The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP025979	Escherichia marmotae strain HT073016 chromosome, complete genome	4671322	29125	42669	4671322	transposase	Enterobacteria_phage(75.0%)	21	NA	NA
AUT25707.1|29125_29819_+|transposase	IS1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	87.4	2.4e-120
AUT25708.1|29846_30053_+	hypothetical protein	NA	NA	NA	NA	NA
AUT25709.1|30245_30386_-	Hok/Gef family protein	NA	A0A0A7NPZ4	Enterobacteria_phage	95.7	5.9e-18
AUT25710.1|30581_31731_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	41.3	5.7e-50
AUT25711.1|32007_32322_-	peptide transporter	NA	A0A0A7NPT5	Enterobacteria_phage	54.8	6.4e-20
AUT25712.1|32326_33286_-	recombinase	NA	A0A0A7NPX4	Enterobacteria_phage	99.1	8.4e-180
AUT29815.1|33419_35690_-	replication protein	NA	A0A0A7NQ77	Enterobacteria_phage	88.8	0.0e+00
AUT25713.1|35972_36215_-	hypothetical protein	NA	NA	NA	NA	NA
AUT25714.1|36211_36601_-	inositol monophosphatase	NA	NA	NA	NA	NA
AUT25715.1|36673_36904_-	derepression protein	NA	A0A0A7NV48	Enterobacteria_phage	97.4	9.1e-32
AUT25716.1|36960_37176_+	hypothetical protein	NA	NA	NA	NA	NA
AUT25717.1|37226_37526_-	hypothetical protein	NA	A0A0A7NRX6	Enterobacteria_phage	89.8	3.1e-40
AUT25718.1|37522_37768_-	MarR family transcriptional regulator	NA	A0A0A7NV47	Enterobacteria_phage	98.8	3.3e-40
AUT25719.1|37764_37968_-	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	86.6	2.9e-26
AUT25720.1|38164_38407_-	DUF4754 domain-containing protein	NA	A0A0A7NQ71	Enterobacteria_phage	98.8	2.0e-37
AUT25721.1|38418_38706_-	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	76.8	4.6e-33
AUT25722.1|38716_39058_-	DUF4761 domain-containing protein	NA	A0A0A7NV42	Enterobacteria_phage	92.2	6.6e-55
AUT25723.1|39310_39517_-	hypothetical protein	NA	NA	NA	NA	NA
AUT25724.1|39523_39811_-	hypothetical protein	NA	A0A0M4RCW1	Salmonella_phage	52.6	4.3e-23
AUT29816.1|39924_40245_+	XRE family transcriptional regulator	NA	Q1JS37	Enterobacteria_phage	43.2	1.4e-14
AUT25725.1|41511_42669_+	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	29.4	1.7e-22
>prophage 2
CP025979	Escherichia marmotae strain HT073016 chromosome, complete genome	4671322	263651	273098	4671322		Enterobacteria_phage(85.71%)	10	NA	NA
AUT25920.1|263651_264578_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.6	1.7e-23
AUT25921.1|264582_265314_+	ABC transporter permease	NA	NA	NA	NA	NA
AUT25922.1|265294_265402_-	hypothetical protein	NA	NA	NA	NA	NA
AUT25923.1|265461_266193_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	97.5	1.0e-108
AUT25924.1|266418_268104_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	99.1	2.1e-303
AUT25925.1|268100_268820_+	two-component system response regulator YehT	NA	NA	NA	NA	NA
AUT25926.1|268866_269337_+	DUF1456 domain-containing protein	NA	Q9EYF4	Enterobacteria_phage	96.8	9.7e-81
AUT25927.1|269378_269840_-	DUF1307 domain-containing protein	NA	Q9EYF5	Enterobacteria_phage	97.4	7.8e-75
AUT25928.1|269946_271965_-	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	86.1	0.0e+00
AUT25929.1|271961_273098_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	93.5	3.4e-156
>prophage 3
CP025979	Escherichia marmotae strain HT073016 chromosome, complete genome	4671322	497046	587018	4671322	portal,terminase,capsid,tail,tRNA,holin,transposase,plate,head,protease	Enterobacteria_phage(49.3%)	106	NA	NA
AUT26127.1|497046_498780_-|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.7	1.4e-87
AUT26128.1|498813_498993_+	hypothetical protein	NA	NA	NA	NA	NA
AUT26129.1|498995_499562_+	VOC family protein	NA	NA	NA	NA	NA
AUT26130.1|499575_500322_+	copper homeostasis protein CutC	NA	NA	NA	NA	NA
AUT26131.1|500661_501633_-|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
AUT26132.1|501629_502373_-|tRNA	tRNA (cmo5U34)-methyltransferase	tRNA	F5B419	Synechococcus_phage	29.6	1.0e-23
AUT26133.1|502413_502809_-	hypothetical protein	NA	NA	NA	NA	NA
AUT26134.1|502861_503626_-	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	92.1	1.4e-65
AUT26135.1|503613_504927_-	DUF3596 domain-containing protein	NA	Q8W658	Enterobacteria_phage	98.4	6.6e-252
AUT26136.1|504982_505219_-	excisionase	NA	Q8W657	Enterobacteria_phage	100.0	6.4e-41
AUT26137.1|505227_505374_-	hypothetical protein	NA	A0A1B5FPC2	Escherichia_phage	95.8	3.1e-22
AUT26138.1|505377_505620_-	DUF4222 domain-containing protein	NA	Q8W656	Enterobacteria_phage	100.0	6.8e-38
AUT26139.1|505651_506023_-	hypothetical protein	NA	Q8W655	Enterobacteria_phage	97.6	1.1e-63
AUT26140.1|506063_506891_-|protease	serine protease	protease	Q8W654	Enterobacteria_phage	98.5	3.4e-129
AUT26141.1|506887_507076_-	hypothetical protein	NA	NA	NA	NA	NA
AUT26142.1|507252_507834_-	hypothetical protein	NA	Q8W653	Enterobacteria_phage	83.9	3.0e-95
AUT26143.1|507830_508028_-	hypothetical protein	NA	Q8W652	Enterobacteria_phage	81.7	5.6e-22
AUT26144.1|508224_508431_-	hypothetical protein	NA	Q8W651	Enterobacteria_phage	97.1	6.9e-31
AUT26145.1|509981_510470_-	transcriptional regulator	NA	Q8W649	Enterobacteria_phage	93.2	1.9e-63
AUT26146.1|510573_511230_-	phage repressor protein	NA	Q8W648	Enterobacteria_phage	99.5	6.2e-126
AUT26147.1|511341_511569_+	hypothetical protein	NA	Q8W647	Enterobacteria_phage	100.0	3.7e-38
AUT26148.1|511570_512317_+	hypothetical protein	NA	NA	NA	NA	NA
AUT26149.1|512354_513062_+	DNA-binding protein	NA	Q8W645	Enterobacteria_phage	91.9	2.8e-116
AUT26150.1|513165_514194_+	hypothetical protein	NA	Q8W643	Enterobacteria_phage	61.3	1.5e-97
AUT26151.1|514190_514385_+	hypothetical protein	NA	NA	NA	NA	NA
AUT26152.1|514381_514615_+	hypothetical protein	NA	A0A1C9II64	Salmonella_phage	48.6	1.9e-13
AUT26153.1|515520_516399_+	AAA family ATPase	NA	Q8W641	Enterobacteria_phage	83.2	3.4e-119
AUT26154.1|516395_517787_+	replicative DNA helicase	NA	Q8W640	Enterobacteria_phage	97.0	1.3e-258
AUT29829.1|517798_518041_+	hypothetical protein	NA	Q8W639	Enterobacteria_phage	96.2	6.0e-34
AUT26155.1|518040_519000_+	RusA family crossover junction endodeoxyribonuclease	NA	I6PDF8	Cronobacter_phage	50.7	1.6e-58
AUT26156.1|519230_519944_+	hypothetical protein	NA	NA	NA	NA	NA
AUT26157.1|520804_521005_+	hypothetical protein	NA	NA	NA	NA	NA
AUT26158.1|520925_522497_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	1.3e-169
AUT26159.1|522516_522864_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZDM8	Stx2-converting_phage	75.7	1.7e-45
AUT26160.1|522863_523541_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
AUT26161.1|523517_523610_+	copper resistance protein	NA	NA	NA	NA	NA
AUT26162.1|523758_524184_+	tellurite/colicin resistance protein	NA	Q71TK7	Escherichia_phage	85.1	4.2e-59
AUT26163.1|524180_524333_+	DUF3927 domain-containing protein	NA	H6WZJ7	Escherichia_phage	68.2	8.1e-05
AUT26164.1|524422_524815_+|holin	holin	holin	Q9MBZ5	Enterobacteria_phage	97.7	3.1e-56
AUT26165.1|524804_525080_+|holin	phage holin family protein	holin	A0A0U2SHD1	Escherichia_phage	91.2	4.9e-40
AUT26166.1|525082_525460_+	peptidase M15	NA	Q9MBZ3	Enterobacteria_phage	99.2	3.5e-65
AUT26167.1|525501_525684_+	hypothetical protein	NA	NA	NA	NA	NA
AUT26168.1|525939_526236_+	hypothetical protein	NA	NA	NA	NA	NA
AUT26169.1|526256_526598_+	HNH endonuclease	NA	Q8W633	Enterobacteria_phage	100.0	3.9e-63
AUT26170.1|526753_527236_+|terminase	phage terminase small subunit P27 family	terminase	A0A1B5FPA0	Escherichia_phage	99.4	2.7e-86
AUT26171.1|527235_528993_+|terminase	terminase large subunit	terminase	A0A1B5FP96	Escherichia_phage	99.1	0.0e+00
AUT26172.1|529004_529187_+	hypothetical protein	NA	A0A1B5FP99	Escherichia_phage	80.0	2.4e-19
AUT26173.1|529186_530428_+|portal	phage portal protein	portal	Q8W629	Enterobacteria_phage	94.4	7.9e-231
AUT26174.1|530369_531056_+|head,protease	HK97 family phage prohead protease	head,protease	Q8W628	Enterobacteria_phage	99.5	2.4e-120
AUT26175.1|531067_532294_+|capsid	phage major capsid protein	capsid	Q8W627	Enterobacteria_phage	94.1	4.3e-197
AUT26176.1|532339_532663_+|head,tail	phage gp6-like head-tail connector protein	head,tail	Q8W626	Enterobacteria_phage	99.1	9.7e-56
AUT26177.1|532659_533076_+|head,tail	head-tail adaptor protein	head,tail	Q8HAC9	Salmonella_phage	67.6	2.9e-44
AUT26178.1|533041_533566_+	hypothetical protein	NA	Q8W625	Enterobacteria_phage	97.7	6.6e-94
AUT26179.1|533562_534126_+	hypothetical protein	NA	Q8W624	Enterobacteria_phage	98.9	1.4e-105
AUT26180.1|534135_534297_+	DUF2635 domain-containing protein	NA	Q8SBH3	Shigella_phage	76.6	4.1e-15
AUT26181.1|534293_535790_+|tail	phage tail protein	tail	Q8W623	Enterobacteria_phage	99.2	1.8e-277
AUT26182.1|535789_536146_+|tail	phage tail protein	tail	Q8W622	Enterobacteria_phage	99.2	5.3e-63
AUT26183.1|536145_536475_+|tail	phage tail assembly protein	tail	Q8W621	Enterobacteria_phage	99.1	3.9e-52
AUT26184.1|538489_539881_+	DNA circularization protein	NA	Q8W619	Enterobacteria_phage	96.8	5.5e-249
AUT26185.1|540931_541465_+|plate	phage baseplate assembly protein V	plate	Q8W617	Enterobacteria_phage	96.6	4.3e-93
AUT26186.1|541470_541884_+	hypothetical protein	NA	Q8W616	Enterobacteria_phage	96.4	2.1e-71
AUT26187.1|541876_542959_+|plate	phage baseplate protein	plate	Q8W615	Enterobacteria_phage	98.6	4.5e-206
AUT26188.1|542958_543549_+	DUF2313 domain-containing protein	NA	Q8W614	Enterobacteria_phage	98.5	4.9e-114
AUT26189.1|543535_543775_+|tail	phage tail protein	tail	Q8W613	Enterobacteria_phage	98.7	5.5e-40
AUT29830.1|543898_544744_+|tail	phage tail protein	tail	A0A0U2SAV1	Escherichia_phage	59.5	5.8e-84
AUT26190.1|544745_545273_+|tail	tail fiber assembly protein	tail	A0A0C4UR05	Shigella_phage	92.0	7.8e-87
AUT29831.1|545343_546972_-	hypothetical protein	NA	NA	NA	NA	NA
AUT26191.1|548361_548610_-	damage-inducible protein DinI	NA	K7PLW4	Enterobacteria_phage	100.0	1.8e-38
AUT26192.1|548954_549521_-	hydrolase	NA	NA	NA	NA	NA
AUT26193.1|549566_549758_-	hypothetical protein	NA	NA	NA	NA	NA
AUT26194.1|549831_551604_+|tRNA	aspartate--tRNA ligase	tRNA	NA	NA	NA	NA
AUT29832.1|551721_552174_+	dihydroneopterin triphosphate diphosphatase	NA	NA	NA	NA	NA
AUT26195.1|552281_553022_+	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
AUT26196.1|553056_553578_+	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	35.1	2.0e-10
AUT26197.1|553579_554182_-	hypothetical protein	NA	NA	NA	NA	NA
AUT26198.1|554308_554494_-	hypothetical protein	NA	NA	NA	NA	NA
AUT26199.1|554455_555067_+	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
AUT26200.1|555075_556086_+	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	25.2	1.6e-08
AUT26201.1|556173_556704_-	disulfide bond formation protein DsbB	NA	NA	NA	NA	NA
AUT26202.1|556849_558391_-	Na+/H+ antiporter NhaB	NA	NA	NA	NA	NA
AUT26203.1|558612_559332_+	fatty acid metabolism transcriptional regulator FadR	NA	NA	NA	NA	NA
AUT26204.1|559475_561008_-	SpoVR family protein	NA	NA	NA	NA	NA
AUT26205.1|561337_562636_+	D-amino acid dehydrogenase small subunit	NA	NA	NA	NA	NA
AUT26206.1|562645_563716_+	alanine racemase	NA	NA	NA	NA	NA
AUT26207.1|563770_565513_-	potassium/proton antiporter	NA	NA	NA	NA	NA
AUT26208.1|565608_566523_-	muramoyltetrapeptide carboxypeptidase	NA	NA	NA	NA	NA
AUT26209.1|566622_567234_+	murein transglycosylase	NA	NA	NA	NA	NA
AUT26210.1|568156_569485_-|transposase	IS4-like element IS4 family transposase	transposase	NA	NA	NA	NA
AUT26211.1|569946_570294_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZDM8	Stx2-converting_phage	75.7	1.7e-45
AUT26212.1|570313_571885_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	1.3e-169
AUT26213.1|571887_572037_+	transcription elongation factor GreA	NA	NA	NA	NA	NA
AUT26214.1|572020_574042_+	lytic transglycosylase domain-containing protein	NA	A0A0M4REK7	Salmonella_phage	68.8	7.2e-48
AUT26215.1|574038_574749_+	hypothetical protein	NA	A0A077KGW3	Edwardsiella_phage	32.1	5.3e-22
AUT26216.1|574748_575051_+	hypothetical protein	NA	A0A077K9U4	Edwardsiella_phage	48.0	1.6e-23
AUT26217.1|575047_575917_+	hypothetical protein	NA	NA	NA	NA	NA
AUT26218.1|575897_576575_+	oxidoreductase	NA	A0A077KAY0	Edwardsiella_phage	35.0	1.1e-29
AUT26219.1|576587_576944_+	hypothetical protein	NA	A0A077KCA1	Edwardsiella_phage	48.1	1.6e-19
AUT26220.1|576940_578182_+	hypothetical protein	NA	A0A077KGW9	Edwardsiella_phage	50.1	3.1e-102
AUT26221.1|578183_578789_+	DUF2612 domain-containing protein	NA	H9C0Y0	Aeromonas_phage	44.3	7.0e-31
AUT26222.1|578775_580161_+|tail	phage tail protein	tail	A0A0U2SAV1	Escherichia_phage	58.3	9.2e-87
AUT26223.1|580162_580690_+|tail	tail fiber assembly protein	tail	A0A0C4UR05	Shigella_phage	92.0	7.8e-87
AUT26224.1|580760_582584_-	E3 ubiquitin--protein ligase	NA	NA	NA	NA	NA
AUT26225.1|583056_583734_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
AUT26226.1|583733_584081_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
AUT26227.1|584100_585672_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
AUT26228.1|586361_587018_+	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	51.4	1.8e-56
>prophage 4
CP025979	Escherichia marmotae strain HT073016 chromosome, complete genome	4671322	795974	884907	4671322	integrase,terminase,tail,holin,transposase,protease	Enterobacteria_phage(39.58%)	96	809498:809557	858905:860220
AUT26435.1|795974_796796_-|protease	serine protease	protease	NA	NA	NA	NA
AUT26436.1|796895_796979_-	hypothetical protein	NA	NA	NA	NA	NA
AUT29841.1|797071_797404_-	acid shock protein	NA	NA	NA	NA	NA
AUT26437.1|799159_800050_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUT26438.1|800187_801408_+	ROK family protein	NA	NA	NA	NA	NA
AUT26439.1|801533_802229_+	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
AUT29842.1|802181_803474_-	voltage-gated ClC-type chloride channel ClcB	NA	NA	NA	NA	NA
AUT26440.1|803631_804246_-	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	36.3	2.5e-28
AUT26441.1|804288_805143_-	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
AUT26442.1|805144_805762_-	dimethylsulfoxide reductase, chain B	NA	A0A077SL61	Escherichia_phage	58.6	8.0e-75
AUT26443.1|808397_808706_-	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
AUT29843.1|808812_809511_+	YnfC family lipoprotein	NA	NA	NA	NA	NA
809498:809557	attL	GAGCCTGTACATAGATTTGTGTAATTGCCTGATTTTGATATGTTCAATCCAGCATCAAAT	NA	NA	NA	NA
AUT26444.1|809569_810778_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	45.2	1.6e-47
AUT26445.1|810840_811401_-	spermidine acetyltransferase	NA	NA	NA	NA	NA
AUT26446.1|811435_811777_-	hypothetical protein	NA	NA	NA	NA	NA
AUT26447.1|811911_812238_+	YnfA family protein	NA	A0A218MNG8	uncultured_virus	54.5	1.3e-23
AUT26448.1|812453_813668_+	D-galactonate dehydratase family protein	NA	Q6A202	Oenococcus_phage	28.6	2.4e-46
AUT26449.1|813679_814699_+	Zn-dependent oxidoreductase	NA	NA	NA	NA	NA
AUT26450.1|814756_814867_+	transporter	NA	NA	NA	NA	NA
AUT26451.1|814886_816182_-|integrase	site-specific integrase	integrase	B6DZ48	Enterobacteria_phage	62.6	2.3e-156
AUT26452.1|816201_816453_-	DNA-binding protein	NA	S4TND0	Salmonella_phage	50.0	2.2e-15
AUT26453.1|816525_818997_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.7	8.5e-59
AUT26454.1|819090_819282_-	DUF1482 domain-containing protein	NA	NA	NA	NA	NA
AUT26455.1|819278_819467_-	division inhibition protein DicB	NA	NA	NA	NA	NA
AUT26456.1|819969_820170_+	hypothetical protein	NA	NA	NA	NA	NA
AUT26457.1|820514_820667_-	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	53.2	6.6e-07
AUT26458.1|820833_821241_-	transcriptional regulator	NA	K7PM82	Enterobacteria_phage	54.7	4.4e-13
AUT26459.1|821324_821555_+	division inhibition gene dicB repressor	NA	NA	NA	NA	NA
AUT26460.1|821538_822060_+	hypothetical protein	NA	NA	NA	NA	NA
AUT26461.1|821986_823006_+	hypothetical protein	NA	U5P0A0	Shigella_phage	60.2	2.4e-55
AUT26462.1|823046_823469_+	DUF977 domain-containing protein	NA	A0A0U2QQN3	Escherichia_phage	92.8	2.3e-65
AUT26463.1|823465_823699_+	methyltransferase	NA	I6S1S6	Salmonella_phage	67.9	2.9e-17
AUT26464.1|823752_824418_+	hypothetical protein	NA	NA	NA	NA	NA
AUT26465.1|824973_825186_+	Hok/Gef family protein	NA	A0A0U2QV81	Escherichia_phage	97.1	1.7e-29
AUT26466.1|825402_825639_+	hypothetical protein	NA	NA	NA	NA	NA
AUT26467.1|825586_825727_-	copper resistance protein	NA	NA	NA	NA	NA
AUT26468.1|826013_827342_-|transposase	IS4-like element IS4 family transposase	transposase	NA	NA	NA	NA
AUT26469.1|827803_828151_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZDM8	Stx2-converting_phage	75.7	1.7e-45
AUT26470.1|828170_829742_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	1.3e-169
AUT26471.1|829865_830144_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	7.4e-12
AUT26472.1|830145_831195_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	57.9	2.5e-113
AUT26473.1|831208_831961_+	antitermination protein	NA	K7PGU5	Enterobacteria_phage	96.8	5.5e-134
AUT26474.1|833121_833307_-	hypothetical protein	NA	NA	NA	NA	NA
AUT26475.1|834076_834289_-	cold-shock protein CspF	NA	NA	NA	NA	NA
AUT26476.1|834589_834805_+	cold-shock protein CspB	NA	A0A1W6JNX5	Morganella_phage	76.5	2.6e-25
AUT26477.1|835557_835773_+|holin	holin	holin	A5LH82	Enterobacteria_phage	90.1	7.9e-30
AUT26478.1|835777_836329_+	DUF1327 domain-containing protein	NA	Q08JA0	Stx2-converting_phage	51.7	1.3e-36
AUT26479.1|836276_836537_-	hypothetical protein	NA	NA	NA	NA	NA
AUT26480.1|836650_837184_+	lysozyme	NA	K7PLY1	Enterobacteria_phage	93.8	1.4e-96
AUT26481.1|837180_837678_+	DUF2514 domain-containing protein	NA	NA	NA	NA	NA
AUT26482.1|838041_838254_+	cold-shock protein CspI	NA	A0A1W6JNX5	Morganella_phage	74.3	1.2e-22
AUT29844.1|838264_838453_+	cold-shock protein	NA	NA	NA	NA	NA
AUT29845.1|838600_838756_+	hypothetical protein	NA	NA	NA	NA	NA
AUT26483.1|839396_839603_+	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	79.4	3.4e-22
AUT26484.1|840153_840693_+	DUF1441 domain-containing protein	NA	A5LH26	Enterobacteria_phage	100.0	1.8e-94
AUT26485.1|840701_842801_+|terminase	phage terminase large subunit family protein	terminase	A5LH27	Enterobacteria_phage	96.4	0.0e+00
AUT26486.1|842797_843010_+	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
AUT26487.1|843382_845506_+	peptidase S14	NA	A5LH30	Enterobacteria_phage	99.4	0.0e+00
AUT26488.1|845547_845916_+	DUF2190 domain-containing protein	NA	A0A291AWX2	Escherichia_phage	100.0	9.7e-52
AUT26489.1|845908_846184_+	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	98.9	1.5e-44
AUT26490.1|846195_846774_+|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	98.4	5.2e-100
AUT29847.1|846770_847172_+|tail	phage tail protein	tail	A5LH34	Enterobacteria_phage	99.2	1.9e-72
AUT26491.1|847182_847926_+|tail	phage tail protein	tail	A0A291AWU6	Escherichia_phage	97.6	6.2e-130
AUT29846.1|847986_848373_+|tail	phage minor tail protein G	tail	A0A291AWW5	Escherichia_phage	96.1	4.9e-62
AUT26492.1|848381_848711_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
AUT26493.1|848682_851748_+|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	99.1	0.0e+00
AUT26494.1|851747_852077_+|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	100.0	1.7e-60
AUT26495.1|852086_852785_+|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	99.1	4.3e-133
AUT26496.1|852790_853534_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.3	1.6e-146
AUT26497.1|853431_854079_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	96.7	1.2e-110
AUT26498.1|854139_857553_+	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	97.0	0.0e+00
AUT26499.1|857683_858892_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	45.2	1.6e-47
AUT26500.1|859085_861062_-	alkyl/aryl-sulfatase	NA	A0A2P0VMX1	Tetraselmis_virus	44.3	1.5e-159
858905:860220	attR	ATTTGATGCTGGATTGAACATATCAAAATCAGGCAATTACACAAATCTATGTACAGGCTCACATTCCACGAATAACCATATCCTGTCGTTTTTTCCACGAATAATGAGAGTGTTTTCTTTTATCAAAAATCATTTCTTATAACCAGAAAAGGGCAGGAAGCCTGCCCAATTTATGCTGAACTTATGGCGTCACAATATTGAACCAGAATTCAAAATTATCCATATAGCCTAACATTTCGTTGAGTTTCTCTGCATTGCCACTGATTTTGACTTCGCCTTTATCTATCGCTTCTTTCAATGTCTCTTCCTTCAGAACGATTTTATTCAAGACATCGCGGGAGAGAGTGATTGTCGCGTCAGCATCAGATGCTTGCGTACCTGCAGTGTGATTGAGCACACCATTTTCAAGCTCTACTTTATAAGTGCCGCCATCTTCACCGAAATCAAAATTCAATACAGTTTTAGCGTCTGCTGCTTTCTCGCCATTAATGTGCACCGCAAGATAATCAAAGAACATTTCCGGCGTCATTGCGCGTACAGTGTCAGGGCTGGCAGTATTTGGCGTTGGCAGTTTTTGCACGCTGTTACGTAATTCCTGTGCGCCAGTAAGATAGAAATTACGCCACGGCCCGGATTCTGCCTGGTAGCCTAACTGTTCAAGCGCATCGGCTTCCAGATTTCTCGCAGCCTGGTTATTTGGATCGGCAAATACCACCTTGCTGACAACCTGGGCAACCCAGCGGAAATTACCCTGGTCATAATCCTGTTTGGCTTTTTGTAAAATGGCATCAGCACCGCCCATATATTCGACAAATTTCTTCGCAGCGTCTTCTGGCGGCAATTCATCAAGCGTTGCCGGGTTACCATCAAACCAACCGAGATAAAGCACATAAGTTGCTTTCACATCATGACTCACCGAACCGTAATACCCGCGATTCGCCCAGGTGTTAGCAAGCGAGGAGGGTAATTTAAAGTTTGCGGCGATCTCATCGCGGGTCTGCCCCTGATTCGCCATGCGCAGCGTTTGATCGTTGATGTAACGATACAAATCGCGTTGGGTTTTTAGCAGTTTAACGACGTTGTCATTGCCCCAGGTTGGCCAGTGATGCTGAGCGAGAATTATCTCCGCTTTATCACCCCACAAATTGAGTGCCTCGTTGATGTATTTGGACCAGGGAAGAGGTTGACGAATTTTGGCACCACGCAGTGAATAGGTGTTGTGGAGGGTGTGCGTGACATCTTCTGCAGTTTCGATCAGTTTCTTTTCTTCGATAAACCACAACATTTCAGAAGGTGCTTCGGAACCGGGCGCCATC	NA	NA	NA	NA
AUT26501.1|861384_861612_+	4-oxalocrotonate tautomerase	NA	NA	NA	NA	NA
AUT26502.1|861616_862186_-	flavin reductase family protein	NA	NA	NA	NA	NA
AUT26503.1|862360_863206_+	N-hydroxyarylamine O-acetyltransferase	NA	NA	NA	NA	NA
AUT26504.1|863349_864243_-	PhzF family protein	NA	NA	NA	NA	NA
AUT26505.1|864323_865004_-	respiratory nitrate reductase subunit gamma	NA	NA	NA	NA	NA
AUT26506.1|865000_865696_-	nitrate reductase molybdenum cofactor assembly chaperone	NA	NA	NA	NA	NA
AUT26507.1|865695_867240_-	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	39.2	6.4e-20
AUT26508.1|867236_870977_-	nitrate reductase subunit alpha	NA	NA	NA	NA	NA
AUT26509.1|871120_872509_-	NarK family nitrate/nitrite MFS transporter	NA	NA	NA	NA	NA
AUT26510.1|872789_873671_-	drug/metabolite DMT transporter permease	NA	NA	NA	NA	NA
AUT26511.1|873902_874490_+	sulfate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUT26512.1|874538_876950_+	formate dehydrogenase-N subunit alpha	NA	NA	NA	NA	NA
AUT26513.1|876962_877847_+	formate dehydrogenase subunit beta	NA	NA	NA	NA	NA
AUT26514.1|877839_878493_+	formate dehydrogenase cytochrome b556 subunit	NA	NA	NA	NA	NA
AUT26515.1|878720_879005_-	transcriptional regulator	NA	A0A2L1IV52	Escherichia_phage	51.1	1.2e-20
AUT26516.1|879004_879283_-	Killer protein	NA	A0A2L1IV28	Escherichia_phage	60.9	1.6e-27
AUT26517.1|879366_879549_+	hypothetical protein	NA	NA	NA	NA	NA
AUT26518.1|879468_880479_-	alcohol dehydrogenase AdhP	NA	A0A2K9L339	Tupanvirus	25.3	7.3e-25
AUT26519.1|880612_882310_-	NAD-dependent malic enzyme	NA	NA	NA	NA	NA
AUT26520.1|882465_882603_-	stationary-phase-induced ribosome-associated protein	NA	NA	NA	NA	NA
AUT26521.1|882693_882909_-	biofilm-dependent modulation protein	NA	NA	NA	NA	NA
AUT26522.1|883231_883663_+	OsmC family peroxiredoxin	NA	NA	NA	NA	NA
AUT26523.1|883983_884907_+|protease	protease	protease	NA	NA	NA	NA
>prophage 5
CP025979	Escherichia marmotae strain HT073016 chromosome, complete genome	4671322	934492	948387	4671322	tail,transposase	Enterobacteria_phage(33.33%)	12	NA	NA
AUT26552.1|934492_934726_+	hypothetical protein	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
AUT26553.1|935042_935633_+	DNA invertase	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	1.6e-24
AUT26554.1|935730_936306_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	95.3	6.5e-103
AUT26555.1|936305_939377_-|tail	phage tail protein	tail	U5N099	Enterobacteria_phage	82.1	1.9e-68
AUT26556.1|939441_940041_-	Ail/Lom family protein	NA	A0A291AWV3	Escherichia_phage	98.0	2.8e-109
AUT26557.1|940100_941429_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
AUT26558.1|941546_942755_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	45.2	1.6e-47
AUT26559.1|942793_943828_+	GGDEF domain-containing protein	NA	G3MA91	Bacillus_virus	31.7	2.8e-11
AUT26560.1|944231_944372_-	copper resistance protein	NA	NA	NA	NA	NA
AUT26561.1|944729_946058_+|transposase	IS4-like element IS4 family transposase	transposase	NA	NA	NA	NA
AUT26562.1|946448_946796_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZDM8	Stx2-converting_phage	75.7	1.7e-45
AUT26563.1|946815_948387_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	1.3e-169
>prophage 6
CP025979	Escherichia marmotae strain HT073016 chromosome, complete genome	4671322	1167561	1222990	4671322	integrase,transposase	Stx2-converting_phage(26.67%)	59	1176293:1176308	1224941:1224956
AUT26748.1|1167561_1169133_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	1.3e-169
AUT26749.1|1169152_1169500_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZDM8	Stx2-converting_phage	75.7	1.7e-45
AUT26750.1|1169890_1171219_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
AUT26751.1|1171484_1172033_+	DUF2441 domain-containing protein	NA	NA	NA	NA	NA
AUT26752.1|1172022_1172223_-	hypothetical protein	NA	NA	NA	NA	NA
AUT26753.1|1172254_1172440_+	hypothetical protein	NA	NA	NA	NA	NA
AUT26754.1|1173213_1173768_-	DUF1133 domain-containing protein	NA	A0A0U2S606	Escherichia_phage	71.6	2.0e-72
AUT26755.1|1173764_1174055_-	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	87.5	6.3e-46
AUT26756.1|1174054_1174654_-	DUF1367 domain-containing protein	NA	A0A0U2RT94	Escherichia_phage	92.0	2.9e-106
AUT26757.1|1175468_1175807_+	DUF1971 domain-containing protein	NA	NA	NA	NA	NA
AUT29862.1|1176025_1176241_-	hypothetical protein	NA	NA	NA	NA	NA
1176293:1176308	attL	CCGCTTTGAGCGAAAA	NA	NA	NA	NA
AUT26758.1|1176396_1177134_-	hypothetical protein	NA	NA	NA	NA	NA
AUT26759.1|1177218_1178369_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	42.8	9.5e-53
AUT26760.1|1178404_1179205_+|integrase	integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	49.6	7.5e-65
AUT26761.1|1179597_1179939_-	DUF2511 domain-containing protein	NA	NA	NA	NA	NA
AUT26762.1|1179951_1180824_-	hypothetical protein	NA	NA	NA	NA	NA
AUT26763.1|1180827_1181202_-	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
AUT26764.1|1181340_1181571_+	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	61.8	1.3e-14
AUT26765.1|1181671_1182328_+	carbon-nitrogen hydrolase family protein	NA	NA	NA	NA	NA
AUT26766.1|1182352_1183015_+	exodeoxyribonuclease X	NA	Q6UAU3	Klebsiella_phage	40.4	3.5e-07
AUT26767.1|1183011_1185072_-	oligopeptidase B	NA	NA	NA	NA	NA
AUT26768.1|1185280_1185940_-	DUF533 domain-containing protein	NA	NA	NA	NA	NA
AUT26769.1|1186246_1186603_-	hypothetical protein	NA	NA	NA	NA	NA
AUT26770.1|1186669_1186960_-	damage-inducible protein YebG	NA	NA	NA	NA	NA
AUT26771.1|1187101_1188280_+	formate-dependent phosphoribosylglycinamide formyltransferase	NA	NA	NA	NA	NA
AUT26772.1|1188335_1188977_-	keto-deoxy-phosphogluconate aldolase	NA	NA	NA	NA	NA
AUT26773.1|1189014_1190826_-	phosphogluconate dehydratase	NA	NA	NA	NA	NA
AUT26774.1|1191060_1192536_-	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	37.3	9.9e-79
AUT26775.1|1192551_1192851_-	hypothetical protein	NA	NA	NA	NA	NA
AUT26776.1|1192873_1193743_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
AUT26777.1|1193869_1195312_+	pyruvate kinase	NA	NA	NA	NA	NA
AUT26778.1|1195541_1196870_+|transposase	IS4-like element IS4 family transposase	transposase	NA	NA	NA	NA
AUT26779.1|1196903_1197875_-	lauroyl-Kdo(2)-lipid IV(A) myristoyltransferase	NA	NA	NA	NA	NA
AUT26780.1|1197993_1199316_-	murein DD-endopeptidase MepM	NA	A8ATH6	Listeria_phage	40.9	1.2e-14
AUT29863.1|1199331_1200264_-	zinc ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUT26781.1|1200342_1201098_+	zinc ABC transporter ATP-binding protein ZnuC	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	31.4	6.1e-16
AUT26782.1|1201094_1201880_+	zinc ABC transporter permease	NA	NA	NA	NA	NA
AUT26783.1|1202717_1203179_-	YcgN family cysteine cluster protein	NA	NA	NA	NA	NA
AUT26784.1|1203255_1203915_-	isomerase/hydrolase	NA	NA	NA	NA	NA
AUT26785.1|1203986_1204280_-	hypothetical protein	NA	NA	NA	NA	NA
AUT26786.1|1204408_1205104_+	septum site-determining protein MinC	NA	NA	NA	NA	NA
AUT26787.1|1205127_1205940_+	septum site-determining protein MinD	NA	NA	NA	NA	NA
AUT26788.1|1205943_1206210_+	cell division topological specificity factor	NA	NA	NA	NA	NA
AUT26789.1|1206660_1207005_+	glycine zipper family protein	NA	NA	NA	NA	NA
AUT26790.1|1207014_1207344_+	hypothetical protein	NA	NA	NA	NA	NA
AUT26791.1|1207651_1207870_-	hypothetical protein	NA	NA	NA	NA	NA
AUT26792.1|1208040_1209564_-	cyclic diguanylate phosphodiesterase	NA	NA	NA	NA	NA
AUT29864.1|1210374_1210704_+	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
AUT26793.1|1210978_1211695_+	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
AUT26794.1|1211807_1212134_-	EthD family reductase	NA	NA	NA	NA	NA
AUT26795.1|1212360_1213272_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUT26796.1|1213272_1214382_-	alkene reductase	NA	NA	NA	NA	NA
AUT26797.1|1216080_1216296_-	cold-shock protein CspB	NA	A0A1W6JNX5	Morganella_phage	75.0	5.9e-25
AUT26798.1|1218015_1218567_-	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
AUT26799.1|1218928_1219972_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
AUT26800.1|1220032_1220305_-	QacE family quaternary ammonium compound efflux SMR transporter	NA	NA	NA	NA	NA
AUT26801.1|1220304_1220397_-	copper resistance protein	NA	NA	NA	NA	NA
AUT26802.1|1221051_1221399_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZDM8	Stx2-converting_phage	75.7	1.7e-45
AUT26803.1|1221418_1222990_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	1.3e-169
1224941:1224956	attR	CCGCTTTGAGCGAAAA	NA	NA	NA	NA
>prophage 7
CP025979	Escherichia marmotae strain HT073016 chromosome, complete genome	4671322	1501548	1511499	4671322	protease	Vibrio_phage(33.33%)	6	NA	NA
AUT27034.1|1501548_1504782_-	type I-F CRISPR-associated helicase Cas3	NA	A0A2I7RCU8	Vibrio_phage	29.1	3.0e-64
AUT27035.1|1504778_1505762_-	type I-F CRISPR-associated endonuclease Cas1	NA	A0A2D0YFC9	Vibrio_phage	34.9	4.4e-43
AUT27036.1|1506305_1508582_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.7	1.5e-166
AUT27037.1|1508612_1508933_-|protease	ATP-dependent Clp protease adaptor ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.6	9.1e-14
AUT27038.1|1509255_1509480_+	cold-shock protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	2.3e-16
AUT27039.1|1509552_1511499_-	MacB family efflux pump subunit	NA	G9BWD6	Planktothrix_phage	38.3	5.5e-37
>prophage 8
CP025979	Escherichia marmotae strain HT073016 chromosome, complete genome	4671322	1680953	1755041	4671322	tail,transposase,plate,head,protease	Escherichia_phage(54.39%)	88	NA	NA
AUT27190.1|1680953_1681478_-	DNA-binding protein	NA	A0A0C4UQZ2	Shigella_phage	89.7	5.2e-83
AUT27191.1|1681663_1681885_+	transcriptional regulator	NA	A0A0C4UQU0	Shigella_phage	98.6	1.4e-34
AUT29886.1|1682069_1682258_+|transposase	transposase	transposase	C9DGL1	Escherichia_phage	96.8	2.9e-28
AUT27192.1|1682261_1683839_+|transposase	transposase	transposase	C9DGL1	Escherichia_phage	96.5	7.3e-306
AUT27193.1|1683877_1684816_+	DNA transposition protein	NA	A0A0C4UQR3	Shigella_phage	97.4	1.9e-168
AUT27194.1|1684831_1685059_+	hypothetical protein	NA	A0A0C4UQY4	Shigella_phage	100.0	7.1e-37
AUT27195.1|1685061_1685292_+	hypothetical protein	NA	C9DGL4	Escherichia_phage	97.3	6.5e-38
AUT27196.1|1685303_1685573_+	hypothetical protein	NA	C9DGL5	Escherichia_phage	31.5	8.5e-05
AUT27197.1|1685593_1686013_+	hypothetical protein	NA	C9DGL6	Escherichia_phage	100.0	1.5e-77
AUT27198.1|1686013_1686313_+	hypothetical protein	NA	C9DGL7	Escherichia_phage	98.0	3.7e-49
AUT27199.1|1686332_1686857_+	host-nuclease inhibitor protein Gam	NA	C9DGL8	Escherichia_phage	100.0	1.5e-90
AUT27200.1|1686955_1687486_+	hypothetical protein	NA	A0A0C4UQU2	Shigella_phage	95.5	9.2e-96
AUT27201.1|1687485_1688016_+	hypothetical protein	NA	C9DGM0	Escherichia_phage	95.5	1.6e-95
AUT27202.1|1688002_1688185_+	hypothetical protein	NA	A0A0C4UR26	Shigella_phage	100.0	2.9e-25
AUT27203.1|1688186_1688498_+	hypothetical protein	NA	A0A0C4UQR5	Shigella_phage	87.0	6.9e-43
AUT27204.1|1688459_1688876_-	DUF2513 domain-containing protein	NA	NA	NA	NA	NA
AUT27205.1|1688906_1689458_+	regulatory protein GemA	NA	A0A0C4UQU3	Shigella_phage	97.8	4.2e-99
AUT27206.1|1689454_1689844_+	transcriptional regulator	NA	A0A0C4UR27	Shigella_phage	99.2	7.8e-68
AUT27207.1|1689921_1690140_+	hypothetical protein	NA	C9DGM5	Escherichia_phage	100.0	5.6e-39
AUT27208.1|1690132_1690495_+	hypothetical protein	NA	C9DGM6	Escherichia_phage	99.2	4.1e-63
AUT27209.1|1690636_1691059_+	positive regulator of late transcription	NA	A0A0C4UQZ9	Shigella_phage	99.3	1.1e-75
AUT27210.1|1691153_1691669_+	lysozyme	NA	C9DGM9	Escherichia_phage	100.0	6.4e-94
AUT27211.1|1691652_1692039_+	DUF2570 domain-containing protein	NA	A0A0C4UR28	Shigella_phage	98.4	1.3e-62
AUT27212.1|1691935_1692241_+	peptidase	NA	NA	NA	NA	NA
AUT27213.1|1692197_1692392_+	hypothetical protein	NA	C9DGN1	Escherichia_phage	100.0	6.2e-34
AUT27214.1|1692391_1692691_+	DUF2730 domain-containing protein	NA	C9DGN2	Escherichia_phage	100.0	5.8e-47
AUT27215.1|1692687_1692978_+	hypothetical protein	NA	A0A0C4UR00	Shigella_phage	100.0	7.4e-47
AUT27216.1|1692989_1693565_+	DUF3486 domain-containing protein	NA	A0A0C4UQU5	Shigella_phage	100.0	9.1e-97
AUT27217.1|1693572_1695228_+	hypothetical protein	NA	C9DGN5	Escherichia_phage	99.5	0.0e+00
AUT27218.1|1695227_1696766_+	DUF935 domain-containing protein	NA	A0A0C4UQR8	Shigella_phage	100.0	4.9e-299
AUT27219.1|1696746_1698066_+|head	phage head morphogenesis protein	head	C9DGN7	Escherichia_phage	95.9	8.1e-242
AUT27220.1|1698062_1698533_+	phage virion morphogenesis protein	NA	C9DGN8	Escherichia_phage	100.0	1.3e-85
AUT27221.1|1698729_1699815_+|protease	protease	protease	C9DGP0	Escherichia_phage	98.1	8.8e-194
AUT27222.1|1699811_1700729_+|head	head protein	head	C9DGP2	Escherichia_phage	99.7	2.3e-179
AUT27223.1|1700795_1701206_+	hypothetical protein	NA	C9DGP3	Escherichia_phage	98.5	6.1e-63
AUT27224.1|1701202_1701628_+	DUF1320 domain-containing protein	NA	C9DGP4	Escherichia_phage	100.0	4.2e-75
AUT27225.1|1701627_1702176_+	DUF1834 domain-containing protein	NA	C9DGP5	Escherichia_phage	99.5	2.5e-104
AUT29887.1|1702162_1702366_+	DUF2635 domain-containing protein	NA	C9DGP6	Escherichia_phage	97.0	3.1e-28
AUT27226.1|1702362_1703850_+|tail	phage tail protein	tail	C9DGP7	Escherichia_phage	99.6	1.3e-280
AUT27227.1|1703859_1704216_+|tail	phage tail protein	tail	C9DGP8	Escherichia_phage	100.0	2.4e-63
AUT27228.1|1704225_1704660_+	hypothetical protein	NA	C9DGP9	Escherichia_phage	97.2	8.4e-71
AUT27229.1|1704804_1706877_+	tape measure domain-containing protein	NA	C9DGQ1	Escherichia_phage	96.4	3.8e-312
AUT27230.1|1706881_1708369_+	multidrug DMT transporter permease	NA	A0A0C4UR32	Shigella_phage	99.6	2.2e-243
AUT27231.1|1708361_1709501_+|plate	baseplate protein	plate	C9DGQ3	Escherichia_phage	98.4	3.8e-211
AUT27232.1|1709488_1710082_+|plate	phage baseplate assembly protein V	plate	A0A0C4UQZ3	Shigella_phage	98.0	6.5e-106
AUT27233.1|1710078_1710516_+	hypothetical protein	NA	A0A0C4UR04	Shigella_phage	100.0	1.0e-79
AUT27234.1|1710516_1711599_+	hypothetical protein	NA	C9DGQ6	Escherichia_phage	99.7	4.1e-207
AUT27235.1|1711589_1712132_+	DUF2313 domain-containing protein	NA	C9DGQ7	Escherichia_phage	100.0	1.3e-100
AUT27236.1|1712131_1713658_+|tail	phage tail protein	tail	C9DGQ8	Escherichia_phage	90.4	3.7e-262
AUT27237.1|1713659_1714193_+|tail	tail fiber assembly protein	tail	A0A0C4UR05	Shigella_phage	93.6	5.5e-88
AUT27238.1|1714251_1715460_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	45.2	1.6e-47
AUT27239.1|1715537_1716071_-|tail	tail fiber assembly protein	tail	A0A077SL44	Escherichia_phage	100.0	1.4e-96
AUT27240.1|1717092_1717686_+	DNA-invertase	NA	A0A0C4UR34	Shigella_phage	100.0	2.6e-107
AUT29888.1|1717768_1717957_+	Com family DNA-binding transcriptional regulator	NA	A0A0C4UQS3	Shigella_phage	100.0	1.3e-31
AUT27241.1|1717907_1718603_+	protein mom	NA	A0A0C4UQZ7	Shigella_phage	98.3	3.1e-131
AUT27242.1|1718584_1719163_-	hypothetical protein	NA	NA	NA	NA	NA
AUT27243.1|1719286_1720225_-	formimidoylglutamase	NA	NA	NA	NA	NA
AUT27244.1|1720224_1721436_-	imidazolonepropionase	NA	NA	NA	NA	NA
AUT27245.1|1721432_1722023_-	hypothetical protein	NA	NA	NA	NA	NA
AUT27246.1|1722024_1723434_-	cytosine permease	NA	NA	NA	NA	NA
AUT27247.1|1723598_1725296_-	urocanate hydratase	NA	NA	NA	NA	NA
AUT27248.1|1726080_1726950_-	succinate--CoA ligase subunit alpha	NA	NA	NA	NA	NA
AUT27249.1|1726949_1728116_-	succinyl-CoA ligase subunit beta	NA	NA	NA	NA	NA
AUT27250.1|1728594_1728903_-	hypothetical protein	NA	NA	NA	NA	NA
AUT27251.1|1728865_1729084_-	hypothetical protein	NA	NA	NA	NA	NA
AUT27252.1|1729152_1730370_-	dihydrolipoyllysine-residue succinyltransferase	NA	NA	NA	NA	NA
AUT27253.1|1730384_1733186_-	2-oxoglutarate dehydrogenase E1 component	NA	NA	NA	NA	NA
AUT27254.1|1733574_1734291_-	succinate dehydrogenase iron-sulfur subunit	NA	NA	NA	NA	NA
AUT27255.1|1734306_1736073_-	succinate dehydrogenase flavoprotein subunit	NA	NA	NA	NA	NA
AUT27256.1|1736072_1736420_-	succinate dehydrogenase, hydrophobic membrane anchor protein	NA	NA	NA	NA	NA
AUT29889.1|1736413_1736803_-	succinate dehydrogenase cytochrome b556 large subunit	NA	NA	NA	NA	NA
AUT27257.1|1736835_1737102_+	hypothetical protein	NA	NA	NA	NA	NA
AUT27258.1|1737338_1737524_-	hypothetical protein	NA	NA	NA	NA	NA
AUT27259.1|1737511_1738795_+	citrate (Si)-synthase	NA	NA	NA	NA	NA
AUT27260.1|1739184_1739751_+	type 1 fimbrial protein	NA	NA	NA	NA	NA
AUT27261.1|1742274_1743006_+	molecular chaperone	NA	NA	NA	NA	NA
AUT27262.1|1743002_1744064_+	hypothetical protein	NA	NA	NA	NA	NA
AUT27263.1|1744212_1745259_+	AbrB family transcriptional regulator	NA	NA	NA	NA	NA
AUT27264.1|1745255_1746047_-	endonuclease VIII	NA	A0A1V0CNR6	Kaumoebavirus	27.7	2.0e-09
AUT27265.1|1746082_1746817_-	LamB/YcsF family protein	NA	NA	NA	NA	NA
AUT27266.1|1746806_1747739_-	hypothetical protein	NA	NA	NA	NA	NA
AUT27267.1|1747732_1748389_-	hypothetical protein	NA	NA	NA	NA	NA
AUT27268.1|1748411_1749155_-	Nif3-like dinuclear metal center hexameric protein	NA	NA	NA	NA	NA
AUT27269.1|1749425_1750907_+	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	28.4	5.0e-46
AUT27270.1|1751082_1752501_-	deoxyribodipyrimidine photo-lyase	NA	A0A1V0SGL1	Hokovirus	32.6	5.0e-64
AUT27271.1|1752497_1753007_-	hypothetical protein	NA	NA	NA	NA	NA
AUT27272.1|1753165_1753405_-	hypothetical protein	NA	NA	NA	NA	NA
AUT27273.1|1753469_1755041_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	1.3e-169
>prophage 9
CP025979	Escherichia marmotae strain HT073016 chromosome, complete genome	4671322	1950192	2008213	4671322	protease,tRNA,transposase	Bacillus_phage(17.65%)	51	NA	NA
AUT27437.1|1950192_1950672_+|tRNA	Cys-tRNA(Pro) deacylase	tRNA	NA	NA	NA	NA
AUT27438.1|1952079_1953288_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	45.2	1.6e-47
AUT27439.1|1953448_1955140_+	E3 ubiquitin--protein ligase	NA	NA	NA	NA	NA
AUT27440.1|1955620_1956829_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	44.1	6.2e-47
AUT27441.1|1957159_1957342_-	hypothetical protein	NA	NA	NA	NA	NA
AUT27442.1|1957441_1958581_+	MFS transporter	NA	NA	NA	NA	NA
AUT27443.1|1958819_1960496_+	Kef family K(+) transporter	NA	NA	NA	NA	NA
AUT27444.1|1960616_1961921_-	inosine/guanosine kinase	NA	NA	NA	NA	NA
AUT27445.1|1962072_1963041_+	acetyl esterase	NA	A0A167RJ59	Powai_lake_megavirus	26.1	5.6e-14
AUT27446.1|1963015_1963978_-	ferrochelatase	NA	NA	NA	NA	NA
AUT27447.1|1964168_1964813_-	adenylate kinase	NA	NA	NA	NA	NA
AUT27448.1|1965032_1966907_-	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	37.8	2.3e-117
AUT27449.1|1967017_1967623_-	recombination protein RecR	NA	NA	NA	NA	NA
AUT27450.1|1967622_1967952_-	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
AUT27451.1|1968004_1969936_-	DNA polymerase III subunit gamma/tau	NA	A0A1L2BWV7	Bacteriophage	41.5	2.3e-43
AUT27452.1|1970054_1970606_-	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	47.3	3.7e-31
AUT27453.1|1970673_1970781_-	adenine phosphoribosyltransferase	NA	NA	NA	NA	NA
AUT27454.1|1970767_1971136_-	DUF454 domain-containing protein	NA	NA	NA	NA	NA
AUT27455.1|1971205_1971733_+	primosomal replication protein N''	NA	NA	NA	NA	NA
AUT27456.1|1971746_1971914_+	DUF2496 domain-containing protein	NA	NA	NA	NA	NA
AUT27457.1|1972117_1975480_-	mechanosensitive channel MscK	NA	NA	NA	NA	NA
AUT27458.1|1975601_1976255_-	DNA-binding transcriptional repressor AcrR	NA	NA	NA	NA	NA
AUT27459.1|1976396_1977590_+	MexE family multidrug efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
AUT27460.1|1977612_1980762_+	multidrug efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	23.7	2.1e-54
AUT27461.1|1981318_1981714_+	Hha toxicity attenuator	NA	NA	NA	NA	NA
AUT27462.1|1981718_1981937_+	hemolysin expression-modulating protein Hha	NA	NA	NA	NA	NA
AUT27463.1|1982108_1982660_+	maltose O-acetyltransferase	NA	NA	NA	NA	NA
AUT27464.1|1982774_1983245_+	hypothetical protein	NA	NA	NA	NA	NA
AUT29898.1|1983408_1984959_+	EAL domain-containing protein	NA	NA	NA	NA	NA
AUT27465.1|1984995_1985349_-	DUF1428 domain-containing protein	NA	NA	NA	NA	NA
AUT29899.1|1985650_1986040_+	6-O-methylguanine DNA methyltransferase	NA	NA	NA	NA	NA
AUT27466.1|1986070_1986643_-	hypothetical protein	NA	NA	NA	NA	NA
AUT27467.1|1986861_1987722_+	acyl-CoA thioesterase II	NA	NA	NA	NA	NA
AUT27468.1|1987903_1989190_-	ammonia channel	NA	NA	NA	NA	NA
AUT27469.1|1989219_1989558_-	nitrogen regulatory protein P-II 2	NA	NA	NA	NA	NA
AUT27470.1|1989738_1991520_-	multidrug ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.1	4.0e-42
AUT27471.1|1991512_1993285_-	multidrug ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	29.5	8.8e-50
AUT27472.1|1993314_1993773_-	transcriptional regulator	NA	NA	NA	NA	NA
AUT27473.1|1993925_1994744_-	HMP-PP phosphatase	NA	NA	NA	NA	NA
AUT27474.1|1996607_1997303_+	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	68.0	1.1e-88
AUT27475.1|1997397_1997796_-	long-chain acyl-CoA thioesterase FadM	NA	NA	NA	NA	NA
AUT27476.1|1997901_1998246_-	hypothetical protein	NA	NA	NA	NA	NA
AUT27477.1|1998312_1999884_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.5	4.9e-169
AUT27478.1|1999903_2000251_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZDM8	Stx2-converting_phage	75.7	1.7e-45
AUT27479.1|2000250_2000928_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
AUT27480.1|2000904_2001135_+	hypothetical protein	NA	NA	NA	NA	NA
AUT27481.1|2001103_2002975_-	peptidylprolyl isomerase	NA	NA	NA	NA	NA
AUT27482.1|2003166_2003439_-	DNA-binding protein HU-beta	NA	A7KV42	Bacillus_phage	58.4	1.1e-20
AUT27483.1|2003647_2006002_-|protease	Lon protease	protease	A0A0R6PGP8	Moraxella_phage	52.4	1.6e-224
AUT27484.1|2006189_2007464_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	56.6	3.9e-132
AUT27485.1|2007589_2008213_-|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	63.9	2.9e-64
>prophage 10
CP025979	Escherichia marmotae strain HT073016 chromosome, complete genome	4671322	2161154	2170294	4671322	transposase	Stx2-converting_phage(42.86%)	10	NA	NA
AUT27604.1|2161154_2162201_-	NAD(P)-dependent alcohol dehydrogenase	NA	A0A2K9L7I1	Tupanvirus	44.9	2.3e-82
AUT27605.1|2162363_2163248_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	42.5	1.1e-53
AUT27606.1|2163344_2164916_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
AUT27607.1|2164935_2165283_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZDM8	Stx2-converting_phage	75.7	1.7e-45
AUT27608.1|2165282_2165960_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
AUT27609.1|2166190_2167042_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	39.6	8.8e-48
AUT27610.1|2167068_2168058_+	aldo/keto reductase	NA	NA	NA	NA	NA
AUT27611.1|2168092_2168986_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUT27612.1|2169134_2169917_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
AUT29907.1|2170042_2170294_+	DUF1471 domain-containing protein	NA	A0A1B2IE60	Erwinia_phage	65.4	8.2e-10
>prophage 11
CP025979	Escherichia marmotae strain HT073016 chromosome, complete genome	4671322	2241165	2279968	4671322	plate,transposase	Stx2-converting_phage(50.0%)	30	NA	NA
AUT27685.1|2241165_2242374_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	45.2	1.6e-47
AUT27686.1|2246663_2248235_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	1.3e-169
AUT27687.1|2248254_2248602_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZDM8	Stx2-converting_phage	75.7	1.7e-45
AUT27688.1|2248601_2249279_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
AUT27689.1|2249240_2249366_+	copper resistance protein	NA	NA	NA	NA	NA
AUT27690.1|2249884_2250367_-	hypothetical protein	NA	NA	NA	NA	NA
AUT27691.1|2250633_2254362_-	type IV secretion protein Rhs	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	47.7	6.7e-15
AUT27692.1|2254600_2255050_-	DUF1795 domain-containing protein	NA	NA	NA	NA	NA
AUT27693.1|2255334_2255544_-	hypothetical protein	NA	NA	NA	NA	NA
AUT27694.1|2255530_2255722_-	hypothetical protein	NA	NA	NA	NA	NA
AUT27695.1|2255705_2257925_-	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
AUT27696.1|2257949_2258321_-	hypothetical protein	NA	NA	NA	NA	NA
AUT27697.1|2258317_2259052_-	hypothetical protein	NA	NA	NA	NA	NA
AUT27698.1|2259243_2260008_-	DUF2094 domain-containing protein	NA	NA	NA	NA	NA
AUT27699.1|2260007_2263874_-	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
AUT27700.1|2264169_2264844_-	hypothetical protein	NA	NA	NA	NA	NA
AUT27701.1|2264849_2266166_-	type VI secretion system protein TssL	NA	NA	NA	NA	NA
AUT27702.1|2266162_2267500_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
AUT27703.1|2267503_2268037_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
AUT27704.1|2268104_2268590_-	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
AUT27705.1|2268770_2269223_-	hypothetical protein	NA	NA	NA	NA	NA
AUT27706.1|2269235_2269643_-	hypothetical protein	NA	NA	NA	NA	NA
AUT27707.1|2269694_2271209_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
AUT27708.1|2271233_2271779_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
AUT27709.1|2271879_2274522_-	type VI secretion system ATPase TssH	NA	A0A2I7SAX5	Vibrio_phage	32.8	1.2e-79
AUT27710.1|2274854_2275766_+	type VI secretion system-associated protein TagK	NA	NA	NA	NA	NA
AUT27711.1|2275755_2276586_+	impE family protein	NA	NA	NA	NA	NA
AUT27712.1|2276582_2277077_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
AUT27713.1|2277092_2278976_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
AUT27714.1|2278972_2279968_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
>prophage 12
CP025979	Escherichia marmotae strain HT073016 chromosome, complete genome	4671322	2611586	2620328	4671322	integrase,transposase	Stx2-converting_phage(50.0%)	9	2610585:2610599	2615228:2615242
2610585:2610599	attL	ACTGGCGGTATAACG	NA	NA	NA	NA
AUT27993.1|2611586_2612189_-|integrase	integrase	integrase	A0A2L1IV36	Escherichia_phage	52.8	1.1e-55
AUT27994.1|2613172_2613289_-	hypothetical protein	NA	NA	NA	NA	NA
AUT27995.1|2613564_2614242_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
AUT27996.1|2614241_2614589_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZDM8	Stx2-converting_phage	75.7	1.7e-45
AUT27997.1|2614608_2616180_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	1.3e-169
2615228:2615242	attR	CGTTATACCGCCAGT	NA	NA	NA	NA
AUT27998.1|2616566_2616803_-	hypothetical protein	NA	NA	NA	NA	NA
AUT27999.1|2616711_2617095_-	hypothetical protein	NA	NA	NA	NA	NA
AUT28000.1|2617495_2618645_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	42.8	9.5e-53
AUT28001.1|2619119_2620328_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	50.0	2.4e-51
>prophage 13
CP025979	Escherichia marmotae strain HT073016 chromosome, complete genome	4671322	2697083	2722004	4671322	integrase,protease,transposase	Salmonella_phage(20.0%)	35	2702728:2702742	2729664:2729678
AUT28071.1|2697083_2697581_-|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	54.8	2.5e-26
AUT28072.1|2697586_2698225_-	stringent starvation protein A	NA	NA	NA	NA	NA
AUT28073.1|2698166_2698376_+	hypothetical protein	NA	NA	NA	NA	NA
AUT29930.1|2698327_2698549_-	hypothetical protein	NA	NA	NA	NA	NA
AUT28074.1|2698619_2699012_-	30S ribosomal protein S9	NA	NA	NA	NA	NA
AUT28075.1|2699027_2699456_-	50S ribosomal protein L13	NA	NA	NA	NA	NA
AUT28076.1|2699730_2700855_-	cell division protein ZapE	NA	NA	NA	NA	NA
AUT28077.1|2701048_2701447_+	hypothetical protein	NA	NA	NA	NA	NA
AUT28078.1|2701601_2702969_+|protease	serine endoprotease DegQ	protease	A0A1B1IT49	uncultured_Mediterranean_phage	25.6	3.0e-21
2702728:2702742	attL	AAGGCGCAACGTTGA	NA	NA	NA	NA
AUT28079.1|2703058_2704126_+|protease	serine endoprotease DegS	protease	A0A1S5Y2X3	uncultured_archaeal_virus	25.6	4.0e-05
AUT28080.1|2704231_2705440_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	45.2	1.6e-47
AUT28081.1|2705502_2706063_-	spermidine acetyltransferase	NA	NA	NA	NA	NA
AUT28082.1|2706097_2706439_-	hypothetical protein	NA	NA	NA	NA	NA
AUT28083.1|2706573_2706900_+	YnfA family protein	NA	A0A218MNG8	uncultured_virus	54.5	1.3e-23
AUT28084.1|2707115_2708330_+	D-galactonate dehydratase family protein	NA	Q6A202	Oenococcus_phage	28.6	2.4e-46
AUT28085.1|2708341_2709361_+	Zn-dependent oxidoreductase	NA	NA	NA	NA	NA
AUT28086.1|2709418_2709529_+	transporter	NA	NA	NA	NA	NA
AUT28087.1|2709548_2710844_-|integrase	site-specific integrase	integrase	B6DZ48	Enterobacteria_phage	62.6	2.3e-156
AUT28088.1|2710863_2711115_-	DNA-binding protein	NA	S4TND0	Salmonella_phage	50.0	2.2e-15
AUT28089.1|2711187_2713659_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.7	8.5e-59
AUT28090.1|2713752_2713944_-	DUF1482 domain-containing protein	NA	NA	NA	NA	NA
AUT28091.1|2713940_2714129_-	division inhibition protein DicB	NA	NA	NA	NA	NA
AUT28092.1|2714631_2714832_+	hypothetical protein	NA	NA	NA	NA	NA
AUT28093.1|2715176_2715329_-	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	53.2	6.6e-07
AUT28094.1|2715495_2715903_-	transcriptional regulator	NA	K7PM82	Enterobacteria_phage	54.7	4.4e-13
AUT28095.1|2715986_2716217_+	division inhibition gene dicB repressor	NA	NA	NA	NA	NA
AUT28096.1|2716200_2716722_+	hypothetical protein	NA	NA	NA	NA	NA
AUT28097.1|2716648_2717668_+	hypothetical protein	NA	U5P0A0	Shigella_phage	60.2	2.4e-55
AUT28098.1|2717708_2718131_+	DUF977 domain-containing protein	NA	A0A0U2QQN3	Escherichia_phage	92.8	2.3e-65
AUT28099.1|2718127_2718361_+	methyltransferase	NA	I6S1S6	Salmonella_phage	67.9	2.9e-17
AUT28100.1|2718414_2719080_+	hypothetical protein	NA	NA	NA	NA	NA
AUT28101.1|2719635_2719848_+	Hok/Gef family protein	NA	A0A0U2QV81	Escherichia_phage	97.1	1.7e-29
AUT28102.1|2720064_2720301_+	hypothetical protein	NA	NA	NA	NA	NA
AUT28103.1|2720248_2720389_-	copper resistance protein	NA	NA	NA	NA	NA
AUT28104.1|2720675_2722004_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
2729664:2729678	attR	TCAACGTTGCGCCTT	NA	NA	NA	NA
>prophage 14
CP025979	Escherichia marmotae strain HT073016 chromosome, complete genome	4671322	3337472	3353661	4671322	integrase,transposase	Enterobacteria_phage(60.0%)	19	NA	NA
AUT28660.1|3337472_3339044_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	1.3e-169
AUT28661.1|3339063_3339411_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZDM8	Stx2-converting_phage	75.7	1.7e-45
AUT28662.1|3339410_3340088_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
AUT28663.1|3340391_3340538_-|integrase	attP region and P4int integrase	integrase	NA	NA	NA	NA
AUT28664.1|3340743_3343077_-	DNA primase	NA	Q7M2A8	Enterobacteria_phage	99.0	0.0e+00
AUT28665.1|3343091_3343412_-	hypothetical protein	NA	NA	NA	NA	NA
AUT28666.1|3343547_3344003_-	hypothetical protein	NA	Q7M298	Enterobacteria_phage	98.2	3.6e-64
AUT28667.1|3343995_3344283_-	Derepression protein	NA	Q7M2A0	Enterobacteria_phage	97.9	8.6e-48
AUT28668.1|3344275_3344866_-	Ash-like/host cell division inhibitor Icd-like protein	NA	Q7M2A7	Enterobacteria_phage	88.8	2.7e-59
AUT28669.1|3344862_3345129_-	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	98.9	1.4e-44
AUT28670.1|3345680_3346415_+	glycoprotein 3	NA	Q7M2A2	Enterobacteria_phage	98.4	2.3e-129
AUT28671.1|3346411_3346657_+	hypothetical protein	NA	Q7M294	Enterobacteria_phage	100.0	1.8e-41
AUT28672.1|3346671_3347244_+	Polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	100.0	1.4e-97
AUT28673.1|3347296_3347482_+	hypothetical protein	NA	NA	NA	NA	NA
AUT28674.1|3347516_3349277_-	ATP-binding protein	NA	NA	NA	NA	NA
AUT28675.1|3349289_3350480_-	DUF4102 domain-containing protein	NA	Q7M297	Enterobacteria_phage	88.9	6.1e-204
AUT28676.1|3351045_3352617_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.5	4.9e-169
AUT28677.1|3352636_3352984_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZDM8	Stx2-converting_phage	75.7	1.7e-45
AUT28678.1|3352983_3353661_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
>prophage 15
CP025979	Escherichia marmotae strain HT073016 chromosome, complete genome	4671322	3670765	3732831	4671322	protease,transposase	uncultured_virus(33.33%)	57	NA	NA
AUT28932.1|3670765_3671974_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	45.2	1.6e-47
AUT28933.1|3672102_3673431_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
AUT28934.1|3674654_3675863_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	45.2	1.6e-47
AUT28935.1|3676837_3678166_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
AUT28936.1|3678272_3678617_-	gamma-glutamylcyclotransferase	NA	NA	NA	NA	NA
AUT28937.1|3678619_3682399_-	autotransporter assembly complex protein TamB	NA	NA	NA	NA	NA
AUT28938.1|3682395_3684129_-	autotransporter assembly complex protein TamA	NA	NA	NA	NA	NA
AUT28939.1|3684098_3684278_-	hypothetical protein	NA	NA	NA	NA	NA
AUT28940.1|3684334_3684973_+	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
AUT28941.1|3685160_3686510_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
AUT28942.1|3686570_3686777_-	DUF1107 domain-containing protein	NA	NA	NA	NA	NA
AUT28943.1|3687101_3687659_+	YtfJ family protein	NA	NA	NA	NA	NA
AUT28944.1|3687648_3688389_-	3'(2'),5'-bisphosphate nucleotidase CysQ	NA	NA	NA	NA	NA
AUT28945.1|3688560_3690504_+	2',3'-cyclic-nucleotide 2'-phosphodiesterase	NA	NA	NA	NA	NA
AUT28946.1|3690616_3690997_-	HxlR family transcriptional regulator	NA	NA	NA	NA	NA
AUT28947.1|3691085_3691946_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
AUT28948.1|3692054_3693020_+	EamA/RhaT family transporter	NA	NA	NA	NA	NA
AUT28949.1|3693127_3693790_+	iron-sulfur cluster repair protein YtfE	NA	NA	NA	NA	NA
AUT28950.1|3693842_3695336_-	hypothetical protein	NA	NA	NA	NA	NA
AUT28951.1|3695368_3696526_-	hypothetical protein	NA	NA	NA	NA	NA
AUT28952.1|3696792_3698196_-	D-serine/D-alanine/glycine transporter	NA	NA	NA	NA	NA
AUT28953.1|3698497_3699118_-	peptidylprolyl isomerase	NA	NA	NA	NA	NA
AUT29970.1|3699335_3699974_+	hypothetical protein	NA	NA	NA	NA	NA
AUT28954.1|3699957_3700605_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
AUT28955.1|3700815_3701607_+	3-ketoacyl-ACP reductase	NA	NA	NA	NA	NA
AUT28956.1|3701616_3702459_+	sugar phosphate isomerase/epimerase	NA	NA	NA	NA	NA
AUT28957.1|3702468_3703245_+	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
AUT28958.1|3703254_3704796_+	acyl CoA:acetate/3-ketoacid CoA transferase	NA	NA	NA	NA	NA
AUT28959.1|3704792_3706865_+	FAD-binding protein	NA	NA	NA	NA	NA
AUT28960.1|3706956_3708234_+	MFS transporter	NA	NA	NA	NA	NA
AUT28961.1|3708334_3708784_-	50S ribosomal protein L9	NA	NA	NA	NA	NA
AUT28962.1|3708825_3709053_-	30S ribosomal protein S18	NA	NA	NA	NA	NA
AUT28963.1|3709057_3709372_-	primosomal replication protein N	NA	NA	NA	NA	NA
AUT28964.1|3709378_3709774_-	30S ribosomal protein S6	NA	NA	NA	NA	NA
AUT28965.1|3710100_3710376_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
AUT28966.1|3710505_3711192_-	L-ribulose-5-phosphate 4-epimerase	NA	NA	NA	NA	NA
AUT28967.1|3711191_3712046_-	L-ribulose-5-phosphate 3-epimerase	NA	NA	NA	NA	NA
AUT28968.1|3712055_3712706_-	3-keto-L-gulonate-6-phosphate decarboxylase UlaD	NA	NA	NA	NA	NA
AUT28969.1|3712719_3713184_-	PTS ascorbate transporter subunit IIA	NA	NA	NA	NA	NA
AUT28970.1|3713193_3713499_-	ascorbate-specific phosphotransferase enzyme IIB component	NA	NA	NA	NA	NA
AUT28971.1|3713514_3714912_-	PTS ascorbate transporter subunit IIC	NA	NA	NA	NA	NA
AUT28972.1|3715266_3716331_+	L-ascorbate 6-phosphate lactonase	NA	NA	NA	NA	NA
AUT28973.1|3716438_3717194_+	HTH-type transcriptional regulator UlaR	NA	NA	NA	NA	NA
AUT28974.1|3717190_3717940_-	esterase	NA	NA	NA	NA	NA
AUT28975.1|3718121_3718451_+	biofilm peroxide resistance protein BsmA	NA	NA	NA	NA	NA
AUT28976.1|3718599_3718875_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
AUT28977.1|3720674_3721838_-	hypothetical protein	NA	B2ZXR7	Ralstonia_phage	44.0	1.3e-81
AUT28978.1|3722904_3723564_-	DUF2491 domain-containing protein	NA	NA	NA	NA	NA
AUT28979.1|3723615_3724314_-	PspA/IM30 family protein	NA	NA	NA	NA	NA
AUT28980.1|3724332_3724734_-	DUF2170 domain-containing protein	NA	NA	NA	NA	NA
AUT28981.1|3724860_3725592_-	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
AUT28982.1|3725771_3728213_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	33.3	4.9e-67
AUT28983.1|3728251_3728677_-	transcriptional regulator	NA	NA	NA	NA	NA
AUT28984.1|3728883_3730182_-	adenylosuccinate synthase	NA	W5S5V7	Pithovirus	35.9	2.9e-66
AUT28985.1|3730285_3730483_-	DUF2065 domain-containing protein	NA	NA	NA	NA	NA
AUT28986.1|3730564_3731569_-|protease	protease modulator HflC	protease	NA	NA	NA	NA
AUT28987.1|3731571_3732831_-|protease	protease modulator HflK	protease	A0A1L2CVV0	Pectobacterium_phage	25.5	3.6e-05
>prophage 16
CP025979	Escherichia marmotae strain HT073016 chromosome, complete genome	4671322	4034838	4081906	4671322	protease,plate,tRNA,transposase	Stx2-converting_phage(40.0%)	42	NA	NA
AUT29248.1|4034838_4036167_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
AUT29249.1|4036557_4036905_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZDM8	Stx2-converting_phage	75.7	1.7e-45
AUT29250.1|4036924_4038496_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	1.3e-169
AUT29251.1|4038644_4039118_-	hypothetical protein	NA	NA	NA	NA	NA
AUT29987.1|4039711_4040209_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
AUT29252.1|4040242_4041790_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
AUT29253.1|4041808_4043146_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
AUT29254.1|4043799_4045524_+	cell envelope biogenesis protein OmpA	NA	NA	NA	NA	NA
AUT29255.1|4045528_4046020_+	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
AUT29256.1|4046197_4048813_+	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	32.8	6.6e-94
AUT29257.1|4050637_4051787_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	42.8	9.5e-53
AUT29258.1|4052789_4053497_-	DUF554 domain-containing protein	NA	NA	NA	NA	NA
AUT29259.1|4053895_4056031_+	ornithine decarboxylase	NA	NA	NA	NA	NA
AUT29260.1|4056079_4057336_-	nucleoside permease	NA	NA	NA	NA	NA
AUT29261.1|4057535_4058615_-	membrane-bound lytic murein transglycosylase MltC	NA	NA	NA	NA	NA
AUT29262.1|4058681_4058957_-	Fe(2+)-trafficking protein	NA	NA	NA	NA	NA
AUT29263.1|4058983_4060036_-	adenine DNA glycosylase	NA	NA	NA	NA	NA
AUT29264.1|4059989_4060127_-	adenine glycosylase	NA	NA	NA	NA	NA
AUT29265.1|4060196_4060916_+|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
AUT29266.1|4060915_4061242_+	DUF469 domain-containing protein	NA	NA	NA	NA	NA
AUT29267.1|4061443_4062163_+	DUF2884 domain-containing protein	NA	NA	NA	NA	NA
AUT29268.1|4062338_4063382_+	L-asparaginase 2	NA	NA	NA	NA	NA
AUT29269.1|4063498_4064506_+	DUF1202 domain-containing protein	NA	NA	NA	NA	NA
AUT29270.1|4064570_4065707_-	YggW family oxidoreductase	NA	NA	NA	NA	NA
AUT29271.1|4065699_4066293_-	XTP/dITP diphosphatase	NA	NA	NA	NA	NA
AUT29272.1|4066300_4066591_-	YggU family protein	NA	NA	NA	NA	NA
AUT29273.1|4066587_4067154_-	YggT family protein	NA	NA	NA	NA	NA
AUT29274.1|4067171_4067876_-	YggS family pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
AUT29275.1|4067893_4068874_+	type IV pili twitching motility protein PilT	NA	NA	NA	NA	NA
AUT29276.1|4069037_4069454_-	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
AUT29277.1|4069453_4070017_-	YqgE/AlgH family protein	NA	NA	NA	NA	NA
AUT29278.1|4070125_4071076_-	glutathione synthase	NA	NA	NA	NA	NA
AUT29279.1|4071088_4071820_-	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
AUT29280.1|4071900_4072608_-	deoxyribonuclease I	NA	NA	NA	NA	NA
AUT29281.1|4072702_4073200_-|protease	SprT family zinc-dependent metalloprotease	protease	NA	NA	NA	NA
AUT29282.1|4075159_4076314_-	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	63.4	6.9e-128
AUT29283.1|4076617_4076833_-	hypothetical protein	NA	NA	NA	NA	NA
AUT29988.1|4076968_4077100_+	virulence promoting factor	NA	NA	NA	NA	NA
AUT29284.1|4077108_4079085_+	biosynthetic arginine decarboxylase	NA	NA	NA	NA	NA
AUT29285.1|4079230_4079962_+	hypothetical protein	NA	NA	NA	NA	NA
AUT29286.1|4080097_4081018_+	agmatinase	NA	NA	NA	NA	NA
AUT29287.1|4081147_4081906_-|protease	metalloprotease	protease	NA	NA	NA	NA
>prophage 17
CP025979	Escherichia marmotae strain HT073016 chromosome, complete genome	4671322	4301068	4309382	4671322	transposase	uncultured_Mediterranean_phage(28.57%)	8	NA	NA
AUT29466.1|4301068_4301830_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	48.4	9.0e-60
AUT29467.1|4301823_4302450_+	protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	49.7	3.3e-36
AUT29468.1|4302588_4303728_+	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	35.6	1.7e-06
AUT29469.1|4303790_4304783_+	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	6.1e-32
AUT29470.1|4305249_4306602_+	group II intron reverse transcriptase/maturase	NA	H7BVN7	unidentified_phage	24.3	3.5e-14
AUT29471.1|4306758_4307967_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	45.2	1.6e-47
AUT29472.1|4308025_4308739_-	hydroxypyruvate isomerase	NA	NA	NA	NA	NA
AUT29473.1|4308743_4309382_-	aldolase	NA	A0A077SK32	Escherichia_phage	76.0	5.7e-84
>prophage 18
CP025979	Escherichia marmotae strain HT073016 chromosome, complete genome	4671322	4508674	4515155	4671322	transposase	Escherichia_phage(66.67%)	7	NA	NA
AUT29647.1|4508674_4510141_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	38.9	8.8e-88
AUT29648.1|4510209_4511787_+	glutamine-hydrolyzing GMP synthase	NA	NA	NA	NA	NA
AUT29649.1|4511937_4512480_-	hypothetical protein	NA	G9L6F0	Escherichia_phage	87.8	7.4e-40
AUT29650.1|4512495_4513014_-	glycine zipper 2TM domain-containing protein	NA	G9L6F1	Escherichia_phage	98.2	8.5e-62
AUT29651.1|4513324_4513516_-	DUF2633 domain-containing protein	NA	G9L6F2	Escherichia_phage	95.2	1.2e-24
AUT29652.1|4513533_4513686_+	hypothetical protein	NA	G9L6F3	Escherichia_phage	80.0	7.3e-14
AUT29653.1|4514005_4515155_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	42.8	9.5e-53
>prophage 19
CP025979	Escherichia marmotae strain HT073016 chromosome, complete genome	4671322	4634952	4671273	4671322	portal,lysis,terminase,transposase,head,coat	Enterobacteria_phage(47.27%)	57	NA	NA
AUT29757.1|4634952_4635873_-	lipid A biosynthesis palmitoleoyl acyltransferase	NA	A0A1W6JP29	Morganella_phage	54.4	8.3e-76
AUT29758.1|4636258_4636555_+	DUF2545 domain-containing protein	NA	NA	NA	NA	NA
AUT29759.1|4636600_4636801_-	transcriptional regulator	NA	K7P7V0	Enterobacteria_phage	100.0	2.4e-33
AUT29760.1|4636858_4637026_-	hypothetical protein	NA	A5VWB7	Enterobacteria_phage	100.0	9.8e-28
AUT29761.1|4637374_4638094_-	hypothetical protein	NA	Q8HAA7	Salmonella_phage	38.8	3.1e-38
AUT29762.1|4638095_4638647_-	hypothetical protein	NA	A0A077SLK5	Escherichia_phage	52.7	2.4e-46
AUT29763.1|4638643_4639075_-	hypothetical protein	NA	K7PMI0	Enterobacteria_phage	81.9	1.9e-59
AUT29764.1|4639071_4639236_-	DUF2737 domain-containing protein	NA	A0A2I6PID4	Escherichia_phage	100.0	1.1e-23
AUT29765.1|4639252_4639567_-	hypothetical protein	NA	K7P7J8	Enterobacteria_phage	99.0	3.5e-50
AUT29766.1|4639578_4640061_-	hypothetical protein	NA	K7P6T5	Enterobacteria_phage	99.4	8.4e-80
AUT29767.1|4640044_4640947_-	DNA recombinase	NA	K7PKG9	Enterobacteria_phage	87.8	9.7e-146
AUT29768.1|4640943_4641252_-	hypothetical protein	NA	K7PJM4	Enterobacteria_phage	99.0	3.3e-53
AUT29769.1|4641582_4641894_-	superinfection exclusion protein	NA	A0A0N7BTN9	Escherichia_phage	98.1	4.6e-55
AUT29770.1|4642081_4642447_-	hypothetical protein	NA	A0A192Y658	Salmonella_phage	96.7	4.0e-58
AUT29771.1|4642455_4642920_-	antitermination protein	NA	J3JZZ6	Escherichia_phage	92.2	1.0e-58
AUT29772.1|4643140_4643545_-	hypothetical protein	NA	Q716D7	Shigella_phage	98.5	3.3e-69
AUT29773.1|4643541_4644174_-	LexA family transcriptional repressor	NA	K7P850	Enterobacteria_phage	99.5	1.6e-118
AUT29774.1|4644280_4644496_+	XRE family transcriptional regulator	NA	Q716D6	Shigella_phage	100.0	1.4e-31
AUT29775.1|4644615_4644909_+	hypothetical protein	NA	K7P6Y2	Enterobacteria_phage	100.0	2.8e-46
AUT29776.1|4644941_4645088_+	hypothetical protein	NA	Q687G5	Enterobacteria_phage	100.0	1.1e-19
AUT29777.1|4645080_4645914_+	DNA replication protein	NA	Q37929	Escherichia_phage	92.0	3.9e-157
AUT29778.1|4645888_4647340_+	helicase DnaB	NA	Q7Y2K5	Escherichia_phage	100.0	7.7e-278
AUT29779.1|4647398_4647857_+	recombination protein NinB	NA	A0A220NRM1	Escherichia_phage	100.0	7.3e-81
AUT29780.1|4647835_4648726_+	hypothetical protein	NA	I6R0S6	Salmonella_phage	99.3	3.6e-177
AUT29781.1|4648722_4648896_+	protein ninD	NA	I6S1V2	Salmonella_phage	100.0	5.8e-31
AUT29782.1|4648862_4649039_+	NinE family protein	NA	I6RSQ2	Salmonella_phage	100.0	4.6e-28
AUT29783.1|4649041_4649401_+	DUF2591 domain-containing protein	NA	G8EYI2	Enterobacteria_phage	95.8	1.2e-62
AUT29784.1|4649400_4649577_+	protein ninF	NA	G9L691	Escherichia_phage	100.0	5.7e-26
AUT29785.1|4649569_4649839_+	hypothetical protein	NA	K7PHK7	Enterobacteria_phage	100.0	7.1e-44
AUT29786.1|4649838_4650450_+	recombination protein NinG	NA	K7P6N9	Enterobacteria_phage	99.5	6.0e-99
AUT29787.1|4650446_4650653_+	protein ninH	NA	Q716C0	Shigella_phage	100.0	7.3e-33
AUT29788.1|4650630_4651296_+	serine/threonine protein phosphatase	NA	A0A2D1GLI5	Escherichia_phage	99.5	1.7e-131
AUT29789.1|4651292_4651916_+	antitermination protein	NA	A0A088CQ66	Enterobacteria_phage	99.5	2.0e-113
AUT29790.1|4652351_4652555_+	hypothetical protein	NA	I6R0S9	Salmonella_phage	100.0	1.1e-33
AUT30007.1|4652532_4653030_+	lysozyme	NA	I6R0P2	Salmonella_phage	99.4	1.7e-91
AUT29791.1|4653118_4653556_+|lysis	lysis protein	lysis	K7P7F7	Enterobacteria_phage	95.2	1.4e-68
AUT29792.1|4653769_4654312_+	Rha family transcriptional regulator	NA	A0A088CBJ5	Shigella_phage	91.1	1.2e-90
AUT29793.1|4654470_4654851_+	hypothetical protein	NA	Q716B1	Shigella_phage	99.2	1.4e-66
AUT29794.1|4654954_4655197_+	DUF2560 domain-containing protein	NA	A5VW77	Enterobacteria_phage	96.2	2.4e-35
AUT29795.1|4655198_4655378_+	hypothetical protein	NA	A0A088CPS9	Enterobacteria_phage	100.0	3.7e-25
AUT30008.1|4655401_4655824_+	ubiquitin carboxyl-hydrolase	NA	Q716H4	Shigella_phage	99.3	2.1e-74
AUT29796.1|4655820_4657236_+|terminase	PBSX family phage terminase large subunit	terminase	A5VW75	Enterobacteria_phage	99.4	7.5e-278
AUT29797.1|4657237_4659436_+|portal	portal protein	portal	A0A088CQ69	Enterobacteria_phage	97.1	0.0e+00
AUT29798.1|4659526_4660420_+	scaffolding protein	NA	A0A088CPT0	Enterobacteria_phage	97.6	6.9e-128
AUT29799.1|4660438_4661692_+|coat	coat protein	coat	A0A088CQ56	Enterobacteria_phage	100.0	2.6e-237
AUT29800.1|4661733_4661922_+	hypothetical protein	NA	A0A088CPR7	Enterobacteria_phage	98.4	6.5e-28
AUT29801.1|4661902_4662364_+|head	head DNA stabilization protein	head	A5VW70	Enterobacteria_phage	100.0	7.1e-84
AUT29802.1|4662373_4663792_+	hypothetical protein	NA	A0A088CQ70	Enterobacteria_phage	98.9	7.8e-275
AUT29803.1|4663791_4664640_+	hypothetical protein	NA	Q716G6	Shigella_phage	92.2	2.2e-99
AUT29804.1|4664639_4665119_+	DUF2824 domain-containing protein	NA	Q2A0B3	Sodalis_phage	73.4	6.5e-64
AUT29805.1|4665093_4665747_+	DNA transfer protein	NA	G5DA80	Enterobacteria_phage	62.8	5.0e-59
AUT29806.1|4665759_4667172_+	acyltransferase	NA	I6RSG0	Salmonella_phage	52.9	2.4e-122
AUT29807.1|4667185_4668336_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	42.8	9.5e-53
AUT29808.1|4668418_4670257_+	DNA transfer protein	NA	A0A192Y934	Salmonella_phage	71.3	5.1e-234
AUT29809.1|4670281_4670671_-	hypothetical protein	NA	I6S5X4	Salmonella_phage	87.6	1.1e-58
AUT29810.1|4670686_4671022_-	hypothetical protein	NA	NA	NA	NA	NA
AUT29811.1|4671018_4671273_-	Arc family DNA-binding protein	NA	A5VW60	Enterobacteria_phage	91.2	1.4e-33
>prophage 1
CP025980	Escherichia marmotae strain HT073016 plasmid pEM148, complete sequence	148809	3996	30737	148809	transposase,protease	uncultured_virus(25.0%)	21	NA	NA
AUT30011.1|3996_5205_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	45.2	1.6e-47
AUT30012.1|6329_7319_-	non-LEE encoded effector protein NleB	NA	Q8HAB2	Salmonella_phage	51.6	1.3e-87
AUT30013.1|7323_7503_-	hypothetical protein	NA	NA	NA	NA	NA
AUT30014.1|7557_8352_+	ribonuclease	NA	NA	NA	NA	NA
AUT30015.1|8965_10150_+|protease	cysteine protease	protease	NA	NA	NA	NA
AUT30115.1|10746_11274_+	hypothetical protein	NA	NA	NA	NA	NA
AUT30016.1|12870_13380_+	DUF2726 domain-containing protein	NA	NA	NA	NA	NA
AUT30017.1|13589_14426_+	OspB	NA	A0A0P0ZCT1	Stx2-converting_phage	37.5	7.6e-36
AUT30018.1|16231_16483_+	hypothetical protein	NA	NA	NA	NA	NA
AUT30019.1|16605_17058_-	lytic transglycosylase	NA	NA	NA	NA	NA
AUT30020.1|17549_17816_+	hypothetical protein	NA	NA	NA	NA	NA
AUT30021.1|17812_18963_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	42.8	9.5e-53
AUT30022.1|19389_19962_-	type III effector	NA	NA	NA	NA	NA
AUT30023.1|20158_21308_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	42.8	9.5e-53
AUT30024.1|23063_23402_-	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
AUT30116.1|23395_23683_-	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
AUT30025.1|25473_26205_-	phosphatase PAP2 family protein	NA	A0A1B1IV46	uncultured_Mediterranean_phage	31.2	1.1e-06
AUT30026.1|26663_27182_-	hypothetical protein	NA	Q1MVP4	Enterobacteria_phage	92.3	6.0e-39
AUT30027.1|27341_27734_+	DUF4158 domain-containing protein	NA	NA	NA	NA	NA
AUT30028.1|28408_29194_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
AUT30029.1|29528_30737_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	45.2	1.6e-47
