The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP025703	Escherichia coli BH100N substr. MG2017, complete genome	5116034	266554	327642	5116034	protease,transposase,plate	Streptococcus_phage(18.18%)	60	NA	NA
AUN88712.1|266554_267901_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
AUN88713.1|267903_268428_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
AUN88714.1|268424_269705_-	type VI secretion system-associated FHA domainprotein TagH	NA	NA	NA	NA	NA
AUN88715.1|269721_270771_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
AUN88716.1|270734_272594_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
AUN88717.1|272581_273007_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
AUN88718.1|273011_274496_-	type VI secretion system contractile sheathlarge subunit	NA	NA	NA	NA	NA
AUN88719.1|274518_275022_-	type VI secretion system contractile sheathsmall subunit	NA	NA	NA	NA	NA
AUN88720.1|275727_276246_+	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
AUN88721.1|276331_276451_+	hypothetical protein	NA	NA	NA	NA	NA
AUN88722.1|276466_278449_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.8	2.5e-24
AUN88723.1|278555_279602_+	DUF2169 domain-containing protein	NA	NA	NA	NA	NA
AUN88724.1|279594_281034_+	peptidase C39	NA	NA	NA	NA	NA
AUN88725.1|281008_281299_+	hypothetical protein	NA	NA	NA	NA	NA
AUN88726.1|281556_281736_+	Mobile element protein	NA	NA	NA	NA	NA
AUN88727.1|282549_283053_+	hypothetical protein	NA	NA	NA	NA	NA
AUN88728.1|283122_283635_+	integrating conjugative element protein	NA	NA	NA	NA	NA
AUN88729.1|283905_284676_-	amidohydrolase	NA	NA	NA	NA	NA
AUN88730.1|284829_285303_+	hypothetical protein	NA	NA	NA	NA	NA
AUN88731.1|285345_287790_-	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
AUN88732.1|288029_288608_+	phosphoheptose isomerase	NA	A0A067XQR2	Caulobacter_phage	32.0	1.1e-14
AUN88733.1|288812_289580_+	class II glutamine amidotransferase	NA	NA	NA	NA	NA
AUN88734.1|289550_290291_-	transpeptidase	NA	NA	NA	NA	NA
AUN88735.1|290593_291352_+	peptidoglycan endopeptidase	NA	A0A1V0DZX6	Clostridioides_phage	37.7	1.5e-19
AUN88736.1|291527_292025_+|transposase	transposase	transposase	NA	NA	NA	NA
AUN88737.1|292107_292317_-	hypothetical protein	NA	NA	NA	NA	NA
AUN88738.1|292344_294084_-	flagellar type III secretion system proteinFlhA	NA	NA	NA	NA	NA
AUN88739.1|294043_294814_+	putative lateral flagellar export/assemblyprotein LafU	NA	NA	NA	NA	NA
AUN88740.1|294884_295940_+	DNA polymerase IV	NA	NA	NA	NA	NA
AUN88741.1|295991_296285_+	antitoxin YafN	NA	NA	NA	NA	NA
AUN88742.1|296287_296686_+	type II toxin-antitoxin system YafO familytoxin	NA	NA	NA	NA	NA
AUN88743.1|296695_297148_+	acyltransferase	NA	NA	NA	NA	NA
AUN88744.1|297325_298477_+	RNA ligase RtcB family protein	NA	A0A222ZMP7	Mycobacterium_phage	31.8	7.8e-31
AUN88745.1|298473_299088_+	peptide chain release factor H	NA	NA	NA	NA	NA
AUN88746.1|299144_300602_-	cytosol nonspecific dipeptidase	NA	NA	NA	NA	NA
AUN88747.1|300862_301321_+	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
AUN88748.1|301412_302657_+	esterase	NA	NA	NA	NA	NA
AUN88749.1|302714_303116_+	sigma factor-binding protein Crl	NA	NA	NA	NA	NA
AUN88750.1|303154_304210_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.6	1.0e-117
AUN88751.1|304498_305602_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
AUN88752.1|305613_306867_+	gamma-glutamyl-phosphate reductase	NA	A0A1X9I5D4	Streptococcus_phage	47.5	5.8e-96
AUN88753.1|307367_307964_+	hypothetical protein	NA	A0A1B0VBK8	Salmonella_phage	88.4	1.7e-98
AUN88754.1|308050_309688_-	hypothetical protein	NA	NA	NA	NA	NA
AUN88755.1|310179_310326_+	hypothetical protein	NA	NA	NA	NA	NA
AUN88756.1|310379_310607_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
AUN88757.1|310712_310940_+	DUF3987 domain-containing protein	NA	NA	NA	NA	NA
AUN88758.1|311188_312622_+	DUF3987 domain-containing protein	NA	NA	NA	NA	NA
AUN88759.1|313591_314155_+	inovirus Gp2 family protein	NA	NA	NA	NA	NA
AUN88760.1|316063_316783_-	PifA	NA	NA	NA	NA	NA
AUN88761.1|316839_317862_+	Mobile element protein	NA	A0A2L1IVA1	Escherichia_phage	99.4	6.0e-200
AUN88762.1|317864_318641_+	Mobile element protein	NA	A0A2L1IVB6	Escherichia_phage	99.2	4.9e-138
AUN88763.1|318691_320443_-	NTPase	NA	NA	NA	NA	NA
AUN88764.1|321440_321554_-	hypothetical protein	NA	NA	NA	NA	NA
AUN88765.1|321742_321940_+	hypothetical protein	NA	NA	NA	NA	NA
AUN88766.1|321963_322998_+	3-deoxy-7-phosphoheptulonate synthase	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	43.4	1.4e-71
AUN88767.1|323127_323307_+	hypothetical protein	NA	NA	NA	NA	NA
AUN88768.1|323483_323600_+	hypothetical protein	NA	NA	NA	NA	NA
AUN88769.1|326282_326504_+	hypothetical protein	NA	NA	NA	NA	NA
AUN88770.1|326500_326779_+	hypothetical protein	NA	NA	NA	NA	NA
AUN88771.1|326955_327642_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
>prophage 2
CP025703	Escherichia coli BH100N substr. MG2017, complete genome	5116034	350793	383280	5116034	tRNA,integrase,transposase	Stx2-converting_phage(15.38%)	37	348269:348285	385073:385089
348269:348285	attL	CATCTGCAGCAGGGTAT	NA	NA	NA	NA
AUN88794.1|350793_351198_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
AUN88795.1|351213_351369_-	hypothetical protein	NA	NA	NA	NA	NA
AUN88796.1|351961_352075_+	hypothetical protein	NA	NA	NA	NA	NA
AUN88797.1|352962_353079_+	hypothetical protein	NA	NA	NA	NA	NA
AUN88798.1|354471_354690_+	hypothetical protein	NA	NA	NA	NA	NA
AUN88799.1|354775_356746_+	ligand-gated channel	NA	NA	NA	NA	NA
AUN88800.1|356764_357556_+	DUF4198 domain-containing protein	NA	NA	NA	NA	NA
AUN88801.1|357819_359019_+	hypothetical protein	NA	NA	NA	NA	NA
AUN88802.1|359125_359308_-|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	67.2	1.1e-19
AUN88803.1|359473_360073_+	Mobile element protein	NA	A0A2L1IVA1	Escherichia_phage	98.9	5.2e-111
AUN88804.1|360069_360852_+|transposase	transposase	transposase	A0A2L1IVB6	Escherichia_phage	99.6	5.9e-139
AUN88805.1|360902_361520_-|transposase	IS66 family transposase	transposase	S5VLC8	Leptospira_phage	30.1	1.1e-07
AUN88806.1|361539_361887_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZDM8	Stx2-converting_phage	75.7	1.3e-45
AUN88807.1|361883_362246_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	71.1	1.4e-23
AUN88808.1|362380_362566_-	hypothetical protein	NA	NA	NA	NA	NA
AUN88809.1|363032_363920_-	ArgP/LysG family DNA-binding transcriptionalregulator	NA	NA	NA	NA	NA
AUN88810.1|363966_365463_-|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	37.1	2.4e-88
AUN88811.1|365756_366467_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AUN88812.1|366670_368797_-	lysine decarboxylase	NA	NA	NA	NA	NA
AUN88813.1|368827_370138_-	arginine:agmatine antiporter	NA	NA	NA	NA	NA
AUN88814.1|370524_370887_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	89.5	2.4e-31
AUN88815.1|371187_371370_-	hypothetical protein	NA	NA	NA	NA	NA
AUN88816.1|371700_372573_+	hypothetical protein	NA	NA	NA	NA	NA
AUN88817.1|372906_376029_+	autotransporter adhesin Ag43	NA	NA	NA	NA	NA
AUN88818.1|376355_377174_+	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	37.3	9.7e-44
AUN88819.1|377265_377751_+	antirestriction protein	NA	A0A2D0W9W4	Bordetella_phage	35.0	3.1e-13
AUN88820.1|377796_378243_+	hypothetical protein	NA	NA	NA	NA	NA
AUN88821.1|378311_378533_+	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.9e-10
AUN88822.1|378532_378646_+	hypothetical protein	NA	NA	NA	NA	NA
AUN88823.1|378695_379064_+	type IV toxin-antitoxin system YeeU familyantitoxin	NA	NA	NA	NA	NA
AUN88824.1|379153_379531_+	toxin	NA	NA	NA	NA	NA
AUN88825.1|379527_380016_+	hypothetical protein	NA	NA	NA	NA	NA
AUN88826.1|380027_380225_+	DUF957 domain-containing protein	NA	NA	NA	NA	NA
AUN88827.1|380228_380354_-	hypothetical protein	NA	NA	NA	NA	NA
AUN88828.1|380339_381164_+	DUF4942 domain-containing protein	NA	NA	NA	NA	NA
AUN88829.1|381256_382576_-|integrase	site-specific integrase	integrase	A0A2H4J5F8	uncultured_Caudovirales_phage	23.4	1.5e-17
AUN88830.1|382941_383280_+|integrase	integrase	integrase	E5AGD0	Erwinia_phage	48.6	5.6e-22
385073:385089	attR	CATCTGCAGCAGGGTAT	NA	NA	NA	NA
>prophage 3
CP025703	Escherichia coli BH100N substr. MG2017, complete genome	5116034	1020517	1028240	5116034	integrase	uncultured_Caudovirales_phage(50.0%)	10	1014504:1014518	1026844:1026858
1014504:1014518	attL	GCTCACGGGCCAGAT	NA	NA	NA	NA
AUN89437.1|1020517_1022464_+	macrolide ABC transporter permease/ATP-bindingprotein MacB	NA	G9BWD6	Planktothrix_phage	40.1	1.1e-37
AUN89438.1|1022536_1022761_-	cold-shock protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	2.3e-16
AUN89439.1|1023165_1024404_+|integrase	integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	52.2	2.0e-125
AUN89440.1|1024813_1025023_+	AlpA family phage regulatory protein	NA	A0A2H4JB58	uncultured_Caudovirales_phage	67.9	2.2e-16
AUN89441.1|1025161_1025341_-	hypothetical protein	NA	A0A2H4JB52	uncultured_Caudovirales_phage	58.6	1.2e-10
AUN89442.1|1025474_1025672_+	hypothetical protein	NA	NA	NA	NA	NA
AUN89443.1|1025664_1025976_+	hypothetical protein	NA	NA	NA	NA	NA
AUN89444.1|1025968_1026196_+	hypothetical protein	NA	NA	NA	NA	NA
AUN89445.1|1026201_1026489_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
AUN89446.1|1026485_1028240_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	40.8	2.2e-93
1026844:1026858	attR	ATCTGGCCCGTGAGC	NA	NA	NA	NA
>prophage 4
CP025703	Escherichia coli BH100N substr. MG2017, complete genome	5116034	1282273	1327376	5116034	lysis,portal,tRNA,integrase,head,capsid,tail,terminase	Enterobacteria_phage(55.77%)	62	1274908:1274923	1334553:1334568
1274908:1274923	attL	TAGCTTTGGAAAACAG	NA	NA	NA	NA
AUN89692.1|1282273_1283380_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
AUN89693.1|1283433_1283895_-	NUDIX hydrolase	NA	NA	NA	NA	NA
AUN89694.1|1283904_1284558_-	23S rRNA pseudouridine synthase E	NA	NA	NA	NA	NA
AUN89695.1|1284729_1285980_+	isocitrate dehydrogenase (NADP(+))	NA	Q77Z09	Phage_21	100.0	3.8e-23
AUN89696.1|1286093_1287236_-|integrase	integrase	integrase	Q77Z02	Phage_21	99.4	3.1e-205
AUN89697.1|1287225_1287462_-	excisionase	NA	NA	NA	NA	NA
AUN89698.1|1287601_1287841_-	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	94.9	3.9e-38
AUN89699.1|1287888_1288107_-	conjugal transfer protein TraR	NA	M1FQT7	Enterobacteria_phage	95.8	1.8e-34
AUN89700.1|1288205_1288487_-	hypothetical protein	NA	A0A0P0ZE02	Stx2-converting_phage	97.8	1.2e-46
AUN89701.1|1288497_1288689_-	hypothetical protein	NA	A0A0P0ZC67	Stx2-converting_phage	98.4	2.1e-26
AUN89702.1|1288661_1288844_-	DUF1317 domain-containing protein	NA	A0A0N7CHV0	Escherichia_phage	98.3	1.3e-28
AUN89703.1|1288840_1289521_-	exonuclease	NA	B6DZ61	Enterobacteria_phage	98.2	5.1e-131
AUN89704.1|1289517_1290303_-	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
AUN89705.1|1290308_1290605_-	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	99.0	3.6e-49
AUN89706.1|1290679_1290886_-	phage encoded cell division inhibitor protein	NA	K7P6H3	Enterobacteria_phage	85.3	3.2e-28
AUN89707.1|1291361_1291739_-	hypothetical protein	NA	Q6SE87	Lactobacillus_prophage	49.2	1.3e-30
AUN89708.1|1291716_1292778_-	hypothetical protein	NA	Q6SE88	Lactobacillus_prophage	42.0	2.9e-64
AUN89709.1|1292858_1293551_-	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	86.1	1.5e-109
AUN89710.1|1293661_1293889_+	transcriptional regulator	NA	Q76H55	Enterobacteria_phage	69.0	3.8e-22
AUN89711.1|1293919_1294459_+	hypothetical protein	NA	M9NZI6	Enterobacteria_phage	66.7	8.9e-62
AUN89712.1|1294455_1295475_+	hypothetical protein	NA	A0A0M5M7Y1	Salmonella_phage	64.7	6.1e-112
AUN89713.1|1295471_1296185_+	hypothetical protein	NA	G8C7U6	Escherichia_phage	83.4	9.8e-109
AUN89714.1|1296263_1296692_-	hypothetical protein	NA	NA	NA	NA	NA
AUN89715.1|1296688_1297066_-	hypothetical protein	NA	NA	NA	NA	NA
AUN89716.1|1297333_1297789_+	hypothetical protein	NA	I6PD71	Cronobacter_phage	66.2	7.0e-60
AUN89717.1|1297788_1297959_+	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	67.9	2.0e-12
AUN89718.1|1297951_1298242_+	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	92.7	9.6e-47
AUN89719.1|1298238_1298601_+	Crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	96.5	4.3e-60
AUN89720.1|1298597_1298738_+	hypothetical protein	NA	K7PHH3	Enterobacteria_phage	69.8	1.1e-08
AUN89721.1|1298823_1299207_+	antitermination protein	NA	A0A088CD47	Shigella_phage	83.3	1.5e-55
AUN89722.1|1299395_1300478_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	80.1	1.6e-166
AUN89723.1|1301066_1301282_+|lysis	lysis protein S	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
AUN89724.1|1301281_1301779_+	lysozyme	NA	M1FJA0	Enterobacteria_phage	96.4	2.1e-89
AUN89725.1|1301775_1302237_+|lysis	lysis protein	lysis	A0A0K2FJD0	Enterobacteria_phage	98.7	1.2e-75
AUN89726.1|1302268_1302562_-	hypothetical protein	NA	K7PL54	Enterobacteria_phage	92.8	7.0e-45
AUN89727.1|1302988_1303369_+	cell envelope biogenesis protein TonB	NA	H6WZK5	Escherichia_phage	72.2	2.6e-39
AUN89728.1|1303491_1303845_-	hypothetical protein	NA	NA	NA	NA	NA
AUN89729.1|1303732_1304053_-	hypothetical protein	NA	NA	NA	NA	NA
AUN89730.1|1303987_1304332_+	DNA-packaging protein	NA	NA	NA	NA	NA
AUN89731.1|1304321_1304870_+|terminase	phage terminase small subunit	terminase	A0A0U2S671	Escherichia_phage	84.2	1.0e-57
AUN89732.1|1304841_1306770_+|terminase	terminase	terminase	A0A0K2FJ14	Enterobacteria_phage	66.7	3.3e-260
AUN89733.1|1306753_1306960_+|head	phage head-stabilizing protein	head	K7PM10	Enterobacteria_phage	55.4	3.0e-10
AUN89734.1|1306956_1308549_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	61.1	6.5e-185
AUN89735.1|1308538_1310044_+	scaffold protein	NA	A0A0K2FI53	Enterobacteria_phage	53.2	1.3e-99
AUN89736.1|1310080_1310428_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	58.1	2.6e-22
AUN89737.1|1310485_1311514_+|capsid	minor capsid protein E	capsid	C6ZCY2	Enterobacteria_phage	61.6	2.7e-115
AUN89738.1|1311517_1311940_+	hypothetical protein	NA	NA	NA	NA	NA
AUN89739.1|1311932_1312286_+|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	65.0	3.4e-38
AUN89740.1|1312297_1312876_+|tail	tail protein	tail	A0A2R9YJK4	Escherichia_phage	92.2	1.7e-79
AUN89741.1|1312872_1313268_+|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	98.5	5.0e-70
AUN89742.1|1313275_1314016_+|tail	major tail protein V	tail	A0A0K2FJ05	Enterobacteria_phage	98.0	6.1e-130
AUN89743.1|1314031_1314454_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	95.7	2.4e-70
AUN89744.1|1314435_1314870_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	97.5	6.5e-63
AUN89745.1|1314862_1317424_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	90.0	0.0e+00
AUN89746.1|1317420_1317750_+|tail	tail protein	tail	A0A2R9YJM0	Escherichia_phage	98.2	2.8e-58
AUN89747.1|1317749_1318448_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	98.7	6.2e-132
AUN89748.1|1318452_1319196_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.2	7.7e-149
AUN89749.1|1319192_1319765_+|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.5	3.0e-84
AUN89750.1|1319825_1323224_+	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	90.8	0.0e+00
AUN89751.1|1323290_1323890_+	hypothetical protein	NA	A0A0P0ZCF6	Stx2-converting_phage	99.5	2.3e-111
AUN89752.1|1323954_1326795_+	membrane protein	NA	A0A0K2FIZ6	Escherichia_phage	92.3	2.5e-54
AUN89753.1|1326794_1327376_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	93.8	1.6e-101
1334553:1334568	attR	TAGCTTTGGAAAACAG	NA	NA	NA	NA
>prophage 5
CP025703	Escherichia coli BH100N substr. MG2017, complete genome	5116034	2472230	2482513	5116034		Pseudomonas_phage(33.33%)	7	NA	NA
AUN90873.1|2472230_2475989_-	AIDA-I family autotransporter YfaL	NA	A0A2L1IV18	Escherichia_phage	27.7	1.3e-21
AUN90874.1|2476412_2476625_-	hypothetical protein	NA	Q1MVF2	Enterobacteria_phage	77.5	6.2e-11
AUN90875.1|2476670_2478956_+	ribonucleoside-diphosphate reductase subunitalpha	NA	A0A2D1GNB1	Pseudoalteromonas_phage	63.6	1.9e-283
AUN90876.1|2479145_2480276_+	ribonucleotide-diphosphate reductase subunitbeta	NA	G9IAA3	Pseudomonas_phage	78.9	2.5e-175
AUN90877.1|2480275_2480530_+	ferredoxin	NA	G9IAA2	Pseudomonas_phage	73.1	2.6e-24
AUN90878.1|2480583_2481234_-	hypothetical protein	NA	NA	NA	NA	NA
AUN90879.1|2481436_2482513_-	glycerophosphodiester phosphodiesterase	NA	A0A220BYK6	Staphylococcus_phage	46.0	5.1e-08
>prophage 6
CP025703	Escherichia coli BH100N substr. MG2017, complete genome	5116034	2769308	2845463	5116034	tRNA,holin,head,tail,terminase	Salmonella_phage(48.08%)	83	NA	NA
AUN91149.1|2769308_2770049_-|tRNA	tRNA (cytidine/uridine-2'-O-)-methyltransferaseTrmJ	tRNA	NA	NA	NA	NA
AUN91150.1|2770167_2770971_+	inositol monophosphatase	NA	NA	NA	NA	NA
AUN91151.1|2771115_2771970_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
AUN91152.1|2772160_2773441_+	stationary phase inducible protein CsiE	NA	NA	NA	NA	NA
AUN91153.1|2773432_2774572_-	3-phenylpropionate MFS transporter	NA	NA	NA	NA	NA
AUN91154.1|2774791_2774944_+	hypothetical protein	NA	NA	NA	NA	NA
AUN91155.1|2774940_2775363_+	hypothetical protein	NA	NA	NA	NA	NA
AUN91156.1|2776958_2777831_-	aldose 1-epimerase	NA	NA	NA	NA	NA
AUN91157.1|2777842_2778904_-	Zn-dependent NAD(P)-binding oxidoreductase	NA	NA	NA	NA	NA
AUN91158.1|2778969_2779968_-	sugar ABC transporter permease	NA	NA	NA	NA	NA
AUN91159.1|2779992_2781504_-	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	23.0	4.0e-11
AUN91160.1|2781526_2782510_-	sugar ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUN91161.1|2782606_2785888_-	DUF5107 domain-containing protein	NA	NA	NA	NA	NA
AUN91162.1|2786005_2787199_+	ROK family protein	NA	NA	NA	NA	NA
AUN91163.1|2787262_2788516_-	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	52.7	7.8e-101
AUN91164.1|2788844_2790035_+	NO-inducible flavohemoprotein	NA	NA	NA	NA	NA
AUN91165.1|2790079_2790418_-	nitrogen regulatory protein P-II 1	NA	NA	NA	NA	NA
AUN91166.1|2790478_2791813_-	two-component system response regulator GlrR	NA	W8CYM9	Bacillus_phage	37.3	3.9e-10
AUN91167.1|2791802_2792516_-	two-component system QseEF-associatedlipoprotein QseG	NA	NA	NA	NA	NA
AUN91168.1|2792680_2794108_-	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	24.9	3.0e-16
AUN91169.1|2794683_2798571_-	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	59.4	2.2e-130
AUN91170.1|2798585_2798726_-	phosphoribosylglycinamide synthetase	NA	NA	NA	NA	NA
AUN91171.1|2800381_2800918_-|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	NA	NA	NA	NA
AUN91172.1|2800942_2801578_-	phosphatidylglycerophosphatase C	NA	NA	NA	NA	NA
AUN91173.1|2801786_2802635_+	transcriptional regulator	NA	NA	NA	NA	NA
AUN91174.1|2802947_2803214_+	hypothetical protein	NA	A0A0M3ULK3	Salmonella_phage	80.7	1.7e-34
AUN91175.1|2803272_2803920_+	hypothetical protein	NA	NA	NA	NA	NA
AUN91176.1|2804000_2804555_-	recombinase family protein	NA	A0A1S6L009	Salmonella_phage	87.3	3.7e-87
AUN91177.1|2804692_2804974_+|tail	Phage tail fiber protein	tail	NA	NA	NA	NA
AUN91178.1|2805000_2805441_+|tail	tail assembly chaperone	tail	A0A0F7LDZ0	Escherichia_phage	69.7	5.6e-54
AUN91179.1|2805412_2806006_-|tail	tail assembly protein	tail	Q9MCR5	Enterobacteria_phage	64.9	4.5e-59
AUN91180.1|2806005_2806800_-|tail	Prophage tail fiber protein	tail	K7PH60	Enterobacterial_phage	92.3	6.3e-80
AUN91181.1|2806799_2807480_-	DUF2612 domain-containing protein	NA	A0A0M5M1K4	Salmonella_phage	78.8	3.4e-103
AUN91182.1|2807476_2808676_-	hypothetical protein	NA	A0A0M4RD32	Salmonella_phage	83.9	1.7e-185
AUN91183.1|2808675_2809029_-	hypothetical protein	NA	A0A0M4R339	Salmonella_phage	88.9	1.5e-54
AUN91184.1|2809028_2809781_-	hypothetical protein	NA	A0A0M5M1K7	Salmonella_phage	65.9	2.5e-86
AUN91185.1|2809840_2810236_-	hypothetical protein	NA	NA	NA	NA	NA
AUN91186.1|2810222_2810996_-	hypothetical protein	NA	NA	NA	NA	NA
AUN91187.1|2811091_2811424_-	hypothetical protein	NA	A0A0M4RTY3	Salmonella_phage	70.5	1.1e-22
AUN91188.1|2811423_2812488_-	hypothetical protein	NA	A0A0M4QX01	Salmonella_phage	81.1	3.2e-156
AUN91189.1|2812490_2812793_-	hypothetical protein	NA	A0A0M4R5B7	Salmonella_phage	91.0	6.3e-49
AUN91190.1|2812792_2813380_-	hypothetical protein	NA	A0A0M3ULD5	Salmonella_phage	88.0	3.4e-83
AUN91191.1|2813379_2815365_-	hypothetical protein	NA	A0A0M4REK7	Salmonella_phage	53.3	3.8e-174
AUN91192.1|2815542_2815995_-	hypothetical protein	NA	A0A0M4S6U8	Salmonella_phage	72.7	6.1e-56
AUN91193.1|2815998_2816439_-	DUF3277 domain-containing protein	NA	A0A2H4J619	uncultured_Caudovirales_phage	75.3	7.0e-57
AUN91194.1|2816449_2817595_-	DUF3383 domain-containing protein	NA	A0A2H4J8G4	uncultured_Caudovirales_phage	73.2	5.2e-160
AUN91195.1|2817598_2818162_-	hypothetical protein	NA	A0A0M4R331	Salmonella_phage	75.7	1.3e-79
AUN91196.1|2818136_2818526_-	hypothetical protein	NA	A0A0M3ULK0	Salmonella_phage	95.3	5.6e-66
AUN91197.1|2818512_2819067_-	hypothetical protein	NA	A0A0M4S631	Salmonella_phage	83.2	1.7e-79
AUN91198.1|2819063_2819471_-	DUF4054 domain-containing protein	NA	A0A0M5M3S2	Salmonella_phage	94.8	4.3e-69
AUN91199.1|2819436_2819658_-	hypothetical protein	NA	A0A0M4RTX5	Salmonella_phage	68.6	7.7e-12
AUN91200.1|2819699_2820641_-	DUF2184 domain-containing protein	NA	A0A0M3ULD3	Salmonella_phage	86.3	3.2e-155
AUN91201.1|2820652_2821159_-	hypothetical protein	NA	A0A0M4QWZ6	Salmonella_phage	79.3	1.1e-69
AUN91202.1|2821162_2822383_-	DUF2213 domain-containing protein	NA	A0A0M4R5A6	Salmonella_phage	88.0	3.2e-200
AUN91203.1|2822397_2822835_-|head	phage head morphogenesis protein	head	A0A0M4REK0	Salmonella_phage	89.7	5.0e-71
AUN91204.1|2823022_2824489_-	hypothetical protein	NA	A0A0M4S6U1	Salmonella_phage	91.8	6.7e-261
AUN91205.1|2824488_2826111_-	hypothetical protein	NA	A0A0M5M1R6	Salmonella_phage	95.4	0.0e+00
AUN91206.1|2826113_2826686_-|terminase	terminase small subunit	terminase	A0A2H4J480	uncultured_Caudovirales_phage	69.6	6.1e-61
AUN91207.1|2826747_2827272_-	hypothetical protein	NA	K7P6W1	Enterobacteria_phage	66.9	4.5e-42
AUN91208.1|2827255_2827732_-	lysozyme	NA	Q8SBE0	Shigella_phage	96.2	2.1e-86
AUN91209.1|2827735_2828077_-|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	91.9	2.8e-53
AUN91210.1|2828522_2828864_-	hypothetical protein	NA	NA	NA	NA	NA
AUN91211.1|2828895_2829318_-	antitermination protein	NA	Q8W638	Enterobacteria_phage	63.3	8.8e-41
AUN91212.1|2829599_2831792_-	replication protein	NA	B6SCY1	Bacteriophage	71.3	1.2e-173
AUN91213.1|2831795_2832008_-	XRE family transcriptional regulator	NA	A0A0R6PHL1	Moraxella_phage	42.9	7.9e-06
AUN91214.1|2832128_2832752_+	DNA-binding protein	NA	A0A1I9KG86	Aeromonas_phage	44.8	3.3e-36
AUN91215.1|2833385_2833535_+	hypothetical protein	NA	NA	NA	NA	NA
AUN91216.1|2833531_2834434_+	hypothetical protein	NA	Q3LZP9	Bacteriophage	54.4	6.1e-07
AUN91217.1|2834436_2835738_+	DUF2800 domain-containing protein	NA	B6SCX9	Bacteriophage	56.4	7.2e-134
AUN91218.1|2835753_2836302_+	DUF2815 domain-containing protein	NA	Q775A5	Bordetella_phage	65.9	1.6e-66
AUN91219.1|2836353_2836992_+	hypothetical protein	NA	H6WRY3	Salmonella_phage	68.8	3.9e-72
AUN91220.1|2837059_2837329_-	hypothetical protein	NA	NA	NA	NA	NA
AUN91221.1|2837385_2839449_+	DNA polymerase	NA	Q775A3	Bordetella_phage	67.8	8.7e-275
AUN91222.1|2839454_2839658_+	hypothetical protein	NA	K7PLX1	Enterobacteria_phage	55.4	3.2e-12
AUN91223.1|2839663_2839885_+	hypothetical protein	NA	NA	NA	NA	NA
AUN91224.1|2839874_2840357_+	class I SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	79.6	3.6e-70
AUN91225.1|2840356_2840650_+	VRR-NUC domain-containing protein	NA	B6SD64	Bacteriophage	68.2	5.0e-27
AUN91226.1|2840622_2841651_+	DNA cytosine methyltransferase	NA	Q858D4	Salmonella_phage	52.9	7.1e-100
AUN91227.1|2841647_2841968_-	hypothetical protein	NA	NA	NA	NA	NA
AUN91228.1|2842002_2843397_+	ATP-dependent helicase	NA	Q3LZN8	Bacteriophage	74.7	7.3e-217
AUN91229.1|2843393_2843594_+	DNA-binding protein	NA	NA	NA	NA	NA
AUN91230.1|2843590_2844988_-	recombinase	NA	NA	NA	NA	NA
AUN91231.1|2845202_2845463_+	ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	54.7	1.7e-18
>prophage 7
CP025703	Escherichia coli BH100N substr. MG2017, complete genome	5116034	4149186	4160748	5116034	integrase	Enterobacteria_phage(88.89%)	14	4149004:4149026	4159638:4159660
4149004:4149026	attL	GACTCCTGTGATCTTCCGCCAAA	NA	NA	NA	NA
AUN92518.1|4149186_4150374_+|integrase	integrase	integrase	Q7M297	Enterobacteria_phage	91.2	1.5e-207
AUN92519.1|4150420_4150948_-	hypothetical protein	NA	NA	NA	NA	NA
AUN92520.1|4150954_4152040_-	hypothetical protein	NA	NA	NA	NA	NA
AUN92521.1|4152336_4152909_-	Polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	96.8	5.0e-95
AUN92522.1|4152982_4153483_-	transactivation protein	NA	NA	NA	NA	NA
AUN92523.1|4153479_4154214_-	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	96.3	1.1e-126
AUN92524.1|4154766_4155033_+	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	100.0	4.9e-45
AUN92525.1|4155029_4155620_+	hypothetical protein	NA	Q7M2A7	Enterobacteria_phage	89.6	2.0e-59
AUN92526.1|4155612_4155900_+	hypothetical protein	NA	Q7M2A0	Enterobacteria_phage	97.9	8.6e-48
AUN92527.1|4155892_4156348_+	hypothetical protein	NA	Q7M298	Enterobacteria_phage	99.1	1.6e-64
AUN92528.1|4156483_4156804_+	hypothetical protein	NA	NA	NA	NA	NA
AUN92529.1|4156818_4159152_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	99.0	0.0e+00
AUN92530.1|4159129_4159339_+	hypothetical protein	NA	NA	NA	NA	NA
AUN92531.1|4159710_4160748_+	2-hydroxyacid dehydrogenase	NA	Q9JMN3	Wolbachia_phage	43.6	7.4e-73
4159638:4159660	attR	GACTCCTGTGATCTTCCGCCAAA	NA	NA	NA	NA
>prophage 8
CP025703	Escherichia coli BH100N substr. MG2017, complete genome	5116034	5048310	5089232	5116034	lysis,portal,integrase,holin,tail	Enterobacteria_phage(51.06%)	53	5048061:5048080	5093185:5093204
5048061:5048080	attL	TTTGCCATTATTTCTCACCC	NA	NA	NA	NA
AUN93375.1|5048310_5049525_+|integrase	site-specific integrase	integrase	A0A291AWU1	Escherichia_phage	99.3	1.6e-236
AUN93376.1|5049900_5050896_-	hypothetical protein	NA	NA	NA	NA	NA
AUN93377.1|5051269_5051464_-	DNA-binding protein	NA	A5LH59	Enterobacteria_phage	93.8	2.5e-30
AUN93378.1|5051463_5052084_-	DUF551 domain-containing protein	NA	A5LH60	Enterobacteria_phage	95.6	1.2e-118
AUN93379.1|5052083_5052446_-	hypothetical protein	NA	U5P092	Shigella_phage	95.8	1.3e-64
AUN93380.1|5052436_5052973_-	HD family hydrolase	NA	S5MW55	Escherichia_phage	100.0	7.4e-101
AUN93381.1|5053100_5053925_-	DUF2303 domain-containing protein	NA	U5P439	Shigella_phage	99.3	6.6e-149
AUN93382.1|5053990_5054353_-	hypothetical protein	NA	Q8SBF8	Shigella_phage	100.0	8.6e-61
AUN93383.1|5054425_5054650_+	hypothetical protein	NA	A0A291AWX8	Escherichia_phage	66.2	4.9e-14
AUN93384.1|5054821_5055334_+	hypothetical protein	NA	NA	NA	NA	NA
AUN93385.1|5055649_5056342_-	helix-turn-helix transcriptional regulator	NA	S5FUZ3	Shigella_phage	99.1	7.3e-125
AUN93386.1|5056315_5056468_+	amino acid permease	NA	NA	NA	NA	NA
AUN93387.1|5056439_5056700_+	XRE family transcriptional regulator	NA	S5FKP1	Shigella_phage	98.8	9.3e-41
AUN93388.1|5056692_5057244_+	hypothetical protein	NA	K7PGU3	Enterobacteria_phage	97.8	1.1e-99
AUN93389.1|5057240_5058077_+	hypothetical protein	NA	Q8SBF3	Shigella_phage	92.4	1.1e-138
AUN93390.1|5058081_5058306_+	hypothetical protein	NA	A0A291AX25	Escherichia_phage	97.3	9.1e-37
AUN93391.1|5058302_5059121_+	helix-turn-helix domain-containing protein	NA	A0A291AWW0	Escherichia_phage	99.6	4.7e-123
AUN93392.1|5059117_5059612_+	PerC family transcriptional regulator	NA	A0A291AWV6	Escherichia_phage	97.5	8.1e-86
AUN93393.1|5059611_5060265_+	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	99.5	1.9e-127
AUN93394.1|5060261_5060588_+	LexA family transcriptional regulator	NA	K7PLX6	Enterobacteria_phage	99.1	2.0e-53
AUN93395.1|5060584_5060974_+	RusA family crossover junctionendodeoxyribonuclease	NA	A0A0P0ZD39	Stx2-converting_phage	100.0	7.1e-69
AUN93396.1|5060993_5061836_+	hypothetical protein	NA	S5MC03	Escherichia_phage	91.8	5.7e-140
AUN93397.1|5061843_5062833_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	99.1	8.1e-194
AUN93398.1|5062850_5063192_+	antitermination protein	NA	A0A0P0ZCW0	Stx2-converting_phage	90.3	4.2e-57
AUN93399.1|5063204_5063753_-	hypothetical protein	NA	NA	NA	NA	NA
AUN93400.1|5063739_5064666_-	hypothetical protein	NA	NA	NA	NA	NA
AUN93401.1|5064930_5065134_+	hypothetical protein	NA	A0A291AWX6	Escherichia_phage	98.5	3.0e-31
AUN93402.1|5065284_5066337_+	site-specific DNA-methyltransferase	NA	A5LH81	Enterobacteria_phage	98.9	2.6e-206
AUN93403.1|5066413_5066740_+|holin	phage holin, lambda family	holin	U5P0K7	Shigella_phage	98.1	2.6e-56
AUN93404.1|5066743_5067220_+	lysozyme	NA	K7PKV2	Enterobacteria_phage	95.6	2.5e-84
AUN93405.1|5067216_5067660_+|lysis	lysis protein	lysis	M1FJ79	Enterobacteria_phage	93.9	1.5e-70
AUN93406.1|5067698_5068073_+	hypothetical protein	NA	M1FPD9	Enterobacteria_phage	87.9	2.5e-55
AUN93407.1|5068171_5068354_-	hypothetical protein	NA	NA	NA	NA	NA
AUN93408.1|5068352_5068553_+	hypothetical protein	NA	K7PJR7	Enterobacteria_phage	93.9	2.3e-31
AUN93409.1|5068711_5069206_+	DUF1441 domain-containing protein	NA	A0A291AWV8	Escherichia_phage	99.4	3.8e-83
AUN93410.1|5069205_5071308_+	DNA packaging protein	NA	K7PH40	Enterobacteria_phage	99.6	0.0e+00
AUN93411.1|5071304_5071517_+	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
AUN93412.1|5071516_5073025_+|portal	phage portal protein	portal	K7PJP3	Enterobacteria_phage	99.8	1.6e-289
AUN93413.1|5072969_5074997_+	peptidase S14	NA	A5LH30	Enterobacteria_phage	99.5	0.0e+00
AUN93414.1|5075038_5075407_+	DUF2190 domain-containing protein	NA	A0A291AWX2	Escherichia_phage	100.0	9.7e-52
AUN93415.1|5075399_5075675_+	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	100.0	2.3e-45
AUN93416.1|5075686_5076265_+|tail	tail protein	tail	A5LH33	Enterobacteria_phage	99.5	2.1e-101
AUN93417.1|5076261_5076663_+|tail	tail protein	tail	A5LH34	Enterobacteria_phage	98.5	1.6e-71
AUN93418.1|5076673_5077417_+|tail	tail protein	tail	A0A291AWU6	Escherichia_phage	98.0	1.6e-130
AUN93419.1|5077477_5077864_+|tail	phage minor tail protein G	tail	K7PLV8	Enterobacteria_phage	100.0	3.3e-66
AUN93420.1|5077872_5078202_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
AUN93421.1|5078173_5081239_+|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	98.8	0.0e+00
AUN93422.1|5081238_5081568_+|tail	tail protein	tail	A5LH39	Enterobacteria_phage	99.1	5.1e-60
AUN93423.1|5081577_5082276_+|tail	Phage minor tail protein	tail	A5LH40	Enterobacteria_phage	99.1	1.9e-133
AUN93424.1|5082281_5083025_+|tail	Phage tail assembly protein	tail	K7PLW1	Enterobacteria_phage	98.8	2.2e-151
AUN93425.1|5083021_5083570_+|tail	Phage tail assembly protein I	tail	K7PH50	Enterobacteria_phage	98.9	4.0e-94
AUN93426.1|5083630_5087113_+	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	89.5	0.0e+00
AUN93427.1|5087171_5089232_+	hypothetical protein	NA	A0A0E3M194	Enterobacteria_phage	54.9	5.7e-125
5093185:5093204	attR	TTTGCCATTATTTCTCACCC	NA	NA	NA	NA
