The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP016887	Bordetella pertussis strain J043, complete genome	4102813	0	64055	4102813	protease,tRNA,integrase	Natrialba_phage(12.5%)	57	14681:14696	69426:69441
AUR54069.1|0_1920_+|tRNA	tRNA uridine(34) 5-carboxymethylaminomethyl synthesis enzyme MnmG	tRNA	NA	NA	NA	NA
AUR54070.1|1916_2609_+	16S rRNA (guanine(527)-N(7))-methyltransferase	NA	NA	NA	NA	NA
AUR54071.1|2605_3403_+	chromosome partitioning protein	NA	Q8JL10	Natrialba_phage	34.9	5.6e-20
AUR54072.1|3409_4171_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AUR54073.1|4214_5132_+	chromosome partitioning protein ParB	NA	I3NLC2	Bifidobacterium_phage	38.1	1.9e-16
AUR54074.1|5124_5910_+	L-asparaginase	NA	NA	NA	NA	NA
AUR54075.1|5943_6126_+	hypothetical protein	NA	NA	NA	NA	NA
AUR54076.1|6721_7912_+	translation elongation factor Tu	NA	A0A1V0SLW6	Klosneuvirus	29.2	3.1e-14
AUR54077.1|8150_8531_+	preprotein translocase subunit SecE	NA	NA	NA	NA	NA
AUR54078.1|8540_9074_+	transcription termination/antitermination protein NusG	NA	G3MAW2	Bacillus_virus	30.5	1.4e-11
AUR54079.1|9137_9569_+	50S ribosomal protein L11	NA	NA	NA	NA	NA
AUR54080.1|9571_10270_+	50S ribosomal protein L1	NA	NA	NA	NA	NA
AUR54081.1|10512_11037_+	50S ribosomal protein L10	NA	NA	NA	NA	NA
AUR54082.1|11118_11502_+	50S ribosomal protein L7/L12	NA	NA	NA	NA	NA
AUR54083.1|11661_15774_+	DNA-directed RNA polymerase subunit beta	NA	A0A0N9R0J7	Chrysochromulina_ericina_virus	28.8	2.4e-21
14681:14696	attL	ACCTGGCCGACCTGGA	NA	NA	NA	NA
AUR54084.1|15773_20018_+	DNA-directed RNA polymerase subunit beta'	NA	A0A2I7QNZ7	Vibrio_phage	24.6	1.7e-67
AUR57427.1|20126_20531_-	hypothetical protein	NA	NA	NA	NA	NA
AUR54085.1|20771_21947_+	hypothetical protein	NA	NA	NA	NA	NA
AUR54086.1|24352_25459_-	peptidoglycan-binding protein	NA	NA	NA	NA	NA
AUR57428.1|26575_27286_+	hypothetical protein	NA	NA	NA	NA	NA
AUR54087.1|27282_28185_-|integrase	integrase	integrase	NA	NA	NA	NA
AUR54088.1|28314_28614_-	hypothetical protein	NA	NA	NA	NA	NA
AUR54089.1|28674_29109_-	hypothetical protein	NA	NA	NA	NA	NA
AUR54090.1|29141_30359_-	thiolase	NA	NA	NA	NA	NA
AUR54091.1|30364_30862_-	dehydratase	NA	NA	NA	NA	NA
AUR54092.1|31069_32005_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUR57429.1|32214_33006_+	enoyl-CoA hydratase	NA	NA	NA	NA	NA
AUR54093.1|33048_34470_+	2-methylcitrate dehydratase	NA	NA	NA	NA	NA
AUR54094.1|34673_35576_+|integrase	integrase	integrase	NA	NA	NA	NA
AUR54095.1|35572_36763_-	transporter	NA	NA	NA	NA	NA
AUR54096.1|37012_37924_+|tRNA	glycine--tRNA ligase subunit alpha	tRNA	NA	NA	NA	NA
AUR54097.1|37925_40064_+|tRNA	glycine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
AUR54098.1|40060_40600_+	D-glycero-beta-D-manno-heptose-1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
AUR54099.1|40603_41332_+	acyl-phosphate glycerol 3-phosphate acyltransferase	NA	NA	NA	NA	NA
AUR54100.1|41318_42212_+	hypothetical protein	NA	NA	NA	NA	NA
AUR54101.1|42282_42678_+	lactoylglutathione lyase	NA	NA	NA	NA	NA
AUR54102.1|42687_43218_+	peptide deformylase	NA	E3SLL2	Synechococcus_phage	35.4	3.7e-12
AUR54103.1|43346_43526_-	hypothetical protein	NA	NA	NA	NA	NA
AUR54104.1|43663_44614_+|integrase	integrase	integrase	NA	NA	NA	NA
AUR57430.1|45224_45749_+	hypothetical protein	NA	NA	NA	NA	NA
AUR54105.1|45720_45957_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
AUR54106.1|46084_46978_+	hypothetical protein	NA	NA	NA	NA	NA
AUR54107.1|48147_49395_+	homoserine O-acetyltransferase	NA	NA	NA	NA	NA
AUR54108.1|49391_50006_+	methionine biosynthesis protein MetW	NA	NA	NA	NA	NA
AUR54109.1|50141_51092_+|integrase	integrase	integrase	NA	NA	NA	NA
AUR54110.1|51134_52391_+	muropeptide transporter AmpG	NA	NA	NA	NA	NA
AUR54111.1|53622_54357_-	glutamate racemase	NA	NA	NA	NA	NA
AUR54112.1|54362_54953_-	arginine transporter ATP-binding subunit	NA	G9BWD6	Planktothrix_phage	33.6	3.2e-20
AUR54113.1|54977_55667_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
AUR54114.1|55663_56425_-	glutamate ABC transporter permease	NA	NA	NA	NA	NA
AUR54115.1|56504_57404_-	ABC transporter	NA	NA	NA	NA	NA
AUR54116.1|57497_58448_-|integrase	integrase	integrase	NA	NA	NA	NA
AUR54117.1|59248_60475_-	serine kinase HipA	NA	NA	NA	NA	NA
AUR54118.1|60474_60894_-	DNA-binding protein	NA	NA	NA	NA	NA
AUR57431.1|61077_62019_-	hypothetical protein	NA	NA	NA	NA	NA
AUR54119.1|62442_63417_-	hypothetical protein	NA	NA	NA	NA	NA
AUR54120.1|63473_64055_-|protease	protease	protease	NA	NA	NA	NA
69426:69441	attR	ACCTGGCCGACCTGGA	NA	NA	NA	NA
>prophage 2
CP016887	Bordetella pertussis strain J043, complete genome	4102813	69085	123122	4102813	transposase,integrase,tRNA	Planktothrix_phage(20.0%)	54	76859:76874	123514:123529
AUR54126.1|69085_70036_+|integrase	integrase	integrase	NA	NA	NA	NA
AUR54127.1|70129_70444_+|transposase	transposase	transposase	NA	NA	NA	NA
AUR54128.1|71636_73544_+	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	37.2	1.1e-117
AUR54129.1|73705_74326_-	glutathione S-transferase	NA	NA	NA	NA	NA
AUR54130.1|74357_74939_-	N-acetyl-anhydromuranmyl-L-alanine amidase	NA	A0A1W6DX33	Sphingobium_phage	54.3	1.7e-05
AUR54131.1|75027_75279_-	hypothetical protein	NA	NA	NA	NA	NA
AUR54132.1|75280_76123_-	hypothetical protein	NA	NA	NA	NA	NA
AUR54133.1|76228_77638_+	signal recognition particle protein	NA	NA	NA	NA	NA
76859:76874	attL	GACGAGGCCATGATGC	NA	NA	NA	NA
AUR54134.1|77634_78585_-|integrase	integrase	integrase	NA	NA	NA	NA
AUR57432.1|78659_79604_+|integrase	integrase	integrase	NA	NA	NA	NA
AUR54135.1|79600_81475_-	capsular biosynthesis protein	NA	A0A2P1ELS8	Moumouvirus	26.9	2.0e-23
AUR54136.1|82822_83527_-	lipopolysaccharide biosynthesis protein	NA	NA	NA	NA	NA
AUR54137.1|83523_84630_-	glycosyl transferase	NA	NA	NA	NA	NA
AUR54138.1|84891_85485_-	sugar transferase	NA	NA	NA	NA	NA
AUR54139.1|85481_86669_-	UDP-4-amino-4, 6-dideoxy-N-acetyl-beta-L-altrosamine transaminase	NA	NA	NA	NA	NA
AUR54140.1|86731_87991_-	glycosyltransferase WbuB	NA	NA	NA	NA	NA
AUR54141.1|88014_89103_-	UDP-N-acetylglucosamine 2-epimerase	NA	A0A0N9R0B2	Chrysochromulina_ericina_virus	36.3	4.8e-46
AUR54142.1|89110_90211_-	aminotransferase DegT	NA	A0A2K9L0G1	Tupanvirus	29.7	3.3e-31
AUR54143.1|90214_90790_-	serine acetyltransferase	NA	NA	NA	NA	NA
AUR54144.1|90793_91846_-	oxidoreductase	NA	NA	NA	NA	NA
AUR57433.1|91976_92984_+	lipopolysaccharide heptosyltransferase I	NA	NA	NA	NA	NA
AUR54145.1|92985_94272_+	3-deoxy-D-manno-octulosonic acid transferase	NA	NA	NA	NA	NA
AUR54146.1|94288_94444_-	hypothetical protein	NA	NA	NA	NA	NA
AUR54147.1|94468_95272_-	pantothenate kinase	NA	NA	NA	NA	NA
AUR54148.1|95268_96135_-	biotin--[acetyl-CoA-carboxylase] ligase	NA	NA	NA	NA	NA
AUR54149.1|96209_97340_+	ABC transporter permease	NA	NA	NA	NA	NA
AUR54150.1|97339_98179_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.4	9.1e-21
AUR54151.1|98332_98800_-	hypothetical protein	NA	NA	NA	NA	NA
AUR54152.1|98889_99111_+	hypothetical protein	NA	NA	NA	NA	NA
AUR54153.1|99111_99714_+	hypothetical protein	NA	NA	NA	NA	NA
AUR54154.1|99743_100397_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
AUR57434.1|100607_101786_+	peptidase	NA	B6DZZ7	Stx2-converting_phage	40.5	5.8e-66
AUR54155.1|101866_102733_+	D-amino acid aminotransferase	NA	NA	NA	NA	NA
AUR54156.1|102808_103084_+	hypothetical protein	NA	NA	NA	NA	NA
AUR54157.1|103091_103754_+	octanoyltransferase	NA	NA	NA	NA	NA
AUR54158.1|103815_104817_+	lipoyl synthase	NA	NA	NA	NA	NA
AUR54159.1|104831_105380_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	53.4	3.7e-47
AUR54160.1|105437_106334_-	dTDP-4-dehydrorhamnose reductase	NA	NA	NA	NA	NA
AUR54161.1|106330_107392_-	dTDP-glucose 4,6-dehydratase	NA	A0A1D7XFE8	Escherichia_phage	44.8	1.6e-78
AUR54162.1|107427_108330_-|integrase	integrase	integrase	NA	NA	NA	NA
AUR54163.1|109277_110471_+	cystathionine beta-lyase	NA	NA	NA	NA	NA
AUR54164.1|110552_111182_-	thiol:disulfide interchange protein	NA	NA	NA	NA	NA
AUR54165.1|111243_111927_-	cell division protein	NA	NA	NA	NA	NA
AUR54166.1|111936_113619_-|tRNA	arginine--tRNA ligase	tRNA	NA	NA	NA	NA
AUR57435.1|113906_114254_+	hypothetical protein	NA	NA	NA	NA	NA
AUR54167.1|114344_114662_+	hypothetical protein	NA	NA	NA	NA	NA
AUR54168.1|114944_115961_+|transposase	transposase	transposase	NA	NA	NA	NA
AUR54169.1|116036_116837_-	ABC transporter permease	NA	NA	NA	NA	NA
AUR54170.1|116833_117709_-	ABC transporter permease	NA	NA	NA	NA	NA
AUR54171.1|117719_119012_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUR54172.1|119054_120095_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	33.7	6.0e-22
AUR54173.1|120200_121022_-	phosphodiesterase	NA	NA	NA	NA	NA
AUR54174.1|121122_122073_-|integrase	integrase	integrase	NA	NA	NA	NA
AUR54175.1|122171_123122_-|integrase	integrase	integrase	NA	NA	NA	NA
123514:123529	attR	GCATCATGGCCTCGTC	NA	NA	NA	NA
>prophage 3
CP016887	Bordetella pertussis strain J043, complete genome	4102813	165936	302703	4102813	protease,integrase,tRNA	Klosneuvirus(10.53%)	117	206600:206659	302704:302806
AUR54212.1|165936_166887_-|integrase	integrase	integrase	NA	NA	NA	NA
AUR54213.1|168330_169233_-	hypothetical protein	NA	NA	NA	NA	NA
AUR54214.1|169210_169840_-	hypothetical protein	NA	NA	NA	NA	NA
AUR54215.1|170122_171553_+	RNA helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	29.8	5.8e-44
AUR54216.1|171586_172216_+	threonine transporter RhtB	NA	NA	NA	NA	NA
AUR54217.1|172264_173872_+	peptide chain release factor 3	NA	A0A2K9L6L3	Tupanvirus	37.8	9.3e-14
AUR54218.1|173908_174580_+	hypothetical protein	NA	NA	NA	NA	NA
AUR57437.1|174661_175138_-	bacterioferritin	NA	NA	NA	NA	NA
AUR54219.1|175392_176295_+|integrase	integrase	integrase	NA	NA	NA	NA
AUR54220.1|177410_177938_+	hypothetical protein	NA	NA	NA	NA	NA
AUR54221.1|178029_178845_+	hypothetical protein	NA	NA	NA	NA	NA
AUR54222.1|178905_179640_+	sulfurtransferase	NA	NA	NA	NA	NA
AUR54223.1|179677_181756_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SHR2	Klosneuvirus	23.6	1.5e-27
AUR54224.1|182005_182278_-	hypothetical protein	NA	NA	NA	NA	NA
AUR54225.1|182379_183465_+	ATP-binding protein	NA	NA	NA	NA	NA
AUR54226.1|183468_185373_+	hypothetical protein	NA	NA	NA	NA	NA
AUR54227.1|185369_189068_+	hypothetical protein	NA	NA	NA	NA	NA
AUR54228.1|189128_189692_+	dCTP deaminase	NA	S5VM63	Pseudomonas_phage	75.3	2.6e-72
AUR54229.1|189699_190122_-	glyoxalase	NA	NA	NA	NA	NA
AUR54230.1|190149_190569_-	glyoxalase	NA	NA	NA	NA	NA
AUR54231.1|190597_190945_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AUR57438.1|191218_191668_+	hypothetical protein	NA	NA	NA	NA	NA
AUR54232.1|191822_194093_+	lysine decarboxylase	NA	NA	NA	NA	NA
AUR54233.1|194168_195374_+	hypothetical protein	NA	NA	NA	NA	NA
AUR54234.1|195472_196423_+|integrase	integrase	integrase	NA	NA	NA	NA
AUR54235.1|196525_197161_+	superoxide dismutase	NA	Q56AR7	Bacillus_thuringiensis_phage	73.8	2.8e-83
AUR54236.1|197157_198051_+	divalent cation transporter	NA	NA	NA	NA	NA
AUR54237.1|198445_199546_+	glycine cleavage system protein T	NA	NA	NA	NA	NA
AUR54238.1|199627_200002_+	glycine cleavage system protein H	NA	NA	NA	NA	NA
AUR54239.1|200061_202926_+	glycine dehydrogenase (aminomethyl-transferring)	NA	E3SN07	Prochlorococcus_phage	51.4	1.2e-261
AUR54240.1|203070_203811_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AUR54241.1|203880_205092_+	formyl-CoA transferase	NA	NA	NA	NA	NA
AUR54242.1|205120_206089_+	hypothetical protein	NA	NA	NA	NA	NA
206600:206659	attL	GCTAGCTGTGAAGATTCAATAGGTTGTATGCATGGTTCATCCGAACCGGATTTGAGAAAC	NA	NA	NA	NA
AUR54243.1|207808_208132_+	PsiF repeat family protein	NA	NA	NA	NA	NA
206600:206659	attL	GCTAGCTGTGAAGATTCAATAGGTTGTATGCATGGTTCATCCGAACCGGATTTGAGAAAC	NA	NA	NA	NA
AUR57439.1|208236_209277_-	cyclase	NA	NA	NA	NA	NA
AUR54244.1|209282_210062_-	3-oxoadipate enol-lactonase	NA	NA	NA	NA	NA
AUR54245.1|210107_210404_-	hypothetical protein	NA	NA	NA	NA	NA
AUR54246.1|210429_210705_-	muconolactone delta-isomerase	NA	NA	NA	NA	NA
AUR54247.1|210761_211406_-	3-oxoadipate CoA-transferase	NA	NA	NA	NA	NA
AUR54248.1|211405_212092_-	3-oxoadipate CoA-transferase	NA	NA	NA	NA	NA
AUR57440.1|212290_213073_+	IclR family transcriptional regulator	NA	NA	NA	NA	NA
AUR54249.1|213123_213849_-	short-chain dehydrogenase	NA	NA	NA	NA	NA
AUR54250.1|213880_215230_-	short-chain fatty acid transporter	NA	NA	NA	NA	NA
AUR54251.1|215341_216274_-	3-hydroxybutyryl-CoA dehydrogenase	NA	NA	NA	NA	NA
AUR54252.1|216731_219527_-	peptidase S8	NA	NA	NA	NA	NA
AUR54253.1|220120_222964_-	phosphoenolpyruvate carboxylase	NA	NA	NA	NA	NA
AUR54254.1|223134_223854_+	7-cyano-7-deazaguanine synthase QueC	NA	A0A0A0RPC6	Escherichia_phage	43.9	8.0e-50
AUR54255.1|223892_224441_-	GNAT family N-acetyltransferase	NA	A0A2H4J136	uncultured_Caudovirales_phage	41.7	1.2e-21
AUR54256.1|224595_225495_+	virginiamycin B lyase	NA	NA	NA	NA	NA
AUR54257.1|225519_226470_-|integrase	integrase	integrase	NA	NA	NA	NA
AUR54258.1|226688_227384_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AUR54259.1|227400_228813_+	hydroxyacid dehydrogenase	NA	NA	NA	NA	NA
AUR54260.1|228925_230356_+	aldehyde dehydrogenase	NA	NA	NA	NA	NA
AUR54261.1|230397_232311_-	phosphomethylpyrimidine synthase ThiC	NA	NA	NA	NA	NA
AUR54262.1|232629_233196_+	preprotein translocase subunit SecD	NA	NA	NA	NA	NA
AUR54263.1|233286_234288_+	restriction endonuclease	NA	NA	NA	NA	NA
AUR54264.1|234402_235353_+|integrase	integrase	integrase	NA	NA	NA	NA
AUR54265.1|235472_236423_-|integrase	integrase	integrase	NA	NA	NA	NA
AUR54266.1|236521_237472_-|integrase	integrase	integrase	NA	NA	NA	NA
236467:236569	attR	GTTTCTCAAATCCGGTTCGGATGAACCATGCATACAACCTATTGAATCTTCACAGCTAGCTGTGAACTGTCAATAGGTTGTATTCGTCCAGGTTGAGTCTGGA	NA	NA	NA	NA
AUR54267.1|238202_239183_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
236467:236569	attR	GTTTCTCAAATCCGGTTCGGATGAACCATGCATACAACCTATTGAATCTTCACAGCTAGCTGTGAACTGTCAATAGGTTGTATTCGTCCAGGTTGAGTCTGGA	NA	NA	NA	NA
AUR54268.1|239196_240321_+	carnitine dehydratase	NA	NA	NA	NA	NA
AUR54269.1|240328_242083_-	gamma-glutamyltransferase	NA	NA	NA	NA	NA
AUR54270.1|242189_243089_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUR54271.1|243153_244137_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUR54272.1|244272_245253_+	hypothetical protein	NA	NA	NA	NA	NA
AUR54273.1|245269_246661_-	fumarate hydratase, class II	NA	NA	NA	NA	NA
AUR54274.1|246812_247349_+|tRNA	tRNA (N6-adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase TsaE	tRNA	NA	NA	NA	NA
AUR54275.1|247279_248665_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A2H4JCM7	uncultured_Caudovirales_phage	30.3	4.5e-17
AUR57441.1|248807_249428_-	hypothetical protein	NA	NA	NA	NA	NA
AUR54276.1|249532_251422_+	DNA mismatch repair protein MutL	NA	A0A1B2LRQ5	Wolbachia_phage	32.8	3.3e-79
AUR54277.1|251418_252360_+|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
AUR54278.1|252465_253515_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	43.6	5.6e-68
AUR54279.1|253767_254469_+	DnaA regulatory inactivator Hda	NA	NA	NA	NA	NA
AUR54280.1|254465_255164_+	hypothetical protein	NA	NA	NA	NA	NA
AUR54281.1|255164_256520_+	poly(A) polymerase	NA	A0A1B1IVF3	uncultured_Mediterranean_phage	36.8	3.4e-25
AUR54282.1|256516_257008_+	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
AUR54283.1|257026_257983_-	hypothetical protein	NA	NA	NA	NA	NA
AUR57442.1|259393_260653_-	hypothetical protein	NA	NA	NA	NA	NA
AUR54284.1|261666_262710_+	C4-dicarboxylate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUR54285.1|262753_263497_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AUR54286.1|263513_264269_-	gamma-hydroxybutyrate dehydrogenase	NA	D2K0C8	Staphylococcus_phage	55.0	4.6e-32
AUR54287.1|264518_264929_-	4-carboxymuconolactone decarboxylase	NA	NA	NA	NA	NA
AUR54288.1|265878_266676_+	beta-D-hydroxybutyrate dehydrogenase	NA	NA	NA	NA	NA
AUR54289.1|266822_267725_+|integrase	integrase	integrase	NA	NA	NA	NA
AUR54290.1|267739_268111_+	hypothetical protein	NA	NA	NA	NA	NA
AUR54291.1|268284_268830_+	ArsR family transcriptional regulator	NA	NA	NA	NA	NA
AUR54292.1|268955_270533_+	cytochrome d terminal oxidase subunit 1	NA	NA	NA	NA	NA
AUR54293.1|270548_271703_+	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
AUR54294.1|271716_271842_+	cyd operon protein YbgT	NA	NA	NA	NA	NA
AUR54295.1|271838_273590_+	thiol reductant ABC exporter subunit CydD	NA	W8CYL7	Bacillus_phage	23.8	3.4e-09
AUR54296.1|273586_275266_+	thiol reductant ABC exporter subunit CydC	NA	W8CYL7	Bacillus_phage	27.6	3.6e-16
AUR54297.1|275328_275877_+	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	43.1	1.3e-28
AUR54298.1|277019_277298_+	hypothetical protein	NA	NA	NA	NA	NA
AUR54299.1|278341_279292_-|integrase	integrase	integrase	NA	NA	NA	NA
AUR54300.1|279569_279731_+	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
AUR54301.1|279738_279879_+	hypothetical protein	NA	NA	NA	NA	NA
AUR54302.1|280397_280847_-|protease	ClpXP protease specificity-enhancing factor	protease	NA	NA	NA	NA
AUR54303.1|280856_281468_-	glutathione S-transferase	NA	NA	NA	NA	NA
AUR54304.1|281626_282475_-	cytochrome C	NA	NA	NA	NA	NA
AUR54305.1|282500_283883_-	cytochrome B	NA	NA	NA	NA	NA
AUR54306.1|283947_284589_-	ubiquinol-cytochrome c reductase iron-sulfur subunit	NA	NA	NA	NA	NA
AUR54307.1|284728_285187_+	large-conductance mechanosensitive channel protein	NA	NA	NA	NA	NA
AUR54308.1|285211_285988_-	Nif3-like dinuclear metal center hexameric protein	NA	NA	NA	NA	NA
AUR57443.1|286041_287178_+	2-alkenal reductase	NA	W5SAB9	Pithovirus	31.2	1.2e-07
AUR54309.1|287174_288077_-|integrase	integrase	integrase	NA	NA	NA	NA
AUR54310.1|288222_288849_-	hypothetical protein	NA	NA	NA	NA	NA
AUR54311.1|288871_289798_-	glyoxylate/hydroxypyruvate reductase A	NA	NA	NA	NA	NA
AUR54312.1|289806_291393_-	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUR54313.1|291389_292394_-	acetylesterase	NA	A0A2L2DMU8	Acanthamoeba_polyphaga_mimivirus	31.5	7.5e-30
AUR54314.1|292593_293454_+	cupin	NA	NA	NA	NA	NA
AUR54315.1|293485_294487_-	hypothetical protein	NA	NA	NA	NA	NA
AUR54316.1|294557_295367_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AUR54317.1|295444_297304_+	dihydroxy-acid dehydratase	NA	NA	NA	NA	NA
AUR54318.1|297432_298635_-	arabinose transporter permease	NA	NA	NA	NA	NA
AUR54319.1|298748_299630_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUR54320.1|301132_301693_-	5'-3'-deoxyribonucleotidase	NA	A0A1E1EUN3	Acanthamoeba_castellanii_mimivirus	30.8	3.2e-14
AUR54321.1|301752_302703_-|integrase	integrase	integrase	NA	NA	NA	NA
302704:302806	attR	CCGGCCGGGCTCCTTGAGTGAACTGGGGGGGTGGCGATTTCCAGTTTCTCAAATCCGGTTCGGATGAACCATGCATACAACCTATTGAATCTTCACACCTAGC	NA	NA	NA	NA
>prophage 4
CP016887	Bordetella pertussis strain J043, complete genome	4102813	393107	447575	4102813	integrase	Heterosigma_akashiwo_virus(14.29%)	48	399510:399526	449755:449771
AUR54410.1|393107_394058_-|integrase	integrase	integrase	NA	NA	NA	NA
AUR54411.1|394146_395061_+	transporter	NA	NA	NA	NA	NA
AUR54412.1|395057_395717_+	hypothetical protein	NA	NA	NA	NA	NA
AUR54413.1|395806_396730_+	peptidase	NA	A0A1C9C5K3	Heterosigma_akashiwo_virus	27.2	4.8e-07
AUR54414.1|396735_397191_-	hypothetical protein	NA	NA	NA	NA	NA
AUR54415.1|397187_398291_-	hypothetical protein	NA	NA	NA	NA	NA
AUR54416.1|398478_400098_-	dolichyl-phosphate-mannose--protein mannosyltransferase	NA	NA	NA	NA	NA
399510:399526	attL	CCAGCATGGCCAGCGCG	NA	NA	NA	NA
AUR54417.1|400094_401153_-	glycosyl transferase family 2	NA	I1TED8	Salmonella_phage	40.5	2.8e-59
AUR54418.1|401282_401777_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AUR54419.1|401869_402847_+|integrase	integrase	integrase	NA	NA	NA	NA
AUR54420.1|403042_404248_+	sodium/glutamate symporter	NA	NA	NA	NA	NA
AUR54421.1|404244_405756_+	TRAP ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUR57448.1|405771_407085_-	short-chain fatty acid transporter	NA	NA	NA	NA	NA
AUR54422.1|407275_407455_-	hypothetical protein	NA	NA	NA	NA	NA
AUR54423.1|407864_408599_-	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	43.8	1.4e-41
AUR54424.1|411091_411994_+|integrase	integrase	integrase	NA	NA	NA	NA
AUR54425.1|412125_412524_-	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	44.3	9.0e-19
AUR54426.1|412934_413405_-	universal stress protein	NA	NA	NA	NA	NA
AUR54427.1|413493_413838_-	TIGR01244 family protein	NA	NA	NA	NA	NA
AUR54428.1|413937_415338_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AUR54429.1|417126_417645_-	methyltransferase	NA	G3MA03	Bacillus_virus	38.9	2.1e-12
AUR54430.1|417755_418511_+	hypothetical protein	NA	A0A0R6PEZ3	Moraxella_phage	40.8	2.9e-42
AUR54431.1|418706_419939_+	acetyl-CoA acetyltransferase	NA	NA	NA	NA	NA
AUR54432.1|419931_420717_+	enoyl-CoA hydratase	NA	NA	NA	NA	NA
AUR54433.1|420783_421755_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUR54434.1|421765_422743_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUR54435.1|422868_424041_+	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
AUR54436.1|424067_425096_+	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
AUR54437.1|425161_426355_+	acetyl-CoA acetyltransferase	NA	NA	NA	NA	NA
AUR54438.1|428136_429039_-|integrase	integrase	integrase	NA	NA	NA	NA
AUR54439.1|429185_430091_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUR54440.1|430266_430470_-	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	58.2	5.8e-14
AUR54441.1|430980_431421_+	hypothetical protein	NA	NA	NA	NA	NA
AUR54442.1|431450_432110_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AUR57449.1|432195_433812_-	1-pyrroline-5-carboxylate dehydrogenase	NA	NA	NA	NA	NA
AUR54443.1|433832_435296_-	Short chain fatty acid transporter	NA	NA	NA	NA	NA
AUR54444.1|435326_438713_-	molybdopterin oxidoreductase	NA	NA	NA	NA	NA
AUR54445.1|438854_439259_-	hypothetical protein	NA	NA	NA	NA	NA
AUR54446.1|439402_440389_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUR54447.1|440375_440657_-	hypothetical protein	NA	NA	NA	NA	NA
AUR54448.1|440743_440974_+	hypothetical protein	NA	NA	NA	NA	NA
AUR54449.1|441043_441268_+	hypothetical protein	NA	NA	NA	NA	NA
AUR54450.1|441402_442635_-	mesaconyl-CoA isomerase	NA	NA	NA	NA	NA
AUR54451.1|442634_443129_-	dehydratase	NA	NA	NA	NA	NA
AUR54452.1|443260_444223_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUR54453.1|444200_445454_-	carnitine dehydratase	NA	NA	NA	NA	NA
AUR54454.1|445575_446526_+|integrase	integrase	integrase	NA	NA	NA	NA
AUR54455.1|446624_447575_+|integrase	integrase	integrase	NA	NA	NA	NA
449755:449771	attR	CCAGCATGGCCAGCGCG	NA	NA	NA	NA
>prophage 5
CP016887	Bordetella pertussis strain J043, complete genome	4102813	455784	502885	4102813	tRNA,terminase,tail,integrase	uncultured_Caudovirales_phage(21.05%)	51	476846:476861	495109:495124
AUR54464.1|455784_456810_-|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
AUR54465.1|456875_458048_-	monooxygenase	NA	NA	NA	NA	NA
AUR54466.1|458153_458606_+	hypothetical protein	NA	NA	NA	NA	NA
AUR54467.1|458615_459956_-	Xaa-Pro aminopeptidase	NA	NA	NA	NA	NA
AUR54468.1|460272_461310_+	hypothetical protein	NA	NA	NA	NA	NA
AUR54469.1|461691_462051_+	hypothetical protein	NA	NA	NA	NA	NA
AUR54470.1|462134_463085_-|integrase	integrase	integrase	NA	NA	NA	NA
AUR57450.1|463183_464125_-|integrase	integrase	integrase	NA	NA	NA	NA
AUR54471.1|464247_465150_+|integrase	integrase	integrase	NA	NA	NA	NA
AUR54472.1|465443_466538_+	porin	NA	NA	NA	NA	NA
AUR57451.1|466628_467501_+	hypothetical protein	NA	NA	NA	NA	NA
AUR54473.1|467522_468362_-	UTP--glucose-1-phosphate uridylyltransferase	NA	A0A127AW70	Bacillus_phage	48.9	1.1e-66
AUR54474.1|468437_469955_+	peptidase	NA	NA	NA	NA	NA
AUR54475.1|470051_471152_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
AUR54476.1|471168_471591_-	DUF4440 domain-containing protein	NA	NA	NA	NA	NA
AUR54477.1|471613_471826_-	hypothetical protein	NA	NA	NA	NA	NA
AUR54478.1|471872_472793_-	branched chain amino acid aminotransferase	NA	NA	NA	NA	NA
AUR54479.1|472975_473725_+	hypothetical protein	NA	NA	NA	NA	NA
AUR54480.1|473727_474057_+	hypothetical protein	NA	NA	NA	NA	NA
AUR54481.1|474263_475697_+	ATP-dependent RNA helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	34.4	1.5e-52
AUR54482.1|475708_476092_-	thiol reductase thioredoxin	NA	NA	NA	NA	NA
AUR54483.1|476153_476954_+	hypothetical protein	NA	NA	NA	NA	NA
476846:476861	attL	GCTGCCGCCGGCCTGG	NA	NA	NA	NA
AUR54484.1|478252_478459_-	hypothetical protein	NA	NA	NA	NA	NA
AUR57452.1|478530_479142_-	repressor	NA	NA	NA	NA	NA
AUR54485.1|479621_479942_-	hypothetical protein	NA	NA	NA	NA	NA
AUR54486.1|479934_480633_-	hypothetical protein	NA	NA	NA	NA	NA
AUR54487.1|480647_480869_-	hypothetical protein	NA	NA	NA	NA	NA
AUR54488.1|480934_481837_+|integrase	integrase	integrase	NA	NA	NA	NA
AUR54489.1|482476_482962_+|terminase	terminase	terminase	C7U0W1	Enterobacteria_phage	61.5	7.3e-39
AUR54490.1|482948_484226_+|terminase	terminase	terminase	A0A1B1P9C9	Acinetobacter_phage	64.7	2.4e-150
AUR54491.1|484228_485647_+	hypothetical protein	NA	R9TF43	Synechococcus_phage	42.1	2.2e-99
AUR54492.1|485618_486731_+	hypothetical protein	NA	A0A0H5BBX3	Pseudomonas_phage	49.7	2.1e-102
AUR54493.1|486736_486979_+	hypothetical protein	NA	A0A0H5AUE5	Pseudomonas_phage	53.2	5.6e-16
AUR54494.1|487101_487704_+	hypothetical protein	NA	R9TF81	Synechococcus_phage	43.6	7.9e-27
AUR54495.1|488273_489083_-|integrase	integrase	integrase	NA	NA	NA	NA
AUR54496.1|489181_490132_-|integrase	integrase	integrase	NA	NA	NA	NA
AUR54497.1|490806_491058_+	hypothetical protein	NA	NA	NA	NA	NA
AUR54498.1|491120_491603_+	hypothetical protein	NA	A0A2H4JE38	uncultured_Caudovirales_phage	37.1	1.8e-13
AUR54499.1|491604_491805_+	hypothetical protein	NA	NA	NA	NA	NA
AUR54500.1|491804_492200_+	hypothetical protein	NA	A0A2D2W284	Stenotrophomonas_phage	35.0	7.8e-07
AUR54501.1|492196_492595_+	hypothetical protein	NA	I6PCW1	Cronobacter_phage	38.0	4.2e-16
AUR54502.1|492591_493014_+	hypothetical protein	NA	NA	NA	NA	NA
AUR54503.1|493021_493522_+	hypothetical protein	NA	A0A1I9SEX5	Klebsiella_phage	45.1	4.4e-31
AUR54504.1|493776_494295_+|tail	phage tail protein	tail	A0A1S5R1H0	Pseudomonas_phage	38.3	5.4e-24
AUR54505.1|494304_494634_+	hypothetical protein	NA	A0A2H4J121	uncultured_Caudovirales_phage	44.0	2.9e-15
AUR54506.1|494651_494942_+	hypothetical protein	NA	A0A2H4JBP7	uncultured_Caudovirales_phage	45.2	3.7e-14
AUR54507.1|494967_497580_+|tail	phage tail tape measure protein	tail	A0A2H4J107	uncultured_Caudovirales_phage	38.6	4.9e-105
495109:495124	attR	GCTGCCGCCGGCCTGG	NA	NA	NA	NA
AUR54508.1|497589_497949_+	hypothetical protein	NA	NA	NA	NA	NA
AUR54509.1|498016_498550_+	hypothetical protein	NA	A5A3Q9	Burkholderia_phage	46.9	1.1e-40
AUR54510.1|498546_498936_+	hypothetical protein	NA	A0A0G3EYJ9	Achromobacter_phage	50.0	3.0e-35
AUR54511.1|498928_502885_+	hypothetical protein	NA	A0A0B5A1N2	Achromobacter_phage	40.8	3.9e-215
>prophage 7
CP016887	Bordetella pertussis strain J043, complete genome	4102813	715823	780280	4102813	transposase,integrase,tRNA	Pandoravirus(16.67%)	50	749303:749332	786936:786965
AUR54690.1|715823_716813_-|integrase	integrase	integrase	NA	NA	NA	NA
AUR54691.1|717052_717301_+	hypothetical protein	NA	NA	NA	NA	NA
AUR54692.1|717337_718474_+	hypothetical protein	NA	NA	NA	NA	NA
AUR54693.1|720738_721641_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUR54694.1|721642_722497_-	formyltetrahydrofolate deformylase	NA	NA	NA	NA	NA
AUR54695.1|722543_723653_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
AUR54696.1|723663_724182_-	flavin reductase	NA	NA	NA	NA	NA
AUR54697.1|724211_724844_-	pyridoxamine 5'-phosphate oxidase	NA	NA	NA	NA	NA
AUR54698.1|724915_725575_-	gamma-glutamylcyclotransferase	NA	NA	NA	NA	NA
AUR54699.1|725571_726711_-	MFS transporter	NA	NA	NA	NA	NA
AUR54700.1|727060_727933_+|tRNA	tRNA threonylcarbamoyladenosine dehydratase	tRNA	NA	NA	NA	NA
AUR54701.1|728088_728826_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AUR54702.1|728828_730460_-	acyl-CoA synthetase	NA	NA	NA	NA	NA
AUR57467.1|730555_731545_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUR54703.1|731541_732252_+	short-chain dehydrogenase	NA	NA	NA	NA	NA
AUR54704.1|732347_733364_-|transposase	transposase	transposase	NA	NA	NA	NA
AUR54705.1|733635_734262_-	aminotransferase	NA	NA	NA	NA	NA
AUR54706.1|734317_735445_-	aminodeoxychorismate synthase, component I	NA	S4VT78	Pandoravirus	37.8	3.8e-38
AUR54707.1|735450_741168_-	excinuclease ABC subunit A	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	39.5	1.0e-195
AUR54708.1|741496_741667_+	hypothetical protein	NA	NA	NA	NA	NA
AUR54709.1|741735_742680_-	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	23.2	8.4e-07
AUR54710.1|742868_743804_+	glycosyl transferase	NA	NA	NA	NA	NA
AUR54711.1|743921_745493_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUR54712.1|745572_746781_+	ABC transporter permease	NA	NA	NA	NA	NA
AUR57468.1|747329_748196_+	multidrug DMT transporter	NA	NA	NA	NA	NA
749303:749332	attL	GGCATCATCGGCCCCAACGGCGCGGGCAAG	NA	NA	NA	NA
AUR54713.1|750556_750778_+	hypothetical protein	NA	NA	NA	NA	NA
AUR54714.1|751108_752125_+|transposase	transposase	transposase	NA	NA	NA	NA
AUR54715.1|752209_752461_-	cell division topological specificity factor MinE	NA	NA	NA	NA	NA
AUR54716.1|752464_753280_-	septum site-determining protein MinD	NA	NA	NA	NA	NA
AUR54717.1|753392_754271_-	septum site-determining protein MinC	NA	NA	NA	NA	NA
AUR54718.1|754382_756146_-|tRNA	glutamine--tRNA ligase	tRNA	A0A222YZ70	Escherichia_phage	50.0	5.0e-162
AUR54719.1|756261_757602_+	transmembrane cytochrome oxidase	NA	NA	NA	NA	NA
AUR54720.1|757598_758654_+	cytochrome oxidase	NA	NA	NA	NA	NA
AUR54721.1|758670_760095_-	ATPase	NA	NA	NA	NA	NA
AUR54722.1|760094_760796_-	two-component system response regulator OmpR	NA	W8CYM9	Bacillus_phage	36.6	5.6e-32
AUR54723.1|762348_763251_+|integrase	integrase	integrase	NA	NA	NA	NA
AUR57469.1|763346_764318_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUR54724.1|764322_765003_-	hypothetical protein	NA	NA	NA	NA	NA
AUR54725.1|765140_765533_+	osmotically inducible protein OsmC	NA	NA	NA	NA	NA
AUR54726.1|765640_766657_-|transposase	transposase	transposase	NA	NA	NA	NA
AUR54727.1|766896_767682_-	enoyl-[acyl-carrier-protein] reductase	NA	NA	NA	NA	NA
AUR54728.1|767776_769186_-	lytic transglycosylase	NA	NA	NA	NA	NA
AUR54729.1|769196_769997_-	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
AUR54730.1|770017_770788_+	methyltransferase type 11	NA	NA	NA	NA	NA
AUR54731.1|770830_771298_+	ribonuclease HI	NA	J9Q745	Salmonella_phage	50.7	5.6e-36
AUR54732.1|772325_773846_-	hypothetical protein	NA	NA	NA	NA	NA
AUR54733.1|773824_774157_-	hypothetical protein	NA	NA	NA	NA	NA
AUR54734.1|774192_775071_-	fatty acid desaturase	NA	NA	NA	NA	NA
AUR54735.1|775997_778976_-	hypothetical protein	NA	NA	NA	NA	NA
AUR54736.1|779329_780280_+|integrase	integrase	integrase	NA	NA	NA	NA
786936:786965	attR	GGCATCATCGGCCCCAACGGCGCGGGCAAG	NA	NA	NA	NA
>prophage 8
CP016887	Bordetella pertussis strain J043, complete genome	4102813	864978	897878	4102813	integrase,tRNA,protease	Pseudomonas_phage(33.33%)	30	892950:892967	899879:899896
AUR54806.1|864978_865575_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
AUR54807.1|865571_866354_+|protease	CAAX protease	protease	NA	NA	NA	NA
AUR54808.1|866426_867518_+	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
AUR54809.1|867797_868925_+|integrase	integrase	integrase	A0A1B0VMI6	Pseudomonas_phage	33.6	1.4e-48
AUR54810.1|869266_870313_+	cell filamentation protein Fic	NA	NA	NA	NA	NA
AUR57472.1|870823_873580_+	restriction endonuclease	NA	NA	NA	NA	NA
AUR54811.1|873581_876533_+	DNA methylase	NA	G8I4P9	Mycobacterium_phage	25.1	2.9e-21
AUR54812.1|876548_877760_+	chromosome segregation protein SMC	NA	NA	NA	NA	NA
AUR54813.1|877943_878894_+|integrase	integrase	integrase	NA	NA	NA	NA
AUR54814.1|879408_879666_+	hypothetical protein	NA	NA	NA	NA	NA
AUR54815.1|879894_880140_-	hypothetical protein	NA	NA	NA	NA	NA
AUR54816.1|880209_881121_+	hypothetical protein	NA	NA	NA	NA	NA
AUR54817.1|881190_881487_+	hypothetical protein	NA	A0A1V0SIN4	Klosneuvirus	34.1	5.5e-05
AUR54818.1|881565_882036_-	hypothetical protein	NA	NA	NA	NA	NA
AUR54819.1|882270_883221_-|integrase	integrase	integrase	NA	NA	NA	NA
AUR54820.1|883414_884230_+	MerR family transcriptional regulator	NA	NA	NA	NA	NA
AUR54821.1|884362_885802_+	amine oxidase	NA	NA	NA	NA	NA
AUR54822.1|885815_886157_+	cupin	NA	NA	NA	NA	NA
AUR54823.1|886211_887867_+	gamma-glutamyltransferase	NA	NA	NA	NA	NA
AUR54824.1|888018_889029_+	LacI family transcriptional regulator	NA	NA	NA	NA	NA
AUR54825.1|889161_889935_+	molybdate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUR54826.1|890462_891413_+|integrase	integrase	integrase	NA	NA	NA	NA
AUR54827.1|891503_891932_+	AsnC family transcriptional regulator	NA	NA	NA	NA	NA
892950:892967	attL	CGCGCCAGCAGGTGGCCG	NA	NA	NA	NA
AUR57473.1|893703_894069_+	hypothetical protein	NA	NA	NA	NA	NA
AUR54828.1|894084_894564_+	hypothetical protein	NA	NA	NA	NA	NA
AUR54829.1|894715_895015_+	hypothetical protein	NA	NA	NA	NA	NA
AUR54830.1|895060_895183_+	hypothetical protein	NA	NA	NA	NA	NA
AUR54831.1|895275_895857_-	hypothetical protein	NA	NA	NA	NA	NA
AUR54832.1|895926_896829_+	hydrolase	NA	NA	NA	NA	NA
AUR54833.1|896927_897878_+|integrase	integrase	integrase	NA	NA	NA	NA
899879:899896	attR	CGGCCACCTGCTGGCGCG	NA	NA	NA	NA
>prophage 9
CP016887	Bordetella pertussis strain J043, complete genome	4102813	902390	950002	4102813	integrase,tRNA	Erwinia_phage(10.0%)	46	894301:894318	954424:954441
894301:894318	attL	GGCGGACTGCTGCTGCAG	NA	NA	NA	NA
AUR54836.1|902390_903341_-|integrase	integrase	integrase	NA	NA	NA	NA
AUR54837.1|903438_903999_-	ATP:cob(I)alamin adenosyltransferase	NA	NA	NA	NA	NA
AUR57475.1|904423_904729_+	RND transporter	NA	NA	NA	NA	NA
AUR54838.1|904742_906077_-	HslU--HslV peptidase ATPase subunit	NA	A0A191ZC11	Erwinia_phage	29.6	3.5e-43
AUR54839.1|906098_906638_-	HslU--HslV peptidase proteolytic subunit	NA	NA	NA	NA	NA
AUR54840.1|906785_907250_-	RNA polymerase-binding protein DksA	NA	NA	NA	NA	NA
AUR54841.1|907392_908508_-	cobalamin biosynthesis protein CobW	NA	NA	NA	NA	NA
AUR54842.1|908784_909288_-	transcriptional repressor	NA	NA	NA	NA	NA
AUR54843.1|909425_909626_+	hypothetical protein	NA	NA	NA	NA	NA
AUR54844.1|909616_910339_+	ABC transporter	NA	A0A2R8FG22	Brazilian_cedratvirus	30.0	1.1e-11
AUR54845.1|910335_911232_+	zinc ABC transporter permease	NA	NA	NA	NA	NA
AUR54846.1|911228_912164_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUR54847.1|912124_912793_+	hypothetical protein	NA	NA	NA	NA	NA
AUR54848.1|912783_913752_+	nickel transporter	NA	NA	NA	NA	NA
AUR54849.1|913800_915942_+	TonB-dependent receptor	NA	NA	NA	NA	NA
AUR54850.1|915954_916935_-	tyrosine recombinase XerC	NA	A0A166YH27	Gordonia_phage	30.5	3.3e-14
AUR54851.1|916949_917642_-	hypothetical protein	NA	NA	NA	NA	NA
AUR54852.1|917668_918580_-	diaminopimelate epimerase	NA	NA	NA	NA	NA
AUR54853.1|918622_919513_-	acyltransferase	NA	NA	NA	NA	NA
AUR54854.1|919509_920364_-	lipid A biosynthesis lauroyl acyltransferase	NA	NA	NA	NA	NA
AUR54855.1|920647_921811_+	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	60.8	5.0e-126
AUR54856.1|921921_922173_+	hypothetical protein	NA	NA	NA	NA	NA
AUR54857.1|922252_923293_+	alpha-mannosyltransferase	NA	NA	NA	NA	NA
AUR54858.1|923572_924991_+	adenosylhomocysteinase	NA	S4VPF6	Pandoravirus	29.4	8.7e-40
AUR54859.1|925061_925397_+	hypothetical protein	NA	NA	NA	NA	NA
AUR54860.1|925396_926239_+	methylenetetrahydrofolate reductase [NAD(P)H]	NA	NA	NA	NA	NA
AUR54861.1|926385_927288_+|integrase	integrase	integrase	NA	NA	NA	NA
AUR54862.1|927352_928324_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUR54863.1|928387_929407_-	acetylpolyamine aminohydrolase	NA	A0A2K9L473	Tupanvirus	31.7	3.4e-22
AUR54864.1|929408_930749_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUR57476.1|931059_931740_-	5-formyltetrahydrofolate cyclo-ligase	NA	NA	NA	NA	NA
AUR57477.1|931815_933879_+	lytic transglycosylase	NA	A0A0S2SXL7	Bacillus_phage	36.6	5.3e-14
AUR54865.1|933875_934970_+|tRNA	tRNA CCA-pyrophosphorylase	tRNA	A0A0F6YPT7	Sinorhizobium_phage	50.5	2.4e-50
AUR54866.1|934984_936175_-	hypothetical protein	NA	NA	NA	NA	NA
AUR54867.1|936263_937952_-	RNA helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	32.9	1.6e-48
AUR54868.1|938226_938979_-	uracil-DNA glycosylase	NA	A0A1Y0B680	Bovine_alphaherpesvirus	47.5	2.5e-46
AUR54869.1|939117_940068_+|integrase	integrase	integrase	NA	NA	NA	NA
AUR54870.1|940508_941414_-	oxidoreductase	NA	NA	NA	NA	NA
AUR54871.1|941469_943074_-	gamma-glutamyltransferase	NA	NA	NA	NA	NA
AUR54872.1|943330_944836_-	hypothetical protein	NA	NA	NA	NA	NA
AUR54873.1|944850_945315_-	tricarboxylate transporter	NA	NA	NA	NA	NA
AUR54874.1|945604_946555_-|integrase	integrase	integrase	NA	NA	NA	NA
AUR54875.1|946653_947556_-|integrase	integrase	integrase	NA	NA	NA	NA
AUR54876.1|947765_948296_+	hypothetical protein	NA	NA	NA	NA	NA
AUR54877.1|948295_948607_+	cell division protein ZapA	NA	NA	NA	NA	NA
AUR54878.1|949051_950002_-|integrase	integrase	integrase	NA	NA	NA	NA
954424:954441	attR	CTGCAGCAGCAGTCCGCC	NA	NA	NA	NA
>prophage 10
CP016887	Bordetella pertussis strain J043, complete genome	4102813	1092046	1157305	4102813	integrase,tRNA,protease	Klebsiella_phage(16.67%)	49	1148425:1148442	1158725:1158742
AUR54992.1|1092046_1092949_+|integrase	integrase	integrase	NA	NA	NA	NA
AUR54993.1|1093047_1093419_-	DNA-binding protein	NA	NA	NA	NA	NA
AUR54994.1|1093543_1094374_+	acyltransferase	NA	NA	NA	NA	NA
AUR54995.1|1094384_1095845_+|protease	metalloprotease TldD	protease	NA	NA	NA	NA
AUR54996.1|1096101_1097175_+	3-deoxy-7-phosphoheptulonate synthase	NA	A0A2I6UFP9	Klebsiella_phage	46.4	3.9e-77
AUR54997.1|1097196_1109850_-	peptidase C80	NA	A0A0R6PJK4	Moraxella_phage	30.5	1.2e-15
AUR54998.1|1109979_1111389_+	2-hydroxy-acid oxidase	NA	NA	NA	NA	NA
AUR54999.1|1111523_1113023_+	glycolate oxidase subunit GlcD	NA	NA	NA	NA	NA
AUR55000.1|1113034_1114144_+	glycolate oxidase subunit GlcE	NA	NA	NA	NA	NA
AUR55001.1|1114176_1115406_+	glycolate oxidase iron-sulfur subunit	NA	NA	NA	NA	NA
AUR55002.1|1115396_1116308_-	ferric-enterobactin hydrolase	NA	NA	NA	NA	NA
AUR55003.1|1116310_1118524_-	outer membrane receptor protein	NA	NA	NA	NA	NA
AUR55004.1|1118699_1119710_+	transcriptional regulator	NA	NA	NA	NA	NA
AUR55005.1|1121504_1122623_-	NADP transhydrogenase subunit alpha	NA	NA	NA	NA	NA
AUR55006.1|1122877_1123753_-	N-formylglutamate amidohydrolase	NA	NA	NA	NA	NA
AUR55007.1|1123813_1124800_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUR55008.1|1124970_1125891_+	LysR family transcriptional regulator	NA	Q6JIH3	Burkholderia_virus	30.5	2.7e-26
AUR55009.1|1125903_1127019_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
AUR55010.1|1127119_1127938_+	hypothetical protein	NA	NA	NA	NA	NA
AUR55011.1|1128035_1128647_-	glutathione S-transferase	NA	NA	NA	NA	NA
AUR55012.1|1128806_1130183_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	47.5	2.2e-109
AUR55013.1|1130245_1130704_+	cytochrome C	NA	NA	NA	NA	NA
AUR55014.1|1130788_1131484_-	cytochrome B	NA	NA	NA	NA	NA
AUR55015.1|1131545_1131827_-	hypothetical protein	NA	NA	NA	NA	NA
AUR55016.1|1132389_1133142_+	hypothetical protein	NA	NA	NA	NA	NA
AUR55017.1|1133186_1134263_+	AI-2E family transporter	NA	NA	NA	NA	NA
AUR55018.1|1134259_1135162_-|integrase	integrase	integrase	NA	NA	NA	NA
AUR55019.1|1135273_1135549_+	hypothetical protein	NA	NA	NA	NA	NA
AUR55020.1|1135695_1136598_+|integrase	integrase	integrase	NA	NA	NA	NA
AUR55021.1|1136608_1137478_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUR55022.1|1137548_1138244_+	hypothetical protein	NA	NA	NA	NA	NA
AUR55023.1|1138233_1138743_+|tRNA	tRNA-specific adenosine deaminase	tRNA	NA	NA	NA	NA
AUR55024.1|1138739_1139960_+	MFS transporter	NA	NA	NA	NA	NA
AUR55025.1|1139907_1140810_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUR55026.1|1141744_1142983_+|integrase	integrase	integrase	NA	NA	NA	NA
AUR55027.1|1143021_1144395_+	amidase	NA	NA	NA	NA	NA
AUR55028.1|1144433_1145135_-	riboflavin synthase subunit alpha	NA	NA	NA	NA	NA
AUR55029.1|1145433_1146423_+	MFS transporter	NA	NA	NA	NA	NA
AUR55030.1|1146523_1146985_+	transcriptional regulator	NA	NA	NA	NA	NA
AUR55031.1|1147000_1147549_-	cysteine dioxygenase	NA	NA	NA	NA	NA
AUR55032.1|1147690_1149166_-	acid--CoA ligase	NA	Q75ZG1	Hepacivirus	25.6	3.0e-35
1148425:1148442	attL	CCATCATGGTGGGCACCG	NA	NA	NA	NA
AUR55033.1|1149271_1150363_+	hypothetical protein	NA	NA	NA	NA	NA
AUR55034.1|1150366_1151149_-	ABC transporter permease	NA	NA	NA	NA	NA
AUR55035.1|1151158_1151947_-	ABC transporter	NA	G3M9Y6	Bacillus_virus	40.0	1.1e-33
AUR55036.1|1153072_1153507_-	thioesterase	NA	NA	NA	NA	NA
AUR55037.1|1153503_1154514_-	zinc-binding dehydrogenase	NA	NA	NA	NA	NA
AUR55038.1|1154557_1155484_-	hypothetical protein	NA	NA	NA	NA	NA
AUR55039.1|1155769_1156138_+	hypothetical protein	NA	NA	NA	NA	NA
AUR55040.1|1156354_1157305_+|integrase	integrase	integrase	NA	NA	NA	NA
1158725:1158742	attR	CCATCATGGTGGGCACCG	NA	NA	NA	NA
>prophage 11
CP016887	Bordetella pertussis strain J043, complete genome	4102813	1166894	1217543	4102813	integrase	Ostreococcus_lucimarinus_virus(25.0%)	44	1167759:1167818	1217544:1217630
AUR55048.1|1166894_1167845_+|integrase	integrase	integrase	NA	NA	NA	NA
1167759:1167818	attL	CATCGACCCCACCAAGGCATCGGGCGCGCTGTACCCATCTCCAGACTCAACCTGGACGAA	NA	NA	NA	NA
AUR55049.1|1167906_1169016_-	porin	NA	NA	NA	NA	NA
AUR55050.1|1169528_1170365_-	3-methyl-2-oxobutanoate hydroxymethyltransferase	NA	A0A0P0BXC9	Ostreococcus_lucimarinus_virus	33.3	1.6e-33
AUR55051.1|1170491_1171400_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUR55052.1|1171396_1172299_-|integrase	integrase	integrase	NA	NA	NA	NA
AUR55053.1|1172732_1173275_+	hypothetical protein	NA	NA	NA	NA	NA
AUR55054.1|1174310_1175261_+|integrase	integrase	integrase	NA	NA	NA	NA
AUR55055.1|1175502_1175871_+	hypothetical protein	NA	NA	NA	NA	NA
AUR55056.1|1175916_1177041_+	hypothetical protein	NA	NA	NA	NA	NA
AUR57492.1|1178175_1178916_-	oxidoreductase	NA	NA	NA	NA	NA
AUR55057.1|1179019_1179640_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
AUR55058.1|1179641_1181750_-	hypothetical protein	NA	NA	NA	NA	NA
AUR55059.1|1181894_1182506_-	3-methyladenine DNA glycosylase	NA	NA	NA	NA	NA
AUR55060.1|1182585_1183050_-	redox-sensitive transcriptional activator SoxR	NA	NA	NA	NA	NA
AUR55061.1|1183325_1183511_+	hypothetical protein	NA	NA	NA	NA	NA
AUR55062.1|1183562_1184315_-	DNA-binding protein	NA	NA	NA	NA	NA
AUR55063.1|1184321_1185584_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUR55064.1|1187941_1189069_-	phosphate ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	32.3	1.2e-23
AUR55065.1|1189079_1189907_-	sugar ABC transporter permease	NA	NA	NA	NA	NA
AUR55066.1|1189893_1190760_-	ABC transporter permease	NA	NA	NA	NA	NA
AUR55067.1|1190756_1191665_-	hypothetical protein	NA	NA	NA	NA	NA
AUR55068.1|1191671_1192130_-	hypothetical protein	NA	NA	NA	NA	NA
AUR55069.1|1192126_1192531_-	hypothetical protein	NA	NA	NA	NA	NA
AUR57493.1|1192893_1193805_+	hypothetical protein	NA	NA	NA	NA	NA
AUR55070.1|1193819_1194530_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AUR55071.1|1194526_1195771_+	hypothetical protein	NA	NA	NA	NA	NA
AUR55072.1|1195772_1196207_+	hypothetical protein	NA	NA	NA	NA	NA
AUR55073.1|1196235_1196541_+	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
AUR55074.1|1196639_1197590_+|integrase	integrase	integrase	NA	NA	NA	NA
AUR55075.1|1197646_1198795_-	alcohol dehydrogenase	NA	NA	NA	NA	NA
AUR55076.1|1198875_1199778_-|integrase	integrase	integrase	NA	NA	NA	NA
AUR55077.1|1200357_1201155_-	metal ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUR55078.1|1201202_1201856_-	DL-methionine transporter permease subunit	NA	NA	NA	NA	NA
AUR55079.1|1201812_1202901_-	phosphate ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.4	8.7e-32
AUR55080.1|1203065_1205291_-	glycosyl hydrolase	NA	NA	NA	NA	NA
AUR55081.1|1207568_1208465_+	inositol monophosphatase	NA	NA	NA	NA	NA
AUR55082.1|1208633_1209536_+|integrase	integrase	integrase	NA	NA	NA	NA
AUR55083.1|1209532_1211224_-	long-chain fatty acid--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	28.1	9.4e-33
AUR55084.1|1211285_1212482_+	amidohydrolase	NA	NA	NA	NA	NA
AUR55085.1|1212495_1213374_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUR55086.1|1213480_1214527_+	hypothetical protein	NA	NA	NA	NA	NA
AUR55087.1|1214590_1215001_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
AUR55088.1|1215011_1216484_+	magnesium transporter	NA	NA	NA	NA	NA
AUR55089.1|1216679_1217543_+|integrase	integrase	integrase	NA	NA	NA	NA
1217544:1217630	attR	CATCGACCCCACCAAGGCATCGGGCGCGCTGTACCCATCTCCAGACTCAACCTGGACGAATACAACCTATTGACAGTTCACAGCTAG	NA	NA	NA	NA
>prophage 12
CP016887	Bordetella pertussis strain J043, complete genome	4102813	1239923	1296696	4102813	integrase,protease	uncultured_Mediterranean_phage(28.57%)	40	1295644:1295703	1305715:1305863
AUR55111.1|1239923_1240874_+|integrase	integrase	integrase	NA	NA	NA	NA
AUR55112.1|1240930_1242043_+	malate dehydrogenase	NA	NA	NA	NA	NA
AUR55113.1|1244426_1245377_-|integrase	integrase	integrase	NA	NA	NA	NA
AUR55114.1|1245967_1246744_+	2-dehydro-3-deoxyglucarate aldolase	NA	NA	NA	NA	NA
AUR55115.1|1246861_1247125_-	30S ribosomal protein S20	NA	NA	NA	NA	NA
AUR55116.1|1247225_1248230_-	iron dicitrate transport regulator FecR	NA	NA	NA	NA	NA
AUR55117.1|1248430_1250032_-	murein biosynthesis integral membrane protein MurJ	NA	NA	NA	NA	NA
AUR55118.1|1250057_1250816_-	3-hydroxy-2-methylbutyryl-CoA dehydrogenase	NA	NA	NA	NA	NA
AUR55119.1|1250907_1251564_-	adenylate kinase	NA	NA	NA	NA	NA
AUR55120.1|1251654_1252419_-	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
AUR55121.1|1252428_1252617_-	hypothetical protein	NA	NA	NA	NA	NA
AUR55122.1|1252672_1253716_-	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
AUR55123.1|1253712_1254126_-	biopolymer transporter ExbD	NA	NA	NA	NA	NA
AUR55124.1|1254122_1254743_-	flagellar motor protein MotA	NA	NA	NA	NA	NA
AUR55125.1|1255071_1255974_+|integrase	integrase	integrase	NA	NA	NA	NA
AUR55126.1|1256141_1257533_+	exodeoxyribonuclease VII large subunit	NA	A0A1V0SD82	Indivirus	32.0	1.4e-29
AUR55127.1|1257605_1258184_+	superoxide dismutase	NA	NA	NA	NA	NA
AUR55128.1|1258300_1259698_+	chloride channel protein EriC	NA	NA	NA	NA	NA
AUR55129.1|1259813_1261019_+	3-oxoadipyl-CoA thiolase	NA	NA	NA	NA	NA
AUR55130.1|1261118_1261610_-	hypothetical protein	NA	A0A1B1IUW8	uncultured_Mediterranean_phage	42.2	4.8e-14
AUR55131.1|1261731_1261977_-	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	76.6	1.3e-20
AUR55132.1|1262204_1262519_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	43.8	1.2e-10
AUR57496.1|1263232_1267798_+	alpha-2-macroglobulin	NA	NA	NA	NA	NA
AUR57495.1|1267794_1269963_+	penicillin-binding protein 1C	NA	NA	NA	NA	NA
AUR55133.1|1270018_1272334_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	41.9	4.1e-164
AUR55134.1|1272338_1273658_+	paraquat-inducible protein A	NA	NA	NA	NA	NA
AUR55135.1|1273676_1275350_+	paraquat-inducible protein B	NA	NA	NA	NA	NA
AUR55136.1|1275354_1276023_+	hypothetical protein	NA	NA	NA	NA	NA
AUR55137.1|1276179_1279992_+	trifunctional transcriptional regulator/proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
AUR55138.1|1281295_1282441_+	branched chain amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUR55139.1|1282589_1283519_+	ABC transporter permease	NA	NA	NA	NA	NA
AUR55140.1|1283515_1284604_+	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
AUR55141.1|1284600_1285404_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	23.5	7.9e-14
AUR55142.1|1285400_1286132_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.0	1.4e-12
AUR55143.1|1286189_1287479_-	MFS transporter	NA	NA	NA	NA	NA
AUR55144.1|1287575_1288178_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
AUR55145.1|1289118_1291398_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	NA	NA	NA	NA
AUR55146.1|1292726_1293065_-	transcriptional regulator	NA	NA	NA	NA	NA
AUR55147.1|1293772_1294039_+	hypothetical protein	NA	NA	NA	NA	NA
1295644:1295703	attL	CTAGCTGTGAAGATTCAATAGGTTGTATGCATGGTTCATCCGAACCGGATTTGAGAAACT	NA	NA	NA	NA
AUR55148.1|1295793_1296696_+|integrase	integrase	integrase	NA	NA	NA	NA
AUR55148.1|1295793_1296696_+|integrase	integrase	integrase	NA	NA	NA	NA
1305715:1305863	attR	AGTTTCTCAAATCCGGTTCGGATGAACCATGCATACAACCTATTGAATCTTCACAGCTAGCCGAGGTGGGTGTGGCGCTCGGGACGCTCTTCGACCTGCATCTCGCTCAGGCCGTGCAGGATGCCGCAGTCCTCGGCGTCCGGGCGGGC	NA	NA	NA	NA
>prophage 13
CP016887	Bordetella pertussis strain J043, complete genome	4102813	1304721	1376631	4102813	transposase,integrase	Streptococcus_phage(14.29%)	56	1324472:1324493	1381923:1381944
AUR55155.1|1304721_1305624_-|integrase	integrase	integrase	NA	NA	NA	NA
AUR55156.1|1305770_1306205_-	Cd(II)/Pb(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
AUR55157.1|1306287_1308624_+	copper-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	42.8	3.2e-124
AUR55158.1|1308815_1309832_+|transposase	transposase	transposase	NA	NA	NA	NA
AUR55159.1|1310022_1310613_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
AUR55160.1|1310703_1311009_-	hypothetical protein	NA	NA	NA	NA	NA
AUR57498.1|1311476_1312484_+	biotin synthase BioB	NA	NA	NA	NA	NA
AUR55161.1|1312480_1313356_+	hypothetical protein	NA	NA	NA	NA	NA
AUR55162.1|1313430_1314831_-	MFS transporter	NA	NA	NA	NA	NA
AUR57499.1|1314908_1315412_-	peroxiredoxin	NA	M1I839	Pelagibacter_phage	44.1	1.8e-24
AUR55163.1|1315663_1316095_+	hypothetical protein	NA	NA	NA	NA	NA
AUR55164.1|1316104_1316989_-	carboxymethylenebutenolidase	NA	NA	NA	NA	NA
AUR55165.1|1317006_1320468_-	hypothetical protein	NA	NA	NA	NA	NA
AUR55166.1|1320603_1321089_+	molybdenum cofactor biosynthesis protein C	NA	NA	NA	NA	NA
AUR55167.1|1321069_1321321_+	molybdopterin synthase sulfur carrier subunit	NA	NA	NA	NA	NA
AUR57500.1|1321326_1321809_+	molybdenum cofactor biosynthesis protein MoaE	NA	NA	NA	NA	NA
AUR55168.1|1321805_1322327_+	molybdenum cofactor biosynthesis protein B	NA	NA	NA	NA	NA
AUR55169.1|1322333_1323539_+	molybdopterin molybdenumtransferase MoeA	NA	NA	NA	NA	NA
AUR55170.1|1323683_1324781_-	cyclic pyranopterin phosphate synthase	NA	NA	NA	NA	NA
1324472:1324493	attL	GCAGCAGCGGCTCGCCGCCGGT	NA	NA	NA	NA
AUR55171.1|1324791_1325898_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUR55172.1|1326032_1326983_+|integrase	integrase	integrase	NA	NA	NA	NA
AUR55173.1|1327085_1327670_+	nitroreductase	NA	NA	NA	NA	NA
AUR57501.1|1327739_1329161_-	argininosuccinate lyase	NA	NA	NA	NA	NA
AUR55174.1|1329268_1330615_+	mechanosensitive ion channel protein MscS	NA	NA	NA	NA	NA
AUR55175.1|1330653_1332288_+	NAD+ synthase	NA	A0A2L0UZF5	Agrobacterium_phage	36.6	8.3e-87
AUR55176.1|1332331_1332670_+	transcriptional regulator	NA	NA	NA	NA	NA
AUR55177.1|1332694_1333069_-	endonuclease	NA	F4YXR7	Roseobacter_phage	54.4	2.1e-25
AUR55178.1|1335693_1335921_-	hypothetical protein	NA	NA	NA	NA	NA
AUR55179.1|1336181_1337063_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUR55180.1|1337170_1338799_+	gamma-glutamyltransferase	NA	NA	NA	NA	NA
AUR55181.1|1338840_1340358_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUR55182.1|1340452_1341397_+	peptide ABC transporter	NA	NA	NA	NA	NA
AUR55183.1|1342578_1343481_-	ribosome small subunit-dependent GTPase A	NA	NA	NA	NA	NA
AUR55184.1|1343477_1344743_-	peptidase M48	NA	NA	NA	NA	NA
AUR55185.1|1344787_1345333_+	oligoribonuclease	NA	Q8B5Y0	Diachasmimorpha_longicaudata_entomopoxvirus	37.7	2.1e-26
AUR55186.1|1345366_1346053_+	NAD(P)H-hydrate epimerase	NA	NA	NA	NA	NA
AUR55187.1|1346024_1346954_-	phenylacetic acid degradation operon negative regulatory protein PaaX	NA	NA	NA	NA	NA
AUR55188.1|1347125_1348115_+	1,2-phenylacetyl-CoA epoxidase subunit A	NA	NA	NA	NA	NA
AUR55189.1|1348179_1348464_+	1,2-phenylacetyl-CoA epoxidase subunit B	NA	NA	NA	NA	NA
AUR55190.1|1348479_1349244_+	phenylacetate-CoA oxygenase subunit PaaI	NA	NA	NA	NA	NA
AUR57502.1|1349240_1349747_+	phenylacetate-CoA oxygenase subunit PaaJ	NA	NA	NA	NA	NA
AUR55191.1|1350956_1351859_+|integrase	integrase	integrase	NA	NA	NA	NA
AUR55192.1|1351946_1353599_+	phenylacetic acid degradation protein PaaN	NA	NA	NA	NA	NA
AUR55193.1|1353609_1354398_+	2-(1,2-epoxy-1,2-dihydrophenyl)acetyl-CoA isomerase	NA	NA	NA	NA	NA
AUR55194.1|1354397_1354868_+	phenylacetic acid degradation protein PaaD	NA	NA	NA	NA	NA
AUR55195.1|1354942_1356256_+	phenylacetate--CoA ligase	NA	NA	NA	NA	NA
AUR55196.1|1356309_1356915_-	fimbrial protein	NA	NA	NA	NA	NA
AUR55197.1|1357231_1358182_+|integrase	integrase	integrase	NA	NA	NA	NA
AUR55198.1|1358178_1359129_-|integrase	integrase	integrase	NA	NA	NA	NA
AUR55199.1|1359227_1360178_-|integrase	integrase	integrase	NA	NA	NA	NA
AUR55200.1|1360438_1361467_-	C4-dicarboxylate ABC transporter	NA	NA	NA	NA	NA
AUR55201.1|1361546_1362845_-	C4-dicarboxylate ABC transporter	NA	NA	NA	NA	NA
AUR55202.1|1362841_1363378_-	C4-dicarboxylate ABC transporter	NA	NA	NA	NA	NA
AUR55203.1|1363735_1367782_+	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	67.4	6.3e-160
AUR55204.1|1368022_1375684_+	adhesin	NA	A0A0R6PJK4	Moraxella_phage	30.9	7.3e-24
AUR55205.1|1375680_1376631_-|integrase	integrase	integrase	NA	NA	NA	NA
1381923:1381944	attR	GCAGCAGCGGCTCGCCGCCGGT	NA	NA	NA	NA
>prophage 14
CP016887	Bordetella pertussis strain J043, complete genome	4102813	1411105	1468858	4102813	integrase	Salmonella_phage(28.57%)	52	1424900:1424916	1471591:1471607
AUR55234.1|1411105_1412056_+|integrase	integrase	integrase	NA	NA	NA	NA
AUR55235.1|1412241_1412511_-	hypothetical protein	NA	NA	NA	NA	NA
AUR55236.1|1412749_1413388_+	hypothetical protein	NA	NA	NA	NA	NA
AUR55237.1|1413637_1414174_+	hypothetical protein	NA	NA	NA	NA	NA
AUR55238.1|1414192_1415806_+	autotransporter	NA	NA	NA	NA	NA
AUR55239.1|1415802_1416414_-	hypothetical protein	NA	NA	NA	NA	NA
AUR55240.1|1416636_1418097_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	41.3	1.6e-97
AUR55241.1|1418193_1419786_+	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	33.3	1.0e-17
AUR55242.1|1420139_1420397_+	transcriptional regulator	NA	NA	NA	NA	NA
AUR55243.1|1420398_1421739_+	toxin HipA	NA	NA	NA	NA	NA
AUR55244.1|1421834_1422524_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
AUR55245.1|1422536_1423967_+	MFS transporter	NA	NA	NA	NA	NA
1424900:1424916	attL	ACGCTGGCCGGCACGCT	NA	NA	NA	NA
AUR55246.1|1425691_1426513_+	transcriptional regulator	NA	NA	NA	NA	NA
AUR55247.1|1426523_1428095_+	hypothetical protein	NA	NA	NA	NA	NA
AUR55248.1|1428123_1429101_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUR55249.1|1429127_1429931_+	nitrate ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.2	2.7e-30
AUR55250.1|1429927_1430722_+	ABC transporter permease	NA	NA	NA	NA	NA
AUR55251.1|1430729_1431965_+	hypothetical protein	NA	NA	NA	NA	NA
AUR57507.1|1431957_1432392_+	aconitase subunit 2	NA	NA	NA	NA	NA
AUR55252.1|1433664_1435392_-	transporter	NA	NA	NA	NA	NA
AUR55253.1|1435503_1436862_+	mRNA 3'-end processing factor	NA	NA	NA	NA	NA
AUR55254.1|1437154_1438105_+|integrase	integrase	integrase	NA	NA	NA	NA
AUR55255.1|1438145_1439216_+	hypothetical protein	NA	NA	NA	NA	NA
AUR55256.1|1439238_1440117_-	hypothetical protein	NA	NA	NA	NA	NA
AUR55257.1|1440288_1441260_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AUR55258.1|1441422_1442265_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUR55259.1|1442426_1443107_+	anti-sigma factor	NA	NA	NA	NA	NA
AUR55260.1|1443100_1444270_+	amine oxidase	NA	NA	NA	NA	NA
AUR55261.1|1444266_1445298_+	alcohol dehydrogenase	NA	A0A2K9L339	Tupanvirus	27.8	1.8e-26
AUR55262.1|1445365_1446583_+	MFS transporter	NA	NA	NA	NA	NA
AUR55263.1|1446617_1448150_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AUR55264.1|1448230_1448854_+	transcriptional regulator	NA	NA	NA	NA	NA
AUR55265.1|1448884_1449496_+	RhtB family transporter	NA	NA	NA	NA	NA
AUR55266.1|1449531_1450002_+	histidine kinase	NA	NA	NA	NA	NA
AUR55267.1|1450433_1451438_+	peptidase M20	NA	NA	NA	NA	NA
AUR55268.1|1451474_1452989_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUR55269.1|1452992_1453952_+	ABC transporter	NA	NA	NA	NA	NA
AUR55270.1|1453980_1454784_+	peptide ABC transporter permease	NA	NA	NA	NA	NA
AUR55271.1|1454785_1456420_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.1	2.9e-15
AUR55272.1|1456503_1457565_+	LacI family transcriptional regulator	NA	NA	NA	NA	NA
AUR55273.1|1458036_1458561_+	DNA-binding protein	NA	J9Q7G7	Salmonella_phage	32.9	6.5e-09
AUR55274.1|1459024_1459927_+|integrase	integrase	integrase	NA	NA	NA	NA
AUR55275.1|1459923_1460958_-	hydrolase	NA	NA	NA	NA	NA
AUR55276.1|1461066_1461705_+	hypothetical protein	NA	NA	NA	NA	NA
AUR55277.1|1461999_1462227_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AUR55278.1|1462349_1463063_+	methyltransferase type 11	NA	NA	NA	NA	NA
AUR55279.1|1463307_1464210_-|integrase	integrase	integrase	NA	NA	NA	NA
AUR55280.1|1464397_1464643_+	hypothetical protein	NA	NA	NA	NA	NA
AUR55281.1|1464757_1466206_-	2-aminoadipate aminotransferase	NA	NA	NA	NA	NA
AUR55282.1|1466364_1467267_+|integrase	integrase	integrase	NA	NA	NA	NA
AUR55283.1|1467263_1467713_-	deoxyuridine 5'-triphosphate nucleotidohydrolase	NA	S4TNT3	Salmonella_phage	67.2	3.7e-45
AUR55284.1|1467955_1468858_+|integrase	integrase	integrase	NA	NA	NA	NA
1471591:1471607	attR	AGCGTGCCGGCCAGCGT	NA	NA	NA	NA
>prophage 15
CP016887	Bordetella pertussis strain J043, complete genome	4102813	1803156	1862052	4102813	integrase	Enterobacteria_phage(33.33%)	59	1820277:1820295	1867603:1867621
AUR55561.1|1803156_1804107_+|integrase	integrase	integrase	NA	NA	NA	NA
AUR55562.1|1804103_1805426_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUR57530.1|1805526_1805817_-	hypothetical protein	NA	NA	NA	NA	NA
AUR55563.1|1805977_1807291_+	pyrimidine utilization transport protein G	NA	Q9KX94	Enterobacteria_phage	67.1	2.1e-149
AUR55564.1|1807321_1808863_-	chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	29.1	1.1e-11
AUR55565.1|1809486_1809963_+	transcription elongation factor GreA	NA	NA	NA	NA	NA
AUR55566.1|1810264_1811215_-|integrase	integrase	integrase	NA	NA	NA	NA
AUR55567.1|1811557_1812013_+	hypothetical protein	NA	NA	NA	NA	NA
AUR55568.1|1812048_1812315_-	type III secretion protein	NA	NA	NA	NA	NA
AUR55569.1|1812304_1812604_-	hypothetical protein	NA	NA	NA	NA	NA
AUR55570.1|1812644_1813925_-	EscD/YscD/HrpQ family type III secretion system inner membrane ring protein	NA	NA	NA	NA	NA
AUR57531.1|1813921_1816021_-	EscV/YscV/HrcV family type III secretion system export apparatus protein	NA	NA	NA	NA	NA
AUR55571.1|1816017_1816386_-	hypothetical protein	NA	NA	NA	NA	NA
AUR55572.1|1816382_1816793_-	hypothetical protein	NA	NA	NA	NA	NA
AUR55573.1|1816797_1817175_-	type III secretion chaperone SycN	NA	NA	NA	NA	NA
AUR55574.1|1817171_1818269_-	SepL/TyeA/HrpJ family type III secretion system gatekeeper	NA	NA	NA	NA	NA
AUR55575.1|1818432_1819050_+	hypothetical protein	NA	NA	NA	NA	NA
AUR55576.1|1819071_1819347_+	hypothetical protein	NA	NA	NA	NA	NA
AUR55577.1|1819362_1819848_+	CesD/SycD/LcrH family type III secretion system chaperone	NA	NA	NA	NA	NA
AUR55578.1|1819895_1820837_+	hypothetical protein	NA	NA	NA	NA	NA
1820277:1820295	attL	CAGGCGGCGAGCGAGCGCA	NA	NA	NA	NA
AUR55579.1|1820866_1822069_+	hypothetical protein	NA	NA	NA	NA	NA
AUR55580.1|1822092_1822554_+	CesD/SycD/LcrH family type III secretion system chaperone	NA	NA	NA	NA	NA
AUR55581.1|1822558_1823080_+	hypothetical protein	NA	NA	NA	NA	NA
AUR55582.1|1823076_1823484_+	EscI/YscI/HrpB family type III secretion system inner rod protein	NA	NA	NA	NA	NA
AUR55583.1|1823480_1824305_+	EscJ/YscJ/HrcJ family type III secretion inner membrane ring protein	NA	NA	NA	NA	NA
AUR55584.1|1824297_1824960_+	hypothetical protein	NA	NA	NA	NA	NA
AUR57532.1|1825004_1825568_+	type III secretion system protein	NA	NA	NA	NA	NA
AUR55585.1|1825572_1826907_+	EscN/YscN/HrcN family type III secretion system ATPase	NA	NA	NA	NA	NA
AUR55586.1|1826906_1827416_+	type III secretion protein	NA	NA	NA	NA	NA
AUR55587.1|1827412_1827961_+	hypothetical protein	NA	NA	NA	NA	NA
AUR57534.1|1827957_1829037_+	type III secretion system protein	NA	NA	NA	NA	NA
AUR55588.1|1829033_1829705_+	EscR/YscR/HrcR family type III secretion system export apparatus protein	NA	NA	NA	NA	NA
AUR57533.1|1829710_1829977_+	EscS/YscS/HrcS family type III secretion system export apparatus protein	NA	NA	NA	NA	NA
AUR55589.1|1829988_1830789_+	EscT/YscT/HrcT family type III secretion system export apparatus protein	NA	NA	NA	NA	NA
AUR55590.1|1830785_1831835_+	EscU/YscU/HrcU family type III secretion system export apparatus switch protein	NA	NA	NA	NA	NA
AUR55591.1|1831831_1832230_+	hypothetical protein	NA	NA	NA	NA	NA
AUR55592.1|1832220_1834023_+	EscC/YscC/HrcC family type III secretion system outer membrane ring protein	NA	NA	NA	NA	NA
AUR55593.1|1834043_1834646_-	RNA polymerase subunit sigma	NA	NA	NA	NA	NA
AUR57535.1|1834820_1835519_-	hypothetical protein	NA	NA	NA	NA	NA
AUR55594.1|1835734_1837042_+	hypothetical protein	NA	NA	NA	NA	NA
AUR55595.1|1837083_1838271_-	hypothetical protein	NA	NA	NA	NA	NA
AUR55596.1|1838267_1840289_-	regulator	NA	NA	NA	NA	NA
AUR55597.1|1840373_1842815_+	MFS transporter	NA	NA	NA	NA	NA
AUR55598.1|1842811_1843975_-	alanine racemase	NA	NA	NA	NA	NA
AUR55599.1|1844058_1844487_-	serine/threonine protein kinase	NA	NA	NA	NA	NA
AUR55600.1|1844630_1844981_+	anti-anti-sigma factor	NA	NA	NA	NA	NA
AUR57536.1|1844977_1846435_-	cardiolipin synthase	NA	NA	NA	NA	NA
AUR57537.1|1847089_1849801_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	NA	NA	NA	NA
AUR55601.1|1850059_1850332_+	hypothetical protein	NA	NA	NA	NA	NA
AUR55602.1|1850328_1851231_-|integrase	integrase	integrase	NA	NA	NA	NA
AUR55603.1|1851377_1852280_-|integrase	integrase	integrase	NA	NA	NA	NA
AUR55604.1|1852426_1855027_-	C4-dicarboxylate ABC transporter	NA	NA	NA	NA	NA
AUR55605.1|1855133_1856138_-	C4-dicarboxylate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUR55606.1|1856246_1857587_-	hypothetical protein	NA	A0A1V0SKB7	Klosneuvirus	22.8	8.8e-18
AUR55607.1|1857627_1858656_-	silent information regulator protein Sir2	NA	NA	NA	NA	NA
AUR55608.1|1858851_1859397_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
AUR55609.1|1859393_1859954_+	diaminobutyrate acetyltransferase	NA	NA	NA	NA	NA
AUR55610.1|1860052_1861003_+|integrase	integrase	integrase	NA	NA	NA	NA
AUR55611.1|1861101_1862052_+|integrase	integrase	integrase	NA	NA	NA	NA
1867603:1867621	attR	CAGGCGGCGAGCGAGCGCA	NA	NA	NA	NA
>prophage 16
CP016887	Bordetella pertussis strain J043, complete genome	4102813	1898749	1942023	4102813	integrase	Staphylococcus_phage(25.0%)	45	1906423:1906441	1949790:1949808
AUR55639.1|1898749_1899700_-|integrase	integrase	integrase	NA	NA	NA	NA
AUR57540.1|1899902_1900985_+	AI-2E family transporter	NA	NA	NA	NA	NA
AUR55640.1|1901000_1901762_-	sugar ABC transporter permease	NA	NA	NA	NA	NA
AUR55641.1|1901758_1902682_-	multidrug ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	33.6	1.6e-23
AUR57541.1|1902780_1903281_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AUR55642.1|1903313_1904057_-	permease	NA	NA	NA	NA	NA
AUR55643.1|1904152_1904392_-	hypothetical protein	NA	NA	NA	NA	NA
AUR55644.1|1904405_1904558_-	lipoprotein	NA	NA	NA	NA	NA
AUR55645.1|1904643_1906134_-	cytochrome c oxidase accessory protein CcoG	NA	NA	NA	NA	NA
AUR55646.1|1906225_1907164_-	cytochrome-c oxidase, cbb3-type subunit III	NA	NA	NA	NA	NA
1906423:1906441	attL	CGCCCAGCGCCTGGTTGCC	NA	NA	NA	NA
AUR55647.1|1907160_1907337_-	cytochrome oxidase	NA	NA	NA	NA	NA
AUR55648.1|1907339_1908002_-	cytochrome-c oxidase, cbb3-type subunit II	NA	NA	NA	NA	NA
AUR57542.1|1909623_1909767_-	cytochrome oxidase maturation protein, cbb3-type	NA	NA	NA	NA	NA
AUR55649.1|1909763_1910738_-	hypothetical protein	NA	NA	NA	NA	NA
AUR55650.1|1910952_1911855_+|integrase	integrase	integrase	NA	NA	NA	NA
AUR55651.1|1911851_1913126_-	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	28.9	9.6e-14
AUR55652.1|1913229_1914423_+	8-amino-7-oxononanoate synthase	NA	NA	NA	NA	NA
AUR55653.1|1914419_1915073_+	biotin synthase	NA	NA	NA	NA	NA
AUR55654.1|1915069_1916506_+	dethiobiotin synthase	NA	NA	NA	NA	NA
AUR55655.1|1916493_1916853_+	murein hydrolase transporter LrgA	NA	NA	NA	NA	NA
AUR55656.1|1916938_1917589_+	hypothetical protein	NA	NA	NA	NA	NA
AUR55657.1|1917825_1918689_+|integrase	integrase	integrase	NA	NA	NA	NA
AUR55658.1|1918772_1920638_-	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
AUR57543.1|1920895_1922416_+	aldehyde dehydrogenase	NA	NA	NA	NA	NA
AUR55659.1|1922503_1923154_-	NAD(P)H dehydrogenase	NA	NA	NA	NA	NA
AUR55660.1|1924102_1925398_+	hypothetical protein	NA	NA	NA	NA	NA
AUR55661.1|1925419_1926304_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUR57544.1|1926402_1927278_+	PhzF family phenazine biosynthesis protein	NA	NA	NA	NA	NA
AUR55662.1|1927267_1927624_-	RNA signal recognition particle	NA	NA	NA	NA	NA
AUR55663.1|1927754_1928729_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AUR55664.1|1928858_1929038_-	DUF3008 domain-containing protein	NA	NA	NA	NA	NA
AUR55665.1|1929180_1929660_+	hypothetical protein	NA	NA	NA	NA	NA
AUR55666.1|1929670_1930507_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
AUR55667.1|1930619_1930991_+	transcriptional regulator	NA	NA	NA	NA	NA
AUR55668.1|1930987_1931539_+	ATPase	NA	NA	NA	NA	NA
AUR55669.1|1931554_1933246_-	sodium-independent anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	27.3	5.0e-42
AUR55670.1|1933294_1933975_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AUR55671.1|1934222_1934687_-	hypothetical protein	NA	NA	NA	NA	NA
AUR55672.1|1934856_1935786_+	hypothetical protein	NA	NA	NA	NA	NA
AUR57545.1|1935798_1936392_-	hypothetical protein	NA	NA	NA	NA	NA
AUR55673.1|1936519_1938337_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.4	2.3e-37
AUR55674.1|1938420_1939371_-|integrase	integrase	integrase	NA	NA	NA	NA
AUR57546.1|1939469_1939949_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AUR55675.1|1940071_1940974_+|integrase	integrase	integrase	NA	NA	NA	NA
AUR55676.1|1941072_1942023_+|integrase	integrase	integrase	NA	NA	NA	NA
1949790:1949808	attR	CGCCCAGCGCCTGGTTGCC	NA	NA	NA	NA
>prophage 17
CP016887	Bordetella pertussis strain J043, complete genome	4102813	2302052	2367601	4102813	integrase,tRNA,protease	Lake_Baikal_phage(21.43%)	60	2348295:2348316	2372786:2372807
AUR55940.1|2302052_2302955_-|integrase	integrase	integrase	NA	NA	NA	NA
AUR55941.1|2303203_2304013_+	enoyl-CoA hydratase	NA	NA	NA	NA	NA
AUR55942.1|2304185_2305088_+|integrase	integrase	integrase	NA	NA	NA	NA
AUR55943.1|2305084_2305978_-	methylglyoxal synthase	NA	NA	NA	NA	NA
AUR55944.1|2306102_2306297_-	Fe-S assembly protein IscX	NA	NA	NA	NA	NA
AUR55945.1|2306296_2306638_-	ferredoxin, 2Fe-2S type, ISC system	NA	NA	NA	NA	NA
AUR55946.1|2306647_2308510_-	Fe-S protein assembly chaperone HscA	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	42.4	3.0e-101
AUR55947.1|2308639_2309152_-	Fe-S protein assembly co-chaperone HscB	NA	NA	NA	NA	NA
AUR55948.1|2309154_2309478_-	iron-sulfur cluster assembly protein IscA	NA	A0A2H4N7N5	Lake_Baikal_phage	52.8	6.8e-25
AUR55949.1|2309479_2309890_-	Fe-S cluster assembly scaffold IscU	NA	A0A218MKD1	uncultured_virus	79.0	7.5e-53
AUR55950.1|2309927_2311139_-	IscS subfamily cysteine desulfurase	NA	NA	NA	NA	NA
AUR55951.1|2311156_2311669_-	Fe-S cluster assembly transcriptional regulator IscR	NA	NA	NA	NA	NA
AUR55952.1|2311884_2312376_-	protein tyrosine phosphatase	NA	NA	NA	NA	NA
AUR55953.1|2312628_2314665_-	excinuclease ABC subunit B	NA	NA	NA	NA	NA
AUR55954.1|2314742_2315945_+	aromatic amino acid aminotransferase	NA	NA	NA	NA	NA
AUR55955.1|2316073_2316724_+	repressor LexA	NA	A0A2H4JG58	uncultured_Caudovirales_phage	50.7	3.3e-10
AUR55956.1|2316950_2317880_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	NA	NA	NA	NA
AUR55957.1|2317925_2318285_+	hypothetical protein	NA	NA	NA	NA	NA
AUR55958.1|2318281_2319184_-|integrase	integrase	integrase	NA	NA	NA	NA
AUR55959.1|2319802_2320015_-	hypothetical protein	NA	NA	NA	NA	NA
AUR55960.1|2320032_2320764_-	hypothetical protein	NA	NA	NA	NA	NA
AUR55961.1|2320798_2321440_-	succinyl-CoA--3-ketoacid-CoA transferase	NA	NA	NA	NA	NA
AUR55962.1|2321432_2322101_-	3-oxoadipate CoA-transferase	NA	NA	NA	NA	NA
AUR55963.1|2324313_2325090_-	3-oxoacyl-ACP reductase	NA	NA	NA	NA	NA
AUR55964.1|2325111_2326269_-	thiolase	NA	NA	NA	NA	NA
AUR55965.1|2326265_2326697_-	hypothetical protein	NA	NA	NA	NA	NA
AUR57567.1|2326693_2327491_-	enoyl-CoA hydratase	NA	NA	NA	NA	NA
AUR55966.1|2327510_2327966_-	oxidoreductase	NA	NA	NA	NA	NA
AUR55967.1|2327978_2328950_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUR55968.1|2329015_2330239_-	CoA-transferase	NA	NA	NA	NA	NA
AUR55969.1|2330466_2331417_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUR55970.1|2331540_2333994_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	52.0	1.5e-220
AUR55971.1|2334182_2335487_-|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	53.8	3.2e-129
AUR55972.1|2335591_2336245_-	ATP-dependent Clp endopeptidase, proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	57.5	6.8e-56
AUR55973.1|2336247_2337558_-	trigger factor	NA	NA	NA	NA	NA
AUR55974.1|2337754_2338315_+	TIGR00645 family protein	NA	K4K6D8	Caulobacter_phage	33.7	1.0e-23
AUR55975.1|2338426_2338627_-	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.4	7.4e-14
AUR55976.1|2338972_2339539_-	hypothetical protein	NA	NA	NA	NA	NA
AUR55977.1|2339622_2339826_-	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	62.1	2.1e-16
AUR55978.1|2340132_2340453_-	hypothetical protein	NA	NA	NA	NA	NA
AUR55979.1|2340494_2340776_-	hypothetical protein	NA	NA	NA	NA	NA
AUR55980.1|2340850_2342107_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	NA	NA	NA	NA
AUR55981.1|2342489_2342819_+	hypothetical protein	NA	NA	NA	NA	NA
AUR55982.1|2344389_2345211_+	2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase	NA	NA	NA	NA	NA
AUR55983.1|2345210_2346350_+	succinyl-diaminopimelate desuccinylase	NA	NA	NA	NA	NA
AUR55984.1|2346356_2347253_+	ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
AUR55985.1|2347267_2349175_+	ABC transporter	NA	A0A2K9L0W2	Tupanvirus	31.8	1.1e-66
2348295:2348316	attL	CGGGCAAGAGCACCCTGATCAA	NA	NA	NA	NA
AUR55986.1|2349534_2352147_+	TonB-dependent receptor	NA	NA	NA	NA	NA
AUR55987.1|2352199_2354500_-	DNA helicase II	NA	A7KV33	Bacillus_phage	35.9	9.9e-110
AUR55988.1|2354496_2355705_-	aminotransferase	NA	NA	NA	NA	NA
AUR55989.1|2355966_2356341_+	hypothetical protein	NA	NA	NA	NA	NA
AUR55990.1|2356337_2357288_-|integrase	integrase	integrase	NA	NA	NA	NA
AUR57568.1|2357386_2358784_-	rRNA methyltransferase	NA	NA	NA	NA	NA
AUR55991.1|2359440_2360406_+	riboflavin biosynthesis protein RibF	NA	NA	NA	NA	NA
AUR55992.1|2360395_2363257_+|tRNA	isoleucine--tRNA ligase	tRNA	A0A1V0SJ93	Klosneuvirus	25.5	1.0e-71
AUR55993.1|2363259_2363766_+	signal peptidase II	NA	NA	NA	NA	NA
AUR55994.1|2363870_2365079_+	phosphopantothenate synthase	NA	Q9HH70	Methanothermobacter_phage	30.0	3.8e-36
AUR55995.1|2365080_2366019_-	hypothetical protein	NA	NA	NA	NA	NA
AUR55996.1|2366180_2366654_+	AsnC family transcriptional regulator	NA	NA	NA	NA	NA
AUR55997.1|2366650_2367601_-|integrase	integrase	integrase	NA	NA	NA	NA
2372786:2372807	attR	TTGATCAGGGTGCTCTTGCCCG	NA	NA	NA	NA
>prophage 18
CP016887	Bordetella pertussis strain J043, complete genome	4102813	2381102	2436367	4102813	transposase,integrase,tRNA	uncultured_Mediterranean_phage(14.29%)	54	2421462:2421477	2436676:2436691
AUR56008.1|2381102_2382005_-|integrase	integrase	integrase	NA	NA	NA	NA
AUR56009.1|2382827_2383496_+	arylesterase	NA	NA	NA	NA	NA
AUR57569.1|2383477_2385433_-	peptidylprolyl isomerase	NA	NA	NA	NA	NA
AUR56010.1|2385675_2386425_+	glycerophosphodiester phosphodiesterase	NA	A0A2H4PGQ5	Escherichia_phage	27.8	1.5e-14
AUR56011.1|2386437_2387301_+	competence protein ComJ	NA	NA	NA	NA	NA
AUR56012.1|2387304_2388720_-	dihydrolipoyl dehydrogenase	NA	NA	NA	NA	NA
AUR56013.1|2388853_2389582_-	glutathione peroxidase	NA	A0A1D8KSL1	Synechococcus_phage	56.8	9.6e-43
AUR56014.1|2389720_2389921_-	heavy metal transporter	NA	NA	NA	NA	NA
AUR56015.1|2390096_2390495_+	Cu(I)-responsive transcriptional regulator	NA	NA	NA	NA	NA
AUR56016.1|2390518_2391919_-	23S rRNA (uracil(1939)-C(5))-methyltransferase	NA	A0A2K5B251	Erysipelothrix_phage	26.5	7.3e-31
AUR56017.1|2392037_2392790_-	hypothetical protein	NA	NA	NA	NA	NA
AUR56018.1|2393078_2393678_-	hypothetical protein	NA	NA	NA	NA	NA
AUR56019.1|2393782_2394562_-	3'-5' exonuclease	NA	NA	NA	NA	NA
AUR56020.1|2394558_2395443_-	peptidase	NA	A0A292GJG6	Xanthomonas_phage	49.5	4.6e-15
AUR56021.1|2395460_2396240_-	protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	46.9	4.8e-32
AUR56022.1|2396224_2396983_-	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	51.2	1.4e-68
AUR57570.1|2397120_2397756_+	glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
AUR56023.1|2398023_2399040_+|transposase	transposase	transposase	NA	NA	NA	NA
AUR56024.1|2399137_2400178_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	51.3	6.1e-91
AUR56025.1|2400312_2401605_+	guanine permease	NA	A0A0R6PHV4	Moraxella_phage	36.0	1.7e-66
AUR56026.1|2402964_2403348_+	thiol reductase thioredoxin	NA	V9SJ74	Achromobacter_phage	25.8	8.1e-09
AUR56027.1|2403365_2403953_-	thymidylate synthase	NA	A0A1X9I5T8	Streptococcus_phage	35.8	4.7e-16
AUR56028.1|2403990_2404893_-|integrase	integrase	integrase	NA	NA	NA	NA
AUR56029.1|2405039_2405888_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUR56030.1|2405924_2406698_-	ABC transporter permease	NA	NA	NA	NA	NA
AUR56031.1|2406694_2407693_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUR56032.1|2407777_2408554_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	34.2	1.2e-30
AUR56033.1|2408709_2410314_-	ABC-F family ATPase	NA	A0A1V0SKJ1	Klosneuvirus	28.9	1.2e-53
AUR56034.1|2410694_2411819_+	C4-dicarboxylate ABC transporter	NA	NA	NA	NA	NA
AUR56035.1|2411945_2412569_+	hypothetical protein	NA	NA	NA	NA	NA
AUR56036.1|2412565_2414467_+	C4-dicarboxylate ABC transporter	NA	NA	NA	NA	NA
AUR56037.1|2414515_2415310_+	enoyl-CoA hydratase	NA	NA	NA	NA	NA
AUR56038.1|2415322_2416324_-	LD-carboxypeptidase	NA	NA	NA	NA	NA
AUR57571.1|2416320_2416770_-|tRNA	tRNA-specific adenosine deaminase	tRNA	S4VYT2	Pandoravirus	38.2	2.0e-06
AUR56039.1|2416819_2417668_-	hydrolase	NA	NA	NA	NA	NA
AUR56040.1|2417765_2418308_-	hypothetical protein	NA	NA	NA	NA	NA
AUR56041.1|2418351_2419254_-|integrase	integrase	integrase	NA	NA	NA	NA
AUR56042.1|2419457_2419784_-	cation:proton antiporter	NA	NA	NA	NA	NA
AUR56043.1|2419780_2420062_-	K+/H+ antiporter subunit F	NA	NA	NA	NA	NA
AUR56044.1|2420061_2420538_-	Na+/H+ antiporter subunit E	NA	NA	NA	NA	NA
AUR56045.1|2420537_2422166_-	monovalent cation/H+ antiporter subunit D	NA	NA	NA	NA	NA
2421462:2421477	attL	CGGCCAGGCGCCGGCC	NA	NA	NA	NA
AUR56046.1|2422162_2422507_-	Na+/H+ antiporter subunit C	NA	NA	NA	NA	NA
AUR56047.1|2422506_2425440_-	monovalent cation/H+ antiporter subunit A	NA	NA	NA	NA	NA
AUR56048.1|2426598_2427501_-|integrase	integrase	integrase	NA	NA	NA	NA
AUR56049.1|2427647_2427944_-	hypothetical protein	NA	NA	NA	NA	NA
AUR56050.1|2428050_2428968_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUR56051.1|2428972_2429686_-	3-oxoacyl-[acyl-carrier-protein] reductase	NA	NA	NA	NA	NA
AUR56052.1|2429699_2430671_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUR56053.1|2430774_2432187_+	hypothetical protein	NA	NA	NA	NA	NA
AUR56054.1|2432420_2432771_+	transcriptional regulator	NA	NA	NA	NA	NA
AUR56055.1|2432774_2433962_+	hypothetical protein	NA	NA	NA	NA	NA
AUR57572.1|2434400_2435123_+	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	68.2	1.3e-87
AUR56056.1|2435119_2435308_-	hypothetical protein	NA	NA	NA	NA	NA
AUR56057.1|2435416_2436367_+|integrase	integrase	integrase	NA	NA	NA	NA
2436676:2436691	attR	GGCCGGCGCCTGGCCG	NA	NA	NA	NA
>prophage 19
CP016887	Bordetella pertussis strain J043, complete genome	4102813	2457158	2528318	4102813	integrase	Brazilian_cedratvirus(11.11%)	55	2458635:2458652	2531951:2531968
AUR56074.1|2457158_2458109_+|integrase	integrase	integrase	NA	NA	NA	NA
AUR56075.1|2458167_2458941_+	short-chain dehydrogenase	NA	NA	NA	NA	NA
2458635:2458652	attL	CAGCGCCAGCAAGGCCGC	NA	NA	NA	NA
AUR56076.1|2458933_2460490_+	capsular biosynthesis protein	NA	NA	NA	NA	NA
AUR56077.1|2460486_2461389_-|integrase	integrase	integrase	NA	NA	NA	NA
AUR56078.1|2462763_2463366_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
AUR56079.1|2463605_2464307_-	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
AUR56080.1|2464300_2465083_-	high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivG	NA	A0A2R8FG22	Brazilian_cedratvirus	25.8	2.0e-09
AUR56081.1|2465267_2466218_-|integrase	integrase	integrase	NA	NA	NA	NA
AUR56082.1|2466316_2467054_-	hypothetical protein	NA	A0A0S4KZH7	Pseudomonas_phage	46.6	4.1e-41
AUR56083.1|2467243_2468002_-	short-chain dehydrogenase	NA	NA	NA	NA	NA
AUR56084.1|2468048_2469050_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUR56085.1|2469215_2470184_-	phenol degradation protein meta	NA	NA	NA	NA	NA
AUR56086.1|2471723_2472692_+	AAA family ATPase	NA	NA	NA	NA	NA
AUR56087.1|2472700_2473642_+	MoxR protein	NA	NA	NA	NA	NA
AUR57575.1|2474115_2475126_+	hypothetical protein	NA	NA	NA	NA	NA
AUR57577.1|2475116_2476631_+	hypothetical protein	NA	NA	NA	NA	NA
AUR56088.1|2476627_2477974_+	hypothetical protein	NA	NA	NA	NA	NA
AUR57576.1|2477976_2479011_+	haloacid dehalogenase	NA	NA	NA	NA	NA
AUR56089.1|2479060_2480686_+	arylsulfatase	NA	A0A2P0VMN7	Tetraselmis_virus	52.2	2.0e-149
AUR56090.1|2480779_2481259_+	hypothetical protein	NA	NA	NA	NA	NA
AUR56091.1|2481238_2482141_-|integrase	integrase	integrase	NA	NA	NA	NA
AUR56092.1|2482270_2483446_-	capsule biosynthesis protein CapA	NA	NA	NA	NA	NA
AUR56093.1|2483459_2485517_-	capsular biosynthesis protein	NA	NA	NA	NA	NA
AUR56094.1|2485513_2486539_-	Vi polysaccharide biosynthesis protein VipB/TviC	NA	A0A2K9L4U8	Tupanvirus	44.2	4.7e-72
AUR56095.1|2486550_2487840_-	Vi polysaccharide biosynthesis protein VipA/TviB	NA	NA	NA	NA	NA
AUR56096.1|2487862_2488960_-	capsule biosynthesis protein CapA	NA	NA	NA	NA	NA
AUR56097.1|2488956_2489847_-	capsular biosynthesis protein	NA	NA	NA	NA	NA
AUR56098.1|2489843_2491928_-	Vi polysaccharide biosynthesis protein TviE	NA	NA	NA	NA	NA
AUR56099.1|2491959_2493129_-	capsule biosynthesis protein	NA	NA	NA	NA	NA
AUR56100.1|2493170_2493917_-	sugar ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
AUR56101.1|2493916_2494687_-	polyhydroxyalkanoate biosynthesis repressor PhaR	NA	NA	NA	NA	NA
AUR57578.1|2495902_2496328_+	hypothetical protein	NA	NA	NA	NA	NA
AUR56102.1|2496354_2498439_+	hypothetical protein	NA	NA	NA	NA	NA
AUR56103.1|2498606_2500562_+	capsular biosynthesis protein	NA	NA	NA	NA	NA
AUR57579.1|2500885_2501386_-	DNA starvation/stationary phase protection protein	NA	W5S6G8	Pithovirus	35.5	6.4e-14
AUR56104.1|2501484_2503011_-	methylmalonate-semialdehyde dehydrogenase (acylating)	NA	NA	NA	NA	NA
AUR57580.1|2503148_2504036_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUR56105.1|2504050_2505004_-	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	26.5	7.2e-14
AUR56106.1|2505055_2507146_-	ATP-dependent DNA helicase RecG	NA	NA	NA	NA	NA
AUR56107.1|2507161_2507548_-	reactive intermediate/imine deaminase	NA	NA	NA	NA	NA
AUR56108.1|2510241_2511045_-	2,5-didehydrogluconate reductase B	NA	A0A2H4PQR8	Staphylococcus_phage	32.4	2.0e-33
AUR56109.1|2512338_2513241_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUR56110.1|2513305_2514082_-	ferredoxin--NADP(+) reductase	NA	NA	NA	NA	NA
AUR56111.1|2514403_2515453_+	iron ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUR56112.1|2515576_2517247_+	iron ABC transporter permease	NA	NA	NA	NA	NA
AUR56113.1|2517251_2518046_+	ABC transporter	NA	G9BWD6	Planktothrix_phage	29.4	8.3e-16
AUR56114.1|2518192_2519095_+|integrase	integrase	integrase	NA	NA	NA	NA
AUR56115.1|2519114_2520020_-	hypothetical protein	NA	NA	NA	NA	NA
AUR56116.1|2520097_2520796_-	quercetin 2,3-dioxygenase	NA	NA	NA	NA	NA
AUR56117.1|2520955_2521900_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUR56118.1|2521909_2523397_-	nitrogen regulation protein NR(I)	NA	NA	NA	NA	NA
AUR56119.1|2523396_2524464_-	PAS domain-containing sensor histidine kinase	NA	Q8QKV7	Ectocarpus_siliculosus_virus	23.5	1.1e-05
AUR56120.1|2524527_2525940_-	type I glutamate--ammonia ligase	NA	NA	NA	NA	NA
AUR56121.1|2526125_2527346_-	YggW family oxidoreductase	NA	NA	NA	NA	NA
AUR56122.1|2527367_2528318_-|integrase	integrase	integrase	NA	NA	NA	NA
2531951:2531968	attR	CAGCGCCAGCAAGGCCGC	NA	NA	NA	NA
>prophage 20
CP016887	Bordetella pertussis strain J043, complete genome	4102813	2548671	2587273	4102813	integrase,tRNA,protease	Lactobacillus_phage(33.33%)	30	2557463:2557522	2585517:2585619
AUR56142.1|2548671_2549574_-|integrase	integrase	integrase	NA	NA	NA	NA
AUR56143.1|2550514_2551420_+	4-hydroxy-tetrahydrodipicolinate synthase	NA	NA	NA	NA	NA
AUR56144.1|2551437_2552559_+	hypothetical protein	NA	NA	NA	NA	NA
AUR56145.1|2552647_2553262_-	fimbrial protein	NA	NA	NA	NA	NA
AUR56146.1|2553915_2555103_-	cupin	NA	NA	NA	NA	NA
AUR56147.1|2556511_2557414_-|integrase	integrase	integrase	NA	NA	NA	NA
2557463:2557522	attL	CCGGCCGGGCTCCTTGAGTGAACTGGGGGGGTGGCGATTTCCAGTTTCTCAAATCCGGTT	NA	NA	NA	NA
AUR56148.1|2559000_2559216_+	hypothetical protein	NA	NA	NA	NA	NA
AUR56149.1|2559671_2560226_-	NADPH-dependent FMN reductase	NA	A0A2P0ZL82	Lactobacillus_phage	32.0	1.7e-15
AUR57583.1|2560496_2561054_+	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
AUR56150.1|2561165_2562470_+	peptidase	NA	NA	NA	NA	NA
AUR56151.1|2562466_2563978_+	thiol oxidoreductase	NA	NA	NA	NA	NA
AUR56152.1|2564083_2565085_+	aminopeptidase	NA	NA	NA	NA	NA
AUR56153.1|2565074_2566187_+	Tat pathway signal protein	NA	NA	NA	NA	NA
AUR56154.1|2566333_2567236_+|integrase	integrase	integrase	NA	NA	NA	NA
AUR56155.1|2567232_2567859_-	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
AUR56156.1|2567918_2568770_+	hypothetical protein	NA	A0A1I9SA48	Rhodococcus_phage	35.3	7.0e-37
AUR57584.1|2568936_2569473_+	hypothetical protein	NA	NA	NA	NA	NA
AUR56157.1|2569469_2570234_+	DUF1828 domain-containing protein	NA	NA	NA	NA	NA
AUR56158.1|2570303_2571206_-|integrase	integrase	integrase	NA	NA	NA	NA
AUR56159.1|2571351_2571960_-	recombination protein RecR	NA	NA	NA	NA	NA
AUR56160.1|2572010_2572337_-	nucleoid-associated protein	NA	NA	NA	NA	NA
AUR57585.1|2572383_2574474_-	DNA polymerase III, subunit gamma and tau	NA	A0A1U9WR94	Streptococcus_virus	38.5	1.1e-43
AUR56161.1|2575276_2578681_-	nuclease	NA	NA	NA	NA	NA
AUR56162.1|2578693_2581354_-	hypothetical protein	NA	NA	NA	NA	NA
AUR56163.1|2581557_2582760_-	MFS transporter	NA	NA	NA	NA	NA
AUR56164.1|2583446_2584559_+	D-alanyl-D-alanine carboxypeptidase	NA	NA	NA	NA	NA
AUR56165.1|2584565_2585516_-|integrase	integrase	integrase	NA	NA	NA	NA
AUR56166.1|2585614_2585983_-	aryl-sulfate sulfotransferase	NA	NA	NA	NA	NA
2585517:2585619	attR	CCGGCCGGGCTCCTTGAGTGAACTGGGGGGGTGGCGATTTCCAGTTTCTCAAATCCGGTTCGGATGAACCATGCATACAACCTATTGAATCTTCACAGCTAGC	NA	NA	NA	NA
AUR56167.1|2586088_2586667_-|protease	protease	protease	NA	NA	NA	NA
AUR57586.1|2586784_2587273_-|tRNA	aminoacyl-tRNA deacylase	tRNA	NA	NA	NA	NA
>prophage 21
CP016887	Bordetella pertussis strain J043, complete genome	4102813	2613561	2679185	4102813	integrase,tRNA	Planktothrix_phage(33.33%)	60	2670907:2670924	2680820:2680837
AUR56196.1|2613561_2614512_-|integrase	integrase	integrase	NA	NA	NA	NA
AUR56197.1|2614610_2615381_-	ectoine/hydroxyectoine ABC transporter ATP-binding protein EhuA	NA	G9BWD6	Planktothrix_phage	39.5	8.3e-29
AUR56198.1|2615377_2616049_-	ectoine/hydroxyectoine ABC transporter permease subunit EhuD	NA	NA	NA	NA	NA
AUR56199.1|2616045_2616687_-	ectoine/hydroxyectoine ABC transporter permease subunit EhuC	NA	NA	NA	NA	NA
AUR56200.1|2616699_2617620_-	ectoine/hydroxyectoine ABC transporter substrate-binding protein EhuB	NA	NA	NA	NA	NA
AUR56201.1|2617780_2618941_-	branched-chain amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUR56202.1|2618982_2619933_-	ornithine cyclodeaminase	NA	NA	NA	NA	NA
AUR56203.1|2620531_2620756_+	hypothetical protein	NA	NA	NA	NA	NA
AUR56204.1|2620920_2622615_-	phosphoenolpyruvate--protein phosphotransferase	NA	NA	NA	NA	NA
AUR56205.1|2622736_2623006_-	phosphocarrier protein HPr	NA	NA	NA	NA	NA
AUR56206.1|2623121_2623520_-	PTS mannose transporter subunit IIA	NA	NA	NA	NA	NA
AUR56207.1|2623530_2624487_-	glutathione synthase	NA	NA	NA	NA	NA
AUR56208.1|2624623_2625169_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	29.9	9.1e-14
AUR56209.1|2625189_2627139_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	36.0	4.1e-125
AUR56210.1|2627526_2628303_+	DNA-binding response regulator	NA	NA	NA	NA	NA
AUR56211.1|2628308_2628701_+	hypothetical protein	NA	NA	NA	NA	NA
AUR56212.1|2628697_2629105_-	hypothetical protein	NA	NA	NA	NA	NA
AUR56213.1|2629170_2630073_+|integrase	integrase	integrase	NA	NA	NA	NA
AUR56214.1|2630069_2631167_-	hypothetical protein	NA	A0A127AWB9	Bacillus_phage	37.3	3.5e-20
AUR56215.1|2631198_2632101_-|integrase	integrase	integrase	NA	NA	NA	NA
AUR56216.1|2632628_2633285_-	N-(5'-phosphoribosyl)anthranilate isomerase	NA	NA	NA	NA	NA
AUR56217.1|2633299_2634967_-	C4-dicarboxylate ABC transporter	NA	NA	NA	NA	NA
AUR56218.1|2634969_2635599_-	C4-dicarboxylate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUR56219.1|2635810_2636905_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUR56220.1|2637049_2637862_-|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
AUR56221.1|2637865_2639449_-	peptidoglycan-binding protein LysM	NA	NA	NA	NA	NA
AUR56222.1|2639619_2640750_-	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
AUR56223.1|2640936_2642013_-	3-isopropylmalate dehydrogenase	NA	NA	NA	NA	NA
AUR57587.1|2642094_2642745_-	3-isopropylmalate dehydratase small subunit	NA	NA	NA	NA	NA
AUR56224.1|2642759_2644163_-	3-isopropylmalate dehydratase large subunit	NA	NA	NA	NA	NA
AUR56225.1|2644446_2645265_-	tungsten ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUR56226.1|2645261_2645966_-	phosphate ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.0	2.6e-13
AUR56227.1|2646865_2647981_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUR56228.1|2648014_2648389_-	hypothetical protein	NA	NA	NA	NA	NA
AUR56229.1|2648411_2649569_-	formate dehydrogenase subunit gamma	NA	NA	NA	NA	NA
AUR56230.1|2649581_2649815_-	hypothetical protein	NA	NA	NA	NA	NA
AUR56231.1|2650449_2653419_-	formate dehydrogenase	NA	NA	NA	NA	NA
AUR56232.1|2653433_2653643_-	formate dehydrogenase	NA	NA	NA	NA	NA
AUR56233.1|2653794_2654424_-	hypothetical protein	NA	NA	NA	NA	NA
AUR57588.1|2654420_2656478_-	4Fe-4S ferredoxin	NA	NA	NA	NA	NA
AUR56234.1|2656534_2657215_-	hypothetical protein	NA	NA	NA	NA	NA
AUR56235.1|2657211_2657772_-	hypothetical protein	NA	NA	NA	NA	NA
AUR56236.1|2657778_2658876_-	ATP-binding protein	NA	NA	NA	NA	NA
AUR56237.1|2659028_2659622_+	molybdenum cofactor guanylyltransferase MobA	NA	NA	NA	NA	NA
AUR56238.1|2659618_2660911_+	molybdopterin molybdenumtransferase MoeA	NA	NA	NA	NA	NA
AUR56239.1|2660924_2661467_+	molybdopterin-guanine dinucleotide biosynthesis protein B	NA	NA	NA	NA	NA
AUR56240.1|2661476_2662313_-	peptidase M48	NA	NA	NA	NA	NA
AUR56241.1|2662346_2663408_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	42.8	2.9e-80
AUR56242.1|2663449_2664502_-	diguanylate cyclase	NA	NA	NA	NA	NA
AUR56243.1|2664517_2664820_-	hypothetical protein	NA	NA	NA	NA	NA
AUR56244.1|2664961_2665912_-|integrase	integrase	integrase	NA	NA	NA	NA
AUR56245.1|2666090_2667785_+	ABC transporter permease	NA	NA	NA	NA	NA
AUR56246.1|2667781_2668867_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.7	6.4e-27
AUR56247.1|2668914_2669814_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUR56248.1|2669824_2670469_+	phosphoglycerate mutase	NA	NA	NA	NA	NA
2670907:2670924	attL	GGCGCCGGCGCCGGGCAG	NA	NA	NA	NA
AUR56249.1|2671490_2674733_-	carbamoyl phosphate synthase large subunit	NA	NA	NA	NA	NA
AUR56250.1|2674743_2675898_-	carbamoyl phosphate synthase small subunit	NA	R4TGJ8	Halovirus	35.4	3.3e-53
AUR56251.1|2676124_2677087_+	transaldolase	NA	H6WFR1	Cyanophage	29.2	7.5e-11
AUR56252.1|2677233_2678136_+|integrase	integrase	integrase	NA	NA	NA	NA
AUR56253.1|2678282_2679185_+|integrase	integrase	integrase	NA	NA	NA	NA
2680820:2680837	attR	CTGCCCGGCGCCGGCGCC	NA	NA	NA	NA
>prophage 22
CP016887	Bordetella pertussis strain J043, complete genome	4102813	2730719	2794065	4102813	transposase,integrase	uncultured_Caudovirales_phage(40.0%)	55	2731624:2731683	2794151:2794295
AUR56301.1|2730719_2731622_+|integrase	integrase	integrase	NA	NA	NA	NA
2731624:2731683	attL	TGTGAAGATTCAATAGGTTGTATGCATGGTTCATCCGAACCGGATTTGAGAAACTGGAAA	NA	NA	NA	NA
AUR56302.1|2731768_2732671_+|integrase	integrase	integrase	NA	NA	NA	NA
AUR56303.1|2732686_2732899_+	hypothetical protein	NA	NA	NA	NA	NA
AUR56304.1|2733040_2733613_+	flagellar basal body protein FliL	NA	NA	NA	NA	NA
AUR56305.1|2733615_2734626_+	flagellar motor switch protein FliM	NA	NA	NA	NA	NA
AUR56306.1|2734618_2735119_+	flagellar motor switch protein FliN	NA	NA	NA	NA	NA
AUR56307.1|2735129_2735471_+	flagellar biosynthetic protein FliO	NA	NA	NA	NA	NA
AUR57592.1|2735539_2736274_+	flagellar biosynthetic protein FliP	NA	NA	NA	NA	NA
AUR56308.1|2736290_2736560_+	EscS/YscS/HrcS family type III secretion system export apparatus protein	NA	NA	NA	NA	NA
AUR56309.1|2736582_2737371_+	flagellar biosynthetic protein FliR	NA	NA	NA	NA	NA
AUR56310.1|2737417_2738434_-|transposase	transposase	transposase	NA	NA	NA	NA
AUR56311.1|2738650_2740093_-	chemotaxis protein	NA	A0A1B0V854	Salmonella_phage	41.8	1.0e-35
AUR56312.1|2740271_2741891_-	chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	45.3	1.5e-08
AUR56313.1|2742011_2743832_-	chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	52.6	6.4e-11
AUR56314.1|2743910_2745443_-	flagellar hook-associated protein 3	NA	NA	NA	NA	NA
AUR56315.1|2745476_2747123_-	flagellar hook-associated protein FlgK	NA	NA	NA	NA	NA
AUR56316.1|2747192_2748215_-	flagellar rod assembly protein/muramidase FlgJ	NA	A0A088F6W1	Sulfitobacter_phage	31.4	1.9e-12
AUR56317.1|2748232_2749366_-	flagellar biosynthesis protein FlgI	NA	NA	NA	NA	NA
AUR56318.1|2749368_2750058_-	flagellar basal body L-ring protein	NA	NA	NA	NA	NA
AUR56319.1|2750057_2750843_-	flagellar basal-body rod protein FlgG	NA	NA	NA	NA	NA
AUR56320.1|2750886_2751651_-	flagellar biosynthesis protein FlgF	NA	NA	NA	NA	NA
AUR56321.1|2751689_2753111_-	flagellar hook protein FlgE	NA	NA	NA	NA	NA
AUR56322.1|2753176_2753881_-	flagellar basal body rod modification protein	NA	NA	NA	NA	NA
AUR56323.1|2753928_2754348_-	flagellar basal body rod protein FlgC	NA	NA	NA	NA	NA
AUR56324.1|2754360_2754768_-	flagellar basal body rod protein FlgB	NA	NA	NA	NA	NA
AUR57593.1|2754951_2755662_+	flagella basal body P-ring formation protein FlgA	NA	NA	NA	NA	NA
AUR56325.1|2755788_2756079_+	flagellar biosynthesis anti-sigma factor FlgM	NA	NA	NA	NA	NA
AUR56326.1|2756096_2756579_+	hypothetical protein	NA	NA	NA	NA	NA
AUR56327.1|2761084_2762239_-	flagellar biosynthesis protein FlhB	NA	NA	NA	NA	NA
AUR56328.1|2762544_2763561_+|transposase	transposase	transposase	NA	NA	NA	NA
AUR56329.1|2763807_2764596_+	amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUR56330.1|2764662_2765343_+	cysteine ABC transporter permease	NA	NA	NA	NA	NA
AUR56331.1|2765339_2766110_+	ATP-binding protein	NA	G9BWD6	Planktothrix_phage	39.1	9.8e-30
AUR56332.1|2766208_2767159_+|integrase	integrase	integrase	NA	NA	NA	NA
AUR56333.1|2767214_2768132_-	2-dehydropantoate 2-reductase	NA	NA	NA	NA	NA
AUR56334.1|2768142_2769321_-	mandelate racemase	NA	NA	NA	NA	NA
AUR56335.1|2769340_2770336_-	hypothetical protein	NA	NA	NA	NA	NA
AUR56336.1|2771924_2772533_+	3-isopropylmalate dehydratase small subunit	NA	NA	NA	NA	NA
AUR56337.1|2772520_2773561_+	LacI family transcriptional regulator	NA	NA	NA	NA	NA
AUR56338.1|2773578_2774541_-	hypothetical protein	NA	NA	NA	NA	NA
AUR56339.1|2774537_2775731_-	formyl-CoA transferase	NA	NA	NA	NA	NA
AUR56340.1|2775727_2776525_-	citryl-CoA lyase	NA	NA	NA	NA	NA
AUR56341.1|2776550_2777537_-	hypothetical protein	NA	NA	NA	NA	NA
AUR56342.1|2777555_2779595_-	acetyl-CoA synthetase	NA	NA	NA	NA	NA
AUR57594.1|2779796_2780477_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AUR56343.1|2780490_2781402_-	malyl-CoA thiolesterase	NA	NA	NA	NA	NA
AUR56344.1|2781398_2781977_-	NADPH-dependent FMN reductase	NA	NA	NA	NA	NA
AUR56345.1|2782115_2783021_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUR56346.1|2783028_2786448_+	nuclease	NA	NA	NA	NA	NA
AUR56347.1|2786435_2789036_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	NA	NA	NA	NA
AUR56348.1|2789991_2790624_-	PadR family transcriptional regulator	NA	NA	NA	NA	NA
AUR56349.1|2791017_2791776_+	hypothetical protein	NA	NA	NA	NA	NA
AUR56350.1|2791772_2792975_+	cardiolipin synthase B	NA	NA	NA	NA	NA
AUR56351.1|2792971_2793172_+	hypothetical protein	NA	NA	NA	NA	NA
AUR56352.1|2793162_2794065_-|integrase	integrase	integrase	NA	NA	NA	NA
2794151:2794295	attR	TTTCCAGTTTCTCAAATCCGGTTCGGATGAACCATGCATACAACCTATTGAATCTTCACAGCACCTGGCCTACGCCGGCTTCGACATCCTGGCGCGCCGCTATGCCGGCCACCGCCTGCCCGCCTGGCAGGTGGCGGCCATCGCC	NA	NA	NA	NA
>prophage 23
CP016887	Bordetella pertussis strain J043, complete genome	4102813	2963882	3014606	4102813	integrase,tRNA	Oenococcus_phage(50.0%)	44	2972457:2972474	3020017:3020034
AUR56490.1|2963882_2964785_-|integrase	integrase	integrase	NA	NA	NA	NA
AUR57609.1|2965092_2966025_+	succinylglutamate desuccinylase	NA	NA	NA	NA	NA
AUR57610.1|2966108_2966462_+	hypothetical protein	NA	NA	NA	NA	NA
AUR56491.1|2966539_2967148_-	hypothetical protein	NA	NA	NA	NA	NA
AUR56492.1|2968821_2969400_-	hypothetical protein	NA	NA	NA	NA	NA
AUR56493.1|2969424_2970378_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUR56494.1|2970417_2971335_-	oxidoreductase	NA	NA	NA	NA	NA
AUR56495.1|2971456_2972383_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUR56496.1|2972390_2973137_-	hypothetical protein	NA	NA	NA	NA	NA
2972457:2972474	attL	GCCGGCCACGCTGGCGGC	NA	NA	NA	NA
AUR57611.1|2973463_2974405_+	LD-carboxypeptidase	NA	NA	NA	NA	NA
AUR56497.1|2974480_2974603_-	hypothetical protein	NA	NA	NA	NA	NA
AUR56498.1|2974631_2976329_-	sodium:proline symporter	NA	NA	NA	NA	NA
AUR56499.1|2976763_2978185_-	multidrug MFS transporter	NA	NA	NA	NA	NA
AUR56500.1|2978338_2979118_-	short-chain dehydrogenase	NA	NA	NA	NA	NA
AUR56501.1|2979242_2980121_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUR56502.1|2980226_2981351_+	racemase	NA	Q6A202	Oenococcus_phage	28.3	1.5e-31
AUR56503.1|2981396_2982359_+	hypothetical protein	NA	NA	NA	NA	NA
AUR56504.1|2982351_2983206_+	2-pyrone-4,6-dicarboxylate hydrolase	NA	NA	NA	NA	NA
AUR56505.1|2983313_2983724_+	lactoylglutathione lyase	NA	NA	NA	NA	NA
AUR56506.1|2983720_2984623_-|integrase	integrase	integrase	NA	NA	NA	NA
AUR56507.1|2984769_2985651_-	phenazine biosynthesis protein PhzC/PhzF	NA	NA	NA	NA	NA
AUR56508.1|2985728_2987108_-	hypothetical protein	NA	NA	NA	NA	NA
AUR56509.1|2987146_2987992_-	FTR1 family iron permease	NA	NA	NA	NA	NA
AUR57612.1|2988007_2988322_-	periplasmic lipoprotein involved in iron transport	NA	NA	NA	NA	NA
AUR56510.1|2988354_2988891_-	hypothetical protein	NA	NA	NA	NA	NA
AUR56511.1|2989542_2990445_-|integrase	integrase	integrase	NA	NA	NA	NA
AUR56512.1|2990790_2991528_-	beta-ketoacyl-ACP reductase	NA	NA	NA	NA	NA
AUR56513.1|2991595_2993233_-	class I poly(R)-hydroxyalkanoic acid synthase	NA	NA	NA	NA	NA
AUR56514.1|2993340_2994096_-	hypothetical protein	NA	NA	NA	NA	NA
AUR56515.1|2994083_2995046_-	RNA pseudouridine synthase	NA	NA	NA	NA	NA
AUR57613.1|2995153_2995948_+	competence protein ComL	NA	NA	NA	NA	NA
AUR56516.1|2996009_2998085_-	helicase	NA	A0A127AW80	Bacillus_phage	30.0	2.4e-75
AUR56517.1|2998249_3000625_+	RNA-binding transcriptional accessory protein	NA	NA	NA	NA	NA
AUR56518.1|3000705_3002061_-|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
AUR56519.1|3002070_3002973_-|integrase	integrase	integrase	NA	NA	NA	NA
AUR56520.1|3003169_3003496_-	iron uptake protein	NA	NA	NA	NA	NA
AUR56521.1|3005140_3005422_-	iron transporter	NA	NA	NA	NA	NA
AUR56522.1|3005565_3008043_-	ligand-gated channel	NA	NA	NA	NA	NA
AUR56523.1|3008136_3009099_-	iron dicitrate transport regulator FecR	NA	NA	NA	NA	NA
AUR56524.1|3009091_3009625_-	RNA polymerase subunit sigma	NA	NA	NA	NA	NA
AUR56525.1|3010346_3011297_-|integrase	integrase	integrase	NA	NA	NA	NA
AUR56526.1|3011764_3012487_+	short-chain dehydrogenase	NA	NA	NA	NA	NA
AUR56527.1|3012541_3013525_+	LacI family transcriptional regulator	NA	NA	NA	NA	NA
AUR56528.1|3013655_3014606_+|integrase	integrase	integrase	NA	NA	NA	NA
3020017:3020034	attR	GCCGGCCACGCTGGCGGC	NA	NA	NA	NA
>prophage 24
CP016887	Bordetella pertussis strain J043, complete genome	4102813	3055257	3117317	4102813	transposase,tRNA,integrase	Catovirus(20.0%)	52	3099359:3099378	3124972:3124991
AUR56552.1|3055257_3056778_+|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.0	1.2e-82
AUR56553.1|3056820_3057123_+	hypothetical protein	NA	NA	NA	NA	NA
AUR56554.1|3057119_3057752_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
AUR56555.1|3057830_3059696_-	long-chain fatty acid--CoA ligase	NA	A0A1V0SBX8	Catovirus	23.3	9.3e-50
AUR56556.1|3059692_3060508_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	23.7	7.5e-12
AUR56557.1|3060515_3061631_-	amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUR56558.1|3062041_3062284_+	hypothetical protein	NA	NA	NA	NA	NA
AUR56559.1|3062535_3063414_-	ABC transporter permease	NA	NA	NA	NA	NA
AUR56560.1|3063413_3064238_-	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	22.7	1.0e-08
AUR56561.1|3064405_3065308_-|integrase	integrase	integrase	NA	NA	NA	NA
AUR56562.1|3065568_3068418_+	diguanylate phosphodiesterase	NA	NA	NA	NA	NA
AUR56563.1|3068399_3069128_-	hypothetical protein	NA	NA	NA	NA	NA
AUR56564.1|3069268_3070732_-	hypothetical protein	NA	A0A075BSJ0	Microcystis_phage	32.5	1.7e-43
AUR56565.1|3070728_3071100_-	hypothetical protein	NA	NA	NA	NA	NA
AUR56566.1|3071117_3072431_+	hypothetical protein	NA	NA	NA	NA	NA
AUR56567.1|3072467_3072926_+	hypothetical protein	NA	NA	NA	NA	NA
AUR56568.1|3073038_3073989_+|integrase	integrase	integrase	NA	NA	NA	NA
AUR56569.1|3073985_3074963_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
AUR56570.1|3075138_3076125_+	homoserine kinase	NA	NA	NA	NA	NA
AUR56571.1|3076168_3076969_+	hypothetical protein	NA	NA	NA	NA	NA
AUR56572.1|3077771_3078674_-|integrase	integrase	integrase	NA	NA	NA	NA
AUR56573.1|3078873_3079476_-	hypothetical protein	NA	NA	NA	NA	NA
AUR56574.1|3079494_3080127_+	rRNA methyltransferase	NA	NA	NA	NA	NA
AUR56575.1|3080364_3082251_+	cell division protein FtsH	NA	M4QMW8	Micromonas_pusilla_virus	41.5	1.4e-109
AUR56576.1|3082269_3083112_+	dihydropteroate synthase	NA	A0A0B5J4J5	Pandoravirus	32.5	3.2e-26
AUR56577.1|3083108_3084467_+	phosphoglucosamine mutase	NA	NA	NA	NA	NA
AUR56578.1|3084687_3085482_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AUR56579.1|3085712_3087206_-	exopolyphosphatase	NA	NA	NA	NA	NA
AUR56580.1|3087441_3089523_+	RNA degradosome polyphosphate kinase	NA	NA	NA	NA	NA
AUR56581.1|3089717_3090758_+	phosphate ABC transporter substrate-binding protein PstS	NA	M4QHS4	Cyanophage	39.9	3.0e-50
AUR56582.1|3090892_3091909_+	phosphate ABC transporter permease subunit PstC	NA	NA	NA	NA	NA
AUR56583.1|3091951_3092788_+	phosphate ABC transporter, permease protein PstA	NA	NA	NA	NA	NA
AUR57616.1|3092832_3093609_+	phosphate ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.7	4.3e-17
AUR56584.1|3093976_3094927_+|integrase	integrase	integrase	NA	NA	NA	NA
AUR56585.1|3094953_3095418_-	barstar family protein 2	NA	NA	NA	NA	NA
AUR56586.1|3096624_3098913_-	malate dehydrogenase	NA	NA	NA	NA	NA
AUR56587.1|3099029_3099902_-	hypothetical protein	NA	NA	NA	NA	NA
3099359:3099378	attL	GCACCAGGCGCTGCACCGTG	NA	NA	NA	NA
AUR56588.1|3099944_3101099_+	aminotransferase	NA	NA	NA	NA	NA
AUR56589.1|3101133_3101964_-	lytic transglycosylase	NA	NA	NA	NA	NA
AUR56590.1|3102047_3103592_+	3-octaprenyl-4-hydroxybenzoate decarboxylase	NA	NA	NA	NA	NA
AUR56591.1|3103634_3103994_-	hypothetical protein	NA	NA	NA	NA	NA
AUR56592.1|3103995_3104409_-	hypothetical protein	NA	NA	NA	NA	NA
AUR56593.1|3104449_3104767_-	hypothetical protein	NA	NA	NA	NA	NA
AUR57617.1|3104851_3105565_-	hypothetical protein	NA	NA	NA	NA	NA
AUR57618.1|3105831_3107253_+	uroporphyrinogen-III C-methyltransferase	NA	NA	NA	NA	NA
AUR56594.1|3107319_3110052_-	pertactin	NA	NA	NA	NA	NA
AUR56595.1|3110384_3111401_-|transposase	transposase	transposase	NA	NA	NA	NA
AUR57619.1|3111735_3112377_-	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
AUR56596.1|3112467_3113904_-	D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase	NA	NA	NA	NA	NA
AUR56597.1|3114061_3115135_+|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
AUR56598.1|3115131_3116268_+|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	44.4	1.9e-85
AUR56599.1|3116366_3117317_+|integrase	integrase	integrase	NA	NA	NA	NA
3124972:3124991	attR	CACGGTGCAGCGCCTGGTGC	NA	NA	NA	NA
>prophage 25
CP016887	Bordetella pertussis strain J043, complete genome	4102813	3344925	3399056	4102813	transposase,integrase,holin	Vibrio_phage(25.0%)	44	3395388:3395407	3407022:3407041
AUR56781.1|3344925_3346884_-|holin	choline transporter	holin	A0A2I7QNT1	Vibrio_phage	30.3	8.0e-28
AUR56782.1|3346966_3347917_-|integrase	integrase	integrase	NA	NA	NA	NA
AUR56783.1|3348137_3348806_+	transcriptional regulator	NA	NA	NA	NA	NA
AUR56784.1|3348929_3350036_+	efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
AUR56785.1|3350048_3353162_+	multidrug efflux protein	NA	S5VTK5	Leptospira_phage	21.5	4.5e-57
AUR56786.1|3353158_3354652_+	RND transporter	NA	NA	NA	NA	NA
AUR56787.1|3354666_3355338_+	transcriptional regulator	NA	NA	NA	NA	NA
AUR57634.1|3355381_3355834_-	azurin	NA	NA	NA	NA	NA
AUR56788.1|3356016_3356664_-	IclR family transcriptional regulator	NA	NA	NA	NA	NA
AUR57635.1|3356767_3358816_+	hydantoinase	NA	NA	NA	NA	NA
AUR56789.1|3358812_3360825_+	hydantoin utilization protein B	NA	NA	NA	NA	NA
AUR56790.1|3360850_3362185_+	hypothetical protein	NA	NA	NA	NA	NA
AUR56791.1|3362293_3363286_+	hypothetical protein	NA	NA	NA	NA	NA
AUR56792.1|3363352_3365437_-	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
AUR56793.1|3365461_3366433_-	hypothetical protein	NA	NA	NA	NA	NA
AUR56794.1|3366561_3367563_-	peptidase M14	NA	NA	NA	NA	NA
AUR56795.1|3367596_3368748_-	cystathionine beta-lyase	NA	NA	NA	NA	NA
AUR56796.1|3368951_3369842_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUR56797.1|3369919_3370744_+	3-oxoacyl-ACP reductase	NA	NA	NA	NA	NA
AUR56798.1|3370940_3371957_-|transposase	transposase	transposase	NA	NA	NA	NA
AUR56799.1|3372153_3373137_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUR56800.1|3373195_3374323_-	argininosuccinate lyase	NA	NA	NA	NA	NA
AUR56801.1|3374313_3374688_-	hypothetical protein	NA	NA	NA	NA	NA
AUR56802.1|3374735_3376124_-	hypothetical protein	NA	NA	NA	NA	NA
AUR56803.1|3376154_3377144_-	hypothetical protein	NA	NA	NA	NA	NA
AUR56804.1|3377254_3378487_-	methylaspartate ammonia-lyase	NA	NA	NA	NA	NA
AUR56805.1|3378768_3379569_+	IclR family transcriptional regulator	NA	NA	NA	NA	NA
AUR56806.1|3379591_3381823_-|holin	high-affinity choline transporter BetT	holin	NA	NA	NA	NA
AUR56807.1|3382610_3383057_-	preprotein translocase subunit SecG	NA	NA	NA	NA	NA
AUR56808.1|3383078_3383825_-	triose-phosphate isomerase	NA	NA	NA	NA	NA
AUR56809.1|3383968_3384946_-	NAD(P)H-quinone oxidoreductase	NA	NA	NA	NA	NA
AUR56810.1|3385579_3386191_+	PIN domain-containing protein	NA	K4HZX4	Acidithiobacillus_phage	32.5	3.3e-12
AUR56811.1|3386184_3387402_-	threonine ammonia-lyase	NA	NA	NA	NA	NA
AUR56812.1|3387542_3388493_+|integrase	integrase	integrase	NA	NA	NA	NA
AUR56813.1|3388489_3389209_-	hypothetical protein	NA	NA	NA	NA	NA
AUR56814.1|3389329_3391489_-	polyribonucleotide nucleotidyltransferase	NA	NA	NA	NA	NA
AUR56815.1|3391579_3391849_-	30S ribosomal protein S15	NA	NA	NA	NA	NA
AUR57636.1|3392142_3392670_+	hypothetical protein	NA	NA	NA	NA	NA
AUR56816.1|3392688_3393468_-	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
AUR56817.1|3393635_3394652_-	ketol-acid reductoisomerase	NA	NA	NA	NA	NA
AUR56818.1|3394724_3395216_-	acetolactate synthase small subunit	NA	NA	NA	NA	NA
AUR56819.1|3395226_3396942_-	acetolactate synthase, large subunit, biosynthetic type	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	30.3	3.1e-60
3395388:3395407	attL	GCTCGATGCGCAGGCCGACG	NA	NA	NA	NA
AUR56820.1|3397412_3398024_+	hypothetical protein	NA	NA	NA	NA	NA
AUR56821.1|3398105_3399056_+|integrase	integrase	integrase	NA	NA	NA	NA
3407022:3407041	attR	GCTCGATGCGCAGGCCGACG	NA	NA	NA	NA
