The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP026167	Leclercia sp. LSNIH1 chromosome, complete genome	4832521	198377	267448	4832521	tRNA,tail,integrase,capsid,portal,holin,head,plate,terminase,protease	Cronobacter_phage(35.14%)	84	212582:212597	273442:273457
AUU82688.1|198377_200462_-|protease	serine protease	protease	Q2A0D0	Sodalis_phage	26.0	1.4e-22
AUU82689.1|200831_201500_+	DNA-binding response regulator	NA	NA	NA	NA	NA
AUU82690.1|201520_202534_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	58.9	1.8e-108
AUU82691.1|202771_202987_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
AUU82692.1|203103_204849_+	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	39.2	3.7e-77
AUU82693.1|204878_206861_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	9.0e-35
AUU82694.1|206922_207429_-	G/U mismatch-specific DNA glycosylase	NA	NA	NA	NA	NA
AUU82695.1|207811_208177_+	hypothetical protein	NA	R9TR46	Vibrio_phage	63.4	6.1e-22
AUU86839.1|208235_208454_-	transcriptional regulator	NA	A0A2I8TV89	Erwinia_phage	80.6	4.3e-31
AUU82696.1|208519_209668_-	hypothetical protein	NA	Q7Y4C6	Escherichia_virus	78.8	3.0e-168
AUU82697.1|209660_210149_-|tail	phage tail protein	tail	A0A0F7LBX3	Escherichia_phage	80.4	1.5e-68
AUU82698.1|210164_212879_-|tail	phage tail tape measure protein	tail	F1BUT7	Erwinia_phage	62.3	1.3e-196
212582:212597	attL	TGGCGTTATCCAGCGC	NA	NA	NA	NA
AUU82699.1|212871_212991_-|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	89.7	2.6e-14
AUU82700.1|213023_213299_-	hypothetical protein	NA	A0A0F7LDQ8	Escherichia_phage	81.3	9.8e-33
AUU82701.1|213359_213878_-|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	91.9	1.2e-87
AUU82702.1|213892_215083_-|tail	phage tail protein	tail	A0A0F7LBW9	Escherichia_phage	85.1	2.7e-196
AUU82703.1|217390_218002_-|tail	phage tail protein I	tail	A0A218M4J3	Erwinia_phage	88.6	7.9e-99
AUU82704.1|217994_218903_-|plate	baseplate assembly protein	plate	A0A218M4K5	Erwinia_phage	79.5	2.6e-130
AUU82705.1|218907_219255_-|plate	baseplate assembly protein	plate	A0A0F7LDQ1	Escherichia_phage	70.4	9.5e-41
AUU82706.1|219251_219887_-|plate	phage baseplate assembly protein V	plate	A0A0F7LDY9	Escherichia_phage	82.5	9.4e-95
AUU82707.1|219956_220406_-	phage virion morphogenesis protein	NA	O80313	Escherichia_phage	66.0	9.4e-49
AUU82708.1|220398_220866_-|tail	phage tail protein	tail	A0A0F7LA33	Escherichia_phage	78.7	5.1e-66
AUU82709.1|220940_221390_-	LysB family transcriptional regulator	NA	F1BUQ1	Erwinia_phage	70.1	3.0e-47
AUU82710.1|221374_221776_-	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	37.6	4.6e-15
AUU82711.1|221772_222282_-	glycoside hydrolase	NA	A0A218M4K3	Erwinia_phage	76.0	1.7e-70
AUU82712.1|222284_222512_-|holin	holin	holin	A0A218M4L5	Erwinia_phage	54.5	9.6e-10
AUU82713.1|222502_222706_-|tail	phage tail protein	tail	A0A0F7LCN2	Escherichia_phage	79.1	6.1e-24
AUU82714.1|222705_223209_-|head	head completion/stabilization protein	head	A0A0F7LDJ1	Escherichia_phage	77.5	9.5e-66
AUU82715.1|223306_224056_-|terminase	terminase	terminase	U5N091	Enterobacteria_phage	77.5	8.8e-92
AUU82716.1|224059_225136_-|capsid	phage major capsid protein, P2 family	capsid	Q778Y7	Enterobacteria_phage	80.7	1.0e-165
AUU82717.1|225193_226048_-|capsid	GPO family capsid scaffolding protein	capsid	Q94MB7	Escherichia_virus	76.8	1.6e-121
AUU82718.1|226215_227985_+	oxidoreductase	NA	A0A0M4RE51	Salmonella_phage	86.1	3.8e-303
AUU82719.1|227984_229019_+|portal	phage portal protein	portal	M1SV64	Escherichia_phage	80.6	1.1e-161
AUU82720.1|229372_229696_-	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	57.0	1.8e-25
AUU82721.1|229770_229959_-	hypothetical protein	NA	F1BUR9	Erwinia_phage	71.0	2.6e-16
AUU86840.1|230105_232208_-	replication protein	NA	A0A218M4H2	Erwinia_phage	71.5	1.2e-292
AUU82722.1|232315_233170_-	DNA adenine methylase	NA	A0A1S6L011	Salmonella_phage	69.0	6.2e-110
AUU82723.1|233166_233358_-	hypothetical protein	NA	NA	NA	NA	NA
AUU82724.1|233358_233580_-	hypothetical protein	NA	Q6K1F5	Salmonella_virus	73.6	8.2e-22
AUU82725.1|233579_233807_-	hypothetical protein	NA	A0A0M3UL87	Salmonella_phage	80.0	5.3e-24
AUU86841.1|233876_234224_-	hypothetical protein	NA	F1BUS4	Erwinia_phage	53.6	1.1e-23
AUU82726.1|234244_234442_-	DUF2724 domain-containing protein	NA	A0A0M4RTI3	Salmonella_phage	66.0	6.2e-13
AUU82727.1|234449_234959_-	hypothetical protein	NA	A0A0M4QWN1	Salmonella_phage	65.1	2.7e-60
AUU82728.1|234989_235253_-	hypothetical protein	NA	A0A218M4I5	Erwinia_phage	70.1	2.4e-28
AUU82729.1|235382_235961_+	phage repressor protein CI	NA	A0A218M4J1	Erwinia_phage	62.2	6.6e-63
AUU82730.1|235960_237010_+|integrase	integrase	integrase	A0A218M4I3	Erwinia_phage	88.7	6.4e-181
AUU82731.1|238265_238544_+	hypothetical protein	NA	NA	NA	NA	NA
AUU82732.1|238581_240279_-	hypothetical protein	NA	F1BUJ7	Cronobacter_phage	66.1	3.6e-210
AUU82733.1|240282_240828_-	hypothetical protein	NA	F1BUJ9	Cronobacter_phage	68.7	5.6e-56
AUU86842.1|240802_241519_-	hypothetical protein	NA	F1BUK1	Cronobacter_phage	53.1	2.0e-48
AUU82734.1|241550_244586_-	hypothetical protein	NA	O09496	Escherichia_virus	47.6	7.5e-158
AUU82735.1|244594_245233_-	hypothetical protein	NA	F1BUK5	Cronobacter_phage	76.2	3.8e-80
AUU82736.1|245225_246410_-	hypothetical protein	NA	F1BUK6	Cronobacter_phage	81.5	6.1e-180
AUU82737.1|246406_246736_-	DUF2590 domain-containing protein	NA	F1BUK8	Cronobacter_phage	85.7	2.1e-45
AUU82738.1|246732_248700_-|tail	phage tail tape measure protein	tail	F1BUK9	Cronobacter_phage	68.6	1.9e-258
AUU82739.1|248887_249148_-	hypothetical protein	NA	A5X9I7	Aeromonas_virus	54.7	4.5e-19
AUU82740.1|249131_249320_-	hypothetical protein	NA	F1BUL1	Cronobacter_phage	61.7	1.1e-11
AUU82741.1|249264_249630_-	hypothetical protein	NA	F1BUL2	Cronobacter_phage	58.5	4.2e-23
AUU82742.1|249629_249971_-	hypothetical protein	NA	F1BUL3	Cronobacter_phage	87.1	5.1e-47
AUU82743.1|249967_250261_-|holin	holin	holin	A0A0M5M1H1	Salmonella_phage	54.2	6.0e-20
AUU82744.1|250269_250725_-	DUF2597 domain-containing protein	NA	F1BUL4	Cronobacter_phage	78.1	2.8e-64
AUU82745.1|250721_251849_-	DUF2586 domain-containing protein	NA	F1BUL5	Cronobacter_phage	81.9	2.5e-175
AUU82746.1|251866_252553_-	hypothetical protein	NA	F1BUL6	Cronobacter_phage	82.5	8.6e-102
AUU82747.1|252552_253056_-|tail	phage tail protein	tail	F1BUL7	Cronobacter_phage	70.9	1.5e-66
AUU82748.1|253052_253505_-|head	head completion protein	head	F1BUL8	Cronobacter_phage	77.3	9.1e-60
AUU82749.1|253598_254303_-|terminase	terminase	terminase	F1BUM0	Cronobacter_phage	76.3	7.7e-98
AUU82750.1|254306_255329_-|capsid	phage major capsid protein, P2 family	capsid	F1BUM2	Cronobacter_phage	80.0	1.2e-155
AUU86843.1|255382_256192_-|capsid	phage capsid protein	capsid	F1BUM4	Cronobacter_phage	54.4	3.9e-77
AUU82751.1|256349_258125_+|terminase	terminase	terminase	F1BUM5	Cronobacter_phage	82.8	2.6e-283
AUU82752.1|258121_259153_+|portal	phage portal protein	portal	F1BUM7	Cronobacter_phage	80.5	7.2e-161
AUU82753.1|259149_259470_+	transcriptional regulator	NA	F1BUM8	Cronobacter_phage	78.8	5.1e-41
AUU82754.1|259446_259635_-	hypothetical protein	NA	NA	NA	NA	NA
AUU82755.1|259753_261796_-	replication endonuclease	NA	F1BUM9	Cronobacter_phage	77.4	0.0e+00
AUU82756.1|261794_262091_+	hypothetical protein	NA	NA	NA	NA	NA
AUU82757.1|262169_263027_-	adenine methylase	NA	F1BUN1	Cronobacter_phage	83.4	3.4e-132
AUU82758.1|263017_263251_-	hypothetical protein	NA	NA	NA	NA	NA
AUU82759.1|263317_263719_-	hypothetical protein	NA	F1BUN2	Cronobacter_phage	56.4	1.6e-39
AUU82760.1|263718_264147_-	hypothetical protein	NA	F1BUN5	Cronobacter_phage	54.1	1.5e-27
AUU82761.1|264136_264334_-	hypothetical protein	NA	NA	NA	NA	NA
AUU82762.1|264343_264847_-	hypothetical protein	NA	F1BUN6	Cronobacter_phage	76.0	6.8e-64
AUU82763.1|264877_265099_-	regulator	NA	NA	NA	NA	NA
AUU82764.1|265242_265824_+	phage repressor protein	NA	A0A218M4J1	Erwinia_phage	37.2	6.9e-28
AUU82765.1|265840_266407_+	hypothetical protein	NA	Q4ZA70	Staphylococcus_virus	32.2	2.8e-18
AUU82766.1|266410_267448_+|integrase	integrase	integrase	F1BUS9	Erwinia_phage	64.4	8.6e-122
273442:273457	attR	TGGCGTTATCCAGCGC	NA	NA	NA	NA
>prophage 2
CP026167	Leclercia sp. LSNIH1 chromosome, complete genome	4832521	1421415	1481513	4832521	tRNA,integrase,capsid,transposase,protease	uncultured_Caudovirales_phage(25.0%)	59	1468523:1468582	1481611:1481673
AUU83806.1|1421415_1422768_+|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
AUU83807.1|1422993_1423377_+	cytochrome b562	NA	NA	NA	NA	NA
AUU83808.1|1423733_1425102_+|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	69.0	1.6e-75
AUU83809.1|1425086_1425197_+	ABC transporter	NA	NA	NA	NA	NA
AUU83810.1|1425235_1426216_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.1	2.3e-185
AUU83811.1|1426288_1426612_+	hypothetical protein	NA	NA	NA	NA	NA
AUU83812.1|1426757_1427174_-	VapC toxin family PIN domain ribonuclease	NA	NA	NA	NA	NA
AUU83813.1|1427170_1427401_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
AUU86874.1|1427624_1427741_+	hypothetical protein	NA	NA	NA	NA	NA
AUU83814.1|1428313_1428781_-	hypothetical protein	NA	NA	NA	NA	NA
AUU83815.1|1430032_1430458_+	arsenate reductase (glutaredoxin)	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	69.3	5.8e-48
AUU83816.1|1430924_1431263_+	glycine dehydrogenase	NA	NA	NA	NA	NA
AUU83817.1|1431273_1431636_+	hypothetical protein	NA	NA	NA	NA	NA
AUU83818.1|1431638_1431938_+	cytoplasmic protein	NA	NA	NA	NA	NA
AUU83819.1|1431960_1432737_+	hypothetical protein	NA	NA	NA	NA	NA
AUU83820.1|1432750_1433392_+	hypothetical protein	NA	NA	NA	NA	NA
AUU83821.1|1433434_1434568_+	amidohydrolase/deacetylase family metallohydrolase	NA	NA	NA	NA	NA
AUU83822.1|1434551_1435670_+	SelA-like pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
AUU83823.1|1435666_1436407_+	2-dehydro-3-deoxyphosphooctonate aldolase	NA	NA	NA	NA	NA
AUU83824.1|1436461_1437598_+	6-phosphogluconolactonase	NA	NA	NA	NA	NA
AUU83825.1|1437617_1439528_+	transcription antiterminator BglG	NA	NA	NA	NA	NA
AUU83826.1|1439605_1439848_+	type II toxin-antitoxin system antitoxin, RelB/DinJ family	NA	A0A2H4JBG1	uncultured_Caudovirales_phage	52.5	1.1e-16
AUU83827.1|1439837_1440122_+	type II toxin-antitoxin system mRNA interferase toxin, RelE/StbE family	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	69.1	2.3e-29
AUU83828.1|1440125_1440590_-	anaerobic ribonucleotide reductase-activating protein	NA	K4F9T1	Cronobacter_phage	55.2	3.6e-51
AUU83829.1|1440696_1442835_-	anaerobic ribonucleoside-triphosphate reductase	NA	A0A2I7QNQ7	Vibrio_phage	64.7	2.8e-268
AUU83830.1|1443205_1444861_-	alpha,alpha-phosphotrehalase	NA	NA	NA	NA	NA
AUU83831.1|1444911_1446333_-	PTS trehalose transporter subunit IIBC	NA	NA	NA	NA	NA
AUU83832.1|1446459_1447407_-	trehalose operon repressor	NA	C6ZCU4	Enterobacteria_phage	22.6	1.6e-13
AUU83833.1|1447797_1450500_+	magnesium-translocating P-type ATPase	NA	M1HLC0	Paramecium_bursaria_Chlorella_virus	26.5	3.8e-44
AUU83834.1|1450655_1453040_+	beta-N-acetylhexosaminidase	NA	NA	NA	NA	NA
AUU83835.1|1453043_1453241_+	hypothetical protein	NA	NA	NA	NA	NA
AUU83836.1|1454814_1455201_-	2-iminobutanoate/2-iminopropanoate deaminase	NA	NA	NA	NA	NA
AUU83837.1|1455269_1455731_-	aspartate carbamoyltransferase regulatory subunit	NA	NA	NA	NA	NA
AUU83838.1|1455743_1456676_-	aspartate carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	38.9	1.6e-50
AUU83839.1|1456710_1456815_-	PyrBI operon leader peptide	NA	NA	NA	NA	NA
AUU83840.1|1457018_1457471_+	YhcH/YjgK/YiaL family protein	NA	NA	NA	NA	NA
AUU83841.1|1457659_1458568_+	dihydrodipicolinate synthase family protein	NA	NA	NA	NA	NA
AUU83842.1|1458582_1460550_+	YjhG/YagF family D-xylonate dehydratase	NA	NA	NA	NA	NA
AUU83843.1|1460789_1462172_+	MFS transporter	NA	NA	NA	NA	NA
AUU83844.1|1462184_1463798_+	glycoside hydrolase 43 family protein	NA	NA	NA	NA	NA
AUU83845.1|1463802_1464561_-	IclR family transcriptional regulator	NA	NA	NA	NA	NA
AUU83846.1|1464814_1465174_+	hypothetical protein	NA	NA	NA	NA	NA
AUU83847.1|1465238_1466243_-	ornithine carbamoyltransferase	NA	NA	NA	NA	NA
AUU83848.1|1466407_1466830_+	ribonuclease E inhibitor RraB	NA	NA	NA	NA	NA
AUU83849.1|1466874_1467633_+|tRNA	tRNA isopentenyl-2-thiomethyl-A-37 hydroxylase MiaE	tRNA	NA	NA	NA	NA
AUU83850.1|1467667_1468399_+	topoisomerase II	NA	NA	NA	NA	NA
1468523:1468582	attL	TAGACGCAGTTGATTCAAAATCAACCGTAGAAATACGTGCCGGTTCGAGTCCGGCCTTCG	NA	NA	NA	NA
AUU83851.1|1469533_1470349_-	hypothetical protein	NA	NA	NA	NA	NA
AUU83852.1|1470531_1470807_-	hypothetical protein	NA	NA	NA	NA	NA
AUU83853.1|1471248_1471512_-	hypothetical protein	NA	NA	NA	NA	NA
AUU83854.1|1471511_1472099_-|integrase	integrase	integrase	NA	NA	NA	NA
AUU83855.1|1474039_1474477_+	hypothetical protein	NA	NA	NA	NA	NA
AUU83856.1|1474642_1475824_+	hypothetical protein	NA	NA	NA	NA	NA
AUU83857.1|1475830_1476415_+	hypothetical protein	NA	NA	NA	NA	NA
AUU83858.1|1476521_1476890_+	hypothetical protein	NA	NA	NA	NA	NA
AUU83859.1|1477536_1477881_+	hypothetical protein	NA	NA	NA	NA	NA
AUU83860.1|1477905_1478943_+|capsid	phage capsid protein	capsid	K4F6Z8	Cronobacter_phage	24.4	4.9e-08
AUU83861.1|1479095_1479389_+	hypothetical protein	NA	NA	NA	NA	NA
AUU83862.1|1479709_1480288_+	N-acetyltransferase	NA	Q8HA62	Vibrio_phage	49.2	3.0e-39
AUU83863.1|1480268_1481513_-|integrase	integrase	integrase	NA	NA	NA	NA
1481611:1481673	attR	TAGACGCAGTTGATTCAAAATCAACCGTAGAAATACGTGCCGGTTCGAGTCCGGCCTTCGGCA	NA	NA	NA	NA
>prophage 3
CP026167	Leclercia sp. LSNIH1 chromosome, complete genome	4832521	2787150	2884542	4832521	tRNA,tail,integrase,lysis,capsid,portal,head,terminase,transposase	Enterobacteria_phage(46.15%)	113	2810211:2810236	2854652:2854677
AUU85004.1|2787150_2787642_+|transposase	transposase	transposase	NA	NA	NA	NA
AUU85005.1|2787781_2788903_-	50S ribosomal protein L16 arginine hydroxylase	NA	NA	NA	NA	NA
AUU85006.1|2788992_2790456_-	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
AUU85007.1|2790456_2791128_-	two-component system response regulator PhoP	NA	NA	NA	NA	NA
AUU85008.1|2791202_2792489_-|integrase	site-specific integrase	integrase	A0A0U2JGI6	Escherichia_phage	49.6	6.1e-109
AUU85009.1|2792488_2792704_-	hypothetical protein	NA	NA	NA	NA	NA
AUU85010.1|2792770_2795692_-	hypothetical protein	NA	K7P6V4	Enterobacteria_phage	59.4	5.9e-168
AUU86929.1|2795829_2796159_-	transcriptional regulator	NA	NA	NA	NA	NA
AUU85011.1|2796174_2796510_-	hypothetical protein	NA	NA	NA	NA	NA
AUU85012.1|2796675_2796858_-	DUF1482 domain-containing protein	NA	NA	NA	NA	NA
AUU85013.1|2797250_2797640_-	transcriptional regulator	NA	A0A077KGZ5	Edwardsiella_phage	68.6	2.8e-17
AUU85014.1|2797748_2797973_+	transcriptional regulator	NA	K7PKH4	Enterobacteria_phage	58.5	3.0e-16
AUU85015.1|2797975_2798530_+	hypothetical protein	NA	NA	NA	NA	NA
AUU85016.1|2799318_2799990_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	76.2	8.8e-67
AUU85017.1|2800005_2800422_+	hypothetical protein	NA	NA	NA	NA	NA
AUU85018.1|2800712_2801861_+	cytosine methyltransferase	NA	M1PSQ0	Streptococcus_phage	31.2	3.7e-33
AUU85019.1|2802818_2804231_-	ATP-binding protein	NA	NA	NA	NA	NA
AUU85020.1|2804909_2805158_+	hypothetical protein	NA	NA	NA	NA	NA
AUU85021.1|2805283_2805490_+	hypothetical protein	NA	NA	NA	NA	NA
AUU86930.1|2805510_2805843_+	RusA family crossover junction endodeoxyribonuclease	NA	K7P6W0	Enterobacteria_phage	63.9	1.9e-38
AUU85022.1|2805842_2806874_+	hypothetical protein	NA	A0A291AWV9	Escherichia_phage	57.1	2.7e-107
AUU85023.1|2806887_2807502_+	hypothetical protein	NA	H9C175	Pectobacterium_phage	62.2	2.8e-64
AUU85024.1|2807765_2808143_+	hypothetical protein	NA	A0A248XD00	Klebsiella_phage	31.7	7.5e-07
AUU85025.1|2808139_2808412_+	hypothetical protein	NA	NA	NA	NA	NA
AUU85026.1|2808414_2809029_+	endolysin	NA	Q8HA86	Salmonella_phage	78.8	3.6e-91
AUU85027.1|2809025_2809376_+	hypothetical protein	NA	R9TPM9	Aeromonas_phage	37.6	6.7e-10
AUU85028.1|2809882_2810110_+	hypothetical protein	NA	NA	NA	NA	NA
2810211:2810236	attL	TGGTGAATCCCCCTAAGCGGTGGGGC	NA	NA	NA	NA
AUU85029.1|2810844_2811186_+	hypothetical protein	NA	Q9EYD5	Enterobacteria_phage	34.2	2.5e-09
AUU85030.1|2811422_2811911_+|terminase	terminase	terminase	K7PJY2	Enterobacterial_phage	82.1	4.4e-68
AUU85031.1|2811910_2814013_+	DNA packaging protein	NA	K7PH52	Enterobacterial_phage	80.7	0.0e+00
AUU85032.1|2814009_2814231_+	hypothetical protein	NA	A5LH28	Enterobacteria_phage	70.4	6.5e-19
AUU85033.1|2814227_2815733_+|portal	phage portal protein	portal	K7PHM5	Enterobacterial_phage	73.3	1.9e-215
AUU85034.1|2815677_2817690_+	peptidase S14	NA	K7PKX4	Enterobacterial_phage	83.6	0.0e+00
AUU85035.1|2817770_2818094_+	recombinase RecA	NA	NA	NA	NA	NA
AUU85036.1|2818086_2818362_+	ATP-binding protein	NA	K7PH55	Enterobacterial_phage	50.0	3.2e-15
AUU85037.1|2818372_2818927_+|tail	phage tail protein	tail	K7PKQ5	Enterobacteria_phage	63.4	5.0e-44
AUU85038.1|2818923_2819322_+|tail	phage tail protein	tail	K7PHM6	Enterobacterial_phage	63.6	2.1e-44
AUU85039.1|2819329_2820067_+|tail	phage tail protein	tail	M9NYX0	Enterobacteria_phage	72.7	1.2e-96
AUU85040.1|2820108_2820519_+|tail	phage minor tail protein G	tail	M9NZD7	Enterobacteria_phage	41.6	1.2e-18
AUU85041.1|2820539_2820848_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	55.1	2.3e-22
AUU85042.1|2820828_2823333_+|tail	phage tail tape measure protein	tail	K7PKR0	Enterobacteria_phage	66.6	5.2e-298
AUU85043.1|2823332_2823680_+|tail	phage tail protein	tail	K7P7G7	Enterobacteria_phage	67.8	6.8e-39
AUU85044.1|2823676_2824432_+|tail	phage minor tail protein L	tail	K7PGX3	Enterobacteria_phage	82.1	1.0e-124
AUU85045.1|2824433_2825141_+	peptidase P60	NA	K7P6F5	Enterobacteria_phage	90.2	2.3e-134
AUU86931.1|2825173_2825509_+	hypothetical protein	NA	NA	NA	NA	NA
AUU85046.1|2825649_2826240_+|tail	phage tail protein	tail	K7PM97	Enterobacterial_phage	68.7	4.8e-69
AUU85047.1|2826291_2831217_+	hypothetical protein	NA	Q6UAW1	Klebsiella_phage	61.9	0.0e+00
AUU85048.1|2831281_2832937_+	hypothetical protein	NA	A0A0E3M194	Enterobacteria_phage	27.5	2.9e-26
AUU85049.1|2832936_2833239_+	hypothetical protein	NA	NA	NA	NA	NA
AUU86932.1|2833348_2834104_+	hypothetical protein	NA	K7P6M1	Enterobacteria_phage	59.4	7.8e-80
AUU85050.1|2834184_2834424_+	hypothetical protein	NA	K7P7N3	Enterobacteria_phage	71.8	2.8e-28
AUU85051.1|2834423_2834741_+	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	52.9	1.3e-23
AUU85052.1|2835001_2836372_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	46.2	6.5e-109
AUU85053.1|2836391_2837021_-	lysogenization regulator HflD	NA	NA	NA	NA	NA
AUU85054.1|2837048_2838203_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
AUU85055.1|2838199_2838673_-	NUDIX hydrolase	NA	NA	NA	NA	NA
AUU85056.1|2838665_2839337_-	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
AUU85057.1|2839454_2840705_+	isocitrate dehydrogenase (NADP(+))	NA	Q77Z09	Phage_21	94.4	4.7e-21
AUU85058.1|2840818_2841673_+	hypothetical protein	NA	NA	NA	NA	NA
AUU85059.1|2841707_2842835_-|integrase	integrase	integrase	O21925	Phage_21	62.0	9.7e-127
AUU85060.1|2842815_2843061_-	excisionase	NA	NA	NA	NA	NA
AUU85061.1|2843184_2843466_-	hypothetical protein	NA	K7PHA5	Enterobacterial_phage	66.7	5.5e-15
AUU85062.1|2843452_2844481_-	chromosome partitioning protein ParB	NA	K7PKM7	Enterobacterial_phage	82.3	6.5e-154
AUU85063.1|2844477_2844891_-	hypothetical protein	NA	K7PJS4	Enterobacterial_phage	79.6	2.9e-52
AUU85064.1|2845179_2845692_+	hypothetical protein	NA	K7P861	Enterobacteria_phage	29.3	7.5e-10
AUU85065.1|2845887_2846535_-	DNA-binding protein	NA	A0A1I9KG86	Aeromonas_phage	41.8	1.3e-38
AUU85066.1|2846632_2846842_+	cell division protein	NA	NA	NA	NA	NA
AUU85067.1|2846870_2847422_+	DNA-binding protein	NA	S5FXP0	Shigella_phage	61.2	9.1e-62
AUU85068.1|2847585_2847798_+	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	61.5	1.3e-11
AUU85069.1|2847754_2848681_+	transcriptional regulator	NA	K7PLZ7	Enterobacterial_phage	84.8	1.4e-62
AUU85070.1|2848677_2849124_+	hypothetical protein	NA	Q8HA95	Salmonella_phage	29.6	5.3e-12
AUU85071.1|2849123_2849783_+	DNA methyltransferase	NA	I6PDF5	Cronobacter_phage	82.5	1.1e-98
AUU85072.1|2849779_2850100_+	LexA family transcriptional regulator	NA	K7PHB4	Enterobacterial_phage	68.3	2.1e-34
AUU85073.1|2850096_2850486_+	hypothetical protein	NA	K7PKN5	Enterobacterial_phage	86.1	1.9e-58
AUU85074.1|2850482_2851472_+	hypothetical protein	NA	K7PJS6	Enterobacterial_phage	76.0	2.5e-155
AUU85075.1|2851486_2851831_+	antitermination protein	NA	A0A0P0ZCW0	Stx2-converting_phage	85.8	1.8e-55
AUU85076.1|2851820_2853053_-	hypothetical protein	NA	NA	NA	NA	NA
AUU85077.1|2853042_2854188_-	nucleoid-associated protein	NA	NA	NA	NA	NA
AUU85078.1|2855090_2855276_+	hypothetical protein	NA	NA	NA	NA	NA
2854652:2854677	attR	TGGTGAATCCCCCTAAGCGGTGGGGC	NA	NA	NA	NA
AUU85079.1|2855437_2855761_+	four-helix bundle copper-binding protein	NA	NA	NA	NA	NA
AUU85080.1|2855800_2856052_-	hypothetical protein	NA	NA	NA	NA	NA
AUU85081.1|2856282_2856522_+|lysis	lysis protein	lysis	A0A2H4JCI1	uncultured_Caudovirales_phage	57.9	2.3e-17
AUU85082.1|2856522_2857026_+	lysozyme	NA	A0A2H4JCH1	uncultured_Caudovirales_phage	75.3	8.0e-73
AUU85083.1|2857015_2857474_+|lysis	lysis protein	lysis	F1C590	Cronobacter_phage	69.3	9.0e-47
AUU85084.1|2858572_2858800_+	hypothetical protein	NA	NA	NA	NA	NA
AUU86933.1|2859238_2859412_+	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
AUU85085.1|2859465_2859717_+	hypothetical protein	NA	NA	NA	NA	NA
AUU85086.1|2859720_2860266_+|terminase	terminase small subunit	terminase	K7P7G0	Enterobacteria_phage	94.5	2.4e-91
AUU85087.1|2860240_2862163_+|terminase	terminase	terminase	E4WL19	Enterobacteria_phage	93.0	0.0e+00
AUU85088.1|2862162_2862369_+|tail	phage tail protein	tail	K7PM10	Enterobacteria_phage	91.2	3.5e-27
AUU85089.1|2862365_2863958_+|portal	phage portal protein	portal	E4WL21	Enterobacteria_phage	92.1	1.3e-291
AUU85090.1|2863938_2865264_+|capsid	capsid assembly protein	capsid	O64320	Escherichia_phage	81.9	6.6e-183
AUU85091.1|2865273_2865606_+|head	head decoration protein	head	E4WL24	Enterobacteria_phage	85.5	1.5e-48
AUU85092.1|2865673_2866699_+|capsid	major capsid protein E	capsid	K7PGW9	Enterobacteria_phage	90.6	5.1e-175
AUU85093.1|2866745_2867153_+	DNA-packaging protein	NA	K7P7M3	Enterobacteria_phage	82.6	1.6e-34
AUU85094.1|2867163_2867517_+|tail	phage tail protein	tail	K7P6U9	Enterobacteria_phage	86.3	2.2e-53
AUU85095.1|2867526_2868081_+|tail	phage tail protein	tail	K7P7A8	Enterobacteria_phage	96.9	2.8e-79
AUU85096.1|2868077_2868476_+|tail	phage tail protein	tail	K7P7G5	Enterobacteria_phage	87.1	7.0e-64
AUU85097.1|2868483_2869221_+|tail	phage tail protein	tail	O64327	Escherichia_phage	88.6	2.0e-117
AUU85098.1|2869256_2869670_+|tail	phage minor tail protein G	tail	K7PM17	Enterobacteria_phage	65.0	7.3e-40
AUU85099.1|2869678_2869999_+|tail	phage tail assembly protein T	tail	K7PHE1	Enterobacteria_phage	90.5	3.9e-49
AUU85100.1|2869976_2872472_+|tail	phage tail tape measure protein	tail	K7PKR0	Enterobacteria_phage	78.2	0.0e+00
AUU85101.1|2872474_2872813_+|tail	phage tail protein	tail	E4WL34	Enterobacteria_phage	83.0	6.2e-53
AUU85102.1|2872870_2873608_+|tail	phage minor tail protein L	tail	M9NYX1	Enterobacteria_phage	84.1	4.5e-125
AUU85103.1|2873610_2874357_+	peptidase P60	NA	M9NZD8	Enterobacteria_phage	71.6	2.8e-106
AUU85104.1|2874334_2874949_+|tail	tail assembly protein	tail	K7PH59	Enterobacterial_phage	69.3	8.8e-74
AUU85105.1|2875002_2879931_+	hypothetical protein	NA	E4WL39	Enterobacteria_phage	42.9	7.0e-12
AUU85106.1|2879995_2881651_+	hypothetical protein	NA	A0A0E3M194	Enterobacteria_phage	27.6	4.1e-25
AUU85107.1|2881650_2881953_+	hypothetical protein	NA	NA	NA	NA	NA
AUU85108.1|2881964_2882963_+	hypothetical protein	NA	O64338	Escherichia_phage	48.5	1.5e-43
AUU85109.1|2883228_2883477_+	hypothetical protein	NA	NA	NA	NA	NA
AUU85110.1|2883985_2884225_+	hypothetical protein	NA	K7P7N3	Enterobacteria_phage	72.2	1.8e-27
AUU85111.1|2884224_2884542_+	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	51.0	2.9e-20
>prophage 4
CP026167	Leclercia sp. LSNIH1 chromosome, complete genome	4832521	3147433	3196064	4832521	tail,lysis,integrase,terminase,transposase	Enterobacteria_phage(30.61%)	60	3137999:3138015	3192401:3192417
3137999:3138015	attL	CAGGCGCAGCTGAAAAC	NA	NA	NA	NA
AUU85366.1|3147433_3149863_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.6	1.8e-218
AUU85367.1|3150013_3150319_-	hypothetical protein	NA	NA	NA	NA	NA
AUU85368.1|3150424_3151135_+	YnfC family lipoprotein	NA	NA	NA	NA	NA
AUU85369.1|3151173_3151503_-	hypothetical protein	NA	NA	NA	NA	NA
AUU85370.1|3151652_3151979_+	YnfA family protein	NA	A0A218MNG8	uncultured_virus	52.5	6.6e-20
AUU85371.1|3152088_3153303_+	bifunctional D-altronate/D-mannonate dehydratase	NA	Q6A202	Oenococcus_phage	29.7	6.3e-47
AUU85372.1|3153314_3154334_+	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	27.5	7.9e-19
AUU85373.1|3154518_3155802_-|integrase	site-specific integrase	integrase	Q8W658	Enterobacteria_phage	59.3	5.6e-155
AUU85374.1|3155834_3156086_-	DNA-binding protein	NA	Q859D3	Escherichia_coli_phage	41.0	2.1e-13
AUU85375.1|3156185_3156425_-	DUF4060 domain-containing protein	NA	M9P0E0	Enterobacteria_phage	87.0	1.6e-31
AUU85376.1|3156411_3157086_-	hypothetical protein	NA	A0A1B0VDT5	Salmonella_phage	42.4	7.8e-39
AUU85377.1|3157120_3158236_-	enterohemolysin	NA	K7PKR8	Enterobacteria_phage	84.9	3.8e-176
AUU85378.1|3158247_3161238_-	exodeoxyribonuclease VIII	NA	K7PJT5	Enterobacteria_phage	70.9	0.0e+00
AUU85379.1|3161549_3161756_-	cell division inhibitor protein	NA	K7PM31	Enterobacteria_phage	86.8	4.9e-29
AUU85380.1|3161741_3161951_+	hypothetical protein	NA	NA	NA	NA	NA
AUU85381.1|3162125_3163022_-	hypothetical protein	NA	A0A0R6PIN1	Moraxella_phage	33.5	1.4e-30
AUU85382.1|3163258_3163642_-	transcriptional regulator	NA	K7PHG0	Enterobacteria_phage	79.5	6.1e-49
AUU85383.1|3163739_3163949_+	Rha family transcriptional regulator	NA	K7PKS2	Enterobacteria_phage	63.2	3.0e-18
AUU85384.1|3163960_3164515_+	hypothetical protein	NA	K7P7P2	Enterobacteria_phage	41.4	1.0e-20
AUU86941.1|3164699_3165686_+	replication protein	NA	A5VW95	Enterobacteria_phage	77.2	4.4e-51
AUU85385.1|3165669_3166359_+	phage replication protein	NA	G8C7U6	Escherichia_phage	61.1	1.0e-78
AUU85386.1|3166371_3166635_+	DNA breaking-rejoining protein	NA	H6WRX9	Salmonella_phage	66.2	7.2e-25
AUU85387.1|3166627_3167137_+	hypothetical protein	NA	F1C5B6	Cronobacter_phage	35.1	1.8e-11
AUU85388.1|3167414_3167597_+	hypothetical protein	NA	R9TNE4	Aeromonas_phage	54.2	8.2e-12
AUU85389.1|3167596_3167854_+	hypothetical protein	NA	NA	NA	NA	NA
AUU85390.1|3167850_3169692_+	DNA cytosine methyltransferase	NA	H9C171	Pectobacterium_phage	55.1	1.1e-199
AUU85391.1|3169760_3170093_-	hypothetical protein	NA	NA	NA	NA	NA
AUU85392.1|3170091_3171072_+|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.1	2.3e-185
AUU86942.1|3171110_3171197_-	ABC transporter	NA	NA	NA	NA	NA
AUU85393.1|3171926_3172166_+	hypothetical protein	NA	K7PHG9	Enterobacteria_phage	54.2	7.2e-16
AUU85394.1|3172200_3172800_+	hypothetical protein	NA	A0A0M4QX23	Salmonella_phage	84.6	1.2e-94
AUU85395.1|3172804_3173005_+	hypothetical protein	NA	S4TNP0	Salmonella_phage	56.1	6.1e-16
AUU85396.1|3173007_3173298_+	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	89.6	2.8e-46
AUU85397.1|3173294_3173657_+	hypothetical protein	NA	K7PM48	Enterobacteria_phage	79.8	2.3e-50
AUU85398.1|3174456_3174597_+	hypothetical protein	NA	NA	NA	NA	NA
AUU85399.1|3174593_3175376_+	antitermination protein	NA	K7PKS8	Enterobacteria_phage	73.6	1.6e-107
AUU85400.1|3176312_3176498_+	hypothetical protein	NA	NA	NA	NA	NA
AUU85401.1|3176659_3176983_+	four-helix bundle copper-binding protein	NA	NA	NA	NA	NA
AUU85402.1|3177504_3177729_+|lysis	lysis protein	lysis	M9NZI9	Enterobacteria_phage	83.8	4.8e-30
AUU85403.1|3177706_3178270_+	lysozyme	NA	M9P0E5	Enterobacteria_phage	86.6	2.2e-79
AUU85404.1|3178269_3178662_+	DUF2570 domain-containing protein	NA	U5P0U9	Shigella_phage	59.7	1.0e-30
AUU85405.1|3178933_3179857_+	hypothetical protein	NA	NA	NA	NA	NA
AUU85406.1|3180003_3180999_+|terminase	terminase small subunit	terminase	I6X6R5	Burkholderia_virus	42.1	2.2e-42
AUU85407.1|3180976_3182284_+|terminase	terminase	terminase	A0A1B1P9C9	Acinetobacter_phage	59.8	7.2e-150
AUU85408.1|3182285_3183692_+	hypothetical protein	NA	A0A1B0VMH0	Pseudomonas_phage	52.6	3.2e-127
AUU85409.1|3183675_3184761_+	hypothetical protein	NA	I6PD76	Cronobacter_phage	57.7	4.2e-119
AUU85410.1|3184841_3185612_+	hypothetical protein	NA	A0A1B0VMG1	Pseudomonas_phage	60.9	5.7e-70
AUU85411.1|3185624_3186578_+	hypothetical protein	NA	A0A1B0VMF8	Pseudomonas_phage	74.1	1.2e-133
AUU85412.1|3186896_3187379_+	hypothetical protein	NA	A0A2H4J970	uncultured_Caudovirales_phage	39.2	1.3e-11
AUU85413.1|3187380_3187731_+	hypothetical protein	NA	I6PD77	Cronobacter_phage	59.5	7.8e-35
AUU85414.1|3187732_3188341_+	hypothetical protein	NA	G8C7Q1	Escherichia_phage	57.8	2.4e-55
AUU85415.1|3188312_3188723_+	hypothetical protein	NA	A0A2H4J130	uncultured_Caudovirales_phage	36.4	3.3e-16
AUU85416.1|3188772_3189450_+|tail	phage tail protein	tail	I6PBN6	Cronobacter_phage	68.8	1.0e-78
AUU85417.1|3189501_3189813_+	hypothetical protein	NA	I6PDG2	Cronobacter_phage	68.9	1.7e-36
AUU85418.1|3189860_3190124_+	hypothetical protein	NA	I6PD79	Cronobacter_phage	67.1	4.8e-21
AUU85419.1|3190123_3193579_+|tail	phage tail tape measure protein	tail	K7PMB9	Enterobacterial_phage	57.5	8.0e-281
3192401:3192417	attR	CAGGCGCAGCTGAAAAC	NA	NA	NA	NA
AUU85420.1|3193612_3193963_+	hypothetical protein	NA	G8C7R0	Escherichia_phage	79.3	1.5e-46
AUU85421.1|3193959_3194733_+|tail	phage minor tail protein L	tail	G8C7R1	Escherichia_phage	89.1	1.9e-134
AUU85422.1|3194745_3195477_+	peptidase P60	NA	G8C7R2	Escherichia_phage	91.8	6.3e-143
AUU85423.1|3195464_3196064_+|tail	phage tail protein	tail	G8C7R3	Escherichia_phage	94.0	1.2e-99
>prophage 5
CP026167	Leclercia sp. LSNIH1 chromosome, complete genome	4832521	3201762	3210487	4832521		Enterobacteria_phage(33.33%)	8	NA	NA
AUU85425.1|3201762_3203418_+	hypothetical protein	NA	A0A0E3M0V5	Enterobacteria_phage	30.0	1.2e-24
AUU85426.1|3203417_3203720_+	hypothetical protein	NA	NA	NA	NA	NA
AUU85427.1|3203729_3204686_+	hypothetical protein	NA	H6WRW6	Salmonella_phage	43.1	3.0e-28
AUU85428.1|3205806_3206046_+	hypothetical protein	NA	K7P7E2	Enterobacteria_phage	66.7	2.0e-26
AUU85429.1|3206045_3206378_+	hypothetical protein	NA	I6PCW5	Cronobacter_phage	45.5	4.2e-14
AUU85430.1|3206569_3206980_+	hemerythrin	NA	NA	NA	NA	NA
AUU85431.1|3207410_3208706_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	26.4	4.2e-25
AUU85432.1|3209026_3210487_+	D-mannonate oxidoreductase	NA	H8ZJP8	Ostreococcus_tauri_virus	32.7	2.5e-42
>prophage 1
CP026169	Leclercia sp. LSNIH1 plasmid pKPC-79f0, complete sequence	58627	0	45374	58627	integrase,transposase	Burkholderia_phage(18.75%)	41	38907:38924	46091:46108
AUU87065.1|4446_5442_-	glycosyl transferase	NA	NA	NA	NA	NA
AUU87066.1|5502_6330_-	universal stress protein	NA	A0A2H4J154	uncultured_Caudovirales_phage	42.0	3.0e-53
AUU87067.1|6348_7827_-	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	74.6	8.6e-200
AUU87068.1|8252_8876_+	serine recombinase	NA	NA	NA	NA	NA
AUU87069.1|8930_11915_+|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	54.2	3.5e-301
AUU87070.1|12154_13474_+|transposase	IS1182 family transposase ISKpn6	transposase	Q9MBP7	Staphylococcus_prophage	24.2	1.9e-12
AUU87071.1|13723_14605_-	carbapenem-hydrolyzing class A beta-lactamase KPC-2	NA	A0A1B0VBP7	Salmonella_phage	52.2	2.2e-73
AUU87072.1|15129_15834_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AUU87073.1|16406_16772_-	FipA	NA	NA	NA	NA	NA
AUU87074.1|16771_20008_-	conjugative relaxase	NA	U5J9B0	Bacillus_phage	27.3	2.4e-05
AUU87075.1|20007_21537_-	DUF87 domain-containing protein	NA	NA	NA	NA	NA
AUU87076.1|21538_21955_-	traK protein	NA	NA	NA	NA	NA
AUU87119.1|22727_22865_+	StbA	NA	NA	NA	NA	NA
AUU87077.1|22873_23590_+	StdB protein	NA	NA	NA	NA	NA
AUU87078.1|23591_23960_+	StbC	NA	NA	NA	NA	NA
AUU87120.1|24252_24486_+	hypothetical protein	NA	NA	NA	NA	NA
AUU87079.1|24596_24917_-	CcgAII protein	NA	NA	NA	NA	NA
AUU87080.1|24971_25151_-	cobalamin biosynthesis protein CbiX	NA	NA	NA	NA	NA
AUU87081.1|25877_26387_-	antirestriction protein	NA	NA	NA	NA	NA
AUU87082.1|27739_28072_-	hypothetical protein	NA	NA	NA	NA	NA
AUU87083.1|28280_28565_-	cobalamin biosynthesis protein CbiX	NA	NA	NA	NA	NA
AUU87084.1|28633_28993_-	hypothetical protein	NA	NA	NA	NA	NA
AUU87085.1|28989_29286_-	cobalamin biosynthesis protein CbiX	NA	NA	NA	NA	NA
AUU87086.1|30171_30411_-	cobalamin biosynthesis protein CbiX	NA	NA	NA	NA	NA
AUU87087.1|30420_30825_-	antirestriction protein ArdR	NA	NA	NA	NA	NA
AUU87088.1|30882_31308_-	hypothetical protein	NA	NA	NA	NA	NA
AUU87089.1|31722_32163_+	peptidase	NA	A0A1W6JNS2	Morganella_phage	48.8	1.2e-27
AUU87090.1|32150_33416_+	translesion error-prone DNA polymerase V subunit UmuC	NA	F1C5A5	Cronobacter_phage	53.8	2.2e-119
AUU87121.1|33566_34358_+	sprT domain-containing protein	NA	NA	NA	NA	NA
AUU87091.1|34372_34714_-	ArdK family transcriptional regulator	NA	NA	NA	NA	NA
AUU87092.1|35273_35993_+	RepB family plasmid replication initiator protein	NA	I3WF20	Macacine_betaherpesvirus	28.9	8.6e-20
AUU87093.1|36599_38012_+	hypothetical protein	NA	NA	NA	NA	NA
AUU87094.1|38433_39003_-	recombinase family protein	NA	E5FFF9	Burkholderia_phage	43.2	5.2e-36
38907:38924	attL	CCTGATAGATTTGCTCAC	NA	NA	NA	NA
AUU87095.1|39142_39457_-|transposase	transposase	transposase	NA	NA	NA	NA
AUU87096.1|39395_40409_-|integrase	integron integrase	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
AUU87097.1|40555_41038_+	trimethoprim-resistant dihydrofolate reductase DfrA14	NA	G3MBI7	Bacillus_virus	28.9	6.6e-16
AUU87098.1|41258_41525_+	plasmid mobilization relaxosome protein MobC	NA	NA	NA	NA	NA
AUU87099.1|41667_42432_+|transposase	IS6 family transposase IS6100	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
AUU87100.1|42473_42686_+	resolvase	NA	NA	NA	NA	NA
AUU87101.1|42698_43907_+	restriction endonuclease	NA	E5E3X4	Burkholderia_phage	42.5	1.2e-34
AUU87102.1|43940_45374_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	50.6	7.0e-106
46091:46108	attR	GTGAGCAAATCTATCAGG	NA	NA	NA	NA
>prophage 1
CP026170	Leclercia sp. LSNIH1 plasmid pLEC-000f, complete sequence	128920	13841	73532	128920	transposase,holin,integrase	Macacine_betaherpesvirus(20.0%)	44	38436:38495	72367:73283
AUU87139.1|13841_14621_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	88.4	1.5e-49
AUU87140.1|16756_17281_+	hypothetical protein	NA	NA	NA	NA	NA
AUU87141.1|17319_17559_+	hypothetical protein	NA	NA	NA	NA	NA
AUU87228.1|17801_18296_-	hypothetical protein	NA	NA	NA	NA	NA
AUU87142.1|18342_18888_-	hypothetical protein	NA	NA	NA	NA	NA
AUU87143.1|19581_20664_+	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	96.1	1.5e-185
AUU87144.1|20785_23860_+	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	95.5	0.0e+00
AUU87145.1|23911_25165_+	MFS transporter	NA	NA	NA	NA	NA
AUU87146.1|25221_25392_+	galactoside O-acetyltransferase	NA	NA	NA	NA	NA
AUU87147.1|28637_29195_-	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	81.3	2.6e-48
AUU87148.1|29324_29537_-	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
AUU87229.1|29499_29619_+	mercury resistance protein	NA	NA	NA	NA	NA
AUU87149.1|29602_29839_-	mercury resistance protein	NA	NA	NA	NA	NA
AUU87150.1|29835_30201_-	transcriptional regulator	NA	NA	NA	NA	NA
AUU87151.1|30218_31904_-	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	29.1	1.8e-39
AUU87152.1|31942_32368_-	mercury transport protein MerC	NA	NA	NA	NA	NA
AUU87153.1|32619_33324_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	6.9e-139
AUU87154.1|33742_34156_-	hypothetical protein	NA	NA	NA	NA	NA
AUU87155.1|34832_35234_+	hypothetical protein	NA	NA	NA	NA	NA
AUU87156.1|36094_36493_+	DNA-binding protein	NA	NA	NA	NA	NA
AUU87157.1|37541_37853_+	cytoplasmic protein	NA	NA	NA	NA	NA
AUU87158.1|37849_38269_+	transcriptional regulator	NA	NA	NA	NA	NA
38436:38495	attL	TGAATCGCCACGGATAATCTAGACACTTCCTAGCCGTTGATAATACTGGTTTTCATATTC	NA	NA	NA	NA
AUU87159.1|39251_39458_+|transposase	transposase	transposase	NA	NA	NA	NA
AUU87160.1|39414_40566_+|transposase	IS30 family transposase IS30	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
AUU87230.1|43937_45145_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	62.9	5.7e-101
AUU87161.1|45471_45867_+	hypothetical protein	NA	NA	NA	NA	NA
AUU87162.1|48118_49090_-	plasmid-partitioning protein	NA	I3WF22	Macacine_betaherpesvirus	62.9	3.5e-109
AUU87163.1|49089_50256_-	plasmid-partitioning protein SopA	NA	A0A2I6B2X3	Macacine_betaherpesvirus	93.3	3.2e-218
AUU87164.1|50920_51781_-	protein RepA	NA	Q71TL8	Escherichia_phage	48.9	3.6e-65
AUU87165.1|53010_54201_-	MFS transporter	NA	NA	NA	NA	NA
AUU87166.1|54288_55083_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AUU87167.1|56207_57131_+	aminoimidazole riboside kinase	NA	NA	NA	NA	NA
AUU87168.1|57296_58814_+	carbohydrate porin	NA	NA	NA	NA	NA
AUU87169.1|58949_60320_+	PTS sucrose EIIBC component	NA	NA	NA	NA	NA
AUU87170.1|60319_61720_+	glycosyl hydrolase family 32	NA	S6ATV4	Bacillus_phage	24.4	6.2e-14
AUU87171.1|61749_62754_+	transcriptional regulator	NA	NA	NA	NA	NA
AUU87172.1|63032_63932_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUU87173.1|65542_65731_-	hypothetical protein	NA	NA	NA	NA	NA
AUU87174.1|66073_66505_-	hypothetical protein	NA	NA	NA	NA	NA
AUU87175.1|66863_67196_+	hypothetical protein	NA	NA	NA	NA	NA
AUU87176.1|67961_68141_+	hypothetical protein	NA	NA	NA	NA	NA
AUU87177.1|68289_70287_+|holin	high-affinity choline transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	24.7	1.4e-19
AUU87178.1|70776_71769_-|integrase	integrase	integrase	A0A0K0N6I5	Gordonia_phage	32.7	2.3e-07
AUU87179.1|72384_73532_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	93.3	3.5e-148
72367:73283	attR	TGAATCGCCACGGATAATCTAGACACTTCCTAGCCGTTGATAATACTGGTTTTCATATTCTGTCGGTGACATCTGATCGCTGGAACCATGCCGACGCTTACTGTTATAAAACATTTCGATGTAATCAAAAATATCGCTGCGGGCTTCTTCCCGCGTTCCGTAGATCTTTTTCTTTATCCGTTCACGTTTCAACAACTGGAAAAAGCTTTCTGCAACCGCATTATCATGGCAGTTACCGCGACGGCTCATGCTGCCCTCCAGGCCGTGTGATTTCAGGAACGACTGCCACTCATGGCTTGTGTACTGACTGCCCTGATCCGAATGAACCAGCACCTGTTTTTGGGGATTACGCCGCCATACAGCCATCAGCAGTGCGTTCAGGACAATGTCCTTTGTCATCCGGGATTGCATGGACCAGCCGATAATTTTGCGTGAGAACAGATCAACAACCACGGCAAGATACAGCCAGCCTTCGTGGGTCCTGATGTAGGTTATGTCCGTTACCCAACGCTCATCCGGAGCATCCGGATTGAACTGTCGCTGGAGCCTGTTGGGCGACACGATACTGGCCTCGCCTTTACGTGCCCGCGGGCTCCGGTATCCGACCTGAGCCTTTATCCCGACACGTTTCATCAGTCGCCAGACTCTGTTCACTCCGCACTGTTGCCCGCTGTCCCGCAGATCCAGATGGATTTTGCGATAACCATAGACGCATCCCGATTCCAGCCAGAACTGTTTAATCTGCCCTGTCAGCCTCAGGTCTGCCTGATGGCGTTGTGAATGCGGCTGCTGAAGCCAGGCGTAAAAACCACTGGGATGAACATCCAGCACCCGACAGAGCAGGCGAACAGGCCAGCAACAGGTGTTGTCACGGATAAAGGCGTACCTCAGTCGGACAGCTTTGCGAAGTACGCCGC	NA	NA	NA	NA
>prophage 2
CP026170	Leclercia sp. LSNIH1 plasmid pLEC-000f, complete sequence	128920	93320	107068	128920	transposase,integrase	Salmonella_phage(25.0%)	14	94131:94146	108212:108227
AUU87193.1|93320_95726_+	copper-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	45.8	1.9e-140
94131:94146	attL	CTGTTCGCGCTGGCCG	NA	NA	NA	NA
AUU87194.1|95722_96802_+	signal peptidase II	NA	NA	NA	NA	NA
AUU87195.1|96977_97538_+|transposase	transposase	transposase	A0A1B0V7I5	Salmonella_phage	100.0	1.1e-59
AUU87196.1|97541_100508_+|transposase	Tn3-like element TnAs1 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	100.0	0.0e+00
AUU87197.1|100967_101225_-	DDE domain-containing protein	NA	A0A077SL39	Escherichia_phage	61.9	8.9e-12
AUU87198.1|101288_102053_-|transposase	IS6 family transposase IS6100	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
AUU87199.1|102140_102254_+	NTP-binding protein	NA	NA	NA	NA	NA
AUU87200.1|102559_103060_-	N-acetyltransferase	NA	NA	NA	NA	NA
AUU87201.1|103078_103258_+	hypothetical protein	NA	NA	NA	NA	NA
AUU87202.1|103187_104027_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
AUU87203.1|104020_104368_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
AUU87204.1|104531_105323_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA1	NA	NA	NA	NA	NA
AUU87205.1|105424_105898_-	trimethoprim-resistant dihydrofolate reductase DfrA15	NA	G3MBI7	Bacillus_virus	30.8	6.9e-18
AUU87206.1|106054_107068_+|integrase	integron integrase	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
108212:108227	attR	CGGCCAGCGCGAACAG	NA	NA	NA	NA
>prophage 1
CP026171	Leclercia sp. LSNIH1 plasmid pLEC-1cb1, complete sequence	341250	222544	286325	341250	transposase,integrase	Escherichia_phage(40.0%)	71	233506:233519	253403:253416
AUU87569.1|222544_223891_+|transposase	transposase	transposase	NA	NA	NA	NA
AUU87437.1|223949_224741_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
AUU87438.1|224781_225618_-	hypothetical protein	NA	NA	NA	NA	NA
AUU87439.1|225674_226238_-	hypothetical protein	NA	NA	NA	NA	NA
AUU87440.1|226604_226898_-	hypothetical protein	NA	NA	NA	NA	NA
AUU87441.1|226918_227218_-	hypothetical protein	NA	NA	NA	NA	NA
AUU87442.1|227281_227512_-	hypothetical protein	NA	NA	NA	NA	NA
AUU87443.1|227533_228481_-	hypothetical protein	NA	NA	NA	NA	NA
AUU87444.1|228477_228993_-	nuclease	NA	V5UN65	Mycobacterium_phage	28.9	3.2e-08
AUU87445.1|229215_230643_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	49.4	9.5e-103
AUU87446.1|230768_230939_+	hypothetical protein	NA	A0A1P7WFU2	Pectobacterium_phage	56.4	2.3e-08
AUU87447.1|230962_232282_+	DUF1173 domain-containing protein	NA	NA	NA	NA	NA
AUU87448.1|232295_232499_+	hypothetical protein	NA	NA	NA	NA	NA
AUU87449.1|232553_233774_-	hypothetical protein	NA	NA	NA	NA	NA
233506:233519	attL	GCCAGCATCTCCTG	NA	NA	NA	NA
AUU87450.1|233776_234589_-	DUF4942 domain-containing protein	NA	NA	NA	NA	NA
AUU87570.1|235089_235755_+	hypothetical protein	NA	NA	NA	NA	NA
AUU87451.1|235792_236245_+	hypothetical protein	NA	NA	NA	NA	NA
AUU87452.1|236820_237276_-	Hg(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
AUU87453.1|237347_237743_+	mercuric ion transporter MerT	NA	NA	NA	NA	NA
AUU87454.1|237758_238034_+	mercuric transporter periplasmic component	NA	NA	NA	NA	NA
AUU87455.1|238061_238487_+	mercury transport protein MerC	NA	NA	NA	NA	NA
AUU87456.1|238525_240211_+	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	29.1	1.8e-39
AUU87457.1|240228_240594_+	transcriptional regulator	NA	NA	NA	NA	NA
AUU87458.1|240590_240827_+	mercury resistance protein	NA	NA	NA	NA	NA
AUU87571.1|240810_240930_-	mercury resistance protein	NA	NA	NA	NA	NA
AUU87459.1|240892_241105_+	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
AUU87460.1|241124_241301_-	resolvase	NA	NA	NA	NA	NA
AUU87461.1|241342_242107_-|transposase	IS6 family transposase IS6100	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
AUU87462.1|242194_242308_+	NTP-binding protein	NA	NA	NA	NA	NA
AUU87463.1|242613_243114_-	N-acetyltransferase	NA	NA	NA	NA	NA
AUU87464.1|243132_243312_+	hypothetical protein	NA	NA	NA	NA	NA
AUU87465.1|243241_244081_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
AUU87466.1|244280_244937_-	quinolone resistance pentapeptide repeat protein QnrA1	NA	NA	NA	NA	NA
AUU87467.1|245269_246811_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
AUU87468.1|247215_248055_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
AUU87469.1|248048_248396_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
AUU87470.1|248559_249351_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA1	NA	NA	NA	NA	NA
AUU87471.1|249442_249748_-	hypothetical protein	NA	NA	NA	NA	NA
AUU87472.1|249763_250276_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AUU87473.1|250394_250859_-	AAC(3)-I family aminoglycoside 3-N-acetyltransferase	NA	NA	NA	NA	NA
AUU87572.1|250934_251489_-	aminoglycoside N-acetyltransferase AAC(6')-Ib3	NA	NA	NA	NA	NA
AUU87474.1|251649_252663_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	6.1e-72
AUU87475.1|252601_252859_+	hypothetical protein	NA	NA	NA	NA	NA
AUU87476.1|252804_253509_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
253403:253416	attR	GCCAGCATCTCCTG	NA	NA	NA	NA
AUU87477.1|254481_255570_-	chromosome segregation protein SMC	NA	A0A077SLJ9	Escherichia_phage	100.0	8.0e-211
AUU87478.1|255656_255917_-	hypothetical protein	NA	A0A077SK33	Escherichia_phage	100.0	1.9e-41
AUU87479.1|256214_257075_+	class A extended-spectrum beta-lactamase SHV-5	NA	A0A077SL40	Escherichia_phage	99.7	4.4e-156
AUU87480.1|257095_257857_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
AUU87481.1|258117_259020_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	100.0	5.3e-160
AUU87482.1|259031_260297_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	99.8	4.6e-234
AUU87483.1|260289_260910_+	aldolase	NA	A0A077SK32	Escherichia_phage	100.0	8.0e-115
AUU87484.1|261621_262326_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AUU87485.1|262488_263511_+|transposase	IS110-like element IS5708 family transposase	transposase	NA	NA	NA	NA
AUU87486.1|264346_265738_+	NAD-dependent succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
AUU87487.1|265836_266805_+|transposase	IS5/IS1182 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	91.3	3.8e-172
AUU87573.1|267066_267864_-	KR domain-containing protein	NA	Q06VL0	Trichoplusia_ni_ascovirus	26.9	5.1e-13
AUU87488.1|268025_268994_+|transposase	IS5/IS1182 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	91.6	1.7e-172
AUU87574.1|269197_270127_+|transposase	ISNCY family transposase	transposase	Q2A0A7	Sodalis_phage	53.1	1.4e-75
AUU87575.1|271426_272407_-	NAD(P)H-quinone oxidoreductase	NA	NA	NA	NA	NA
AUU87489.1|273109_274633_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.8	4.8e-44
AUU87490.1|274926_275337_+	hypothetical protein	NA	NA	NA	NA	NA
AUU87491.1|275728_276880_-|transposase	IS30 family transposase IS30	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
AUU87492.1|276836_277193_-	hypothetical protein	NA	U5P4I9	Shigella_phage	91.2	1.3e-32
AUU87493.1|278264_278561_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AUU87494.1|278984_279641_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
AUU87576.1|279703_280687_-	oxidoreductase	NA	NA	NA	NA	NA
AUU87495.1|281898_282174_+	regulator protein FrmR	NA	NA	NA	NA	NA
AUU87496.1|282208_283318_+	S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase	NA	E3SJ82	Synechococcus_phage	28.3	4.9e-30
AUU87497.1|283361_283760_+	VOC family protein	NA	NA	NA	NA	NA
AUU87498.1|283824_284661_+	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
AUU87499.1|285248_286325_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
>prophage 1
CP026168	Leclercia sp. LSNIH1 plasmid pLEC-b38d, complete sequence	50622	0	17952	50622	transposase	Salmonella_phage(50.0%)	20	NA	NA
AUU87003.1|2123_2753_-	hypothetical protein	NA	NA	NA	NA	NA
AUU87058.1|2998_3628_-	hypothetical protein	NA	NA	NA	NA	NA
AUU87004.1|3909_4419_-	transcription termination factor NusG	NA	NA	NA	NA	NA
AUU87005.1|4705_4966_-	conjugal transfer protein TraA	NA	NA	NA	NA	NA
AUU87006.1|5417_6080_-	hypothetical protein	NA	NA	NA	NA	NA
AUU87007.1|6350_6551_+	plasmid stabilization protein	NA	NA	NA	NA	NA
AUU87008.1|6856_7393_+	hypothetical protein	NA	NA	NA	NA	NA
AUU87009.1|7389_8412_+	replication initiation protein	NA	NA	NA	NA	NA
AUU87010.1|8907_9210_-	hypothetical protein	NA	NA	NA	NA	NA
AUU87059.1|9958_10414_+	hypothetical protein	NA	NA	NA	NA	NA
AUU87011.1|10578_11391_-|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	78.4	3.0e-37
AUU87012.1|11549_11840_+	nucleotidyltransferase	NA	NA	NA	NA	NA
AUU87013.1|11836_12238_+	DUF86 domain-containing protein	NA	NA	NA	NA	NA
AUU87014.1|12227_12584_+	cupin domain-containing protein	NA	NA	NA	NA	NA
AUU87015.1|12838_13165_+	hypothetical protein	NA	NA	NA	NA	NA
AUU87016.1|13161_13662_+|transposase	transposase	transposase	NA	NA	NA	NA
AUU87017.1|13658_14030_+	hypothetical protein	NA	NA	NA	NA	NA
AUU87018.1|14023_14581_+	recombinase family protein	NA	A0A0C4UR34	Shigella_phage	63.2	3.3e-59
AUU87019.1|14577_14958_-	chromosome partitioning protein ParB	NA	A0A0R6PHV6	Moraxella_phage	46.2	1.4e-13
AUU87020.1|14964_17952_-|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	53.3	5.5e-294
>prophage 2
CP026168	Leclercia sp. LSNIH1 plasmid pLEC-b38d, complete sequence	50622	21794	24298	50622	transposase	Escherichia_phage(33.33%)	3	NA	NA
AUU87023.1|21794_22499_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AUU87024.1|22508_22973_+	hypothetical protein	NA	W8CYM9	Bacillus_phage	31.5	1.6e-11
AUU87025.1|22948_24298_+	two-component sensor histidine kinase	NA	Q8QKV7	Ectocarpus_siliculosus_virus	25.6	2.9e-08
>prophage 3
CP026168	Leclercia sp. LSNIH1 plasmid pLEC-b38d, complete sequence	50622	27508	33782	50622		Escherichia_phage(42.86%)	10	NA	NA
AUU87028.1|27508_27709_-	hypothetical protein	NA	A0A2L1IV26	Escherichia_phage	93.3	6.1e-08
AUU87029.1|27784_28576_+	resolvase	NA	I3WFA4	Macacine_betaherpesvirus	92.9	6.5e-53
AUU87030.1|28726_28918_-	hypothetical protein	NA	NA	NA	NA	NA
AUU87031.1|28914_29100_-	hypothetical protein	NA	NA	NA	NA	NA
AUU87032.1|29390_30023_+	hypothetical protein	NA	A0A0K1LMB9	Rhodobacter_phage	40.3	8.1e-30
AUU87033.1|30022_30433_+	hypothetical protein	NA	NA	NA	NA	NA
AUU87034.1|30713_31688_+	plasmid segregation protein parM	NA	A0A222YXF2	Escherichia_phage	43.1	7.5e-67
AUU87035.1|31692_32082_+	plasmid stability protein	NA	A0A222YWJ6	Escherichia_phage	45.5	1.1e-05
AUU87036.1|32085_33354_-	DNA polymerase V subunit UmuC	NA	F1C5A5	Cronobacter_phage	61.0	1.5e-147
AUU87037.1|33353_33782_-	peptidase	NA	A0A1W6JNS2	Morganella_phage	47.7	7.4e-27
>prophage 4
CP026168	Leclercia sp. LSNIH1 plasmid pLEC-b38d, complete sequence	50622	38520	39659	50622		Rhodococcus_phage(50.0%)	3	NA	NA
AUU87045.1|38520_39024_+	antirestriction protein	NA	A0A1I9S7Y0	Rhodococcus_phage	34.7	4.3e-10
AUU87046.1|39061_39247_+	hypothetical protein	NA	NA	NA	NA	NA
AUU87047.1|39404_39659_+	DNA polymerase III subunit theta	NA	A0A077SLL5	Escherichia_phage	65.5	2.7e-21
>prophage 5
CP026168	Leclercia sp. LSNIH1 plasmid pLEC-b38d, complete sequence	50622	46336	48661	50622		uncultured_Caudovirales_phage(100.0%)	2	NA	NA
AUU87055.1|46336_47164_-	universal stress protein	NA	A0A2H4J154	uncultured_Caudovirales_phage	42.0	3.0e-53
AUU87056.1|47182_48661_-	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	74.6	8.6e-200
