The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP026192	Enterobacteriaceae bacterium ENNIH2 chromosome, complete genome	5956094	17973	75916	5956094	integrase,transposase,plate,capsid	Enterobacteria_phage(30.77%)	59	15925:15940	81651:81666
15925:15940	attL	TTGTCAGCCAGTGGGA	NA	NA	NA	NA
AUV05128.1|17973_19236_+|transposase	IS1380 family transposase ISEc9	transposase	A0A1B0VDR3	Salmonella_phage	100.0	1.3e-39
AUV05129.1|19495_21073_+	hypothetical protein	NA	NA	NA	NA	NA
AUV05130.1|21090_21675_+	hypothetical protein	NA	NA	NA	NA	NA
AUV05131.1|21687_22716_+	hypothetical protein	NA	NA	NA	NA	NA
AUV05132.1|22766_23054_+	zinc/iron-chelating domain-containing protein	NA	NA	NA	NA	NA
AUV10402.1|23643_24048_+	hypothetical protein	NA	NA	NA	NA	NA
AUV05133.1|24034_24406_+	hypothetical protein	NA	NA	NA	NA	NA
AUV05134.1|24802_25303_-	hypothetical protein	NA	NA	NA	NA	NA
AUV05135.1|25299_26487_-	abortive infection protein	NA	NA	NA	NA	NA
AUV05136.1|27278_27551_-	transcriptional regulator	NA	F1BUM8	Cronobacter_phage	53.5	7.7e-22
AUV05137.1|27832_30526_-	alkaline-shock protein	NA	A0A1B0VP75	Pseudomonas_phage	34.4	1.9e-59
AUV05138.1|30516_30924_-	hypothetical protein	NA	NA	NA	NA	NA
AUV05139.1|30913_31153_-	hypothetical protein	NA	NA	NA	NA	NA
AUV05140.1|31149_31692_-	Ash-like/host cell division inhibitor Icd-like protein	NA	Q7M2A7	Enterobacteria_phage	45.1	2.2e-15
AUV05141.1|31815_32820_-|capsid	major capsid protein	capsid	F1BUM2	Cronobacter_phage	50.0	1.4e-81
AUV05142.1|32836_33703_-	hypothetical protein	NA	NA	NA	NA	NA
AUV05143.1|33735_33939_-	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
AUV10403.1|34045_34837_-	hypothetical protein	NA	NA	NA	NA	NA
AUV05144.1|34846_36028_-|integrase	integrase	integrase	Q7M297	Enterobacteria_phage	56.2	8.0e-124
AUV05145.1|36384_37638_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	46.1	9.8e-96
AUV05146.1|37649_38753_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	39.9	2.0e-60
AUV05147.1|39049_40291_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	58.2	3.3e-96
AUV05148.1|40905_41088_+	hypothetical protein	NA	Q1MVN1	Enterobacteria_phage	63.6	2.4e-11
AUV05149.1|41256_42528_-	hypothetical protein	NA	NA	NA	NA	NA
AUV05150.1|42539_43277_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.4	1.9e-30
AUV05151.1|43273_43918_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
AUV05152.1|43914_44652_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
AUV05153.1|44706_45531_-	amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUV05154.1|45642_46035_-	RidA family protein	NA	NA	NA	NA	NA
AUV05155.1|46449_47202_+	IclR family transcriptional regulator	NA	NA	NA	NA	NA
AUV05156.1|47343_47742_-	Crl family RNA polymerase assembly factor	NA	NA	NA	NA	NA
AUV05157.1|47799_49044_-	esterase FrsA	NA	NA	NA	NA	NA
AUV05158.1|49152_49611_-	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
AUV05159.1|49566_49764_+	hypothetical protein	NA	NA	NA	NA	NA
AUV05160.1|49869_51327_+	cytosol nonspecific dipeptidase	NA	NA	NA	NA	NA
AUV05161.1|51404_52463_-	DNA polymerase IV	NA	NA	NA	NA	NA
AUV05162.1|52768_53509_+	transpeptidase	NA	NA	NA	NA	NA
AUV05163.1|53479_54247_-	class II glutamine amidotransferase	NA	NA	NA	NA	NA
AUV05164.1|54247_54388_-	L-asparaginase	NA	NA	NA	NA	NA
AUV05165.1|54395_54977_-	D-sedoheptulose 7-phosphate isomerase	NA	A0A067XQR2	Caulobacter_phage	28.4	1.8e-12
AUV05166.1|55227_57672_+	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
AUV05167.1|57783_58554_+	amidohydrolase	NA	NA	NA	NA	NA
AUV05168.1|58852_60094_-	allantoate amidohydrolase	NA	NA	NA	NA	NA
AUV05169.1|60093_61332_-	aminotransferase	NA	NA	NA	NA	NA
AUV05170.1|61534_62374_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
AUV10404.1|62488_64072_+	gamma-glutamyltransferase	NA	NA	NA	NA	NA
AUV05171.1|64081_64270_+	DUF4089 domain-containing protein	NA	NA	NA	NA	NA
AUV05172.1|64266_65640_+	AtzE family amidohydrolase	NA	NA	NA	NA	NA
AUV05173.1|65639_66023_+	DUF3225 domain-containing protein	NA	NA	NA	NA	NA
AUV05174.1|66006_66411_-	hypothetical protein	NA	NA	NA	NA	NA
AUV05175.1|66664_67609_-	allantoinase PuuE	NA	NA	NA	NA	NA
AUV05176.1|67638_68376_-	Asp/Glu racemase	NA	NA	NA	NA	NA
AUV05177.1|68372_69092_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AUV05178.1|69238_70711_+	nitrate reductase	NA	NA	NA	NA	NA
AUV05179.1|70782_71877_-	type VI secretion system protein VasL	NA	NA	NA	NA	NA
AUV05180.1|71880_72306_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
AUV05181.1|72309_72846_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
AUV05182.1|72826_73909_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
AUV10405.1|74708_75916_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	62.7	2.6e-101
81651:81666	attR	TCCCACTGGCTGACAA	NA	NA	NA	NA
>prophage 2
CP026192	Enterobacteriaceae bacterium ENNIH2 chromosome, complete genome	5956094	435020	531501	5956094	transposase,protease,tail,head,plate,tRNA	Pseudomonas_phage(32.5%)	103	NA	NA
AUV05487.1|435020_435626_-|protease	ATP-dependent Clp protease proteolytic subunit	protease	G3M9Z8	Bacillus_virus	40.6	5.3e-31
AUV05488.1|435718_435886_-	DUF1127 domain-containing protein	NA	NA	NA	NA	NA
AUV05489.1|436062_437481_+	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
AUV05490.1|437612_439709_-	ferrioxamine B receptor FoxA	NA	NA	NA	NA	NA
AUV05491.1|439873_440827_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AUV05492.1|441515_442091_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
AUV05493.1|442246_443368_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
AUV05494.1|443367_446475_+	hydrophobe/amphiphile efflux-1 family RND transporter	NA	NA	NA	NA	NA
AUV05495.1|446477_447842_+	multidrug transporter	NA	NA	NA	NA	NA
AUV05496.1|447932_448826_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
AUV05497.1|448822_449773_-	preprotein translocase YidC	NA	NA	NA	NA	NA
AUV05498.1|449786_450839_-	iron ABC transporter permease	NA	NA	NA	NA	NA
AUV05499.1|450835_451852_-	heme ABC transporter	NA	NA	NA	NA	NA
AUV05500.1|451848_452676_-	cobalamin/Fe(3+)-siderophore ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.4	6.0e-17
AUV10422.1|453112_455272_+	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
AUV05501.1|456840_457611_-	phage repressor protein C	NA	A0A2I7S9A5	Vibrio_phage	37.5	8.0e-40
AUV05502.1|457745_458003_+	transcriptional regulator	NA	M1PVU4	Vibrio_phage	64.6	2.1e-16
AUV05503.1|458002_460051_+|transposase	transposase	transposase	A0A2D1GNK9	Pseudomonas_phage	48.3	1.1e-173
AUV05504.1|460058_460952_+	ATPase	NA	A0A2D1GNS0	Pseudomonas_phage	59.7	1.8e-96
AUV05505.1|460962_461253_+	hypothetical protein	NA	NA	NA	NA	NA
AUV05506.1|461263_461497_+	hypothetical protein	NA	A0A0S3UG15	Pseudomonas_phage	37.9	4.9e-09
AUV05507.1|461484_461682_+	hypothetical protein	NA	NA	NA	NA	NA
AUV05508.1|461671_462331_+	sulfate transporter	NA	A4JWM8	Burkholderia_virus	67.5	8.9e-72
AUV05509.1|462332_462575_+	hypothetical protein	NA	NA	NA	NA	NA
AUV05510.1|462555_462747_+	hypothetical protein	NA	NA	NA	NA	NA
AUV05511.1|462825_463041_+	hypothetical protein	NA	NA	NA	NA	NA
AUV05512.1|463051_463771_+	hypothetical protein	NA	A0A0S4L2R2	Pseudomonas_phage	30.5	1.4e-14
AUV10423.1|463992_464295_+	hypothetical protein	NA	I3UM56	Rhodobacter_phage	46.6	9.5e-13
AUV05513.1|464291_464492_+	hypothetical protein	NA	NA	NA	NA	NA
AUV05514.1|464488_464851_+	hypothetical protein	NA	A0A0K1LK36	Vibrio_phage	56.7	3.5e-22
AUV05515.1|464843_465059_+	hypothetical protein	NA	NA	NA	NA	NA
AUV10424.1|465058_465247_+	hypothetical protein	NA	NA	NA	NA	NA
AUV05516.1|465934_466150_+	hypothetical protein	NA	A0A2D1GNS9	Pseudomonas_phage	68.6	3.9e-21
AUV05517.1|466209_466686_+	regulatory protein GemA	NA	A0A2D1GNN4	Pseudomonas_phage	60.6	1.5e-41
AUV05518.1|466630_467071_+	hypothetical protein	NA	A0A2D1GNW5	Pseudomonas_phage	44.7	1.7e-26
AUV10425.1|467073_467421_+	hypothetical protein	NA	NA	NA	NA	NA
AUV05519.1|467500_468145_+	glycoside hydrolase family 19	NA	A0A2D1GNI0	Pseudomonas_phage	61.5	3.5e-65
AUV05520.1|468135_468384_+	hypothetical protein	NA	NA	NA	NA	NA
AUV05521.1|468373_469009_+	hypothetical protein	NA	NA	NA	NA	NA
AUV05522.1|469005_469251_+	hypothetical protein	NA	NA	NA	NA	NA
AUV05523.1|469247_469550_+	hypothetical protein	NA	NA	NA	NA	NA
AUV05524.1|469549_470050_+	DNA-binding protein	NA	A0A0A1IX73	Pseudomonas_phage	54.8	3.4e-47
AUV05525.1|470042_470240_+	hypothetical protein	NA	NA	NA	NA	NA
AUV05526.1|470244_471945_+	hypothetical protein	NA	H6V8N6	Pseudomonas_phage	62.1	1.5e-195
AUV05527.1|471944_473513_+	hypothetical protein	NA	A0A125RNC0	Pseudomonas_phage	47.0	6.5e-129
AUV05528.1|473505_474777_+|head	phage head morphogenesis protein	head	A0A0M4UTA3	Ralstonia_phage	40.7	6.5e-63
AUV05529.1|474766_475309_+	phage virion morphogenesis protein	NA	A0A2H4J9E5	uncultured_Caudovirales_phage	40.2	8.5e-20
AUV05530.1|475543_476632_+	hypothetical protein	NA	A0A2D1GNS3	Pseudomonas_phage	42.8	5.2e-53
AUV05531.1|476624_477020_+	hypothetical protein	NA	J9RWG0	Pseudomonas_phage	47.7	3.6e-20
AUV05532.1|477031_477940_+|head	head protein	head	A0A2H4J778	uncultured_Caudovirales_phage	61.9	1.4e-104
AUV05533.1|478405_478834_+	DUF1320 domain-containing protein	NA	NA	NA	NA	NA
AUV05534.1|478830_479487_+	hypothetical protein	NA	NA	NA	NA	NA
AUV10426.1|479476_479728_+	hypothetical protein	NA	A0A0M3LQM9	Mannheimia_phage	56.5	4.2e-06
AUV05535.1|479727_481146_+|tail	phage tail protein	tail	B7SDP8	Haemophilus_phage	49.0	7.2e-103
AUV05536.1|481157_481532_+|tail	phage tail protein	tail	A0A0M3LRV6	Mannheimia_phage	55.9	4.9e-27
AUV05537.1|481528_481927_+	hypothetical protein	NA	NA	NA	NA	NA
AUV05538.1|482046_484584_+|tail	phage tail tape measure protein	tail	A0A0M3LPB6	Mannheimia_phage	32.2	6.3e-65
AUV05539.1|484583_486005_+	multidrug DMT transporter permease	NA	A0A2H4JGT4	uncultured_Caudovirales_phage	30.6	9.0e-45
AUV05540.1|485988_487200_+|tail	phage tail protein	tail	A0A2H4J9E6	uncultured_Caudovirales_phage	37.3	3.8e-76
AUV05541.1|487183_487765_+|plate	phage baseplate assembly protein V	plate	F6MIL4	Haemophilus_phage	55.1	4.9e-42
AUV05542.1|487827_488184_+	hypothetical protein	NA	A0A0M3LQK5	Mannheimia_phage	48.3	2.0e-22
AUV05543.1|488183_489245_+|tail	phage tail protein	tail	F6MIL6	Haemophilus_phage	47.0	5.4e-79
AUV05544.1|489241_489814_+|tail	phage tail protein	tail	F6MIL7	Haemophilus_phage	43.5	3.9e-39
AUV05545.1|491321_491759_+|tail	phage tail protein	tail	U5P083	Shigella_phage	49.3	7.5e-27
AUV05546.1|491819_493658_+	hypothetical protein	NA	NA	NA	NA	NA
AUV05547.1|494635_495034_-	hypothetical protein	NA	NA	NA	NA	NA
AUV05548.1|495136_495772_-	hypothetical protein	NA	NA	NA	NA	NA
AUV05549.1|495783_496716_-	hypothetical protein	NA	NA	NA	NA	NA
AUV05550.1|496696_496933_-	hypothetical protein	NA	NA	NA	NA	NA
AUV05551.1|496952_497381_-	hypothetical protein	NA	NA	NA	NA	NA
AUV05552.1|498406_498697_+	hypothetical protein	NA	NA	NA	NA	NA
AUV05553.1|499018_499579_-	recombinase family protein	NA	G8I4U3	Mycobacterium_phage	39.8	3.7e-26
AUV05554.1|499982_500183_+	hypothetical protein	NA	NA	NA	NA	NA
AUV05555.1|500460_500727_+	hypothetical protein	NA	NA	NA	NA	NA
AUV05556.1|500816_501260_+	hypothetical protein	NA	NA	NA	NA	NA
AUV05557.1|502473_503487_+	HNH endonuclease	NA	NA	NA	NA	NA
AUV05558.1|503486_504065_+	class I SAM-dependent methyltransferase	NA	A0A2H4J5G6	uncultured_Caudovirales_phage	46.2	2.5e-14
AUV05559.1|504122_505142_+	NAD(P)-dependent alcohol dehydrogenase	NA	A0A2K9L7I1	Tupanvirus	31.4	4.6e-43
AUV05560.1|505361_507002_-	DAK2 domain-containing protein	NA	NA	NA	NA	NA
AUV05561.1|507167_508250_-	lipopolysaccharide ABC transporter permease LptG	NA	NA	NA	NA	NA
AUV05562.1|508249_509350_-	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
AUV05563.1|509744_511256_+	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	38.0	7.8e-47
AUV05564.1|511380_511824_+	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
AUV05565.1|511823_514679_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	37.2	8.4e-143
AUV05566.1|514821_516024_-	DUF898 domain-containing protein	NA	NA	NA	NA	NA
AUV05567.1|516232_517450_-	DUF898 domain-containing protein	NA	NA	NA	NA	NA
AUV05568.1|517601_518105_+	N-acetyltransferase	NA	NA	NA	NA	NA
AUV05569.1|518154_518982_-	topoisomerase II	NA	NA	NA	NA	NA
AUV05570.1|519073_519832_-|tRNA	tRNA isopentenyl-2-thiomethyl-A-37 hydroxylase MiaE	tRNA	NA	NA	NA	NA
AUV05571.1|519879_520302_-	ribonuclease E inhibitor RraB	NA	NA	NA	NA	NA
AUV05572.1|520464_521469_+	ornithine carbamoyltransferase	NA	NA	NA	NA	NA
AUV05573.1|522006_522732_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AUV05574.1|522818_524237_-	YfcC family protein	NA	NA	NA	NA	NA
AUV05575.1|524305_525874_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
AUV05576.1|525963_526794_-	fructoselysine 6-kinase	NA	NA	NA	NA	NA
AUV05577.1|526804_527779_-	SIS domain-containing protein	NA	NA	NA	NA	NA
AUV05578.1|528057_528510_-	YhcH/YjgK/YiaL family protein	NA	NA	NA	NA	NA
AUV05579.1|528770_528932_+	pyr operon leader peptide	NA	NA	NA	NA	NA
AUV05580.1|528924_529860_+	aspartate carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	40.5	2.5e-51
AUV05581.1|529872_530334_+	aspartate carbamoyltransferase regulatory subunit	NA	NA	NA	NA	NA
AUV05582.1|530458_530845_+	2-iminobutanoate/2-iminopropanoate deaminase	NA	NA	NA	NA	NA
AUV05583.1|530841_531030_-	hypothetical protein	NA	NA	NA	NA	NA
AUV05584.1|531042_531501_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 3
CP026192	Enterobacteriaceae bacterium ENNIH2 chromosome, complete genome	5956094	739296	746420	5956094		uncultured_Caudovirales_phage(100.0%)	9	NA	NA
AUV05776.1|739296_739650_+	transcriptional regulator	NA	A0A2H4J145	uncultured_Caudovirales_phage	47.2	5.9e-22
AUV05777.1|739706_740186_+	arsenate reductase ArsC	NA	A0A2H4J8A6	uncultured_Caudovirales_phage	51.3	1.8e-34
AUV05778.1|740208_740574_+	arsenical resistance operon transcriptional repressor ArsD	NA	NA	NA	NA	NA
AUV05779.1|740597_742364_+	arsenical pump-driving ATPase	NA	NA	NA	NA	NA
AUV05780.1|742404_743694_+	arsenical efflux pump membrane protein ArsB	NA	A0A2H4J144	uncultured_Caudovirales_phage	72.5	3.3e-171
AUV05781.1|743751_744180_+	arsenate reductase (glutaredoxin)	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	70.7	1.8e-49
AUV05782.1|744252_744762_+	arsenate reductase ArsC	NA	A0A2H4J8A6	uncultured_Caudovirales_phage	37.8	6.5e-22
AUV05783.1|744901_745399_+	phosphatase	NA	NA	NA	NA	NA
AUV05784.1|745697_746420_+	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	73.0	1.8e-97
>prophage 4
CP026192	Enterobacteriaceae bacterium ENNIH2 chromosome, complete genome	5956094	861958	904536	5956094	portal,tail,holin,integrase,tRNA,terminase	Enterobacteria_phage(34.04%)	53	862893:862908	905302:905317
AUV05886.1|861958_862996_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
862893:862908	attL	TCGAGCATCGGCGCAA	NA	NA	NA	NA
AUV05887.1|863083_864175_+|integrase	integrase	integrase	S5MDN5	Escherichia_phage	82.5	2.9e-176
AUV05888.1|864178_864463_-	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	43.3	8.1e-14
AUV05889.1|864462_864702_-	hypothetical protein	NA	K7P7E2	Enterobacteria_phage	55.1	6.3e-20
AUV05890.1|864805_865981_-	hypothetical protein	NA	A0A2I6PID3	Escherichia_phage	51.1	4.5e-42
AUV05891.1|870191_870806_-|tail	phage tail protein	tail	K7PM69	Enterobacteria_phage	67.8	4.5e-70
AUV05892.1|871492_872203_-	peptidase P60	NA	K7PLS6	Enterobacteria_phage	83.7	7.7e-122
AUV05893.1|872204_872960_-|tail	phage minor tail protein L	tail	K7PGX3	Enterobacteria_phage	79.7	1.0e-119
AUV05894.1|872956_873304_-|tail	phage tail protein	tail	K7PJT2	Enterobacteria_phage	60.9	1.0e-34
AUV05895.1|873306_875880_-|tail	phage tail tape measure protein	tail	K7PKR0	Enterobacteria_phage	38.0	1.8e-136
AUV05896.1|875860_876190_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	48.1	3.0e-20
AUV05897.1|876186_876597_-|tail	phage minor tail protein G	tail	M9NZD7	Enterobacteria_phage	42.1	6.4e-20
AUV05898.1|876608_877340_-|tail	phage tail protein	tail	K7PKX6	Enterobacterial_phage	69.4	4.7e-90
AUV05899.1|877347_877746_-|tail	phage tail protein	tail	K7PHM6	Enterobacterial_phage	66.7	7.0e-48
AUV05900.1|877742_878300_-|tail	phage tail protein	tail	K7P7A8	Enterobacteria_phage	84.0	5.6e-67
AUV05901.1|878309_878585_-	ATP-binding protein	NA	K7PH55	Enterobacterial_phage	52.5	1.3e-16
AUV05902.1|878577_878901_-	DUF2190 domain-containing protein	NA	Q9EYD5	Enterobacteria_phage	53.3	1.4e-22
AUV05903.1|878979_881013_-	peptidase S14	NA	K7PKX4	Enterobacterial_phage	80.6	3.7e-312
AUV05904.1|880936_882445_-|portal	phage portal protein	portal	K7PHM5	Enterobacterial_phage	78.1	6.9e-229
AUV05905.1|882444_882660_-	hypothetical protein	NA	A5LH28	Enterobacteria_phage	74.3	7.9e-22
AUV05906.1|882656_884774_-	DNA packaging protein	NA	K7PH52	Enterobacterial_phage	77.5	0.0e+00
AUV05907.1|884773_885313_-|terminase	terminase	terminase	A5LH26	Enterobacteria_phage	63.2	1.9e-51
AUV05908.1|885599_886373_-	hypothetical protein	NA	NA	NA	NA	NA
AUV05909.1|886496_886688_-	hypothetical protein	NA	K7PM01	Enterobacterial_phage	80.0	8.1e-18
AUV05910.1|886638_886905_-	hypothetical protein	NA	G8C7W1	Escherichia_phage	48.9	5.1e-10
AUV05911.1|886904_887120_-	hypothetical protein	NA	A0A2P9HXL2	Yersinia_phage	36.6	2.2e-08
AUV05912.1|887116_887746_-	endolysin	NA	A0A193GYJ3	Enterobacter_phage	68.1	5.7e-76
AUV05913.1|887742_888054_-|holin	holin	holin	A0A286N2Q5	Klebsiella_phage	84.5	2.0e-42
AUV05914.1|888317_889262_+	hypothetical protein	NA	A5LH79	Enterobacteria_phage	45.5	2.0e-69
AUV05915.1|889281_889731_+	hypothetical protein	NA	A5LH78	Enterobacteria_phage	48.4	2.6e-22
AUV05916.1|889767_890139_-	antitermination protein Q	NA	A5LH77	Enterobacteria_phage	70.0	1.2e-44
AUV05917.1|890156_891146_-	hypothetical protein	NA	A0A291AWV9	Escherichia_phage	67.5	3.1e-137
AUV10444.1|891408_892287_-	hypothetical protein	NA	F1C5A3	Cronobacter_phage	47.9	4.5e-63
AUV05918.1|892298_892784_-	hypothetical protein	NA	A0A1C9IIA0	Salmonella_phage	78.7	2.1e-54
AUV05919.1|892780_893440_-	DNA methyltransferase	NA	I6PDF5	Cronobacter_phage	80.1	1.9e-98
AUV05920.1|893442_893883_-	hypothetical protein	NA	U5P0U0	Shigella_phage	34.2	4.3e-14
AUV05921.1|894888_895080_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	57.9	3.6e-10
AUV05922.1|895262_895832_-	DNA-binding protein	NA	A0A1C9II13	Salmonella_phage	61.0	3.5e-56
AUV05923.1|895876_896104_-	cytoplasmic chaperone TorD	NA	NA	NA	NA	NA
AUV05924.1|896240_896927_+	helix-turn-helix transcriptional regulator	NA	A0A0N7C1P9	Escherichia_phage	42.6	1.2e-39
AUV05925.1|896918_897800_-	NAD-dependent DNA ligase	NA	A0A0U4J8W4	Pseudomonas_phage	33.9	1.5e-18
AUV05926.1|898000_898267_+	hypothetical protein	NA	NA	NA	NA	NA
AUV05927.1|899151_900069_+	hypothetical protein	NA	A0A1W6JP69	Morganella_phage	40.5	4.1e-51
AUV05928.1|900156_900693_+	hypothetical protein	NA	A0A192Y8M4	Salmonella_phage	77.0	8.8e-78
AUV05929.1|900683_901346_+	hypothetical protein	NA	NA	NA	NA	NA
AUV05930.1|901335_902175_+	chromosome partitioning protein ParB	NA	K7PKM7	Enterobacterial_phage	74.6	3.7e-107
AUV05931.1|902171_902666_+	hypothetical protein	NA	NA	NA	NA	NA
AUV05932.1|902662_902983_+	hypothetical protein	NA	A0A222YY67	Escherichia_phage	70.8	1.0e-36
AUV05933.1|902988_903216_+	hypothetical protein	NA	A0A2R2Z310	Escherichia_phage	49.2	2.1e-09
AUV05934.1|903219_903483_+	hypothetical protein	NA	G8C7S3	Escherichia_phage	53.5	6.1e-16
AUV05935.1|903482_903773_+	hypothetical protein	NA	K7PKM4	Enterobacterial_phage	54.2	1.3e-19
AUV05936.1|903802_904075_+	pyocin activator protein PrtN	NA	K7PGU0	Enterobacteria_phage	84.3	1.1e-36
AUV05937.1|904101_904536_-	hypothetical protein	NA	A0A0S2SYH1	Pseudomonas_phage	52.4	1.1e-38
905302:905317	attR	TCGAGCATCGGCGCAA	NA	NA	NA	NA
>prophage 5
CP026192	Enterobacteriaceae bacterium ENNIH2 chromosome, complete genome	5956094	1805396	1877778	5956094	portal,protease,capsid,tail,head,integrase,tRNA,terminase	uncultured_Caudovirales_phage(52.17%)	76	1824932:1824949	1840874:1840891
AUV06726.1|1805396_1806344_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	32.0	4.9e-07
AUV06727.1|1806358_1806868_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	41.1	5.1e-19
AUV06728.1|1806995_1808120_+	DNA-protecting protein DprA	NA	NA	NA	NA	NA
AUV06729.1|1808091_1808565_+	DUF494 domain-containing protein	NA	NA	NA	NA	NA
AUV06730.1|1808591_1809149_+	hypothetical protein	NA	NA	NA	NA	NA
AUV06731.1|1809138_1809711_+	L-threonylcarbamoyladenylate synthase type 1 TsaC	NA	NA	NA	NA	NA
AUV06732.1|1809715_1810534_+	shikimate dehydrogenase	NA	NA	NA	NA	NA
AUV06733.1|1810530_1810788_+	DUF1488 domain-containing protein	NA	NA	NA	NA	NA
AUV06734.1|1810769_1811318_-	gamma carbonic anhydrase family protein	NA	NA	NA	NA	NA
AUV06735.1|1811394_1811613_-	hypothetical protein	NA	NA	NA	NA	NA
AUV06736.1|1817171_1817930_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.8	2.6e-19
AUV06737.1|1817937_1819041_-	ABC transporter permease	NA	NA	NA	NA	NA
AUV06738.1|1819050_1820232_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
AUV06739.1|1820302_1821328_-	amino acid ABC transporter substrate-binding protein	NA	A0A1B1IT51	uncultured_Mediterranean_phage	40.7	6.9e-71
AUV06740.1|1821804_1822026_-	hypothetical protein	NA	NA	NA	NA	NA
AUV06741.1|1822391_1824470_-	bifunctional diguanylate cyclase/phosphodiesterase	NA	G3MA91	Bacillus_virus	38.2	7.5e-24
AUV06742.1|1824611_1824776_-	DUF2556 domain-containing protein	NA	NA	NA	NA	NA
1824932:1824949	attL	CTATCAGTTCATGCCGTA	NA	NA	NA	NA
AUV06743.1|1825122_1826349_+|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	62.4	1.6e-151
AUV06744.1|1826441_1827383_+	hypothetical protein	NA	NA	NA	NA	NA
AUV06745.1|1827564_1827849_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
AUV06746.1|1827857_1828637_+	hypothetical protein	NA	Q8HA02	Enterobacteria_phage	50.9	4.8e-40
AUV10479.1|1828907_1829099_-	toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
AUV10480.1|1829232_1829433_+	host cell division inhibitor Icd-like protein	NA	Q7M2A7	Enterobacteria_phage	46.7	2.2e-05
AUV06747.1|1829425_1829611_+	hypothetical protein	NA	A0A2H4JFH8	uncultured_Caudovirales_phage	90.2	1.5e-21
AUV06748.1|1829603_1829831_+	aminotransferase	NA	A0A2H4JBA1	uncultured_Caudovirales_phage	87.8	7.8e-28
AUV06749.1|1829827_1830196_+	hypothetical protein	NA	A0A2H4JCX7	uncultured_Caudovirales_phage	85.2	6.1e-54
AUV06750.1|1830192_1830573_+	hypothetical protein	NA	NA	NA	NA	NA
AUV06751.1|1830572_1832708_+	DNA primase	NA	A0A1W6JPG0	Morganella_phage	62.4	3.4e-205
AUV06752.1|1833050_1833386_+	hypothetical protein	NA	NA	NA	NA	NA
AUV06753.1|1833433_1833904_-	hypothetical protein	NA	NA	NA	NA	NA
AUV06754.1|1834180_1835347_+|capsid	phage major capsid protein	capsid	A0A2H4JED2	uncultured_Caudovirales_phage	93.0	1.5e-202
AUV06755.1|1835398_1835959_+|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	97.8	6.5e-100
AUV06756.1|1835960_1837187_+|portal	phage portal protein	portal	A0A2H4JFJ9	uncultured_Caudovirales_phage	88.3	9.3e-216
AUV06757.1|1837183_1837522_+|head,tail	head-tail adaptor protein	head,tail	A0A2H4JHK5	uncultured_Caudovirales_phage	82.9	1.7e-47
AUV06758.1|1837518_1837809_+	hypothetical protein	NA	A0A2H4JD08	uncultured_Caudovirales_phage	80.0	2.3e-40
AUV06759.1|1837808_1838252_+	HNH endonuclease	NA	A0A2H4JAS8	uncultured_Caudovirales_phage	83.0	3.5e-72
AUV06760.1|1838378_1838570_+|terminase	terminase	terminase	NA	NA	NA	NA
AUV06761.1|1838527_1838884_+|terminase	phage terminase small subunit P27 family	terminase	A0A2H4JHS3	uncultured_Caudovirales_phage	99.2	5.5e-60
AUV06762.1|1838867_1840529_+|terminase	terminase large subunit	terminase	A0A2H4JB64	uncultured_Caudovirales_phage	98.4	0.0e+00
AUV06763.1|1840531_1840723_+	hypothetical protein	NA	NA	NA	NA	NA
AUV06764.1|1840876_1841173_-	Fis family transcriptional regulator	NA	NA	NA	NA	NA
1840874:1840891	attR	CTATCAGTTCATGCCGTA	NA	NA	NA	NA
AUV06765.1|1841196_1842162_-|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
AUV06766.1|1842520_1843402_-	50S ribosomal protein L11 methyltransferase	NA	NA	NA	NA	NA
AUV06767.1|1843413_1844865_-	sodium/panthothenate symporter	NA	NA	NA	NA	NA
AUV06768.1|1844854_1845097_-	hypothetical protein	NA	NA	NA	NA	NA
AUV06769.1|1845211_1846561_-	acetyl-CoA carboxylase biotin carboxylase subunit	NA	NA	NA	NA	NA
AUV06770.1|1846571_1847048_-	acetyl-CoA carboxylase biotin carboxyl carrier protein	NA	NA	NA	NA	NA
AUV06771.1|1847553_1848153_-	protein-methionine-sulfoxide reductase heme-binding subunit MsrQ	NA	NA	NA	NA	NA
AUV06772.1|1848153_1849155_-	protein-methionine-sulfoxide reductase catalytic subunit MsrP	NA	NA	NA	NA	NA
AUV06773.1|1849435_1851376_+	RNase E specificity factor CsrD	NA	NA	NA	NA	NA
AUV06774.1|1851384_1851708_-	hypothetical protein	NA	NA	NA	NA	NA
AUV06775.1|1851685_1852729_+	rod shape-determining protein	NA	F2Y0P3	Organic_Lake_phycodnavirus	22.3	6.7e-05
AUV06776.1|1852794_1853799_+	rod shape-determining protein MreC	NA	NA	NA	NA	NA
AUV06777.1|1853798_1854287_+	rod shape-determining protein MreD	NA	NA	NA	NA	NA
AUV06778.1|1854295_1854889_+	septum formation inhibitor Maf	NA	NA	NA	NA	NA
AUV06779.1|1854878_1856348_+	ribonuclease G	NA	NA	NA	NA	NA
AUV06780.1|1856389_1860199_+	AsmA2 domain-containing protein	NA	NA	NA	NA	NA
AUV06781.1|1860285_1861731_+|protease	metalloprotease TldD	protease	NA	NA	NA	NA
AUV06782.1|1861779_1862703_-	transcriptional regulator	NA	NA	NA	NA	NA
AUV06783.1|1862876_1863080_+	protein AaeX	NA	NA	NA	NA	NA
AUV06784.1|1863087_1864020_+	p-hydroxybenzoic acid efflux pump subunit AaeA	NA	NA	NA	NA	NA
AUV06785.1|1864025_1865993_+	p-hydroxybenzoic acid efflux pump subunit AaeB	NA	NA	NA	NA	NA
AUV06786.1|1866076_1867531_+	NAD-dependent succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
AUV06787.1|1867576_1867843_+	hypothetical protein	NA	NA	NA	NA	NA
AUV06788.1|1867904_1868168_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
AUV06789.1|1868263_1868527_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
AUV06790.1|1868888_1869359_-	transcriptional regulator ArgR	NA	NA	NA	NA	NA
AUV06791.1|1869763_1870702_+	malate dehydrogenase	NA	NA	NA	NA	NA
AUV10481.1|1870788_1871856_-|protease	serine endoprotease DegS	protease	NA	NA	NA	NA
AUV06792.1|1871946_1873317_-|protease	serine endoprotease DegQ	protease	A0A1B1IT49	uncultured_Mediterranean_phage	27.7	1.9e-23
AUV06793.1|1873487_1873886_-	hypothetical protein	NA	NA	NA	NA	NA
AUV06794.1|1874075_1875200_+	cell division protein ZapE	NA	NA	NA	NA	NA
AUV06795.1|1875486_1875915_+	50S ribosomal protein L13	NA	NA	NA	NA	NA
AUV06796.1|1875930_1876323_+	30S ribosomal protein S9	NA	NA	NA	NA	NA
AUV06797.1|1876637_1877276_+	stringent starvation protein A	NA	NA	NA	NA	NA
AUV06798.1|1877280_1877778_+|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	54.9	1.5e-26
>prophage 6
CP026192	Enterobacteriaceae bacterium ENNIH2 chromosome, complete genome	5956094	1986409	2088978	5956094	portal,capsid,tail,head,holin,integrase,plate,tRNA,terminase	Escherichia_phage(27.08%)	98	2024556:2024605	2066924:2066973
AUV06907.1|1986409_1988734_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase GatCAB subunit C	tRNA	A0A077SK27	Escherichia_phage	32.2	1.2e-78
AUV06908.1|1988738_1989932_-	aspartate/tyrosine/aromatic aminotransferase	NA	NA	NA	NA	NA
AUV06909.1|1989970_1990585_-	YitT family protein	NA	NA	NA	NA	NA
AUV06910.1|1990836_1991316_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
AUV06911.1|1991651_1993034_+	amino acid permease	NA	NA	NA	NA	NA
AUV06912.1|1993723_1994908_+	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
AUV06913.1|1995353_1995851_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
AUV06914.1|1995920_1997051_+	23S rRNA (guanine(1835)-N(2))-methyltransferase RlmG	NA	NA	NA	NA	NA
AUV06915.1|1997164_1999186_-	NADPH-dependent 2,4-dienoyl-CoA reductase	NA	NA	NA	NA	NA
AUV06916.1|1999400_2000993_-	autoinducer-2 kinase	NA	NA	NA	NA	NA
AUV06917.1|2001036_2002008_-	transcriptional regulator LsrR	NA	NA	NA	NA	NA
AUV06918.1|2002224_2003715_+	autoinducer 2 ABC transporter ATP-binding protein LsrA	NA	A0A2H4PQG7	Staphylococcus_phage	31.5	3.3e-21
AUV06919.1|2003711_2004746_+	autoinducer 2 ABC transporter permease LsrC	NA	NA	NA	NA	NA
AUV06920.1|2004746_2005724_+	autoinducer 2 import system permease LsrD	NA	NA	NA	NA	NA
AUV06921.1|2005740_2006754_+	autoinducer 2 ABC transporter substrate-binding protein LsrB	NA	NA	NA	NA	NA
AUV06922.1|2006766_2007654_+	3-hydroxy-5-phosphonooxypentane-2,4-dione thiolase	NA	NA	NA	NA	NA
AUV06923.1|2007650_2007944_+	(4S)-4-hydroxy-5-phosphonooxypentane-2,3-dione isomerase	NA	NA	NA	NA	NA
AUV06924.1|2008142_2009633_-	putrescine aminotransferase	NA	A0A1V0SKB7	Klosneuvirus	27.9	1.4e-32
AUV06925.1|2009955_2011476_+	PAS domain S-box protein	NA	A0A1B0V854	Salmonella_phage	50.0	2.6e-34
AUV06926.1|2011930_2013493_+	methyl-accepting chemotaxis protein	NA	NA	NA	NA	NA
AUV06927.1|2013489_2014086_-	PadR family transcriptional regulator	NA	NA	NA	NA	NA
AUV06928.1|2014325_2015096_+	siderophore-interacting protein	NA	NA	NA	NA	NA
AUV06929.1|2015893_2017063_-	DNA repair protein	NA	NA	NA	NA	NA
AUV06930.1|2017427_2019314_+	PTS beta-glucoside transporter subunit EIIBCA	NA	NA	NA	NA	NA
AUV06931.1|2019455_2020460_+	LacI family transcriptional regulator	NA	NA	NA	NA	NA
AUV06932.1|2020488_2020749_+	hypothetical protein	NA	NA	NA	NA	NA
AUV06933.1|2020802_2021396_-	hypothetical protein	NA	NA	NA	NA	NA
AUV06934.1|2021395_2022358_-	hypothetical protein	NA	NA	NA	NA	NA
AUV06935.1|2022980_2023439_+	hypothetical protein	NA	NA	NA	NA	NA
AUV06936.1|2024161_2024485_+	DUF1889 domain-containing protein	NA	NA	NA	NA	NA
2024556:2024605	attL	AATTTGGTGGCCCCTGCTGGGTTTGAACCAGCGACCAAGCGATTATGAGT	NA	NA	NA	NA
AUV06937.1|2024785_2026210_+|integrase	integrase	integrase	NA	NA	NA	NA
AUV06938.1|2026206_2026851_+	hypothetical protein	NA	NA	NA	NA	NA
AUV06939.1|2026948_2027155_+	DNA-binding protein	NA	NA	NA	NA	NA
AUV06940.1|2027273_2027582_-	hypothetical protein	NA	NA	NA	NA	NA
AUV10484.1|2027869_2028040_+	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
AUV06941.1|2028032_2028233_+	hypothetical protein	NA	A0A286SGR4	Klebsiella_phage	43.6	1.3e-05
AUV06942.1|2028237_2028537_+	hypothetical protein	NA	NA	NA	NA	NA
AUV06943.1|2028533_2030333_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	48.8	3.2e-132
AUV06944.1|2030735_2030927_+	hypothetical protein	NA	NA	NA	NA	NA
AUV06945.1|2030923_2032840_+	peptidase	NA	K7PKX4	Enterobacterial_phage	57.4	3.4e-212
AUV06946.1|2033246_2035586_+|tail	phage tail tape measure protein	tail	A0A2D1GPC9	Escherichia_phage	44.1	3.1e-151
AUV06947.1|2035818_2036835_-|integrase	integrase	integrase	A0A218M4I3	Erwinia_phage	96.2	4.1e-193
AUV06948.1|2036834_2037407_-	phage repressor protein CI	NA	A0A218M4J1	Erwinia_phage	88.9	1.9e-94
AUV06949.1|2037537_2037801_+	hypothetical protein	NA	A0A218M4I5	Erwinia_phage	88.5	1.2e-40
AUV06950.1|2037831_2038341_+	hypothetical protein	NA	Q6K1F8	Salmonella_virus	86.4	1.9e-77
AUV06951.1|2038348_2038549_+	DUF2724 domain-containing protein	NA	Q6K1F7	Salmonella_virus	95.5	1.3e-31
AUV06952.1|2038512_2038851_+	hypothetical protein	NA	A0A218M4I7	Erwinia_phage	94.6	1.6e-53
AUV06953.1|2038918_2039146_+	DUF2732 domain-containing protein	NA	A0A0M3UL87	Salmonella_phage	98.7	2.0e-31
AUV06954.1|2039145_2039367_+	hypothetical protein	NA	A0A0M4S5Q7	Salmonella_phage	89.0	3.3e-31
AUV06955.1|2039368_2041591_+	replication protein	NA	A0A218M4H2	Erwinia_phage	90.4	0.0e+00
AUV06956.1|2041709_2042150_+	DinI family protein	NA	A0A218M4I0	Erwinia_phage	75.9	1.2e-51
AUV06957.1|2042232_2042910_-	hypothetical protein	NA	NA	NA	NA	NA
AUV06958.1|2042920_2043979_-	hypothetical protein	NA	NA	NA	NA	NA
AUV06959.1|2043968_2044982_-	hypothetical protein	NA	NA	NA	NA	NA
AUV06960.1|2045150_2045360_+	hypothetical protein	NA	NA	NA	NA	NA
AUV06961.1|2045389_2046427_-|portal	phage portal protein	portal	Q6K1J0	Salmonella_virus	76.7	7.5e-158
AUV06962.1|2046426_2048196_-	oxidoreductase	NA	A0A0M4RE51	Salmonella_phage	85.1	3.6e-301
AUV06963.1|2048372_2049230_+|capsid	GPO family capsid scaffolding protein	capsid	Q6K1I7	Salmonella_virus	73.7	1.3e-115
AUV06964.1|2049266_2050415_+|capsid	phage major capsid protein, P2 family	capsid	A0A0M4R4W2	Salmonella_phage	61.2	8.4e-126
AUV06965.1|2050418_2051177_+|terminase	terminase	terminase	Q94MI7	Enterobacteria_phage	65.9	2.7e-80
AUV06966.1|2051273_2051780_+|head	head completion/stabilization protein	head	M1SNN6	Escherichia_phage	79.8	2.8e-73
AUV06967.1|2051779_2051983_+|tail	phage tail protein	tail	A0A0F7LCN2	Escherichia_phage	79.1	4.7e-24
AUV06968.1|2051973_2052210_+|holin	holin	holin	A0A218M4L5	Erwinia_phage	51.7	1.5e-10
AUV06969.1|2052193_2052706_+	glycoside hydrolase	NA	A0A218M4K3	Erwinia_phage	80.0	8.7e-75
AUV06970.1|2052702_2053134_+	hypothetical protein	NA	NA	NA	NA	NA
AUV06971.1|2053118_2053541_+	protein lysB	NA	Q7Y4E2	Escherichia_virus	65.2	1.6e-42
AUV06972.1|2053440_2053686_+|holin	holin	holin	S4TNY4	Salmonella_phage	77.8	2.0e-29
AUV06973.1|2053648_2054116_+|tail	phage tail protein	tail	A0A0F7LA33	Escherichia_phage	81.3	7.9e-67
AUV06974.1|2054108_2054561_+	phage virion morphogenesis protein	NA	O80313	Escherichia_phage	67.8	6.5e-50
AUV06975.1|2054626_2055268_+|plate	phage baseplate assembly protein V	plate	Q6K1H6	Salmonella_virus	84.5	4.5e-97
AUV06976.1|2055264_2055612_+|plate	baseplate assembly protein	plate	A0A0F7LDQ1	Escherichia_phage	79.1	1.7e-45
AUV06977.1|2055616_2056525_+|plate	baseplate assembly protein	plate	A0A0F7LCQ9	Escherichia_phage	84.8	2.1e-140
AUV06978.1|2056517_2057048_+|tail	phage tail protein I	tail	Q858V5	Yersinia_virus	90.3	1.6e-95
AUV06979.1|2059004_2059550_+|tail	phage tail protein	tail	U5N0T1	Enterobacteria_phage	45.1	9.4e-35
AUV06980.1|2059679_2060870_+|tail	phage tail protein	tail	A0A0F7LBW9	Escherichia_phage	89.1	2.1e-204
AUV06981.1|2060882_2061401_+|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	93.6	3.1e-88
AUV06982.1|2061461_2061737_+|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	87.9	1.5e-36
AUV06983.1|2061769_2061889_+|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	92.3	1.2e-14
AUV06984.1|2061881_2064353_+|tail	phage tail tape measure protein	tail	Q7Y4C8	Escherichia_virus	64.2	3.2e-255
AUV06985.1|2064364_2064841_+|tail	phage tail protein	tail	A0A0F7LDE8	Escherichia_phage	71.3	3.9e-61
AUV06986.1|2064840_2066025_+	hypothetical protein	NA	Q7Y4C6	Escherichia_virus	77.5	1.7e-161
AUV06987.1|2066064_2066472_-	hypothetical protein	NA	NA	NA	NA	NA
AUV06988.1|2066565_2066784_+	transcriptional regulator	NA	A0A2I8TV89	Erwinia_phage	84.5	3.0e-32
AUV10485.1|2068169_2068946_+	ABC transporter permease	NA	NA	NA	NA	NA
2066924:2066973	attR	AATTTGGTGGCCCCTGCTGGGTTTGAACCAGCGACCAAGCGATTATGAGT	NA	NA	NA	NA
AUV06989.1|2068942_2069608_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.4	1.8e-08
AUV06990.1|2069631_2070624_+	capsular biosynthesis protein	NA	NA	NA	NA	NA
AUV06991.1|2070689_2073263_+	hypothetical protein	NA	NA	NA	NA	NA
AUV06992.1|2074039_2075218_+	hypothetical protein	NA	NA	NA	NA	NA
AUV06993.1|2075284_2076151_+	hypothetical protein	NA	NA	NA	NA	NA
AUV06994.1|2076376_2077639_-	capsular biosynthesis protein	NA	NA	NA	NA	NA
AUV10486.1|2077665_2079690_-	capsular polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
AUV06995.1|2079803_2081480_-	polysialic acid transporter	NA	NA	NA	NA	NA
AUV06996.1|2081514_2082666_-	capsule biosynthesis protein	NA	NA	NA	NA	NA
AUV06997.1|2082744_2082948_-	hypothetical protein	NA	NA	NA	NA	NA
AUV06998.1|2083521_2085369_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	8.4e-35
AUV10487.1|2085527_2087273_-	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	38.5	4.6e-75
AUV06999.1|2087512_2087728_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
AUV07000.1|2087964_2088978_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	58.9	1.0e-106
>prophage 7
CP026192	Enterobacteriaceae bacterium ENNIH2 chromosome, complete genome	5956094	2714213	2764997	5956094	tail,head,holin,integrase,terminase	Salmonella_phage(21.82%)	74	2709997:2710011	2754921:2754935
2709997:2710011	attL	CCGGCACGCCAGGCC	NA	NA	NA	NA
AUV07543.1|2714213_2715443_+|integrase	integrase	integrase	H6WRW7	Salmonella_phage	92.2	1.6e-231
AUV10525.1|2715420_2715708_-	excisionase	NA	H6WRW8	Salmonella_phage	72.6	3.0e-32
AUV10526.1|2715743_2716094_-	hypothetical protein	NA	I3PV00	Vibrio_phage	53.6	9.6e-25
AUV07544.1|2716090_2716423_-	hypothetical protein	NA	M1FQT7	Enterobacteria_phage	57.1	3.5e-16
AUV07545.1|2716496_2717204_-	hypothetical protein	NA	H2BDG4	Pseudomonas_virus	46.4	1.2e-45
AUV07546.1|2717203_2717419_-	hypothetical protein	NA	NA	NA	NA	NA
AUV07547.1|2717415_2717637_-	hypothetical protein	NA	NA	NA	NA	NA
AUV07548.1|2717633_2718188_-	phage N-6-adenine-methyltransferase	NA	E5AGF8	Erwinia_phage	59.4	5.2e-57
AUV07549.1|2718180_2718363_-	hypothetical protein	NA	NA	NA	NA	NA
AUV07550.1|2718346_2719027_-	hypothetical protein	NA	A0A088C400	Shewanella_sp._phage	43.5	1.9e-29
AUV07551.1|2719037_2719706_-	ATP-binding protein	NA	G9L667	Escherichia_phage	45.2	3.7e-49
AUV07552.1|2719707_2720370_-	exodeoxyribonuclease X	NA	A0A1W5PTR6	Pseudoalteromonas_phage	36.0	1.4e-21
AUV10527.1|2720373_2720733_-	HNH endonuclease	NA	Q6WYF0	Enterobacteria_phage	50.0	2.4e-23
AUV07553.1|2720926_2721322_-	hypothetical protein	NA	NA	NA	NA	NA
AUV07554.1|2721403_2721601_-	DUF1482 domain-containing protein	NA	NA	NA	NA	NA
AUV07555.1|2721600_2721798_-	hypothetical protein	NA	NA	NA	NA	NA
AUV07556.1|2722082_2722289_+	hypothetical protein	NA	K7P7I0	Enterobacteria_phage	94.1	1.3e-29
AUV07557.1|2722299_2722881_-	hypothetical protein	NA	NA	NA	NA	NA
AUV10528.1|2722955_2723666_-	phage repressor protein C	NA	M9NZE3	Enterobacteria_phage	68.1	1.3e-84
AUV07558.1|2723770_2723992_+	transcriptional regulator	NA	A0A2H4FNF3	Salmonella_phage	67.1	6.9e-21
AUV07559.1|2724038_2724359_+	hypothetical protein	NA	A0A0M4RU01	Salmonella_phage	65.1	6.1e-34
AUV07560.1|2724479_2724812_+	hypothetical protein	NA	A0A088F856	Sulfitobacter_phage	48.2	5.7e-11
AUV07561.1|2724929_2725157_+	hypothetical protein	NA	NA	NA	NA	NA
AUV07562.1|2725156_2726032_+	hypothetical protein	NA	G8C7U5	Escherichia_phage	76.9	1.9e-122
AUV07563.1|2726015_2726732_+	Replication protein P	NA	A0A0M3ULE2	Salmonella_phage	63.1	1.8e-78
AUV07564.1|2726731_2727013_+	hypothetical protein	NA	NA	NA	NA	NA
AUV07565.1|2727009_2727786_+	hypothetical protein	NA	F1C5B6	Cronobacter_phage	51.7	1.2e-06
AUV07566.1|2727782_2727986_+	hypothetical protein	NA	NA	NA	NA	NA
AUV07567.1|2727982_2728327_+	hypothetical protein	NA	NA	NA	NA	NA
AUV07568.1|2728319_2728778_+	hypothetical protein	NA	NA	NA	NA	NA
AUV07569.1|2728750_2728984_+	hypothetical protein	NA	NA	NA	NA	NA
AUV07570.1|2729731_2729941_+	hypothetical protein	NA	K7P6F8	Enterobacteria_phage	63.1	2.4e-15
AUV07571.1|2730318_2730768_+	recombination protein NinB	NA	Q8VNP6	Enterobacteria_phage	51.7	5.2e-39
AUV07572.1|2730760_2730931_+	hypothetical protein	NA	G8C7V4	Escherichia_phage	69.6	4.3e-15
AUV07573.1|2730923_2731520_+	protein NinG	NA	A0A1P8DTE0	Proteus_phage	66.1	2.8e-56
AUV07574.1|2731635_2732325_+	antiterminator	NA	I6PDF8	Cronobacter_phage	46.3	3.7e-52
AUV07575.1|2732858_2733074_+|holin	holin	holin	Q9ZWW2	Enterobacteria_phage	80.3	2.4e-26
AUV07576.1|2733073_2733586_+	glycoside hydrolase	NA	I6PBN2	Cronobacter_phage	59.1	3.8e-46
AUV07577.1|2733585_2734116_+	hypothetical protein	NA	K7P6W1	Enterobacteria_phage	55.8	5.7e-29
AUV07578.1|2734112_2734373_+	hypothetical protein	NA	NA	NA	NA	NA
AUV07579.1|2734494_2735142_+	hypothetical protein	NA	I6S676	Salmonella_phage	76.9	9.2e-98
AUV07580.1|2735172_2735661_+	hypothetical protein	NA	H9C190	Pectobacterium_phage	79.5	1.7e-51
AUV07581.1|2735657_2737226_+|terminase	terminase	terminase	G8C7P3	Escherichia_phage	88.1	5.4e-293
AUV07582.1|2737238_2738690_+	DUF1073 domain-containing protein	NA	F1C5D7	Cronobacter_phage	53.4	4.2e-122
AUV10529.1|2738625_2739621_+|head	phage head morphogenesis protein	head	F1C5D8	Cronobacter_phage	66.0	2.1e-109
AUV07583.1|2739722_2740415_+	HNH endonuclease	NA	S5M802	Pseudoalteromonas_phage	38.7	8.8e-38
AUV07584.1|2740475_2740658_+	hypothetical protein	NA	NA	NA	NA	NA
AUV07585.1|2740669_2742055_+	DUF2213 domain-containing protein	NA	F1C5D9	Cronobacter_phage	56.1	8.5e-141
AUV07586.1|2742054_2742489_+	hypothetical protein	NA	A0A0M3LPQ2	Mannheimia_phage	46.4	6.3e-26
AUV07587.1|2742500_2743532_+	encapsulating for peroxidase	NA	A0A0M3LQZ1	Mannheimia_phage	52.6	5.2e-95
AUV07588.1|2743571_2743796_+	hypothetical protein	NA	A0A0M3LR32	Mannheimia_phage	73.3	5.4e-13
AUV07589.1|2743798_2744182_+	hypothetical protein	NA	A0A0M3LQS8	Mannheimia_phage	42.1	1.9e-18
AUV07590.1|2744178_2744349_+	50S ribosomal protein L13	NA	NA	NA	NA	NA
AUV07591.1|2744352_2744709_+	hypothetical protein	NA	G0ZNE2	Cronobacter_phage	63.2	3.6e-35
AUV07592.1|2744710_2745151_+	hypothetical protein	NA	A0A291AXD9	Shigella_phage	52.1	8.4e-34
AUV07593.1|2745147_2745531_+	hypothetical protein	NA	F1C5E4	Cronobacter_phage	66.1	2.3e-43
AUV07594.1|2745594_2746338_+	DNA breaking-rejoining protein	NA	F1C5E5	Cronobacter_phage	85.0	4.5e-72
AUV07595.1|2746395_2747073_+	hypothetical protein	NA	F1C5E8	Cronobacter_phage	52.3	3.5e-55
AUV07596.1|2747277_2747805_+	hypothetical protein	NA	B8K1H1	Salmonella_phage	86.9	1.3e-81
AUV07597.1|2747897_2748371_+	hypothetical protein	NA	NA	NA	NA	NA
AUV10530.1|2748632_2750987_+|tail	tail protein (tape measure)	tail	Q5G8W8	Enterobacteria_phage	50.8	2.0e-121
AUV07598.1|2751021_2751243_+	hypothetical protein	NA	NA	NA	NA	NA
AUV07599.1|2751299_2751653_+|tail	phage tail protein	tail	A0A1V0E5N3	Salmonella_phage	82.9	1.1e-49
AUV07600.1|2751689_2752397_+|tail	phage minor tail protein L	tail	A0A1V0E5N2	Salmonella_phage	85.1	1.1e-117
AUV10531.1|2752396_2753116_+|tail	phage tail protein	tail	A0A1V0E5M9	Salmonella_phage	73.4	5.4e-107
AUV07601.1|2753058_2753586_+|tail	phage tail protein	tail	H6WRW3	Salmonella_phage	60.9	3.2e-48
AUV07602.1|2753598_2757678_+	hypothetical protein	NA	Q5G8W0	Enterobacteria_phage	81.6	0.0e+00
2754921:2754935	attR	GGCCTGGCGTGCCGG	NA	NA	NA	NA
AUV07603.1|2757742_2758903_+	hypothetical protein	NA	A0A2I6PID3	Escherichia_phage	52.2	2.0e-42
AUV07604.1|2759096_2759516_+	DNA polymerase V subunit UmuD	NA	A0A1W6JNS2	Morganella_phage	60.6	2.9e-36
AUV07605.1|2759527_2760793_+	DNA polymerase V subunit UmuC	NA	I6RSM4	Salmonella_phage	86.7	1.3e-217
AUV07606.1|2760816_2761104_+	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	43.5	3.1e-13
AUV07607.1|2761258_2763058_+	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	26.5	3.2e-23
AUV07608.1|2763074_2764049_+	signal peptidase I	NA	NA	NA	NA	NA
AUV10532.1|2764316_2764997_+	ribonuclease III	NA	A0A2P0VNZ5	Tetraselmis_virus	39.0	9.6e-21
>prophage 8
CP026192	Enterobacteriaceae bacterium ENNIH2 chromosome, complete genome	5956094	2978440	3023396	5956094	protease,transposase	Salmonella_phage(16.67%)	46	NA	NA
AUV07767.1|2978440_2979409_-|transposase	IS5/IS1182 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	91.3	5.0e-172
AUV07768.1|2979676_2979889_+	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	72.9	1.7e-21
AUV07769.1|2980143_2980374_+	hypothetical protein	NA	NA	NA	NA	NA
AUV10544.1|2980382_2981297_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUV07770.1|2981474_2982251_+	sugar dehydrogenase	NA	A0A0M4JSW6	Mollivirus	26.5	3.2e-12
AUV07771.1|2982294_2982777_+	OsmC family peroxiredoxin	NA	NA	NA	NA	NA
AUV07772.1|2982842_2984039_+	MFS transporter	NA	NA	NA	NA	NA
AUV07773.1|2984193_2985132_-	transcriptional regulator GcvA	NA	NA	NA	NA	NA
AUV07774.1|2985389_2985671_+	hypothetical protein	NA	NA	NA	NA	NA
AUV07775.1|2985695_2986037_+	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
AUV07776.1|2986098_2986776_+	anti-sigma factor	NA	NA	NA	NA	NA
AUV07777.1|2986769_2987897_+	amine oxidase	NA	NA	NA	NA	NA
AUV07778.1|2987880_2988900_+	alcohol dehydrogenase	NA	A0A2K9L339	Tupanvirus	28.0	1.3e-26
AUV07779.1|2989170_2990106_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUV07780.1|2990478_2991756_+	transporter	NA	NA	NA	NA	NA
AUV07781.1|2991980_2992193_-	hypothetical protein	NA	NA	NA	NA	NA
AUV07782.1|2992185_2993154_-|transposase	IS5/IS1182 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	91.3	5.0e-172
AUV07783.1|2993173_2994313_+	cystathionine beta-lyase	NA	NA	NA	NA	NA
AUV07784.1|2994383_2994770_+	RidA family protein	NA	NA	NA	NA	NA
AUV07785.1|2994926_2995532_-	DNA-binding response regulator	NA	NA	NA	NA	NA
AUV07786.1|2995546_2997271_-	sensor histidine kinase	NA	NA	NA	NA	NA
AUV07787.1|2997438_2998188_+	tetrathionate reductase subunit TtrB	NA	A0A077SL61	Escherichia_phage	33.0	6.2e-21
AUV10545.1|2998184_2999198_+	tetrathionate reductase subunit TtrC	NA	NA	NA	NA	NA
AUV07788.1|2999190_3002262_+	tetrathionate reductase subunit TtrA	NA	A0A077SK27	Escherichia_phage	26.3	4.2e-07
AUV07789.1|3002744_3003071_-	toxin	NA	NA	NA	NA	NA
AUV07790.1|3003091_3003409_-	antitoxin	NA	NA	NA	NA	NA
AUV07791.1|3003422_3003650_-	DUF987 domain-containing protein	NA	NA	NA	NA	NA
AUV07792.1|3003658_3004135_-	hypothetical protein	NA	NA	NA	NA	NA
AUV07793.1|3004150_3004609_-	antirestriction protein	NA	A9J566	Pseudomonas_phage	31.4	1.9e-12
AUV07794.1|3004712_3004952_-	DUF905 domain-containing protein	NA	NA	NA	NA	NA
AUV07795.1|3004975_3005797_-	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	38.7	1.5e-44
AUV10546.1|3005923_3006184_-	permease	NA	NA	NA	NA	NA
AUV07796.1|3006263_3006536_-	hypothetical protein	NA	NA	NA	NA	NA
AUV07797.1|3006592_3007330_-	transcriptional regulator	NA	NA	NA	NA	NA
AUV07798.1|3007590_3008475_-	NgrB	NA	NA	NA	NA	NA
AUV07799.1|3008556_3009516_+	hypothetical protein	NA	NA	NA	NA	NA
AUV07800.1|3009512_3010724_-	hypothetical protein	NA	NA	NA	NA	NA
AUV07801.1|3010740_3010932_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
AUV07802.1|3011573_3012693_+|transposase	IS3-like element ISSen4 family transposase	transposase	S5WIU1	Leptospira_phage	42.8	1.7e-51
AUV07803.1|3014586_3015549_-|protease	Zn-dependent protease	protease	NA	NA	NA	NA
AUV07804.1|3015535_3016285_-	diguanylate cyclase	NA	NA	NA	NA	NA
AUV07805.1|3016522_3016720_-	hypothetical protein	NA	NA	NA	NA	NA
AUV07806.1|3016719_3019515_-|protease	Clp protease ClpC	protease	K4FB40	Cronobacter_phage	41.0	5.2e-129
AUV07807.1|3019620_3020190_-	Hsp20/alpha crystallin family protein	NA	NA	NA	NA	NA
AUV10547.1|3020224_3020506_-	DNA-binding protein	NA	NA	NA	NA	NA
AUV10548.1|3022188_3023396_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	62.7	2.6e-101
>prophage 9
CP026192	Enterobacteriaceae bacterium ENNIH2 chromosome, complete genome	5956094	3027491	3072721	5956094	portal,lysis,protease,capsid,tail,head,integrase,terminase	Enterobacteria_phage(23.26%)	53	3033804:3033821	3074298:3074315
AUV07811.1|3027491_3030566_-	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	96.7	0.0e+00
AUV07812.1|3030687_3031770_-	lac repressor	NA	C6ZCU4	Enterobacteria_phage	98.1	6.5e-189
AUV07813.1|3032371_3033571_-|integrase	integrase	integrase	Q7M297	Enterobacteria_phage	59.6	3.3e-133
3033804:3033821	attL	CCATTTAACTAAGGGGAC	NA	NA	NA	NA
AUV07814.1|3033971_3035186_+|integrase	integrase	integrase	E7DYQ7	Enterobacteria_phage	80.4	9.9e-202
AUV07815.1|3035169_3035352_-	hypothetical protein	NA	G3CFG7	Escherichia_phage	71.7	6.9e-19
AUV07816.1|3036338_3036575_-	hypothetical protein	NA	A0A286S2B6	Klebsiella_phage	52.6	1.5e-13
AUV07817.1|3036571_3036796_-	hypothetical protein	NA	A0A286S2B3	Klebsiella_phage	50.0	5.0e-11
AUV07818.1|3036796_3037138_-	hypothetical protein	NA	A0A1B5FPL8	Escherichia_phage	70.8	6.4e-42
AUV07819.1|3037137_3037890_-	hypothetical protein	NA	A0A1B5FPC0	Escherichia_phage	76.1	1.0e-100
AUV07820.1|3037886_3038168_-	hypothetical protein	NA	NA	NA	NA	NA
AUV07821.1|3038167_3038581_-	hypothetical protein	NA	A0A286S1S2	Klebsiella_phage	70.6	2.5e-48
AUV07822.1|3038811_3039045_-	hypothetical protein	NA	A0A286SGR4	Klebsiella_phage	53.0	5.2e-11
AUV07823.1|3039034_3039388_-	hypothetical protein	NA	NA	NA	NA	NA
AUV10549.1|3039374_3039560_-	hypothetical protein	NA	NA	NA	NA	NA
AUV07824.1|3040204_3040420_-	hypothetical protein	NA	NA	NA	NA	NA
AUV07825.1|3040621_3041287_-	phage repressor	NA	C6ZR47	Salmonella_phage	57.0	3.4e-71
AUV07826.1|3041399_3041615_+	XRE family transcriptional regulator	NA	A0A0N7C2U7	Escherichia_phage	47.7	4.4e-12
AUV07827.1|3041616_3041817_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
AUV07828.1|3041817_3042846_+	hypothetical protein	NA	V5URT9	Shigella_phage	57.1	9.7e-49
AUV07829.1|3042949_3044821_+	bifunctional DNA primase/helicase	NA	I6S1U6	Salmonella_phage	59.0	4.9e-224
AUV07830.1|3044823_3045132_+	hypothetical protein	NA	NA	NA	NA	NA
AUV07831.1|3045201_3045615_+	antitermination protein	NA	Q8W638	Enterobacteria_phage	50.8	1.7e-28
AUV07832.1|3045716_3045980_+	hypothetical protein	NA	NA	NA	NA	NA
AUV07833.1|3046189_3046444_+|lysis	lysis protein	lysis	NA	NA	NA	NA
AUV07834.1|3046446_3046983_+	lysozyme	NA	H6WRZ4	Salmonella_phage	87.6	6.5e-89
AUV07835.1|3046979_3047432_+|lysis	lysis protein	lysis	A0A2H4JHL8	uncultured_Caudovirales_phage	49.0	2.4e-28
AUV07836.1|3047695_3047938_+	hypothetical protein	NA	NA	NA	NA	NA
AUV07837.1|3048102_3048717_+	hypothetical protein	NA	M9NZE9	Enterobacteria_phage	47.8	1.3e-21
AUV07838.1|3048719_3050177_+	glycosyltransferase	NA	K7PKP3	Enterobacterial_phage	81.9	2.7e-246
AUV07839.1|3050158_3050749_+	hypothetical protein	NA	S4TR53	Salmonella_phage	69.2	9.1e-76
AUV07840.1|3050745_3051108_+	HNH endonuclease	NA	F1C587	Cronobacter_phage	73.0	3.3e-44
AUV07841.1|3051306_3051774_+|terminase	phage terminase small subunit P27 family	terminase	Q9B019	Phage_GMSE-1	58.4	1.6e-43
AUV07842.1|3051727_3053464_+|terminase	phage terminase small subunit P27 family	terminase	A0A0U2C138	Paracoccus_phage	46.7	3.9e-143
AUV07843.1|3053463_3054738_+|portal	phage portal protein	portal	F1C584	Cronobacter_phage	84.9	1.1e-216
AUV07844.1|3054754_3055435_+|head,protease	HK97 family phage prohead protease	head,protease	Q9MCV5	Escherichia_phage	80.1	8.5e-102
AUV07845.1|3055437_3056598_+|capsid	phage major capsid protein	capsid	F1C582	Cronobacter_phage	86.7	2.7e-188
AUV10550.1|3056633_3056951_+	hypothetical protein	NA	Q77W99	Escherichia_phage	63.0	1.1e-32
AUV07846.1|3056950_3057292_+|head,tail	head-tail adaptor	head,tail	F1C580	Cronobacter_phage	58.6	7.4e-30
AUV07847.1|3057288_3057735_+	hypothetical protein	NA	F1C579	Cronobacter_phage	68.5	1.0e-50
AUV07848.1|3057731_3058079_+	hypothetical protein	NA	K7PM93	Enterobacterial_phage	48.7	1.5e-22
AUV07849.1|3058136_3058613_+|tail	phage tail protein	tail	A0A220NRQ0	Escherichia_phage	82.1	2.6e-65
AUV07850.1|3058656_3059052_+|tail	phage tail protein	tail	A0A220NRP3	Escherichia_phage	59.5	1.4e-32
AUV07851.1|3059063_3059321_+|tail	phage tail protein	tail	K7PLY6	Enterobacterial_phage	71.3	1.2e-27
AUV07852.1|3059356_3062905_+|tail	phage tail tape measure protein	tail	K7P7L6	Enterobacteria_phage	44.5	5.3e-203
AUV07853.1|3062904_3063243_+|tail	phage tail protein	tail	K7PKL8	Enterobacterial_phage	75.9	3.9e-47
AUV07854.1|3063239_3063995_+|tail	phage minor tail protein L	tail	K7PKU0	Enterobacteria_phage	79.7	1.5e-120
AUV07855.1|3063996_3064707_+	peptidase P60	NA	K7PGR2	Enterobacteria_phage	83.9	4.8e-124
AUV07856.1|3064739_3065417_+	hypothetical protein	NA	NA	NA	NA	NA
AUV07857.1|3065467_3066082_+|tail	phage tail protein	tail	K7PHE5	Enterobacteria_phage	69.6	1.4e-71
AUV07858.1|3066133_3069916_+	host specificity protein	NA	Q9MCU0	Escherichia_phage	71.6	0.0e+00
AUV07859.1|3069915_3070869_+	hypothetical protein	NA	I6PBN9	Cronobacter_phage	39.8	2.8e-50
AUV07860.1|3072197_3072437_+	hypothetical protein	NA	K7P7N3	Enterobacteria_phage	60.3	9.8e-21
AUV07861.1|3072436_3072721_+	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	39.1	2.6e-12
3074298:3074315	attR	CCATTTAACTAAGGGGAC	NA	NA	NA	NA
>prophage 10
CP026192	Enterobacteriaceae bacterium ENNIH2 chromosome, complete genome	5956094	3348874	3355214	5956094		Enterobacteria_phage(66.67%)	6	NA	NA
AUV08090.1|3348874_3350281_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	31.8	1.3e-19
AUV08091.1|3350463_3351357_+	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	39.9	2.8e-44
AUV08092.1|3351766_3352855_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	52.0	3.8e-96
AUV08093.1|3352873_3353746_+	glucose-1-phosphate thymidylyltransferase	NA	I7I009	Enterobacteria_phage	67.7	6.4e-110
AUV08094.1|3353770_3354661_+	dTDP-4-dehydrorhamnose reductase	NA	A0A140G5S3	Enterobacteria_phage	34.7	9.9e-26
AUV08095.1|3354665_3355214_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	59.9	3.9e-49
>prophage 11
CP026192	Enterobacteriaceae bacterium ENNIH2 chromosome, complete genome	5956094	3815433	3829816	5956094	tRNA	Tupanvirus(11.11%)	16	NA	NA
AUV08527.1|3815433_3817362_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	36.9	6.7e-128
AUV08528.1|3817365_3817908_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	32.9	2.2e-15
AUV08529.1|3818004_3818202_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
AUV08530.1|3818301_3818658_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
AUV10584.1|3818904_3818949_+|tRNA	phenylalanyl--tRNA ligase operon leader peptide	tRNA	NA	NA	NA	NA
AUV08531.1|3819074_3820058_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2H4UW22	Bodo_saltans_virus	43.2	3.8e-34
AUV08532.1|3820072_3822460_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	A0A1L3IZU3	BeAn_58058_virus	25.0	4.7e-06
AUV08533.1|3822464_3822764_+	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	7.2e-13
AUV08534.1|3822863_3823844_+	vitamin B12 ABC transporter permease BtuC	NA	NA	NA	NA	NA
AUV08535.1|3824063_3824615_+	glutathione peroxidase	NA	NA	NA	NA	NA
AUV08536.1|3824611_3825361_+	vitamin B12 ABC transporter ATP-binding protein BtuD	NA	A0A2R8FG22	Brazilian_cedratvirus	31.9	1.6e-08
AUV08537.1|3825437_3825899_+	endopeptidase	NA	A0A217EQL1	Bacillus_phage	35.3	2.9e-13
AUV08538.1|3826223_3826934_+	EAL domain-containing protein	NA	NA	NA	NA	NA
AUV08539.1|3826995_3828438_+	YdiU family protein	NA	A0A075BSJ0	Microcystis_phage	37.0	5.5e-58
AUV08540.1|3828442_3828634_-	hemin uptake protein HemP	NA	NA	NA	NA	NA
AUV10585.1|3828769_3829816_-	3-deoxy-7-phosphoheptulonate synthase	NA	A0A0B5IW14	Pandoravirus	45.9	7.5e-81
>prophage 12
CP026192	Enterobacteriaceae bacterium ENNIH2 chromosome, complete genome	5956094	5081323	5127509	5956094	lysis,holin,head,tail,integrase	Salmonella_phage(30.43%)	60	5081071:5081130	5124671:5124772
5081071:5081130	attL	AAAAACAAAGGGCTTACCAAATGGTAAGCCCTTGTTTAATCTGGCGGAAGCGCAGAGATT	NA	NA	NA	NA
AUV10660.1|5081323_5081752_-|tail	phage tail protein	tail	U5P083	Shigella_phage	50.7	6.7e-28
AUV09634.1|5083427_5084108_-	DUF2612 domain-containing protein	NA	A0A0M5M1K4	Salmonella_phage	81.9	2.0e-111
AUV09635.1|5084104_5085304_-	hypothetical protein	NA	A0A2H4J5T1	uncultured_Caudovirales_phage	74.6	4.4e-162
AUV09636.1|5085304_5085658_-	hypothetical protein	NA	A0A2H4J629	uncultured_Caudovirales_phage	81.2	7.9e-51
AUV09637.1|5085657_5086410_-	translation initiation factor IF-2	NA	A0A0M5M1K7	Salmonella_phage	69.4	1.3e-79
AUV09638.1|5086465_5086861_-	hypothetical protein	NA	NA	NA	NA	NA
AUV09639.1|5086841_5087582_-	hypothetical protein	NA	NA	NA	NA	NA
AUV09640.1|5087713_5088064_-	hypothetical protein	NA	A0A2H4J1A5	uncultured_Caudovirales_phage	55.2	4.5e-30
AUV09641.1|5088060_5089092_-	hypothetical protein	NA	A0A2H4J1B2	uncultured_Caudovirales_phage	53.8	3.2e-100
AUV09642.1|5089094_5089397_-	hypothetical protein	NA	A0A0M4R5B7	Salmonella_phage	58.0	1.7e-25
AUV09643.1|5089393_5089963_-	hypothetical protein	NA	A0A0M3ULD5	Salmonella_phage	72.4	6.7e-68
AUV10661.1|5089962_5091912_-	lytic transglycosylase	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	47.3	2.4e-149
AUV09644.1|5092288_5092480_-	NTP pyrophosphohydrolase	NA	A0A2H4J1A2	uncultured_Caudovirales_phage	74.5	2.4e-14
AUV09645.1|5092479_5092923_-	hypothetical protein	NA	A0A2H4J2V6	uncultured_Caudovirales_phage	56.2	3.9e-31
AUV09646.1|5092926_5093367_-	DUF3277 domain-containing protein	NA	A0A0M5M1K6	Salmonella_phage	75.3	1.4e-57
AUV09647.1|5093376_5094522_-	hypothetical protein	NA	A0A2H4J8G4	uncultured_Caudovirales_phage	73.5	3.1e-157
AUV09648.1|5094525_5095074_-	hypothetical protein	NA	A0A2H4J1A0	uncultured_Caudovirales_phage	52.2	4.7e-50
AUV09649.1|5095066_5095471_-|head,tail	head-tail adaptor	head,tail	A0A2H4J1A4	uncultured_Caudovirales_phage	70.2	1.4e-43
AUV09650.1|5095470_5095980_-	hypothetical protein	NA	A0A2H4J488	uncultured_Caudovirales_phage	42.7	1.4e-21
AUV09651.1|5095976_5096396_-	DUF4054 domain-containing protein	NA	A0A0M5M3S2	Salmonella_phage	62.2	3.9e-41
AUV09652.1|5096364_5096646_-	hypothetical protein	NA	NA	NA	NA	NA
AUV09653.1|5096686_5097628_-	DUF2184 domain-containing protein	NA	A0A2H4J191	uncultured_Caudovirales_phage	77.1	1.3e-137
AUV09654.1|5097639_5098134_-	hypothetical protein	NA	A0A2H4JHM9	uncultured_Caudovirales_phage	63.8	2.5e-50
AUV09655.1|5098137_5099340_-	hypothetical protein	NA	A0A0M4R5A6	Salmonella_phage	53.7	1.1e-107
AUV09656.1|5099408_5099687_-	hypothetical protein	NA	NA	NA	NA	NA
AUV10662.1|5099725_5100274_-	hypothetical protein	NA	A0A0M4REK0	Salmonella_phage	52.8	7.7e-45
AUV09657.1|5100326_5101781_-	hypothetical protein	NA	A0A0M4S6U1	Salmonella_phage	68.3	3.9e-189
AUV09658.1|5101784_5103398_-	TerL protein	NA	A0A0M5M1R6	Salmonella_phage	83.1	6.8e-275
AUV09659.1|5103634_5104108_-	hypothetical protein	NA	F1C5D6	Cronobacter_phage	71.2	3.0e-53
AUV09660.1|5104138_5104771_-	hypothetical protein	NA	F1C5D5	Cronobacter_phage	79.8	8.2e-99
AUV09661.1|5104870_5105179_-	hypothetical protein	NA	NA	NA	NA	NA
AUV09662.1|5105269_5105728_-|lysis	lysis protein	lysis	M9NYX9	Enterobacteria_phage	58.3	1.4e-39
AUV09663.1|5105724_5106261_-	lysozyme	NA	H6WRZ4	Salmonella_phage	85.9	6.1e-87
AUV09664.1|5106260_5106476_-|holin	holin	holin	Q9ZWW2	Enterobacteria_phage	78.9	5.3e-26
AUV09665.1|5106629_5107175_-	hypothetical protein	NA	NA	NA	NA	NA
AUV09666.1|5107386_5107965_-	hypothetical protein	NA	A0A0U2S606	Escherichia_phage	44.4	4.6e-40
AUV09667.1|5107961_5108255_-	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	64.2	5.7e-31
AUV09668.1|5108251_5108848_-	hypothetical protein	NA	H9C173	Pectobacterium_phage	68.7	3.1e-76
AUV09669.1|5108914_5109106_-	hypothetical protein	NA	NA	NA	NA	NA
AUV09670.1|5111035_5112898_-	DNA cytosine methyltransferase	NA	H9C171	Pectobacterium_phage	51.0	7.1e-191
AUV09671.1|5112894_5113155_-	hypothetical protein	NA	NA	NA	NA	NA
AUV10663.1|5113151_5113373_-	hypothetical protein	NA	S4TVX5	Salmonella_phage	58.5	5.7e-15
AUV09672.1|5113387_5113834_-	hypothetical protein	NA	NA	NA	NA	NA
AUV09673.1|5113830_5114076_-	hypothetical protein	NA	NA	NA	NA	NA
AUV09674.1|5114079_5114778_-	hypothetical protein	NA	NA	NA	NA	NA
AUV09675.1|5114819_5116211_-	replicative DNA helicase	NA	I6R0N4	Salmonella_phage	48.0	6.8e-106
AUV09676.1|5116207_5117218_-	helix-turn-helix domain-containing protein	NA	H9C164	Pectobacterium_phage	72.2	2.3e-39
AUV09677.1|5117220_5117433_-	hypothetical protein	NA	H9C163	Pectobacterium_phage	48.5	6.4e-08
AUV09678.1|5117452_5117899_-	hypothetical protein	NA	H9C162	Pectobacterium_phage	53.2	8.2e-29
AUV09679.1|5117968_5118202_-	transcriptional regulator	NA	A0A0U2S629	Escherichia_phage	50.0	9.5e-13
AUV09680.1|5118301_5118766_+	transcriptional regulator	NA	A0A0U2QW76	Escherichia_phage	49.0	8.8e-34
AUV09681.1|5119795_5120125_+	hypothetical protein	NA	NA	NA	NA	NA
AUV09682.1|5120162_5122445_+	hypothetical protein	NA	H9C157	Pectobacterium_phage	34.1	1.2e-104
AUV09683.1|5122441_5123002_+	hypothetical protein	NA	H9C156	Pectobacterium_phage	59.6	6.2e-50
AUV09684.1|5123004_5123187_+	hypothetical protein	NA	NA	NA	NA	NA
AUV09685.1|5123236_5123437_+	hypothetical protein	NA	H9C154	Pectobacterium_phage	52.3	6.1e-08
AUV09686.1|5123399_5123618_+	hypothetical protein	NA	H9C153	Pectobacterium_phage	71.0	5.2e-21
AUV09687.1|5123617_5124628_+|integrase	integrase	integrase	A0A192Y7M7	Salmonella_phage	49.8	1.8e-84
AUV09688.1|5124944_5126573_-	oligopeptide ABC transporter substrate-binding protein OppA	NA	NA	NA	NA	NA
5124671:5124772	attR	AAAAACAAAGGGCTTACCAAATGGTAAGCCCTTGTTTAATCTGGCGGAAGCGCAGAGATTCGAACTCTGGAACCCTTTCGGGTCGCCGGTTTTCAAGACCGG	NA	NA	NA	NA
AUV09689.1|5126849_5127509_+	transmembrane protein	NA	A0A2H4JFM9	uncultured_Caudovirales_phage	54.4	3.4e-47
>prophage 1
CP026189	Enterobacteriaceae bacterium ENNIH2 plasmid pENT-812c, complete sequence	171306	0	8826	171306		Bacillus_phage(66.67%)	7	NA	NA
AUV04917.1|2139_3432_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
AUV04918.1|3545_3899_-	copper ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUV04919.1|3928_5314_-	hypothetical protein	NA	NA	NA	NA	NA
AUV04920.1|5503_6184_+	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	36.0	2.7e-31
AUV04921.1|6176_7652_+	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	30.1	1.0e-27
AUV04922.1|7897_8329_+	silver-binding protein SilE	NA	NA	NA	NA	NA
AUV04923.1|8475_8826_+	DUF305 domain-containing protein	NA	A0A218MND9	uncultured_virus	52.4	6.7e-18
>prophage 2
CP026189	Enterobacteriaceae bacterium ENNIH2 plasmid pENT-812c, complete sequence	171306	13892	27463	171306	integrase	Macacine_betaherpesvirus(22.22%)	15	8751:8765	32889:32903
8751:8765	attL	GCTCGCGCAGGACAT	NA	NA	NA	NA
AUV04928.1|13892_14681_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	84.3	7.4e-49
AUV04929.1|14699_16034_+	hypothetical protein	NA	NA	NA	NA	NA
AUV04930.1|16100_16811_-	RepB family plasmid replication initiator protein	NA	I3WF20	Macacine_betaherpesvirus	31.8	3.9e-25
AUV05083.1|17683_18889_+	ParA family protein	NA	A0A077SL49	Escherichia_phage	68.1	4.5e-162
AUV04931.1|18888_19854_+	chromosome partitioning protein ParB	NA	A0A1B0V750	Salmonella_phage	51.1	6.9e-81
AUV04932.1|20074_21349_-	translesion error-prone DNA polymerase V subunit UmuC	NA	F1C5A5	Cronobacter_phage	63.3	1.9e-150
AUV04933.1|21348_21777_-	peptidase	NA	A0A1W6JNS2	Morganella_phage	52.4	4.6e-29
AUV04934.1|22190_22448_-	hypothetical protein	NA	NA	NA	NA	NA
AUV04935.1|22860_23817_+	recombinase	NA	A0A222YXF2	Escherichia_phage	56.6	1.4e-97
AUV05084.1|23821_24220_+	plasmid stability protein	NA	NA	NA	NA	NA
AUV04936.1|24220_24469_+	hypothetical protein	NA	NA	NA	NA	NA
AUV04937.1|24840_25113_+	hypothetical protein	NA	NA	NA	NA	NA
AUV04938.1|25112_25934_+	N-6 DNA methylase	NA	H7BVT3	unidentified_phage	34.5	2.4e-10
AUV04939.1|26239_26458_+	hypothetical protein	NA	NA	NA	NA	NA
AUV04940.1|26770_27463_+	DNA methylase	NA	A0A2K9VH43	Faecalibacterium_phage	37.7	2.6e-29
32889:32903	attR	GCTCGCGCAGGACAT	NA	NA	NA	NA
>prophage 3
CP026189	Enterobacteriaceae bacterium ENNIH2 plasmid pENT-812c, complete sequence	171306	38011	38833	171306		Yersinia_phage(100.0%)	1	NA	NA
AUV04954.1|38011_38833_+	DUF945 domain-containing protein	NA	A0A2C9CYF8	Yersinia_phage	38.5	9.8e-44
>prophage 4
CP026189	Enterobacteriaceae bacterium ENNIH2 plasmid pENT-812c, complete sequence	171306	52196	52535	171306		Yersinia_phage(100.0%)	1	NA	NA
AUV04970.1|52196_52535_+	hypothetical protein	NA	Q7Y3W7	Yersinia_phage	49.0	6.6e-23
>prophage 5
CP026189	Enterobacteriaceae bacterium ENNIH2 plasmid pENT-812c, complete sequence	171306	76708	161089	171306	integrase,transposase	Escherichia_phage(22.86%)	88	117182:117241	129685:129886
AUV04991.1|76708_77242_+	phospholipase D family protein	NA	A0A1B2LRT6	Wolbachia_phage	33.8	1.6e-18
AUV04992.1|77384_77645_+	replication protein	NA	NA	NA	NA	NA
AUV04993.1|77933_78806_+	incFII family plasmid replication initiator RepA	NA	NA	NA	NA	NA
AUV04994.1|78802_79408_-	DNA resolvase	NA	A0A1S5Y2X8	uncultured_archaeal_virus	35.3	5.5e-20
AUV04995.1|79502_82400_+|transposase	Tn3-like element Tn5403 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	37.8	4.2e-182
AUV04996.1|82784_83258_-	hypothetical protein	NA	NA	NA	NA	NA
AUV04997.1|83498_83813_+	hypothetical protein	NA	NA	NA	NA	NA
AUV04998.1|84397_86416_+	ATP-dependent endonuclease	NA	NA	NA	NA	NA
AUV05089.1|86420_88406_+	ATP-dependent helicase	NA	NA	NA	NA	NA
AUV04999.1|88634_89108_+	hypothetical protein	NA	NA	NA	NA	NA
AUV05000.1|89315_90299_-|integrase	integrase	integrase	A0A1P8DJ76	Virus_Rctr85	37.7	1.3e-42
AUV05001.1|90589_91192_+	hypothetical protein	NA	NA	NA	NA	NA
AUV05002.1|91207_91660_-	hypothetical protein	NA	NA	NA	NA	NA
AUV05003.1|91826_92162_-	hypothetical protein	NA	NA	NA	NA	NA
AUV05004.1|92421_92694_-	hypothetical protein	NA	NA	NA	NA	NA
AUV05005.1|94040_94496_-	Hg(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
AUV05006.1|94567_94933_+	mercuric transport protein	NA	NA	NA	NA	NA
AUV05007.1|94948_95224_+	mercuric transporter periplasmic component	NA	NA	NA	NA	NA
AUV05008.1|95251_95677_+	mercury transport protein MerC	NA	NA	NA	NA	NA
AUV05009.1|95715_97410_+	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.6	8.8e-39
AUV05010.1|97427_97790_+	transcriptional regulator	NA	NA	NA	NA	NA
AUV05011.1|97786_98023_+	mercury resistance protein	NA	NA	NA	NA	NA
AUV05012.1|98019_98727_+	EAL domain-containing protein	NA	NA	NA	NA	NA
AUV05013.1|98765_100481_+|transposase	transposase	transposase	NA	NA	NA	NA
AUV05014.1|100483_101344_+|transposase	transposase	transposase	NA	NA	NA	NA
AUV05015.1|101394_102939_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	34.6	1.0e-38
AUV05016.1|103061_104585_+|transposase	IS21 family transposase IS1326	transposase	A0A2L1IVA1	Escherichia_phage	24.2	1.2e-15
AUV05090.1|104574_105357_+	ATP-binding protein	NA	A0A2L1IVB6	Escherichia_phage	35.0	2.5e-33
AUV05017.1|105532_106033_-	N-acetyltransferase	NA	NA	NA	NA	NA
AUV05018.1|106051_106231_+	hypothetical protein	NA	NA	NA	NA	NA
AUV05019.1|106160_107012_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.1e-11
AUV05020.1|107113_108073_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	40.5	1.7e-47
AUV05021.1|107963_108668_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AUV05022.1|108751_109636_-	Mph(E) family macrolide 2'-phosphotransferase	NA	NA	NA	NA	NA
AUV05023.1|109691_111167_-	ABC-F type ribosomal protection protein Msr(E)	NA	A0A1B0RXA0	Streptococcus_phage	59.0	2.3e-160
AUV05024.1|111616_112321_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AUV05025.1|112497_113262_-|transposase	IS6 family transposase IS6100	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
AUV05026.1|113327_113507_+	hypothetical protein	NA	NA	NA	NA	NA
AUV05027.1|113436_114276_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
AUV05028.1|114269_114617_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
AUV05029.1|114773_115406_-	type B-3 chloramphenicol O-acetyltransferase CatB3	NA	A0A2R8FE91	Brazilian_cedratvirus	41.2	4.1e-26
AUV05091.1|115488_116022_-	aminoglycoside nucleotidyltransferase ANT(2'')-Ia	NA	NA	NA	NA	NA
AUV05030.1|116167_117181_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
AUV05031.1|117119_117401_+|transposase	transposase	transposase	NA	NA	NA	NA
117182:117241	attL	GGCAGCGCAAGTCAATCCTGGCGGATTCACTACCCCTGCGCGAAGGCCATCGGTGCCGCA	NA	NA	NA	NA
AUV05032.1|117783_118353_-	trimethoprim-resistant dihydrofolate reductase DfrA19	NA	A0A1V0SD48	Indivirus	27.2	3.5e-08
AUV05033.1|118352_118853_-	hypothetical protein	NA	A0A1V0SB21	Catovirus	31.7	3.3e-10
AUV05034.1|119118_120660_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
AUV05035.1|121064_121904_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
AUV05036.1|121897_122245_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
AUV05037.1|122174_122456_-	hypothetical protein	NA	NA	NA	NA	NA
AUV05038.1|122434_123067_-	type B-2 chloramphenicol O-acetyltransferase CatB11	NA	M1HKK6	Paramecium_bursaria_Chlorella_virus	43.0	7.1e-26
AUV05039.1|123191_124451_-	chloramphenicol efflux MFS transporter	NA	S4TR35	Salmonella_phage	31.7	4.8e-26
AUV05040.1|125251_126601_+	group II intron reverse transcriptase/maturase	NA	H7BV81	unidentified_phage	28.1	5.2e-10
AUV05092.1|126689_127481_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA2	NA	NA	NA	NA	NA
AUV05093.1|127598_128465_-	PSE family carbenicillin-hydrolyzing class A beta-lactamase CARB-2	NA	A0A077SL40	Escherichia_phage	44.1	4.8e-57
AUV05041.1|128670_129684_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
AUV05042.1|129628_129952_+|transposase	transposase	transposase	NA	NA	NA	NA
129685:129886	attR	GGCAGCGCAAGTCAATCCTGGCGGATTCACTACCCCTGCGCGAAGGCCATCGGTGCCGCATCGAACGGCCGGTTGCGGAAAGTCCTCCCTGCGTCCGCTGATGGCCGGCAGCAGCCCGTCGTTGCCTGATGGATCCAACCCCTCCGCTGCTATAGTGCAGTCGGCTTCTGACGTTCAGTGCAGCCGTCTTCTGAAAACGACA	NA	NA	NA	NA
AUV05043.1|129989_130547_+	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	81.3	5.8e-48
AUV05044.1|130549_133522_+|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.1	0.0e+00
AUV05045.1|133600_134605_+|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
AUV05046.1|135095_135959_-	conjugal transfer protein TraX	NA	A0A077JBM8	Xanthomonas_phage	38.0	1.9e-05
AUV05047.1|136229_136667_+	hypothetical protein	NA	NA	NA	NA	NA
AUV05048.1|136663_137347_-	DUF159 family protein	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	61.1	8.0e-84
AUV05049.1|137774_138146_-	hypothetical protein	NA	NA	NA	NA	NA
AUV05050.1|138186_138714_-	hypothetical protein	NA	A0A1B2LRT6	Wolbachia_phage	35.0	5.9e-18
AUV05051.1|139033_140050_-|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.7	2.2e-186
AUV05052.1|140093_141941_-	diol dehydratase reactivase subunit alpha	NA	NA	NA	NA	NA
AUV05053.1|141953_142385_-	propanediol dehydratase small subunit PduE	NA	NA	NA	NA	NA
AUV05054.1|142381_142972_-	propanediol dehydratase medium subunit PduD	NA	NA	NA	NA	NA
AUV05094.1|142985_144653_-	propanediol dehydratase large subunit PduC	NA	NA	NA	NA	NA
AUV05055.1|145046_145475_+	heme-binding protein	NA	NA	NA	NA	NA
AUV05056.1|145512_146676_+	1,3-propanediol dehydrogenase	NA	NA	NA	NA	NA
AUV05057.1|146745_147111_+	hypothetical protein	NA	NA	NA	NA	NA
AUV05058.1|147112_147661_+	ATP:cob(I)alamin adenosyltransferase	NA	NA	NA	NA	NA
AUV05059.1|147638_149564_-	PTS-dependent dihydroxyacetone kinase operon transcriptional regulator DhaR	NA	NA	NA	NA	NA
AUV05060.1|149703_150804_-	glycerol dehydrogenase	NA	NA	NA	NA	NA
AUV05061.1|151400_152471_+	dihydroxyacetone kinase subunit DhaK	NA	NA	NA	NA	NA
AUV05062.1|152482_153115_+	dihydroxyacetone kinase subunit L	NA	NA	NA	NA	NA
AUV05063.1|153131_154559_+	dihydroxyacetone kinase subunit DhaM	NA	NA	NA	NA	NA
AUV05064.1|154635_156294_+	glycerone kinase	NA	NA	NA	NA	NA
AUV05065.1|156537_157554_+|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.7	2.2e-186
AUV05095.1|157591_157732_-	sugar kinase	NA	Q6QLL3	Human_immunodeficiency_virus	97.2	2.6e-13
AUV05066.1|157718_157898_+	antitoxin	NA	NA	NA	NA	NA
AUV05067.1|157863_157983_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
AUV05068.1|158148_158331_-	hypothetical protein	NA	NA	NA	NA	NA
AUV05069.1|158359_158794_-	copper-binding protein	NA	NA	NA	NA	NA
AUV05070.1|159011_160412_-	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	26.6	3.2e-18
AUV05071.1|160408_161089_-	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	34.4	8.7e-30
>prophage 6
CP026189	Enterobacteriaceae bacterium ENNIH2 plasmid pENT-812c, complete sequence	171306	166183	169634	171306		uncultured_Caudovirales_phage(50.0%)	3	NA	NA
AUV05077.1|166183_166921_+	peptidase M23	NA	A0A2H4JAF5	uncultured_Caudovirales_phage	31.9	1.3e-10
AUV05078.1|166954_167152_-	DUF2933 domain-containing protein	NA	NA	NA	NA	NA
AUV05079.1|167192_169634_-	copper-translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	34.9	8.4e-83
>prophage 1
CP026188	Enterobacteriaceae bacterium ENNIH2 plasmid pKPC-ddab, complete sequence	82861	6263	33795	82861	transposase,integrase,protease	Escherichia_phage(36.36%)	25	26350:26409	27659:27800
AUV04826.1|6263_9161_-|transposase	Tn3-like element Tn5403 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	37.8	4.2e-182
AUV04827.1|9255_9861_+	DNA resolvase	NA	A0A1S5Y2X8	uncultured_archaeal_virus	35.3	5.5e-20
AUV04828.1|10174_11494_+|transposase	IS1182 family transposase ISKpn6	transposase	Q9MBP7	Staphylococcus_prophage	24.2	1.9e-12
AUV04829.1|11743_12625_-	carbapenem-hydrolyzing class A beta-lactamase KPC-2	NA	A0A1B0VBP7	Salmonella_phage	52.2	2.2e-73
AUV04830.1|13149_13854_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AUV04831.1|13844_14027_+	hypothetical protein	NA	NA	NA	NA	NA
AUV04832.1|13990_14851_+	class A extended-spectrum beta-lactamase SHV-12	NA	A0A077SL40	Escherichia_phage	99.3	2.2e-155
AUV04833.1|14871_15633_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
AUV04834.1|17418_18681_+|transposase	IS1380 family transposase ISEc9	transposase	A0A1B0VDR3	Salmonella_phage	100.0	1.3e-39
AUV04835.1|18844_19162_+	hypothetical protein	NA	NA	NA	NA	NA
AUV04836.1|19170_19815_-	quinolone resistance pentapeptide repeat protein QnrB19	NA	NA	NA	NA	NA
AUV04837.1|20492_21197_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AUV04838.1|21554_22112_+	recombinase	NA	Q1MVP4	Enterobacteria_phage	98.4	2.0e-93
AUV04907.1|22345_22900_+	aminoglycoside N-acetyltransferase AAC(6')-Ib'	NA	NA	NA	NA	NA
AUV04839.1|22969_23758_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA1	NA	NA	NA	NA	NA
AUV04840.1|23817_24642_+	oxacillin-hydrolyzing class D beta-lactamase OXA-9	NA	NA	NA	NA	NA
AUV04841.1|25341_26202_+	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
26350:26409	attL	TAGACAAGAAAGTCCGTTAAGTGCCAATTTTCGATTAAAAAGACACCGTTTTGATGGCGT	NA	NA	NA	NA
AUV04908.1|26597_27131_-	aminoglycoside nucleotidyltransferase ANT(2'')-Ia	NA	NA	NA	NA	NA
AUV04842.1|27279_27627_+|integrase	class 1 integron integrase IntI1	integrase	NA	NA	NA	NA
AUV04843.1|27810_29898_-	conjugal transfer protein TrbC	NA	NA	NA	NA	NA
27659:27800	attR	TAGACAAGAAAGTCCGTTAAGTGCCAATTTTCGATTAAAAAGACACCGTTTTGATGGCGTTTTCCAATGTACATTATGTTTCGATATATCAGACAGTTACTTCACTAACGTACGTTTTCGTTCTATTGGCCTTCAGACCCCT	NA	NA	NA	NA
AUV04844.1|29910_30861_-	DsbC family protein	NA	NA	NA	NA	NA
AUV04909.1|30871_32134_-	conjugal transfer protein TrbA	NA	NA	NA	NA	NA
AUV04845.1|32178_32574_-	lytic transglycosylase	NA	NA	NA	NA	NA
AUV04846.1|32678_33062_-	DUF1496 domain-containing protein	NA	NA	NA	NA	NA
AUV04847.1|33141_33795_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
