flagellar assembly protein FliO	NA	NA	NA	NA	NA
AUR61207.1|2581383_2582118_+	flagellar biosynthesis protein flip	NA	NA	NA	NA	NA
AUR59793.1|2582134_2582404_+	flagellar biosynthetic protein FliQ	NA	NA	NA	NA	NA
AUR59794.1|2582426_2583215_+	flagellar biosynthesis protein FliR	NA	NA	NA	NA	NA
AUR61208.1|2583261_2584278_-|transposase	transposase	transposase	NA	NA	NA	NA
AUR59795.1|2584494_2585937_-	chemotaxis protein	NA	A0A1B0V854	Salmonella_phage	41.8	1.0e-35
AUR59796.1|2586115_2587735_-	chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	45.3	1.5e-08
AUR59797.1|2587855_2589676_-	chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	52.6	6.4e-11
AUR59798.1|2589754_2591287_-	flagellar hook protein FlgL	NA	NA	NA	NA	NA
AUR59799.1|2591320_2592967_-	flagellar hook protein FlgK	NA	NA	NA	NA	NA
AUR59800.1|2593036_2594059_-	flagellar rod assembly protein FlgJ	NA	A0A088F6W1	Sulfitobacter_phage	31.4	1.9e-12
AUR59801.1|2594076_2595210_-	flagellar P-ring protein FlgI	NA	NA	NA	NA	NA
AUR59802.1|2595212_2595902_-	flagellar L-ring protein FlgH	NA	NA	NA	NA	NA
AUR59803.1|2595901_2596687_-	flagellar basal body rod protein FlgG	NA	NA	NA	NA	NA
AUR59804.1|2596730_2597495_-	flagellar basal body rod protein FlgF	NA	NA	NA	NA	NA
AUR59805.1|2597533_2598955_-	flagellar hook protein FlgE	NA	NA	NA	NA	NA
AUR59806.1|2599020_2599725_-	flagellar basal body rod modification protein	NA	NA	NA	NA	NA
AUR59807.1|2599772_2600192_-	flagellar basal body rod protein FlgC	NA	NA	NA	NA	NA
AUR59808.1|2600204_2600612_-	flagellar basal-body rod protein FlgB	NA	NA	NA	NA	NA
AUR61209.1|2600795_2601506_+	flagellar basal body P-ring biosynthesis protein FlgA	NA	NA	NA	NA	NA
AUR59809.1|2601632_2601923_+	flagellar biosynthesis anti-sigma factor FlgM	NA	NA	NA	NA	NA
AUR59810.1|2601940_2602423_+	hypothetical protein	NA	NA	NA	NA	NA
AUR59811.1|2606928_2608083_-	flagellar biosynthesis protein FlhB	NA	NA	NA	NA	NA
AUR61210.1|2608388_2609405_+|transposase	transposase	transposase	NA	NA	NA	NA
AUR59812.1|2609651_2610440_+	amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUR59813.1|2610506_2611187_+	cysteine ABC transporter permease	NA	NA	NA	NA	NA
AUR59814.1|2611183_2611954_+	ATP-binding protein	NA	G9BWD6	Planktothrix_phage	39.1	9.8e-30
AUR59815.1|2612052_2613003_+|integrase	integrase	integrase	NA	NA	NA	NA
AUR59816.1|2613058_2613976_-	2-dehydropantoate 2-reductase	NA	NA	NA	NA	NA
AUR59817.1|2613986_2615165_-	mandelate racemase	NA	NA	NA	NA	NA
AUR59818.1|2615184_2616180_-	hypothetical protein	NA	NA	NA	NA	NA
AUR59819.1|2617768_2618377_+	isopropylmalate isomerase	NA	NA	NA	NA	NA
AUR59820.1|2618364_2619405_+	LacI family transcriptional regulator	NA	NA	NA	NA	NA
AUR59821.1|2619422_2620385_-	hypothetical protein	NA	NA	NA	NA	NA
AUR59822.1|2620381_2621575_-	formyl-CoA transferase	NA	NA	NA	NA	NA
AUR59823.1|2621571_2622369_-	citrate synthase	NA	NA	NA	NA	NA
AUR59824.1|2622394_2623381_-	hypothetical protein	NA	NA	NA	NA	NA
AUR59825.1|2623399_2625439_-	acetyl-CoA synthetase	NA	NA	NA	NA	NA
AUR61211.1|2625640_2626321_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AUR59826.1|2626334_2627246_-	malyl-CoA thiolesterase	NA	NA	NA	NA	NA
AUR59827.1|2627242_2627821_-	NADPH-dependent FMN reductase	NA	NA	NA	NA	NA
AUR59828.1|2627959_2628865_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUR59829.1|2628872_2632292_+	nuclease	NA	NA	NA	NA	NA
AUR59830.1|2632279_2634880_-	autotransporter	NA	NA	NA	NA	NA
AUR59831.1|2635835_2636444_-	PadR family transcriptional regulator	NA	NA	NA	NA	NA
AUR59832.1|2636861_2637620_+	hypothetical protein	NA	NA	NA	NA	NA
AUR59833.1|2637616_2638819_+	cardiolipin synthase 2	NA	NA	NA	NA	NA
AUR59834.1|2638815_2639016_+	hypothetical protein	NA	NA	NA	NA	NA
AUR59835.1|2639006_2639957_-|integrase	integrase	integrase	NA	NA	NA	NA
AUR59836.1|2640864_2642010_+	hypothetical protein	NA	NA	NA	NA	NA
AUR59837.1|2641996_2642752_+	permease	NA	NA	NA	NA	NA
AUR59838.1|2642868_2643048_+	hypothetical protein	NA	NA	NA	NA	NA
AUR59839.1|2643113_2644064_-|integrase	integrase	integrase	NA	NA	NA	NA
2647910:2647928	attR	GCGCCGCCTGGCGCCGCTG	NA	NA	NA	NA
>prophage 19
CP012135	Bordetella pertussis strain J014, complete genome	4107409	2672227	2709591	4107409	integrase	Planktothrix_phage(33.33%)	40	2665019:2665038	2711737:2711756
2665019:2665038	attL	GCGCCAGCTGGCGCAGGCGC	NA	NA	NA	NA
AUR59857.1|2672227_2673130_+|integrase	integrase	integrase	NA	NA	NA	NA
AUR59858.1|2673228_2674179_+|integrase	integrase	integrase	NA	NA	NA	NA
AUR59859.1|2674271_2674811_+	peroxiredoxin	NA	NA	NA	NA	NA
AUR59860.1|2674917_2675262_-	arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	58.4	3.0e-31
AUR59861.1|2675319_2676768_-	carnitine dehydratase	NA	NA	NA	NA	NA
AUR61214.1|2676955_2677282_-	hypothetical protein	NA	NA	NA	NA	NA
AUR59862.1|2678918_2680097_+	hypothetical protein	NA	NA	NA	NA	NA
AUR59863.1|2680179_2680680_+	glutathione peroxidase	NA	Q6VZR0	Canarypox_virus	38.4	4.7e-25
AUR59864.1|2680789_2681491_+	glutathione S-transferase	NA	NA	NA	NA	NA
AUR59865.1|2681502_2681967_+	GNAT family acetyltransferase	NA	NA	NA	NA	NA
AUR59866.1|2681981_2682257_+	biotin--protein ligase	NA	NA	NA	NA	NA
AUR59867.1|2682253_2683030_+	lipoate--protein ligase	NA	NA	NA	NA	NA
AUR59868.1|2683058_2683886_+	lipoprotein	NA	NA	NA	NA	NA
AUR59869.1|2684011_2684482_+	hypothetical protein	NA	NA	NA	NA	NA
AUR59870.1|2684608_2685502_+	phosphatidylserine decarboxylase	NA	NA	NA	NA	NA
AUR59871.1|2685549_2686731_+	(S)-2-hydroxy-acid oxidase	NA	NA	NA	NA	NA
AUR59872.1|2686743_2687559_-	iron ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUR59873.1|2687692_2688220_-	hypothetical protein	NA	NA	NA	NA	NA
AUR61215.1|2688216_2688714_-	hypothetical protein	NA	NA	NA	NA	NA
AUR59874.1|2688861_2689239_+	membrane protein	NA	NA	NA	NA	NA
AUR59875.1|2689196_2689481_+	hypothetical protein	NA	NA	NA	NA	NA
AUR59876.1|2689460_2690411_-|integrase	integrase	integrase	NA	NA	NA	NA
AUR61216.1|2690509_2691121_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
AUR59877.1|2691355_2692483_+	leucine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUR59878.1|2692593_2693682_-	glycerol-3-phosphate transporter ATP-binding subunit	NA	G9BWD6	Planktothrix_phage	31.2	2.2e-19
AUR59879.1|2693734_2694586_-	glycerol-3-phosphate transporter membrane protein	NA	NA	NA	NA	NA
AUR59880.1|2694605_2695487_-	glycerol-3-phosphate transporter permease	NA	NA	NA	NA	NA
AUR61217.1|2695663_2696977_-	glycerol-3-phosphate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUR59881.1|2697187_2698021_+	pyrroline-5-carboxylate reductase	NA	NA	NA	NA	NA
AUR59882.1|2698017_2698599_+	membrane protein	NA	A0A2I7SAW6	Vibrio_phage	37.3	9.4e-17
AUR59883.1|2698952_2699903_+|integrase	integrase	integrase	NA	NA	NA	NA
AUR59884.1|2699918_2701034_+	leucine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUR59885.1|2701136_2702063_+	branched-chain amino acid transporter permease subunit LivH	NA	NA	NA	NA	NA
AUR59886.1|2702062_2703301_+	leucine/isoleucine/valine transporter permease subunit	NA	NA	NA	NA	NA
AUR59887.1|2703297_2704065_+	leucine/isoleucine/valine transporter ATP-binding subunit	NA	A0A2H4PQG7	Staphylococcus_phage	26.4	1.2e-14
AUR59888.1|2704065_2704767_+	leucine/isoleucine/valine transporter ATP-binding subunit	NA	G9BWD6	Planktothrix_phage	30.4	1.3e-17
AUR61218.1|2704848_2705295_-	glutamate racemase	NA	NA	NA	NA	NA
AUR59889.1|2706184_2706823_+	glutathione S-transferase	NA	NA	NA	NA	NA
AUR59890.1|2707591_2708542_+|integrase	integrase	integrase	NA	NA	NA	NA
AUR59891.1|2708640_2709591_+|integrase	integrase	integrase	NA	NA	NA	NA
2711737:2711756	attR	GCGCCAGCTGGCGCAGGCGC	NA	NA	NA	NA
>prophage 20
CP012135	Bordetella pertussis strain J014, complete genome	4107409	2808718	2863235	4107409	transposase,integrase	Diachasmimorpha_longicaudata_entomopoxvirus(20.0%)	49	2830338:2830356	2866798:2866816
AUR59973.1|2808718_2809621_-|integrase	integrase	integrase	NA	NA	NA	NA
AUR59974.1|2809997_2810603_+	fimbrial protein	NA	NA	NA	NA	NA
AUR59975.1|2810656_2811970_-	phenylacetate--CoA ligase	NA	NA	NA	NA	NA
AUR59976.1|2812044_2812515_-	phenylacetic acid degradation protein	NA	NA	NA	NA	NA
AUR59977.1|2812514_2813303_-	enoyl-CoA hydratase	NA	NA	NA	NA	NA
AUR59978.1|2813313_2814966_-	aldehyde dehydrogenase	NA	NA	NA	NA	NA
AUR59979.1|2815053_2816004_-|integrase	integrase	integrase	NA	NA	NA	NA
AUR61226.1|2817165_2817672_-	phenylacetate-CoA oxygenase	NA	NA	NA	NA	NA
AUR59980.1|2817668_2818433_-	phenylacetic acid degradation protein	NA	NA	NA	NA	NA
AUR59981.1|2818448_2818733_-	phenylacetate-CoA oxygenase	NA	NA	NA	NA	NA
AUR59982.1|2818797_2819787_-	phenylacetate-CoA oxygenase	NA	NA	NA	NA	NA
AUR59983.1|2819958_2820888_+	phenylacetic acid degradation protein	NA	NA	NA	NA	NA
AUR59984.1|2820859_2821546_-	NAD(P)H-hydrate epimerase	NA	NA	NA	NA	NA
AUR59985.1|2821579_2822125_-	oligoribonuclease	NA	Q8B5Y0	Diachasmimorpha_longicaudata_entomopoxvirus	37.7	2.1e-26
AUR59986.1|2822169_2823435_+	peptidase M48	NA	NA	NA	NA	NA
AUR59987.1|2823431_2824334_+	GTPase RsgA	NA	NA	NA	NA	NA
AUR59988.1|2825515_2826460_-	peptide ABC transporter	NA	NA	NA	NA	NA
AUR59989.1|2826554_2828072_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUR59990.1|2828113_2829742_-	gamma-glutamyltransferase	NA	NA	NA	NA	NA
AUR59991.1|2829849_2830731_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
2830338:2830356	attL	GCCGCTGGTCGTGCTGGCG	NA	NA	NA	NA
AUR59992.1|2830991_2831219_+	hypothetical protein	NA	NA	NA	NA	NA
AUR59993.1|2833843_2834218_+	endonuclease	NA	F4YXR7	Roseobacter_phage	54.4	2.1e-25
AUR59994.1|2834242_2834581_-	hypothetical protein	NA	NA	NA	NA	NA
AUR59995.1|2834624_2836259_-	NAD synthetase	NA	A0A2L0UZF5	Agrobacterium_phage	36.6	8.3e-87
AUR59996.1|2836297_2837644_-	mechanosensitive ion channel protein MscS	NA	NA	NA	NA	NA
AUR61227.1|2837751_2839173_+	argininosuccinate lyase	NA	NA	NA	NA	NA
AUR59997.1|2839242_2839827_-	nitroreductase	NA	NA	NA	NA	NA
AUR59998.1|2839929_2840880_-|integrase	integrase	integrase	NA	NA	NA	NA
AUR59999.1|2841014_2842121_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUR60000.1|2842131_2843229_+	molybdenum cofactor biosynthesis protein MoeA	NA	NA	NA	NA	NA
AUR60001.1|2843373_2844579_-	molybdopterin biosynthesis protein MoeA	NA	NA	NA	NA	NA
AUR60002.1|2844585_2845107_-	molybdopterin biosynthesis protein B	NA	NA	NA	NA	NA
AUR61228.1|2845103_2845586_-	molybdenum cofactor biosynthesis protein MoaE	NA	NA	NA	NA	NA
AUR60003.1|2845591_2845843_-	molybdopterin converting factor	NA	NA	NA	NA	NA
AUR60004.1|2845823_2846309_-	molybdenum cofactor biosynthesis protein C	NA	NA	NA	NA	NA
AUR60005.1|2846444_2849906_+	hypothetical protein	NA	NA	NA	NA	NA
AUR60006.1|2849923_2850808_+	carboxymethylenebutenolidase	NA	NA	NA	NA	NA
AUR60007.1|2850817_2851249_-	lipoprotein	NA	NA	NA	NA	NA
AUR61229.1|2851495_2851999_+	peroxiredoxin	NA	M1I839	Pelagibacter_phage	44.1	1.8e-24
AUR60008.1|2852076_2853477_+	MFS transporter	NA	NA	NA	NA	NA
AUR60009.1|2853551_2854427_-	membrane protein	NA	NA	NA	NA	NA
AUR61230.1|2854423_2855431_-	biotin synthase	NA	NA	NA	NA	NA
AUR60010.1|2855898_2856204_+	hypothetical protein	NA	NA	NA	NA	NA
AUR60011.1|2856294_2856885_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
AUR61231.1|2857075_2858092_-|transposase	transposase	transposase	NA	NA	NA	NA
AUR60012.1|2858283_2860620_-	ATPase P	NA	E4ZFI9	Streptococcus_phage	42.8	3.2e-124
AUR60013.1|2860702_2861137_+	MerR family transcriptional regulator	NA	NA	NA	NA	NA
AUR60014.1|2861283_2862186_+|integrase	integrase	integrase	NA	NA	NA	NA
AUR60015.1|2862332_2863235_+|integrase	integrase	integrase	NA	NA	NA	NA
2866798:2866816	attR	CGCCAGCACGACCAGCGGC	NA	NA	NA	NA
>prophage 21
CP012135	Bordetella pertussis strain J014, complete genome	4107409	2871260	2928046	4107409	integrase,protease	uncultured_Mediterranean_phage(28.57%)	41	2872212:2872271	2928047:2928149
AUR60022.1|2871260_2872163_-|integrase	integrase	integrase	NA	NA	NA	NA
2872212:2872271	attL	CCGGCCGGGCTCCTTGAGTGAACTGGGGGGGTGGCGATTTCCAGTTTCTCAAATCCGGTT	NA	NA	NA	NA
AUR60023.1|2873917_2874184_-	hypothetical protein	NA	NA	NA	NA	NA
AUR60024.1|2874891_2875230_+	nitrogen regulatory protein P-II 1	NA	NA	NA	NA	NA
AUR60025.1|2876558_2878838_-	autotransporter	NA	NA	NA	NA	NA
AUR60026.1|2879783_2880386_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
AUR60027.1|2880482_2881772_+	MFS transporter	NA	NA	NA	NA	NA
AUR60028.1|2881829_2882561_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.0	1.4e-12
AUR60029.1|2882557_2883361_-	ABC transporter	NA	A0A2H4PQG7	Staphylococcus_phage	23.5	7.9e-14
AUR60030.1|2883357_2884446_-	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
AUR60031.1|2884442_2885372_-	ABC transporter permease	NA	NA	NA	NA	NA
AUR60032.1|2885520_2886666_-	amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUR60033.1|2886687_2887590_-|integrase	integrase	integrase	NA	NA	NA	NA
AUR60034.1|2887968_2891790_-	transcriptional regulator	NA	NA	NA	NA	NA
AUR60035.1|2891946_2892615_-	lipoprotein	NA	NA	NA	NA	NA
AUR60036.1|2892619_2894293_-	paraquat-inducible protein B	NA	NA	NA	NA	NA
AUR60037.1|2894311_2895631_-	paraquat-inducible protein A	NA	NA	NA	NA	NA
AUR60038.1|2895635_2897951_-|protease	Clp protease ClpX	protease	A0A223W0B1	Agrobacterium_phage	41.9	4.1e-164
AUR61233.1|2898006_2900175_-	penicillin-binding protein	NA	NA	NA	NA	NA
AUR61234.1|2900171_2904737_-	alpha-2-macroglobulin	NA	NA	NA	NA	NA
AUR60039.1|2905450_2905765_-|protease	Clp protease ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	43.8	1.2e-10
AUR60040.1|2905992_2906238_+	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	76.6	1.3e-20
AUR60041.1|2906359_2906851_+	hypothetical protein	NA	A0A1B1IUW8	uncultured_Mediterranean_phage	42.2	4.8e-14
AUR60042.1|2906950_2908156_-	beta-ketoadipyl CoA thiolase	NA	NA	NA	NA	NA
AUR60043.1|2908271_2909669_-	chloride channel protein EriC	NA	NA	NA	NA	NA
AUR60044.1|2909785_2910364_-	superoxide dismutase	NA	NA	NA	NA	NA
AUR60045.1|2910436_2911828_-	exodeoxyribonuclease VII large subunit	NA	A0A1V0SD82	Indivirus	32.0	1.4e-29
AUR60046.1|2911995_2912946_-|integrase	integrase	integrase	NA	NA	NA	NA
AUR60047.1|2913226_2913847_+	flagellar motor protein MotA	NA	NA	NA	NA	NA
AUR60048.1|2913843_2914257_+	biopolymer transporter ExbD	NA	NA	NA	NA	NA
AUR60049.1|2914253_2915297_+	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
AUR60050.1|2915352_2915541_+	hypothetical protein	NA	NA	NA	NA	NA
AUR60051.1|2915550_2916315_+	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
AUR60052.1|2916405_2917062_+	adenylate kinase	NA	NA	NA	NA	NA
AUR60053.1|2917153_2917912_+	3-hydroxy-2-methylbutyryl-CoA dehydrogenase	NA	NA	NA	NA	NA
AUR60054.1|2917937_2919539_+	membrane protein	NA	NA	NA	NA	NA
AUR60055.1|2919739_2920744_+	iron dicitrate transport regulator FecR	NA	NA	NA	NA	NA
AUR60056.1|2920844_2921108_+	30S ribosomal protein S20	NA	NA	NA	NA	NA
AUR60057.1|2921225_2922002_-	alpha-dehydro-beta-deoxy-D-glucarate aldolase	NA	NA	NA	NA	NA
AUR60058.1|2922592_2923543_+|integrase	integrase	integrase	NA	NA	NA	NA
AUR60059.1|2925926_2927039_-	malate dehydrogenase	NA	NA	NA	NA	NA
AUR60060.1|2927095_2928046_-|integrase	integrase	integrase	NA	NA	NA	NA
2928047:2928149	attR	CCGGCCGGGCTCCTTGAGTGAACTGGGGGGGTGGCGATTTCCAGTTTCTCAAATCCGGTTCGGATGAACCATGCATACAACCTATTGAATCTTCACAGCTAGG	NA	NA	NA	NA
>prophage 22
CP012135	Bordetella pertussis strain J014, complete genome	4107409	2950424	3002122	4107409	integrase	Staphylococcus_phage(25.0%)	45	2951289:2951348	3002123:3002219
AUR60082.1|2950424_2951288_-|integrase	integrase	integrase	NA	NA	NA	NA
2951289:2951348	attL	CCGGCCGGGCTCCTTGAGTGAACTGGGGGGTTGGCGATTTCCAGTTTCTCAAATCCGGTT	NA	NA	NA	NA
AUR60083.1|2951483_2952956_-	magnesium transporter	NA	NA	NA	NA	NA
AUR60084.1|2952966_2953377_-	acyl-CoA hydrolase	NA	NA	NA	NA	NA
AUR60085.1|2953440_2954487_-	membrane protein	NA	NA	NA	NA	NA
AUR60086.1|2954593_2955472_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUR60087.1|2955485_2956682_-	amidohydrolase	NA	NA	NA	NA	NA
AUR60088.1|2956743_2958435_+	long-chain fatty acid--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	28.1	9.4e-33
AUR60089.1|2958431_2959334_-|integrase	integrase	integrase	NA	NA	NA	NA
AUR60090.1|2959502_2960399_-	inositol phosphatase	NA	NA	NA	NA	NA
AUR60091.1|2962676_2964902_+	glycosyl hydrolase	NA	NA	NA	NA	NA
AUR60092.1|2965066_2966155_+	phosphate ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.4	8.7e-32
AUR60093.1|2966111_2966765_+	DL-methionine transporter permease subunit	NA	NA	NA	NA	NA
AUR60094.1|2966812_2967610_+	dioxygenase	NA	NA	NA	NA	NA
AUR60095.1|2968189_2969092_+|integrase	integrase	integrase	NA	NA	NA	NA
AUR60096.1|2969172_2970321_+	alcohol dehydrogenase	NA	NA	NA	NA	NA
AUR60097.1|2970377_2971328_-|integrase	integrase	integrase	NA	NA	NA	NA
AUR60098.1|2971426_2971732_-	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
AUR60099.1|2971760_2972195_-	hypothetical protein	NA	NA	NA	NA	NA
AUR60100.1|2972196_2973441_-	hypothetical protein	NA	NA	NA	NA	NA
AUR60101.1|2973437_2974148_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AUR61236.1|2974162_2975074_-	hypothetical protein	NA	NA	NA	NA	NA
AUR60102.1|2975436_2975841_+	hypothetical protein	NA	NA	NA	NA	NA
AUR60103.1|2975837_2976296_+	hypothetical protein	NA	NA	NA	NA	NA
AUR60104.1|2976302_2977211_+	hypothetical protein	NA	NA	NA	NA	NA
AUR61237.1|2977207_2978074_+	ABC transporter permease	NA	NA	NA	NA	NA
AUR60105.1|2978060_2978888_+	sugar ABC transporter permease	NA	NA	NA	NA	NA
AUR60106.1|2978898_2980026_+	phosphate ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	32.3	1.2e-23
AUR60107.1|2982383_2983646_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUR60108.1|2983652_2984405_+	DNA-binding protein	NA	NA	NA	NA	NA
AUR60109.1|2984456_2984642_-	hypothetical protein	NA	NA	NA	NA	NA
AUR60110.1|2984917_2985382_+	MerR family transcriptional regulator	NA	NA	NA	NA	NA
AUR60111.1|2985461_2986073_+	3-methyladenine DNA glycosylase	NA	NA	NA	NA	NA
AUR60112.1|2986217_2988326_+	hypothetical protein	NA	NA	NA	NA	NA
AUR60113.1|2988322_2989273_-|integrase	integrase	integrase	NA	NA	NA	NA
AUR60114.1|2989376_2989997_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
AUR61238.1|2990100_2990841_+	oxidoreductase	NA	NA	NA	NA	NA
AUR60115.1|2991975_2993100_-	hypothetical protein	NA	NA	NA	NA	NA
AUR60116.1|2993145_2993514_-	hypothetical protein	NA	NA	NA	NA	NA
AUR60117.1|2993755_2994658_-|integrase	integrase	integrase	NA	NA	NA	NA
AUR60118.1|2995741_2996284_-	hypothetical protein	NA	NA	NA	NA	NA
AUR60119.1|2996717_2997620_+|integrase	integrase	integrase	NA	NA	NA	NA
AUR60120.1|2997616_2998525_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUR60121.1|2998651_2999488_+	3-methyl-2-oxobutanoate hydroxymethyltransferase	NA	A0A0P0BXC9	Ostreococcus_lucimarinus_virus	33.3	1.6e-33
AUR60122.1|3000000_3001110_+	porin	NA	NA	NA	NA	NA
AUR60123.1|3001171_3002122_-|integrase	integrase	integrase	NA	NA	NA	NA
3002123:3002219	attR	CCGGCCGGGCTCCTTGAGTGAACTGGGGGGTTGGCGATTTCCAGTTTCTCAAATCCGGTTCGGATGAACCATGCATACAACCTATTGAATCTTCACA	NA	NA	NA	NA
>prophage 24
CP012135	Bordetella pertussis strain J014, complete genome	4107409	3382108	3435753	4107409	transposase,integrase	Staphylococcus_phage(33.33%)	48	3411136:3411165	3448771:3448800
AUR60424.1|3382108_3383011_+|integrase	integrase	integrase	NA	NA	NA	NA
AUR60425.1|3383415_3384060_-	urease accessory protein UreG	NA	NA	NA	NA	NA
AUR60426.1|3384084_3384669_-	Urease accessory protein UreF	NA	NA	NA	NA	NA
AUR60427.1|3384769_3385387_-	urease accessory protein UreE	NA	NA	NA	NA	NA
AUR60428.1|3385389_3387105_-	urease subunit alpha	NA	NA	NA	NA	NA
AUR60429.1|3387101_3387410_-	urease subunit beta	NA	NA	NA	NA	NA
AUR61260.1|3387426_3388044_-	urease accessory protein UreJ	NA	NA	NA	NA	NA
AUR60430.1|3388088_3388391_-	urease subunit gamma	NA	NA	NA	NA	NA
AUR60431.1|3388491_3389346_-	urease accessory protein ureD	NA	NA	NA	NA	NA
AUR60432.1|3390617_3391025_-	aldehyde-activating protein	NA	NA	NA	NA	NA
AUR60433.1|3391394_3392189_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AUR60434.1|3392289_3393525_+	methylaspartate ammonia-lyase	NA	NA	NA	NA	NA
AUR60435.1|3393593_3394610_+	LacI family transcriptional regulator	NA	NA	NA	NA	NA
AUR60436.1|3394621_3395998_+	hypothetical protein	NA	NA	NA	NA	NA
AUR60437.1|3395994_3397191_+	membrane protein	NA	NA	NA	NA	NA
AUR60438.1|3397187_3398726_-	SpoVR family protein	NA	NA	NA	NA	NA
AUR60439.1|3398722_3399982_-	hypothetical protein	NA	NA	NA	NA	NA
AUR60440.1|3401922_3402825_-|integrase	integrase	integrase	NA	NA	NA	NA
AUR60441.1|3403639_3404734_-	hypothetical protein	NA	NA	NA	NA	NA
AUR60442.1|3404726_3406061_-	CoA ligase	NA	NA	NA	NA	NA
AUR60443.1|3406014_3406698_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
AUR60444.1|3406723_3407887_-	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
AUR60445.1|3407883_3408885_-	ABC transporter permease	NA	NA	NA	NA	NA
AUR60446.1|3408884_3409757_-	ABC transporter permease	NA	NA	NA	NA	NA
AUR60447.1|3409753_3410503_-	branched-chain amino acid ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.8	1.9e-09
AUR60448.1|3410499_3411291_-	ABC transporter ATP-binding protein	NA	A0A1M7XV31	Cedratvirus	29.4	1.7e-08
3411136:3411165	attL	CTTGCCCGCGCCGTTGGGGCCGATGATGCC	NA	NA	NA	NA
AUR60449.1|3411287_3412427_-	ABC transporter	NA	NA	NA	NA	NA
AUR60450.1|3412702_3413488_+	3-hydroxy-2-methylbutyryl-CoA dehydrogenase	NA	NA	NA	NA	NA
AUR60451.1|3413521_3414304_+	enoyl-CoA hydratase	NA	NA	NA	NA	NA
AUR60452.1|3414307_3414697_+	DNA-binding protein	NA	NA	NA	NA	NA
AUR60453.1|3415836_3416700_+	3-alpha,7-alpha, 12-alpha-trihydroxy-5-beta-cholest-24-enoyl-CoA hydratase	NA	NA	NA	NA	NA
AUR60454.1|3416735_3417824_+	hypothetical protein	NA	NA	NA	NA	NA
AUR60455.1|3417820_3418723_-|integrase	integrase	integrase	NA	NA	NA	NA
AUR60456.1|3419124_3422103_+	hypothetical protein	NA	NA	NA	NA	NA
AUR60457.1|3423029_3423908_+	fatty acid desaturase	NA	NA	NA	NA	NA
AUR60458.1|3423943_3424276_+	hypothetical protein	NA	NA	NA	NA	NA
AUR60459.1|3424254_3425775_+	hypothetical protein	NA	NA	NA	NA	NA
AUR60460.1|3425904_3426807_+|integrase	integrase	integrase	NA	NA	NA	NA
AUR60461.1|3426803_3427271_-	ribonuclease H	NA	J9Q745	Salmonella_phage	50.7	5.6e-36
AUR60462.1|3427313_3428084_-	methyltransferase type 11	NA	NA	NA	NA	NA
AUR60463.1|3428104_3428905_+	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
AUR60464.1|3428915_3430325_+	murein transglycosylase	NA	NA	NA	NA	NA
AUR60465.1|3430419_3431205_+	enoyl-ACP reductase	NA	NA	NA	NA	NA
AUR61261.1|3431444_3432461_+|transposase	transposase	transposase	NA	NA	NA	NA
AUR60466.1|3432568_3432961_-	OsmC family protein	NA	NA	NA	NA	NA
AUR60467.1|3433098_3433779_+	membrane protein	NA	NA	NA	NA	NA
AUR61262.1|3433783_3434755_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUR60468.1|3434850_3435753_-|integrase	integrase	integrase	NA	NA	NA	NA
3448771:3448800	attR	CTTGCCCGCGCCGTTGGGGCCGATGATGCC	NA	NA	NA	NA
>prophage 25
CP012135	Bordetella pertussis strain J014, complete genome	4107409	3441956	3501254	4107409	transposase,integrase,tRNA	Acinetobacter_phage(27.27%)	50	3482616:3482632	3502842:3502858
AUR60472.1|3441956_3443720_+|tRNA	glutaminyl-tRNA synthetase	tRNA	A0A222YZ70	Escherichia_phage	50.0	5.0e-162
AUR60473.1|3443831_3444710_+	septum formation inhibitor	NA	NA	NA	NA	NA
AUR60474.1|3444822_3445638_+	cell division inhibitor MinD	NA	NA	NA	NA	NA
AUR60475.1|3445641_3445893_+	cell division topological specificity factor MinE	NA	NA	NA	NA	NA
AUR61263.1|3445977_3446994_-|transposase	transposase	transposase	NA	NA	NA	NA
AUR60476.1|3447324_3447546_-	ornithine carbamoyltransferase	NA	NA	NA	NA	NA
AUR61264.1|3449906_3450773_-	multidrug DMT transporter	NA	NA	NA	NA	NA
AUR60477.1|3451321_3452530_-	ABC transporter permease	NA	NA	NA	NA	NA
AUR60478.1|3452609_3454181_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUR60479.1|3454298_3455234_-	glycosyl transferase	NA	NA	NA	NA	NA
AUR60480.1|3455422_3456367_+	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	23.2	8.4e-07
AUR60481.1|3456435_3456606_-	hypothetical protein	NA	NA	NA	NA	NA
AUR60482.1|3456934_3462652_+	excinuclease ABC subunit A	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	39.5	1.0e-195
AUR60483.1|3462657_3463785_+	aminodeoxychorismate synthase	NA	S4VT78	Pandoravirus	37.8	3.8e-38
AUR60484.1|3463840_3464467_+	aminobenzoate synthetase	NA	NA	NA	NA	NA
AUR61265.1|3464738_3465755_+|transposase	transposase	transposase	NA	NA	NA	NA
AUR60485.1|3465850_3466561_-	short-chain dehydrogenase	NA	NA	NA	NA	NA
AUR61266.1|3466557_3467547_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUR60486.1|3467642_3469274_+	acyl-CoA synthetase	NA	NA	NA	NA	NA
AUR60487.1|3469276_3470014_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AUR60488.1|3470169_3471042_-	heme biosynthesis protein HemY	NA	NA	NA	NA	NA
AUR60489.1|3471391_3472531_+	MFS transporter	NA	NA	NA	NA	NA
AUR60490.1|3472527_3473187_+	gamma-glutamyl cyclotransferase	NA	NA	NA	NA	NA
AUR60491.1|3473258_3473891_+	pyridoxine 5'-phosphate oxidase	NA	NA	NA	NA	NA
AUR60492.1|3473920_3474439_+	flavin reductase	NA	NA	NA	NA	NA
AUR60493.1|3474449_3475559_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
AUR60494.1|3475605_3476460_+	formyltetrahydrofolate deformylase	NA	NA	NA	NA	NA
AUR60495.1|3476461_3477364_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUR60496.1|3478586_3479537_-|integrase	integrase	integrase	NA	NA	NA	NA
AUR60497.1|3479633_3480767_-	hypothetical protein	NA	NA	NA	NA	NA
AUR60498.1|3480803_3481052_-	hypothetical protein	NA	NA	NA	NA	NA
AUR60499.1|3481291_3482281_+|integrase	integrase	integrase	NA	NA	NA	NA
AUR60500.1|3482456_3483245_-	indole-3-glycerol-phosphate synthase	NA	A0A0P0IR83	Acinetobacter_phage	53.0	5.1e-66
3482616:3482632	attL	CGGCAGCAGGTCCAGCG	NA	NA	NA	NA
AUR60501.1|3483241_3484273_-	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	42.7	7.4e-73
AUR60502.1|3484291_3484855_-	anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	62.1	1.1e-65
AUR60503.1|3484910_3486431_-	anthranilate synthase component I	NA	S4VT78	Pandoravirus	32.1	9.0e-43
AUR60504.1|3486694_3487399_-	phosphoglycolate phosphatase	NA	NA	NA	NA	NA
AUR60505.1|3487406_3488135_-	ribulose-phosphate 3-epimerase	NA	NA	NA	NA	NA
AUR60506.1|3488249_3488624_+	magnesium transporter ApaG	NA	NA	NA	NA	NA
AUR60507.1|3488666_3489956_+	membrane protein	NA	NA	NA	NA	NA
AUR60508.1|3489952_3491122_+	ubiquinone biosynthesis protein UbiH	NA	NA	NA	NA	NA
AUR60509.1|3491148_3491958_+	thiol:disulfide interchange protein DsbC	NA	NA	NA	NA	NA
AUR60510.1|3492017_3492953_+	2-hydroxyacid dehydrogenase	NA	A0A1J0F959	Only_Syngen_Nebraska_virus	27.7	6.4e-15
AUR60511.1|3492965_3493916_-|integrase	integrase	integrase	NA	NA	NA	NA
AUR60512.1|3494014_3494977_-	potassium ABC transporter ATPase	NA	A0A0U2S5Z2	Escherichia_phage	64.5	4.6e-93
AUR60513.1|3495008_3495368_-	dihydroneopterin aldolase	NA	NA	NA	NA	NA
AUR60514.1|3495492_3496395_+	oxidoreductase	NA	G3MA85	Bacillus_virus	24.0	1.9e-08
AUR61267.1|3496396_3498163_-	peptidase M61	NA	NA	NA	NA	NA
AUR60515.1|3498203_3498980_+	enoyl-CoA hydratase	NA	NA	NA	NA	NA
AUR60516.1|3500303_3501254_-|integrase	integrase	integrase	NA	NA	NA	NA
3502842:3502858	attR	CGCTGGACCTGCTGCCG	NA	NA	NA	NA
>prophage 26
CP012135	Bordetella pertussis strain J014, complete genome	4107409	3516192	3574265	4107409	integrase,tRNA	Planktothrix_phage(12.5%)	49	3513993:3514010	3578397:3578414
3513993:3514010	attL	CGCCGGCGCTCGAACCCG	NA	NA	NA	NA
AUR60529.1|3516192_3517143_+|integrase	integrase	integrase	NA	NA	NA	NA
AUR60530.1|3517271_3518405_-	peptidase	NA	NA	NA	NA	NA
AUR60531.1|3518448_3519354_-	hydrolase	NA	NA	NA	NA	NA
AUR60532.1|3519356_3521057_-	hypothetical protein	NA	G9BWD6	Planktothrix_phage	32.7	1.0e-15
AUR60533.1|3521053_3521974_-	peptide ABC transporter permease	NA	NA	NA	NA	NA
AUR60534.1|3521981_3522959_-	ABC transporter permease	NA	NA	NA	NA	NA
AUR60535.1|3523017_3523977_-	succinylglutamate desuccinylase	NA	NA	NA	NA	NA
AUR60536.1|3526026_3526263_-	hypothetical protein	NA	NA	NA	NA	NA
AUR60537.1|3526389_3527253_-	ADP-dependent (S)-NAD(P)H-hydrate dehydratase	NA	NA	NA	NA	NA
AUR60538.1|3527341_3528163_+	enoyl-CoA hydratase	NA	NA	NA	NA	NA
AUR60539.1|3528242_3528980_-	enoyl-CoA hydratase	NA	NA	NA	NA	NA
AUR60540.1|3528976_3529969_-	2-nitropropane dioxygenase	NA	NA	NA	NA	NA
AUR61270.1|3530121_3530745_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
AUR60541.1|3530789_3531938_+	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
AUR60542.1|3534309_3535212_+|integrase	integrase	integrase	NA	NA	NA	NA
AUR60543.1|3535552_3536503_+|integrase	integrase	integrase	NA	NA	NA	NA
AUR60544.1|3536649_3537552_+|integrase	integrase	integrase	NA	NA	NA	NA
AUR60545.1|3537848_3538346_+	blue copper protein	NA	NA	NA	NA	NA
AUR60546.1|3538388_3540164_+	hypothetical protein	NA	NA	NA	NA	NA
AUR60547.1|3540171_3541038_+	copper resistance protein	NA	NA	NA	NA	NA
AUR61271.1|3541044_3541770_-	enoyl-CoA hydratase	NA	NA	NA	NA	NA
AUR60548.1|3541939_3542170_+	hypothetical protein	NA	NA	NA	NA	NA
AUR60549.1|3542207_3542429_+	hypothetical protein	NA	NA	NA	NA	NA
AUR60550.1|3542948_3543719_-	IclR family transcriptional regulator	NA	NA	NA	NA	NA
AUR60551.1|3544032_3544623_+	cysteine dioxygenase	NA	NA	NA	NA	NA
AUR60552.1|3544656_3545985_-	amidase	NA	NA	NA	NA	NA
AUR60553.1|3546059_3547205_-	transporter	NA	NA	NA	NA	NA
AUR60554.1|3547316_3548315_+|integrase	integrase	integrase	NA	NA	NA	NA
AUR60555.1|3548277_3548712_+	carbon monoxide dehydrogenase	NA	NA	NA	NA	NA
AUR60556.1|3550228_3551113_+	membrane protein	NA	NA	NA	NA	NA
AUR60557.1|3551109_3552315_-	phospholipase	NA	NA	NA	NA	NA
AUR60558.1|3552311_3553172_-	endonuclease	NA	NA	NA	NA	NA
AUR60559.1|3553284_3555075_-|tRNA	aspartyl-tRNA synthetase	tRNA	A0A1V0SAC0	Catovirus	25.5	6.5e-08
AUR61272.1|3555115_3555760_-	membrane protein	NA	A0A2I7S9X1	Vibrio_phage	28.4	8.5e-11
AUR60560.1|3555781_3556090_-	FmdB family transcriptional regulator	NA	NA	NA	NA	NA
AUR61273.1|3556255_3557542_-	membrane protein	NA	NA	NA	NA	NA
AUR60561.1|3561877_3563092_-	phosphoribosylglycinamide formyltransferase	NA	NA	NA	NA	NA
AUR60562.1|3563197_3564187_+	D-arabinose 5-phosphate isomerase	NA	A0A2P0VNK5	Tetraselmis_virus	37.7	4.3e-38
AUR60563.1|3564183_3564792_+	3-deoxy-D-manno-octulosonate 8-phosphate phosphatase	NA	E3T535	Cafeteria_roenbergensis_virus	26.1	5.2e-10
AUR60564.1|3564804_3565434_+	hypothetical protein	NA	NA	NA	NA	NA
AUR60565.1|3565430_3566051_+	sugar ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUR60566.1|3566082_3566874_+	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.4	9.5e-20
AUR60567.1|3567227_3567449_+	hypothetical protein	NA	NA	NA	NA	NA
AUR60568.1|3567725_3568181_+	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
AUR60569.1|3568199_3569126_+	serine kinase	NA	NA	NA	NA	NA
AUR60570.1|3569179_3570466_-	alcohol dehydrogenase	NA	NA	NA	NA	NA
AUR60571.1|3571396_3572269_+	nucleotide-binding protein	NA	A0A1P8D5W0	Corynebacterium_phage	34.5	2.4e-08
AUR60572.1|3572265_3573216_+	lipoprotein	NA	F5B3X9	Synechococcus_phage	47.2	6.9e-17
AUR60573.1|3573314_3574265_+|integrase	integrase	integrase	NA	NA	NA	NA
3578397:3578414	attR	CGGGTTCGAGCGCCGGCG	NA	NA	NA	NA
>prophage 27
CP012135	Bordetella pertussis strain J014, complete genome	4107409	3706436	3749607	4107409	integrase,tRNA	Streptococcus_phage(11.11%)	41	3744446:3744464	3750230:3750248
AUR60682.1|3706436_3707339_+|integrase	integrase	integrase	NA	NA	NA	NA
AUR60683.1|3707486_3708389_+|integrase	integrase	integrase	NA	NA	NA	NA
AUR60684.1|3708385_3709021_-	lysine transporter LysE	NA	NA	NA	NA	NA
AUR60685.1|3709150_3710050_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUR60686.1|3710145_3710637_+	membrane protein	NA	NA	NA	NA	NA
AUR60687.1|3710683_3711649_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUR60688.1|3712782_3714024_+	2-aminoadipate aminotransferase	NA	A0A1X9I5H2	Streptococcus_phage	24.9	1.9e-14
AUR60689.1|3714137_3715154_+	amino acid ABC transporter substrate-binding protein	NA	A0A1B1IT51	uncultured_Mediterranean_phage	43.8	3.5e-75
AUR60690.1|3715188_3715665_-	membrane protein	NA	NA	NA	NA	NA
AUR60691.1|3715807_3716716_-	hydroxymethylglutaryl-CoA lyase	NA	NA	NA	NA	NA
AUR60692.1|3716829_3717942_-	DNA processing protein DprA	NA	S6BFL3	Thermus_phage	35.0	1.9e-21
AUR61282.1|3718042_3718528_-	AsnC family transcriptional regulator	NA	NA	NA	NA	NA
AUR60693.1|3718664_3719915_+	kynureninase	NA	NA	NA	NA	NA
AUR60694.1|3720016_3720529_+	peptide deformylase	NA	E3SLL2	Synechococcus_phage	43.3	8.5e-22
AUR60695.1|3720675_3721578_+|integrase	integrase	integrase	NA	NA	NA	NA
AUR60696.1|3721643_3722582_+|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	35.7	1.4e-09
AUR60697.1|3722604_3723231_-	pyridoxamine 5'-phosphate oxidase	NA	NA	NA	NA	NA
AUR60698.1|3723227_3723884_-	HAD family hydrolase	NA	NA	NA	NA	NA
AUR60699.1|3723880_3724483_-	hypothetical protein	NA	NA	NA	NA	NA
AUR60700.1|3724489_3725077_-	LOG family protein	NA	A0A2I2L3F0	Orpheovirus	23.3	1.1e-07
AUR60701.1|3725257_3725827_+	bacterioferritin	NA	NA	NA	NA	NA
AUR60702.1|3725897_3727217_-	ribosomal protein S12 methylthiotransferase	NA	NA	NA	NA	NA
AUR60703.1|3727323_3727515_-	4-oxalocrotonate tautomerase	NA	NA	NA	NA	NA
AUR60704.1|3727766_3729056_+	glycine/D-amino acid oxidase	NA	NA	NA	NA	NA
AUR60705.1|3729210_3730206_+	hypothetical protein	NA	NA	NA	NA	NA
AUR60706.1|3730290_3730965_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AUR60707.1|3730961_3731864_-|integrase	integrase	integrase	NA	NA	NA	NA
AUR60708.1|3732073_3733315_+	ornithine--oxo-acid aminotransferase	NA	A0A1V0SKB7	Klosneuvirus	25.2	4.0e-25
AUR60709.1|3733311_3734256_+	arginase	NA	A0A0N9R043	Chrysochromulina_ericina_virus	33.3	9.5e-27
AUR60710.1|3734374_3735325_+|integrase	integrase	integrase	NA	NA	NA	NA
AUR60711.1|3735284_3736214_-	hypothetical protein	NA	NA	NA	NA	NA
AUR60712.1|3736267_3736603_-	alkylhydroperoxidase	NA	NA	NA	NA	NA
AUR60713.1|3736647_3737412_-	enoyl-CoA hydratase	NA	NA	NA	NA	NA
AUR60714.1|3737435_3738176_-	IclR family transcriptional regulator	NA	NA	NA	NA	NA
AUR60715.1|3738183_3739737_-	long-chain fatty acid--CoA ligase	NA	A0A2K9L3I8	Tupanvirus	22.6	1.5e-13
AUR60716.1|3739771_3740749_-	hypothetical protein	NA	NA	NA	NA	NA
AUR60717.1|3741021_3741603_-	ureidoglycolate hydrolase	NA	NA	NA	NA	NA
AUR60718.1|3741654_3748788_-	autotransporter	NA	NA	NA	NA	NA
3744446:3744464	attL	GCGACCCGCAGCGTGCCGG	NA	NA	NA	NA
AUR60719.1|3749003_3749135_-	entericidin	NA	NA	NA	NA	NA
AUR61283.1|3749166_3749292_-	hypothetical protein	NA	NA	NA	NA	NA
AUR60720.1|3749400_3749607_-|integrase	integrase	integrase	NA	NA	NA	NA
3750230:3750248	attR	GCGACCCGCAGCGTGCCGG	NA	NA	NA	NA
>prophage 28
CP012135	Bordetella pertussis strain J014, complete genome	4107409	3755542	3791217	4107409	integrase	Burkholderia_phage(11.11%)	37	3787133:3787192	3791256:3791353
AUR60727.1|3755542_3756445_+|integrase	integrase	integrase	NA	NA	NA	NA
AUR60728.1|3756455_3757097_+	hypothetical protein	NA	NA	NA	NA	NA
AUR60729.1|3757263_3757506_+	hypothetical protein	NA	NA	NA	NA	NA
AUR60730.1|3757652_3758555_+|integrase	integrase	integrase	NA	NA	NA	NA
AUR60731.1|3758590_3759058_+	hypothetical protein	NA	Q3HQX1	Burkholderia_phage	71.3	2.1e-43
AUR60732.1|3759291_3759669_+	hypothetical protein	NA	NA	NA	NA	NA
AUR60733.1|3759665_3759848_+	membrane protein	NA	NA	NA	NA	NA
AUR60734.1|3759851_3760838_+	DNA recombinase	NA	H9C0R8	Aeromonas_phage	57.3	2.0e-67
AUR60735.1|3760834_3761482_+	exonuclease	NA	A0A0U2BXF3	Paracoccus_phage	41.4	2.0e-31
AUR60736.1|3761539_3762067_+	hypothetical protein	NA	NA	NA	NA	NA
AUR60737.1|3762103_3763288_+	hypothetical protein	NA	A0A291L9X3	Bordetella_phage	37.8	1.5e-24
AUR60738.1|3763298_3763640_+	hypothetical protein	NA	A0A0H5ARN8	Pseudomonas_phage	45.3	1.0e-10
AUR60739.1|3763632_3763752_+	membrane protein	NA	NA	NA	NA	NA
AUR60740.1|3763752_3763953_+	hypothetical protein	NA	NA	NA	NA	NA
AUR60741.1|3763949_3764939_-|integrase	integrase	integrase	A0A1B1P9F9	Acinetobacter_phage	44.4	4.4e-75
AUR60742.1|3766425_3768396_-	hypothetical protein	NA	NA	NA	NA	NA
AUR60743.1|3768637_3769036_+	hypothetical protein	NA	NA	NA	NA	NA
AUR60744.1|3769044_3769968_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUR60745.1|3770473_3771376_+|integrase	integrase	integrase	NA	NA	NA	NA
AUR60746.1|3771606_3773298_-	insertase	NA	NA	NA	NA	NA
AUR60747.1|3773346_3773619_-	membrane protein insertion efficiency factor	NA	A0A2H4PQM5	Staphylococcus_phage	52.2	7.0e-15
AUR60748.1|3773615_3773987_-	ribonuclease P	NA	NA	NA	NA	NA
AUR60749.1|3774082_3774217_-	50S ribosomal protein L34	NA	NA	NA	NA	NA
AUR60750.1|3774622_3776032_+	chromosomal replication initiator protein DnaA	NA	NA	NA	NA	NA
AUR60751.1|3776034_3777144_+	DNA polymerase III subunit beta	NA	B4UTW9	Rhizobium_phage	32.6	1.2e-41
AUR60752.1|3777238_3779692_+	DNA gyrase subunit B	NA	G3M9Z3	Bacillus_virus	34.8	2.3e-112
AUR60753.1|3779810_3780602_-	IclR family transcriptional regulator	NA	NA	NA	NA	NA
AUR60754.1|3780745_3782149_+	amidase	NA	NA	NA	NA	NA
AUR61284.1|3782187_3783159_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUR61285.1|3783243_3783447_+	hypothetical protein	NA	NA	NA	NA	NA
AUR60755.1|3783577_3784741_+	lactate dehydrogenase	NA	NA	NA	NA	NA
AUR60756.1|3784828_3785674_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
3787133:3787192	attL	CTGTGAAGATTCAATAGGTTGTATGCATGGTTCATCCGAACCGGATTTGAGAAACTGGAA	NA	NA	NA	NA
AUR60757.1|3787278_3788181_+|integrase	integrase	integrase	NA	NA	NA	NA
AUR60758.1|3788177_3788522_-	hypothetical protein	NA	NA	NA	NA	NA
AUR60759.1|3788735_3789110_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
AUR60760.1|3789184_3790243_+	Zn-dependent hydrolase	NA	NA	NA	NA	NA
AUR60761.1|3790266_3791217_-|integrase	integrase	integrase	NA	NA	NA	NA
3791256:3791353	attR	TTCCAGTTTCTCAAATCCGGTTCGGATGAACCATGCATACAACCTATTGAATCTTCACAGCTACCTGCCCAAGCTGGTCAGCGGCGAACACGTGGGCG	NA	NA	NA	NA
