The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP026193	Enterobacteriaceae bacterium ENNIH1 chromosome, complete genome	5267614	1182579	1194024	5267614		Enterobacteria_phage(37.5%)	11	NA	NA
AUV00530.1|1182579_1183986_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	28.7	6.4e-19
AUV00531.1|1184168_1185062_+	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	40.3	2.5e-45
AUV00532.1|1185476_1186565_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	49.1	5.9e-89
AUV00533.1|1186583_1187450_+	glucose-1-phosphate thymidylyltransferase	NA	I7I009	Enterobacteria_phage	66.3	3.1e-109
AUV00534.1|1187474_1188362_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	34.4	4.3e-29
AUV00535.1|1188386_1189352_+	glycosyl transferase family 2	NA	NA	NA	NA	NA
AUV00536.1|1189403_1189949_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	61.1	2.8e-55
AUV04137.1|1189981_1190770_+	sugar ABC transporter permease	NA	NA	NA	NA	NA
AUV04138.1|1190786_1192127_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	22.6	3.8e-05
AUV00537.1|1192119_1192920_+	hypothetical protein	NA	NA	NA	NA	NA
AUV00538.1|1192923_1194024_+	aminotransferase	NA	A0A0P0YLZ6	Yellowstone_lake_phycodnavirus	24.0	1.2e-09
>prophage 2
CP026193	Enterobacteriaceae bacterium ENNIH1 chromosome, complete genome	5267614	1212210	1246041	5267614	lysis,capsid,terminase,portal,head,tail,transposase,holin,protease,integrase	Enterobacteria_phage(28.57%)	50	1206231:1206245	1221794:1221808
1206231:1206245	attL	GCGGGTCACCTGCTG	NA	NA	NA	NA
AUV00555.1|1212210_1213392_+|integrase	integrase	integrase	A0A0M4QX09	Salmonella_phage	88.8	4.3e-210
AUV04141.1|1213372_1213564_-	AlpA family transcriptional regulator	NA	A0A0P0ZBL0	Stx2-converting_phage	60.3	2.0e-16
AUV00556.1|1213610_1213988_-	hypothetical protein	NA	NA	NA	NA	NA
AUV00557.1|1213984_1214209_-	hypothetical protein	NA	A0A286S2B6	Klebsiella_phage	48.6	2.3e-11
AUV00558.1|1214205_1214430_-	hypothetical protein	NA	A0A286S2B3	Klebsiella_phage	53.0	9.2e-13
AUV00559.1|1214426_1214771_-	hypothetical protein	NA	A0A1B5FPL8	Escherichia_phage	71.2	6.1e-40
AUV00560.1|1214770_1215523_-	hypothetical protein	NA	A0A1B5FPC0	Escherichia_phage	91.2	2.6e-128
AUV04142.1|1215534_1216068_-	hypothetical protein	NA	A0A286S1S7	Klebsiella_phage	68.8	2.4e-67
AUV00561.1|1216115_1216532_-	hypothetical protein	NA	A0A286S1S2	Klebsiella_phage	68.1	1.3e-44
AUV00562.1|1216528_1216750_-	hypothetical protein	NA	A0A286S1P6	Klebsiella_phage	65.3	5.5e-18
AUV04143.1|1216749_1217115_-	hypothetical protein	NA	A0A1B5FPB3	Escherichia_phage	58.4	6.1e-30
AUV00563.1|1217104_1217410_-	hypothetical protein	NA	NA	NA	NA	NA
AUV00564.1|1217402_1217792_-	peptidase S24	NA	F1C5A0	Cronobacter_phage	50.0	1.8e-24
AUV00565.1|1217854_1218364_-	hypothetical protein	NA	NA	NA	NA	NA
AUV00566.1|1218553_1219186_-	DNA-binding protein	NA	A0A1I9KG86	Aeromonas_phage	38.5	5.0e-32
AUV00567.1|1219298_1219514_+	transcriptional regulator	NA	NA	NA	NA	NA
AUV00568.1|1219510_1220383_+	helix-turn-helix domain-containing protein	NA	Q8HA96	Salmonella_phage	66.3	1.5e-82
AUV00569.1|1220399_1221284_+	AAA family ATPase	NA	Q8W641	Enterobacteria_phage	61.4	4.7e-76
AUV00570.1|1221280_1222654_+	helicase	NA	Q8W640	Enterobacteria_phage	65.1	1.9e-169
1221794:1221808	attR	GCGGGTCACCTGCTG	NA	NA	NA	NA
AUV00571.1|1222650_1223463_+	antitermination protein	NA	A0A1B5FPA5	Escherichia_phage	68.0	5.7e-105
AUV00572.1|1223844_1224681_+	hypothetical protein	NA	A0A1B2IGT1	Erwinia_phage	75.2	2.2e-112
AUV00573.1|1225502_1225718_+|holin	holin	holin	Q9ZWW2	Enterobacteria_phage	78.9	6.9e-26
AUV00574.1|1225717_1226254_+	lysozyme	NA	K7PM52	Enterobacteria_phage	75.1	2.2e-76
AUV00575.1|1226250_1226703_+|lysis	lysis protein	lysis	A0A2H4JHL8	uncultured_Caudovirales_phage	49.0	4.6e-27
AUV00576.1|1226717_1226915_+	hypothetical protein	NA	K7PHC3	Enterobacterial_phage	86.2	1.0e-23
AUV00577.1|1226989_1227286_+	hypothetical protein	NA	NA	NA	NA	NA
AUV00578.1|1227359_1227710_+	HNH endonuclease	NA	A0A1B5FP94	Escherichia_phage	77.4	4.3e-49
AUV00579.1|1227706_1227907_+	hypothetical protein	NA	Q6UAR8	Klebsiella_phage	87.9	6.5e-10
AUV00580.1|1227949_1228141_+	hypothetical protein	NA	NA	NA	NA	NA
AUV00581.1|1228098_1228572_+|terminase	phage terminase small subunit P27 family	terminase	K7PHI2	Enterobacteria_phage	89.2	3.9e-77
AUV00582.1|1228571_1230329_+|terminase	terminase	terminase	A0A1B5FP96	Escherichia_phage	88.3	6.0e-309
AUV00583.1|1230476_1231703_+|portal	phage portal protein	portal	Q8SBI0	Shigella_phage	82.4	1.0e-198
AUV00584.1|1231695_1232295_+|head,protease	HK97 family phage prohead protease	head,protease	Q8SBH9	Shigella_phage	79.5	6.1e-88
AUV00585.1|1232305_1233532_+|capsid	phage major capsid protein	capsid	A0A1W6JP20	Morganella_phage	69.9	1.8e-155
AUV00586.1|1233606_1233924_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1W6JNZ5	Morganella_phage	54.8	1.6e-23
AUV00587.1|1233932_1234271_+|head,tail	head-tail adaptor protein	head,tail	A0A2H4JHK5	uncultured_Caudovirales_phage	64.9	1.2e-35
AUV00588.1|1234267_1234714_+	hypothetical protein	NA	K7PH04	Enterobacteria_phage	77.9	9.3e-57
AUV00589.1|1234710_1235058_+	hypothetical protein	NA	F1C578	Cronobacter_phage	60.9	3.1e-31
AUV00590.1|1235120_1235597_+|tail	phage tail protein	tail	A0A220NRQ0	Escherichia_phage	83.3	5.2e-66
AUV00591.1|1235647_1236040_+|tail	phage tail protein	tail	K7P7C2	Enterobacteria_phage	64.8	4.7e-36
AUV00592.1|1236063_1236330_+|tail	phage tail protein	tail	K7P7L5	Enterobacteria_phage	72.7	3.4e-30
AUV00593.1|1236365_1239674_+|tail	phage tail tape measure protein	tail	A0A220NRN7	Escherichia_phage	73.0	0.0e+00
AUV00594.1|1239673_1240012_+|tail	phage tail protein	tail	K7PHJ6	Enterobacteria_phage	75.9	3.3e-46
AUV00595.1|1240008_1240764_+|tail	phage minor tail protein L	tail	K7PKU0	Enterobacteria_phage	80.5	6.3e-122
AUV00596.1|1240765_1241332_+	peptidase P60	NA	K7PJV6	Enterobacteria_phage	85.6	5.2e-97
AUV00597.1|1241358_1242479_-|transposase	IS3-like element ISSen4 family transposase	transposase	S5WIU1	Leptospira_phage	42.8	1.7e-51
AUV00598.1|1242491_1242677_+	hypothetical protein	NA	NA	NA	NA	NA
AUV00599.1|1243022_1243907_-	serine dehydrogenasease	NA	NA	NA	NA	NA
AUV00600.1|1244227_1244467_-	DinI family protein	NA	K7P6H1	Enterobacteria_phage	82.3	3.0e-30
AUV00601.1|1244877_1246041_+	serine-type D-Ala-D-Ala carboxypeptidase DacD	NA	B6DZZ7	Stx2-converting_phage	78.9	2.9e-182
>prophage 3
CP026193	Enterobacteriaceae bacterium ENNIH1 chromosome, complete genome	5267614	1580448	1594767	5267614	tRNA	Tupanvirus(11.11%)	16	NA	NA
AUV00924.1|1580448_1582377_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	36.9	6.7e-128
AUV00925.1|1582380_1582923_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	32.9	2.2e-15
AUV00926.1|1583019_1583217_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
AUV00927.1|1583267_1583624_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
AUV00928.1|1583776_1583977_-	hypothetical protein	NA	NA	NA	NA	NA
AUV00929.1|1584042_1585026_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2H4UW22	Bodo_saltans_virus	43.2	2.9e-34
AUV00930.1|1585040_1587428_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	A0A1L3IZU3	BeAn_58058_virus	25.0	1.2e-06
AUV00931.1|1587432_1587732_+	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	7.2e-13
AUV00932.1|1587831_1588812_+	vitamin B12 ABC transporter permease BtuC	NA	NA	NA	NA	NA
AUV00933.1|1589016_1589568_+	glutathione peroxidase	NA	NA	NA	NA	NA
AUV00934.1|1589564_1590314_+	vitamin B12 ABC transporter ATP-binding protein BtuD	NA	A0A2R8FG22	Brazilian_cedratvirus	29.3	6.7e-07
AUV00935.1|1590390_1590852_+	endopeptidase	NA	A0A217EQL1	Bacillus_phage	35.3	8.5e-13
AUV00936.1|1591176_1591887_+	EAL domain-containing protein	NA	NA	NA	NA	NA
AUV00937.1|1591948_1593391_+	YdiU family protein	NA	A0A075BSJ0	Microcystis_phage	37.2	1.1e-58
AUV00938.1|1593395_1593587_-	hemin uptake protein HemP	NA	NA	NA	NA	NA
AUV04161.1|1593720_1594767_-	3-deoxy-7-phosphoheptulonate synthase	NA	S4W5F1	Pandoravirus	46.0	2.6e-81
>prophage 4
CP026193	Enterobacteriaceae bacterium ENNIH1 chromosome, complete genome	5267614	2352514	2398905	5267614	capsid,lysis,terminase,portal,head,tail,transposase,holin,integrase	Enterobacteria_phage(51.11%)	59	2371412:2371428	2402807:2402823
AUV01609.1|2352514_2352898_-	hypothetical protein	NA	U5P083	Shigella_phage	44.3	4.4e-15
AUV01610.1|2354321_2355227_-	hypothetical protein	NA	G1CSU0	Cronobacter_virus	32.7	4.9e-28
AUV01611.1|2355272_2358491_-	host specificity protein	NA	O64335	Escherichia_phage	78.8	0.0e+00
AUV01612.1|2358542_2359121_-|tail	phage tail protein	tail	K7PHE5	Enterobacteria_phage	65.3	1.2e-64
AUV01613.1|2359175_2359559_-	hypothetical protein	NA	A0A0M4QWT0	Salmonella_phage	54.3	1.2e-36
AUV01614.1|2359622_2360324_-	peptidase P60	NA	K7PGR2	Enterobacteria_phage	85.8	2.8e-124
AUV01615.1|2360325_2361081_-|tail	phage minor tail protein L	tail	K7PKU0	Enterobacteria_phage	80.1	1.0e-119
AUV01616.1|2361077_2361425_-|tail	phage tail protein	tail	K7PJT2	Enterobacteria_phage	61.7	4.6e-35
AUV01617.1|2361427_2364001_-|tail	phage tail tape measure protein	tail	K7PKR0	Enterobacteria_phage	37.9	1.1e-138
AUV01618.1|2363981_2364311_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	47.2	3.0e-20
AUV01619.1|2364307_2364724_-|tail	phage minor tail protein G	tail	M9NZD7	Enterobacteria_phage	41.5	1.2e-18
AUV01620.1|2364736_2365468_-|tail	phage tail protein	tail	K7PKX6	Enterobacterial_phage	70.2	4.3e-91
AUV01621.1|2365475_2365874_-|tail	phage tail protein	tail	K7P7G5	Enterobacteria_phage	72.0	3.1e-51
AUV01622.1|2365870_2366425_-|tail	phage tail protein	tail	K7P7A8	Enterobacteria_phage	81.0	5.5e-67
AUV01623.1|2366405_2366792_-|tail	phage tail protein	tail	K7P6U9	Enterobacteria_phage	67.2	2.1e-41
AUV01624.1|2366804_2367206_-	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	44.6	1.1e-19
AUV01625.1|2367247_2368273_-|capsid	major capsid protein E	capsid	K7P6G7	Enterobacteria_phage	92.1	7.6e-179
AUV01626.1|2368340_2368673_-|head	head decoration protein	head	E4WL24	Enterobacteria_phage	84.5	7.7e-48
AUV01627.1|2368682_2370035_-|capsid	capsid assembly protein	capsid	O64320	Escherichia_phage	82.4	9.1e-180
AUV01628.1|2370015_2371605_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	88.4	2.5e-277
2371412:2371428	attL	CCATTGTTACGCACCAG	NA	NA	NA	NA
AUV01629.1|2371601_2371808_-|tail	phage tail protein	tail	K7PM10	Enterobacteria_phage	88.2	1.8e-26
AUV01630.1|2371807_2373730_-|terminase	terminase	terminase	E4WL19	Enterobacteria_phage	91.2	0.0e+00
AUV01631.1|2373704_2374250_-|terminase	terminase small subunit	terminase	K7P7G0	Enterobacteria_phage	87.3	1.6e-82
AUV01632.1|2374526_2374988_-	hypothetical protein	NA	NA	NA	NA	NA
AUV01633.1|2375142_2375361_-	hypothetical protein	NA	K7PJU3	Enterobacteria_phage	72.5	6.6e-24
AUV04198.1|2375423_2375633_-	hypothetical protein	NA	NA	NA	NA	NA
AUV01634.1|2375745_2376060_-	hypothetical protein	NA	NA	NA	NA	NA
AUV01635.1|2376142_2376340_-	hypothetical protein	NA	K7PHC3	Enterobacterial_phage	89.2	1.4e-25
AUV01636.1|2376449_2376698_+	hypothetical protein	NA	NA	NA	NA	NA
AUV01637.1|2376715_2377000_-	hypothetical protein	NA	G8C7W3	Escherichia_phage	68.1	2.2e-27
AUV01638.1|2377011_2377464_-|lysis	lysis protein	lysis	M1FJ79	Enterobacteria_phage	53.2	5.0e-26
AUV01639.1|2377460_2377997_-	lysozyme	NA	K7PM52	Enterobacteria_phage	76.9	1.0e-78
AUV01640.1|2377996_2378212_-|holin	holin	holin	A5LH82	Enterobacteria_phage	78.9	4.1e-26
AUV01641.1|2379844_2380450_-	hypothetical protein	NA	H9C175	Pectobacterium_phage	76.4	4.8e-88
AUV01642.1|2380460_2381486_-	hypothetical protein	NA	S5MW46	Escherichia_phage	53.4	7.8e-107
AUV01643.1|2381470_2381839_-	RusA family crossover junction endodeoxyribonuclease	NA	K7P6W0	Enterobacteria_phage	61.5	2.9e-40
AUV01644.1|2381841_2382042_-	hypothetical protein	NA	H6WRY8	Salmonella_phage	55.4	3.1e-12
AUV01645.1|2382038_2382431_-	DNA-binding protein	NA	K7PHB4	Enterobacterial_phage	47.0	9.1e-16
AUV01646.1|2382474_2382708_-	hypothetical protein	NA	H6WRY6	Salmonella_phage	50.6	2.3e-19
AUV04199.1|2382745_2383807_-	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	60.1	8.3e-104
AUV01647.1|2384001_2386065_-	DNA cytosine methyltransferase	NA	H9C171	Pectobacterium_phage	47.3	1.4e-184
AUV01648.1|2386061_2386322_-	hypothetical protein	NA	NA	NA	NA	NA
AUV01649.1|2386314_2386638_-	hypothetical protein	NA	NA	NA	NA	NA
AUV01650.1|2386634_2386886_-	hypothetical protein	NA	NA	NA	NA	NA
AUV01651.1|2386882_2387107_-	hypothetical protein	NA	NA	NA	NA	NA
AUV01652.1|2387103_2387640_-	hypothetical protein	NA	NA	NA	NA	NA
AUV01653.1|2387636_2387948_-	hypothetical protein	NA	NA	NA	NA	NA
AUV01654.1|2387941_2388382_-	hypothetical protein	NA	NA	NA	NA	NA
AUV01655.1|2388401_2389142_-	DNA replication protein DnaC	NA	S4TNF5	Salmonella_phage	70.8	2.2e-95
AUV01656.1|2390251_2390806_-	hypothetical protein	NA	K7P7P2	Enterobacteria_phage	33.0	1.1e-14
AUV01657.1|2390808_2391021_-	transcriptional regulator	NA	A0A220NRR8	Escherichia_phage	57.6	1.3e-16
AUV01658.1|2391129_2391513_+	transcriptional regulator	NA	K7PH71	Enterobacterial_phage	61.4	1.1e-16
AUV01659.1|2391553_2392711_+	type I restriction endonuclease subunit R	NA	A0A1S5SAB0	Streptococcus_phage	27.8	1.8e-35
AUV01660.1|2393230_2393416_+	DUF1482 domain-containing protein	NA	NA	NA	NA	NA
AUV04200.1|2393463_2393802_+	transcriptional regulator	NA	NA	NA	NA	NA
AUV04201.1|2395892_2396453_+	3'-5' exoribonuclease	NA	K7PLW7	Enterobacteria_phage	57.4	2.8e-58
AUV01661.1|2396523_2396802_+	histone-lysine N-methyltransferase	NA	NA	NA	NA	NA
AUV01662.1|2396740_2397736_+|integrase	integrase	integrase	A0A192Y7M7	Salmonella_phage	49.7	3.5e-80
AUV01663.1|2397785_2398905_+|transposase	IS3-like element ISSen4 family transposase	transposase	S5WIU1	Leptospira_phage	42.8	1.7e-51
2402807:2402823	attR	CCATTGTTACGCACCAG	NA	NA	NA	NA
>prophage 5
CP026193	Enterobacteriaceae bacterium ENNIH1 chromosome, complete genome	5267614	3022452	3101656	5267614	capsid,tRNA,terminase,portal,tail,transposase,protease,plate,integrase	Enterobacteria_phage(43.9%)	85	3063130:3063149	3097504:3097523
AUV02191.1|3022452_3023838_-|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.8	6.7e-45
AUV02192.1|3024012_3024507_+	peptidylprolyl isomerase	NA	NA	NA	NA	NA
AUV02193.1|3024509_3025235_+	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
AUV02194.1|3025379_3025889_+	5-(carboxyamino)imidazole ribonucleotide mutase	NA	NA	NA	NA	NA
AUV02195.1|3025885_3026953_+	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
AUV02196.1|3027112_3028021_-	carbamate kinase	NA	NA	NA	NA	NA
AUV02197.1|3028072_3029332_-	hypothetical protein	NA	NA	NA	NA	NA
AUV02198.1|3029341_3031009_-	acyl-CoA synthetase FdrA	NA	NA	NA	NA	NA
AUV02199.1|3031320_3032370_+	ureidoglycolate dehydrogenase	NA	NA	NA	NA	NA
AUV02200.1|3032394_3033630_+	allantoate amidohydrolase	NA	NA	NA	NA	NA
AUV02201.1|3034628_3035735_-	hypothetical protein	NA	NA	NA	NA	NA
AUV02202.1|3036152_3037295_-	glycerate kinase	NA	W6LM47	Streptococcus_phage	38.8	2.8e-41
AUV04240.1|3037364_3038726_-	allantoinase AllB	NA	NA	NA	NA	NA
AUV02203.1|3038803_3040258_-	allantoin permease	NA	NA	NA	NA	NA
AUV02204.1|3040353_3041607_-	MFS transporter	NA	NA	NA	NA	NA
AUV02205.1|3041674_3042553_-	2-hydroxy-3-oxopropionate reductase	NA	NA	NA	NA	NA
AUV02206.1|3042653_3043430_-	hydroxypyruvate isomerase	NA	NA	NA	NA	NA
AUV02207.1|3043442_3045224_-	glyoxylate carboligase	NA	E4WLQ6	Ostreococcus_tauri_virus	25.9	1.9e-36
AUV02208.1|3045312_3046131_-	HTH-type transcriptional repressor AllR	NA	NA	NA	NA	NA
AUV02209.1|3046219_3046702_-	ureidoglycolate lyase	NA	NA	NA	NA	NA
AUV04241.1|3046925_3047885_+	HTH-type transcriptional activator AllS	NA	NA	NA	NA	NA
AUV02210.1|3047917_3048229_+	cytoplasmic protein	NA	NA	NA	NA	NA
AUV02211.1|3048225_3048642_+	transcriptional regulator	NA	NA	NA	NA	NA
AUV02212.1|3048705_3049365_-	methionine ABC transporter permease	NA	NA	NA	NA	NA
AUV02213.1|3049357_3050374_-	virulence-associated ABC transporter ATP-binding protein SfbB	NA	G9BWD6	Planktothrix_phage	37.9	9.6e-33
AUV02214.1|3050431_3051268_-	metal ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUV02215.1|3051533_3051644_-	DNA metabolism protein	NA	NA	NA	NA	NA
AUV04242.1|3051676_3052822_-	porin	NA	NA	NA	NA	NA
AUV02216.1|3053004_3055419_-	ABC transporter permease	NA	NA	NA	NA	NA
AUV02217.1|3055415_3056102_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	33.8	4.6e-31
AUV04243.1|3056039_3056696_+|protease	multifunctional acyl-CoA thioesterase I/protease I/lysophospholipase L1	protease	NA	NA	NA	NA
AUV02218.1|3056724_3057495_+	oxidoreductase	NA	NA	NA	NA	NA
AUV02219.1|3057553_3058408_+	co-chaperone YbbN	NA	NA	NA	NA	NA
AUV02220.1|3058493_3059411_+	paraslipin	NA	NA	NA	NA	NA
AUV02221.1|3059407_3059866_+	hypothetical protein	NA	NA	NA	NA	NA
AUV02222.1|3059887_3062044_+	hypothetical protein	NA	NA	NA	NA	NA
AUV02223.1|3062013_3062757_+	DUF3142 domain-containing protein	NA	NA	NA	NA	NA
AUV02224.1|3062704_3063121_-	heavy metal-responsive transcriptional regulator	NA	NA	NA	NA	NA
3063130:3063149	attL	CTTGACCTTCCCCTTGATGG	NA	NA	NA	NA
AUV02225.1|3063207_3064233_-|integrase	integrase	integrase	Q83VS6	Escherichia_phage	52.3	4.1e-92
AUV02226.1|3064302_3064602_-	XRE family transcriptional regulator	NA	Q1JS29	Enterobacteria_phage	59.6	2.9e-30
AUV04244.1|3064850_3065180_+	hypothetical protein	NA	NA	NA	NA	NA
AUV02227.1|3065218_3065431_+	DUF4761 domain-containing protein	NA	A0A0M5M1I3	Salmonella_phage	61.9	1.2e-17
AUV02228.1|3065411_3065660_+	hypothetical protein	NA	NA	NA	NA	NA
AUV02229.1|3065647_3065887_+	hypothetical protein	NA	NA	NA	NA	NA
AUV02230.1|3065959_3066172_+	hypothetical protein	NA	A0A0M4R514	Salmonella_phage	58.0	5.8e-17
AUV02231.1|3066174_3066750_+	3'-5' exoribonuclease	NA	K7PLW7	Enterobacteria_phage	56.0	1.1e-54
AUV04245.1|3066749_3067580_+	adenine methylase	NA	A0A0M4QWR0	Salmonella_phage	66.2	6.3e-99
AUV04246.1|3067582_3068605_+	DNA cytosine methyltransferase	NA	A0A0M3ULA1	Salmonella_phage	62.0	2.6e-123
AUV02232.1|3068601_3071073_+	replication endonuclease	NA	F1BUS0	Erwinia_phage	40.8	2.5e-135
AUV02233.1|3071206_3072346_+	ATPase	NA	R4TQL5	Phaeocystis_globosa_virus	27.0	1.6e-15
AUV02234.1|3072357_3074580_+	peptidase S8 and S53, subtilisin, kexin, sedolisin	NA	NA	NA	NA	NA
AUV02235.1|3074640_3074874_+	hypothetical protein	NA	NA	NA	NA	NA
AUV02236.1|3075024_3076077_-|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	69.7	2.1e-144
AUV02237.1|3076079_3077801_-	oxidoreductase	NA	A0A0A7NV54	Enterobacteria_phage	66.7	6.7e-228
AUV02238.1|3077960_3078794_+|capsid	phage capsid protein	capsid	A0A0A7NRY7	Enterobacteria_phage	64.4	3.6e-94
AUV02239.1|3078817_3079852_+|capsid	phage major capsid protein, P2 family	capsid	A0A0M3ULA3	Salmonella_phage	55.1	1.3e-106
AUV02240.1|3079912_3080830_+|terminase	terminase	terminase	B9A7B6	Serratia_phage	75.1	2.9e-89
AUV02241.1|3080931_3081429_+|capsid	capsid assembly protein	capsid	B9A7B7	Serratia_phage	66.1	3.0e-56
AUV02242.1|3081428_3081629_+|tail	phage tail protein	tail	A0A0A7NV57	Enterobacteria_phage	63.1	3.9e-15
AUV02243.1|3081701_3082007_+	hypothetical protein	NA	O64361	Escherichia_phage	61.4	1.6e-28
AUV02244.1|3082006_3082561_+	lysozyme	NA	K7P7Q3	Enterobacteria_phage	59.5	5.7e-56
AUV02245.1|3082560_3083106_+	hypothetical protein	NA	K7PHH7	Enterobacteria_phage	59.6	3.4e-45
AUV02246.1|3083102_3083564_+|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	46.1	6.5e-29
AUV02247.1|3083560_3084205_+	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	51.5	4.3e-47
AUV02248.1|3084201_3084786_+|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	66.5	3.1e-68
AUV02249.1|3084782_3085151_+|plate	baseplate assembly protein	plate	A0A0A7NQ90	Enterobacteria_phage	54.4	3.1e-26
AUV02250.1|3085137_3086034_+|plate	baseplate assembly protein	plate	A0A0A7NPY5	Enterobacteria_phage	65.8	1.4e-99
AUV02251.1|3086026_3086629_+|tail	phage tail protein I	tail	E5G6N9	Salmonella_phage	58.1	1.3e-66
AUV02252.1|3086632_3087790_+|tail	phage tail protein	tail	A0A1S6KZZ8	Salmonella_phage	70.8	1.3e-102
AUV02253.1|3087771_3088233_+|tail	phage tail protein	tail	B6SCW7	Bacteriophage	48.8	4.5e-22
AUV02254.1|3088352_3088841_-|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	65.7	1.6e-49
AUV02255.1|3088855_3091789_-|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	42.6	1.3e-191
AUV02256.1|3091778_3091901_-|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
AUV02257.1|3091948_3092245_-|tail	phage tail protein	tail	B9A7B2	Serratia_phage	78.0	6.4e-30
AUV02258.1|3092303_3092819_-|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	64.7	1.1e-58
AUV02259.1|3092818_3094000_-|tail	phage tail protein	tail	A0A0A7NV69	Enterobacteria_phage	71.1	2.9e-158
AUV02260.1|3094151_3095279_+	hypothetical protein	NA	B9A7A9	Serratia_phage	77.0	3.7e-150
AUV02261.1|3095316_3096333_-|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.4	4.9e-186
AUV02262.1|3096549_3096798_+	hypothetical protein	NA	NA	NA	NA	NA
AUV02263.1|3096830_3097043_-	membrane protein insertion efficiency factor YidD	NA	NA	NA	NA	NA
AUV02264.1|3097043_3097289_-	DUF4177 domain-containing protein	NA	A0A0A7NPW2	Enterobacteria_phage	58.0	1.1e-19
AUV02265.1|3097315_3097561_+	hypothetical protein	NA	NA	NA	NA	NA
3097504:3097523	attR	CTTGACCTTCCCCTTGATGG	NA	NA	NA	NA
AUV02266.1|3097603_3100105_+	Cu+ exporting ATPase	NA	A0A218MNH6	uncultured_virus	36.4	2.0e-108
AUV02267.1|3100189_3100990_+	conjugal transfer protein TraB	NA	NA	NA	NA	NA
AUV02268.1|3101176_3101656_+|tRNA	Cys-tRNA(Pro) deacylase	tRNA	NA	NA	NA	NA
>prophage 6
CP026193	Enterobacteriaceae bacterium ENNIH1 chromosome, complete genome	5267614	3303832	3327889	5267614	transposase,integrase	Salmonella_phage(37.5%)	23	3301280:3301294	3331850:3331864
3301280:3301294	attL	CCATCGCCACGGTGA	NA	NA	NA	NA
AUV02441.1|3303832_3304953_-|transposase	IS3-like element ISSen4 family transposase	transposase	S5WIU1	Leptospira_phage	42.8	1.7e-51
AUV04254.1|3305337_3305877_+	hypothetical protein	NA	NA	NA	NA	NA
AUV02442.1|3306358_3306610_+	transcriptional regulator	NA	A0A193GYW1	Enterobacter_phage	68.4	2.0e-24
AUV02443.1|3306856_3307114_+	hypothetical protein	NA	A0A0M4R2Z9	Salmonella_phage	54.1	1.4e-12
AUV02444.1|3307117_3307315_+	hypothetical protein	NA	A0A0M4RCZ9	Salmonella_phage	73.0	5.2e-20
AUV02445.1|3307357_3307543_-	hypothetical protein	NA	NA	NA	NA	NA
AUV02446.1|3307542_3310299_-	hypothetical protein	NA	Q858F8	Salmonella_phage	91.6	0.0e+00
AUV02447.1|3310298_3312197_-	hypothetical protein	NA	Q858F9	Salmonella_phage	81.4	5.7e-289
AUV02448.1|3312196_3314710_-	hypothetical protein	NA	Q858G0	Salmonella_phage	73.2	0.0e+00
AUV02449.1|3314722_3314950_-	hypothetical protein	NA	NA	NA	NA	NA
AUV02450.1|3315256_3315631_+	hypothetical protein	NA	NA	NA	NA	NA
AUV02451.1|3315711_3316155_-	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
AUV02452.1|3316334_3319115_-	DNA primase	NA	A0A1W6JPG0	Morganella_phage	56.7	6.8e-299
AUV02453.1|3319114_3319327_-	hypothetical protein	NA	NA	NA	NA	NA
AUV04255.1|3319319_3319997_-	Ash-like/host cell division inhibitor Icd-like protein	NA	A0A1C9IHV9	Salmonella_phage	52.4	7.8e-15
AUV02454.1|3320037_3320847_-	antA/AntB antirepressor family protein	NA	A0A0R6PJV6	Moraxella_phage	45.8	1.6e-30
AUV02455.1|3320860_3321295_-	hypothetical protein	NA	A0A1W6JPH9	Morganella_phage	54.3	2.7e-29
AUV02456.1|3321294_3321492_-	AlpA family transcriptional regulator	NA	A0A1V0E8E5	Vibrio_phage	45.3	3.0e-07
AUV02457.1|3321707_3322427_-	hypothetical protein	NA	NA	NA	NA	NA
AUV02458.1|3322571_3323786_-|integrase	integrase	integrase	Q7M297	Enterobacteria_phage	55.7	2.9e-129
AUV02459.1|3324143_3325397_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	46.4	8.9e-97
AUV02460.1|3325408_3326512_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	39.9	1.5e-60
AUV02461.1|3326809_3327889_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	59.8	8.7e-117
3331850:3331864	attR	TCACCGTGGCGATGG	NA	NA	NA	NA
>prophage 7
CP026193	Enterobacteriaceae bacterium ENNIH1 chromosome, complete genome	5267614	3933828	3996706	5267614	transposase	Pseudomonas_phage(16.67%)	59	NA	NA
AUV02971.1|3933828_3934905_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
AUV02972.1|3935446_3936970_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.8	3.7e-44
AUV02973.1|3937263_3937635_+	hypothetical protein	NA	NA	NA	NA	NA
AUV02974.1|3938501_3939470_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
AUV04288.1|3939947_3941186_+	MFS transporter	NA	NA	NA	NA	NA
AUV02975.1|3941317_3942739_+	3-isopropylmalate dehydratase large subunit	NA	NA	NA	NA	NA
AUV02976.1|3942740_3943367_+	3-isopropylmalate dehydratase small subunit	NA	NA	NA	NA	NA
AUV02977.1|3943381_3944260_+	FAA hydrolase family protein	NA	NA	NA	NA	NA
AUV02978.1|3944259_3945174_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
AUV02979.1|3945207_3946173_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUV02980.1|3948180_3949197_+|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.4	4.9e-186
AUV02981.1|3949706_3949937_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
AUV02982.1|3949933_3950350_+	PIN domain-containing protein	NA	NA	NA	NA	NA
AUV02983.1|3950536_3951766_-	diguanylate phosphodiesterase	NA	NA	NA	NA	NA
AUV02984.1|3952621_3952960_+	hypothetical protein	NA	NA	NA	NA	NA
AUV02985.1|3953337_3953580_-	transcription factor	NA	NA	NA	NA	NA
AUV02986.1|3954916_3955885_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	41.7	2.0e-11
AUV02987.1|3956046_3956220_-	stress-induced protein	NA	NA	NA	NA	NA
AUV02988.1|3956636_3956846_+	hypothetical protein	NA	NA	NA	NA	NA
AUV02989.1|3957296_3957563_+	hypothetical protein	NA	NA	NA	NA	NA
AUV02990.1|3957811_3958078_-	monooxygenase	NA	NA	NA	NA	NA
AUV02991.1|3958479_3959250_+	hypothetical protein	NA	NA	NA	NA	NA
AUV04289.1|3959253_3959577_-	hypothetical protein	NA	NA	NA	NA	NA
AUV04290.1|3960111_3960339_-	hypothetical protein	NA	NA	NA	NA	NA
AUV02992.1|3962235_3963312_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
AUV02993.1|3964098_3965922_-	diol dehydratase reactivase subunit alpha	NA	NA	NA	NA	NA
AUV02994.1|3965934_3966360_-	propanediol dehydratase small subunit PduE	NA	NA	NA	NA	NA
AUV02995.1|3966362_3966953_-	propanediol dehydratase	NA	NA	NA	NA	NA
AUV02996.1|3966965_3968633_-	propanediol dehydratase	NA	NA	NA	NA	NA
AUV02997.1|3969065_3969497_+	heme-binding protein	NA	NA	NA	NA	NA
AUV02998.1|3969516_3970680_+	1,3-propanediol dehydrogenase	NA	NA	NA	NA	NA
AUV02999.1|3970700_3971054_+	hypothetical protein	NA	NA	NA	NA	NA
AUV03000.1|3971054_3971585_+	ATP:cob(I)alamin adenosyltransferase	NA	NA	NA	NA	NA
AUV03001.1|3971562_3973476_-	PTS-dependent dihydroxyacetone kinase operon transcriptional regulator DhaR	NA	NA	NA	NA	NA
AUV03002.1|3973556_3974654_-	glycerol dehydrogenase	NA	NA	NA	NA	NA
AUV03003.1|3975249_3976320_+	dihydroxyacetone kinase subunit DhaK	NA	NA	NA	NA	NA
AUV03004.1|3976330_3976963_+	dihydroxyacetone kinase subunit L	NA	NA	NA	NA	NA
AUV03005.1|3976973_3978398_+	dihydroxyacetone kinase subunit DhaM	NA	NA	NA	NA	NA
AUV03006.1|3978479_3980135_+	glycerone kinase	NA	NA	NA	NA	NA
AUV03007.1|3980792_3981939_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	92.2	1.1e-146
AUV03008.1|3983248_3983650_-	hypothetical protein	NA	NA	NA	NA	NA
AUV03009.1|3983768_3983975_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
AUV03010.1|3984060_3984645_-	hypothetical protein	NA	NA	NA	NA	NA
AUV03011.1|3985716_3986643_+	hypothetical protein	NA	NA	NA	NA	NA
AUV03012.1|3986740_3987628_+	GTP-binding protein HSR1	NA	NA	NA	NA	NA
AUV03013.1|3987840_3988044_+	hypothetical protein	NA	NA	NA	NA	NA
AUV03014.1|3988025_3988490_+	hypothetical protein	NA	NA	NA	NA	NA
AUV03015.1|3988510_3988852_+	hypothetical protein	NA	NA	NA	NA	NA
AUV03016.1|3988934_3989753_+	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	36.5	2.4e-42
AUV03017.1|3989840_3990296_+	hypothetical protein	NA	NA	NA	NA	NA
AUV03018.1|3990306_3990786_+	hypothetical protein	NA	NA	NA	NA	NA
AUV03019.1|3990829_3991162_+	antitoxin YeeU	NA	NA	NA	NA	NA
AUV03020.1|3991173_3991368_+	hypothetical protein	NA	NA	NA	NA	NA
AUV03021.1|3991413_3991767_+	toxin	NA	NA	NA	NA	NA
AUV03022.1|3991763_3991961_+	methyltransferase	NA	NA	NA	NA	NA
AUV03023.1|3992528_3992840_+	hypothetical protein	NA	NA	NA	NA	NA
AUV04291.1|3992913_3994779_+	hypothetical protein	NA	NA	NA	NA	NA
AUV03024.1|3995305_3995593_+	hypothetical protein	NA	NA	NA	NA	NA
AUV03025.1|3995585_3996706_-|transposase	IS3-like element ISSen4 family transposase	transposase	S5WIU1	Leptospira_phage	42.8	1.7e-51
>prophage 8
CP026193	Enterobacteriaceae bacterium ENNIH1 chromosome, complete genome	5267614	4718636	4750840	5267614	transposase	Salmonella_phage(40.0%)	18	NA	NA
AUV03650.1|4718636_4719756_+|transposase	IS3-like element ISSen4 family transposase	transposase	S5WIU1	Leptospira_phage	42.8	1.7e-51
AUV03651.1|4720144_4720348_-	hypothetical protein	NA	NA	NA	NA	NA
AUV04320.1|4720370_4722005_-	AAA family ATPase	NA	NA	NA	NA	NA
AUV03652.1|4725077_4726154_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
AUV03653.1|4726428_4728732_-	hypothetical protein	NA	NA	NA	NA	NA
AUV03654.1|4728918_4730961_-	hypothetical protein	NA	NA	NA	NA	NA
AUV03655.1|4730953_4732405_-	hypothetical protein	NA	NA	NA	NA	NA
AUV03656.1|4732788_4734051_-|transposase	IS1380 family transposase ISEc9	transposase	A0A1B0VDR3	Salmonella_phage	100.0	1.3e-39
AUV03657.1|4736151_4738446_+	cellulose biosynthesis cyclic di-GMP-binding regulatory protein BcsB	NA	NA	NA	NA	NA
AUV03658.1|4738459_4742461_+	cellulose synthase	NA	NA	NA	NA	NA
AUV03659.1|4742460_4742940_+	cellulose synthase	NA	NA	NA	NA	NA
AUV03660.1|4742948_4743947_+	endoglucanase	NA	NA	NA	NA	NA
AUV03661.1|4744612_4746142_-	cellulose biosynthesis protein BcsG	NA	NA	NA	NA	NA
AUV03662.1|4746224_4746929_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AUV03663.1|4746919_4747237_+	hypothetical protein	NA	NA	NA	NA	NA
AUV03664.1|4747160_4748480_+|transposase	IS1182 family transposase ISKpn6	transposase	NA	NA	NA	NA
AUV03665.1|4748729_4749611_-	carbapenem-hydrolyzing class A beta-lactamase KPC-2	NA	A0A1B0VBP7	Salmonella_phage	52.2	2.2e-73
AUV03666.1|4750135_4750840_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
>prophage 9
CP026193	Enterobacteriaceae bacterium ENNIH1 chromosome, complete genome	5267614	4969566	5013839	5267614	transposase,tRNA,plate	Vibrio_phage(12.5%)	37	NA	NA
AUV03850.1|4969566_4970349_-|tRNA	tRNA pseudouridine(65) synthase TruC	tRNA	NA	NA	NA	NA
AUV04330.1|4970348_4970678_-	hypothetical protein	NA	NA	NA	NA	NA
AUV03851.1|4971318_4971864_-	SecY-interacting protein	NA	NA	NA	NA	NA
AUV03852.1|4971934_4972780_+	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	A0A2I7SAX1	Vibrio_phage	36.0	2.0e-39
AUV03853.1|4972898_4974263_+	LOG family protein	NA	NA	NA	NA	NA
AUV03854.1|4974708_4975998_+	HAAAP family serine/threonine permease	NA	NA	NA	NA	NA
AUV03855.1|4976062_4977430_+	L-serine ammonia-lyase	NA	NA	NA	NA	NA
AUV03856.1|4977480_4978296_+	flap endonuclease Xni	NA	F8WQ40	Bacillus_phage	30.4	6.6e-08
AUV03857.1|4978448_4979549_-	23S rRNA (cytidine(2498)-2'-O)-methyltransferase RlmM	NA	NA	NA	NA	NA
AUV03858.1|4979541_4979937_-	hypothetical protein	NA	NA	NA	NA	NA
AUV03859.1|4979975_4980890_-	transcriptional regulator GcvA	NA	NA	NA	NA	NA
AUV03860.1|4981240_4981471_-	YgdI/YgdR family lipoprotein	NA	NA	NA	NA	NA
AUV04331.1|4981663_4982869_+	cysteine desulfurase CsdA	NA	Q2XUY6	environmental_halophage	37.2	7.8e-74
AUV03861.1|4982868_4983282_+	cysteine desulfurase sulfur acceptor subunit CsdE	NA	NA	NA	NA	NA
AUV04332.1|4983227_4983353_+	sugar kinase	NA	Q6QLL3	Human_immunodeficiency_virus	97.2	3.9e-13
AUV03862.1|4983390_4984407_-|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.4	4.9e-186
AUV03863.1|4984501_4985314_-|tRNA	tRNA cyclic N6-threonylcarbamoyladenosine(37) synthase TcdA	tRNA	S4VW33	Pandoravirus	32.3	6.5e-16
AUV04333.1|4985524_4986622_-	murein transglycosylase A	NA	NA	NA	NA	NA
AUV03864.1|4986627_4986750_-	murein transglycosylase	NA	NA	NA	NA	NA
AUV03865.1|4987766_4988267_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
AUV03866.1|4988325_4989864_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
AUV03867.1|4989881_4991219_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
AUV03868.1|4991215_4991881_+	type VI secretion protein ImpK	NA	NA	NA	NA	NA
AUV03869.1|4991893_4993546_+	hypothetical protein	NA	NA	NA	NA	NA
AUV03870.1|4993603_4994095_+	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
AUV03871.1|4994285_4996931_+	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	30.8	2.0e-98
AUV03872.1|4999429_5000431_+	hypothetical protein	NA	NA	NA	NA	NA
AUV03873.1|5000439_5000916_+	hypothetical protein	NA	NA	NA	NA	NA
AUV03874.1|5001044_5002155_+|transposase	IS3 family transposase	transposase	A0A0N9SIX5	Staphylococcus_phage	31.2	2.6e-07
AUV04334.1|5003483_5004920_+	hypothetical protein	NA	NA	NA	NA	NA
AUV03875.1|5005994_5006399_+	hypothetical protein	NA	NA	NA	NA	NA
AUV04335.1|5007333_5008911_+	hypothetical protein	NA	NA	NA	NA	NA
AUV03876.1|5008910_5009549_+	hypothetical protein	NA	NA	NA	NA	NA
AUV03877.1|5010089_5011850_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
AUV03878.1|5011813_5012893_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
AUV03879.1|5012873_5013407_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
AUV03880.1|5013410_5013839_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
>prophage 1
CP026196	Enterobacteriaceae bacterium ENNIH1 plasmid pENT-1f0b, complete sequence	302640	38530	108035	302640	integrase,transposase	Escherichia_phage(15.0%)	73	69051:69064	109555:109568
AUV04750.1|38530_39877_+|transposase	transposase	transposase	NA	NA	NA	NA
AUV04496.1|39935_40727_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
AUV04497.1|40767_41604_-	hypothetical protein	NA	NA	NA	NA	NA
AUV04498.1|41660_42224_-	hypothetical protein	NA	NA	NA	NA	NA
AUV04499.1|42590_42884_-	hypothetical protein	NA	NA	NA	NA	NA
AUV04500.1|42904_43204_-	hypothetical protein	NA	NA	NA	NA	NA
AUV04501.1|43267_43498_-	hypothetical protein	NA	NA	NA	NA	NA
AUV04502.1|43519_44467_-	hypothetical protein	NA	NA	NA	NA	NA
AUV04503.1|44463_44979_-	nuclease	NA	V5UN65	Mycobacterium_phage	28.9	3.2e-08
AUV04504.1|45201_46629_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	49.4	9.5e-103
AUV04505.1|46754_46925_+	hypothetical protein	NA	A0A1P7WFU2	Pectobacterium_phage	56.4	2.3e-08
AUV04506.1|46948_48268_+	DUF1173 domain-containing protein	NA	NA	NA	NA	NA
AUV04507.1|48281_48485_+	hypothetical protein	NA	NA	NA	NA	NA
AUV04508.1|48539_49760_-	hypothetical protein	NA	NA	NA	NA	NA
AUV04509.1|49762_50575_-	DUF4942 domain-containing protein	NA	NA	NA	NA	NA
AUV04751.1|51075_51741_+	hypothetical protein	NA	NA	NA	NA	NA
AUV04510.1|51778_52231_+	hypothetical protein	NA	NA	NA	NA	NA
AUV04511.1|52806_53262_-	Hg(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
AUV04512.1|53333_53729_+	mercuric ion transporter MerT	NA	NA	NA	NA	NA
AUV04513.1|53744_54020_+	mercuric transporter periplasmic component	NA	NA	NA	NA	NA
AUV04514.1|54047_54473_+	mercury transport protein MerC	NA	NA	NA	NA	NA
AUV04515.1|54511_56197_+	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	29.1	1.8e-39
AUV04516.1|56214_56580_+	transcriptional regulator	NA	NA	NA	NA	NA
AUV04517.1|56576_56813_+	mercury resistance protein	NA	NA	NA	NA	NA
AUV04752.1|56796_56916_-	mercury resistance protein	NA	NA	NA	NA	NA
AUV04518.1|56878_57091_+	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
AUV04519.1|57110_57287_-	resolvase	NA	NA	NA	NA	NA
AUV04520.1|57328_58093_-|transposase	IS6 family transposase IS6100	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
AUV04521.1|58180_58294_+	NTP-binding protein	NA	NA	NA	NA	NA
AUV04522.1|58599_59100_-	N-acetyltransferase	NA	NA	NA	NA	NA
AUV04523.1|59118_59298_+	hypothetical protein	NA	NA	NA	NA	NA
AUV04524.1|59227_60067_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
AUV04525.1|60266_60923_-	quinolone resistance pentapeptide repeat protein QnrA1	NA	NA	NA	NA	NA
AUV04526.1|61255_62797_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
AUV04527.1|63201_64041_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
AUV04528.1|64034_64382_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
AUV04529.1|64572_64878_-	hypothetical protein	NA	NA	NA	NA	NA
AUV04530.1|64893_65406_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AUV04531.1|65524_65989_-	AAC(3)-I family aminoglycoside 3-N-acetyltransferase	NA	NA	NA	NA	NA
AUV04753.1|66064_66619_-	aminoglycoside N-acetyltransferase AAC(6')-Ib3	NA	NA	NA	NA	NA
AUV04532.1|66779_67793_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	6.1e-72
AUV04533.1|67731_67989_+	hypothetical protein	NA	NA	NA	NA	NA
AUV04534.1|67934_68639_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
69051:69064	attL	AAATCGCGCCAGCG	NA	NA	NA	NA
AUV04535.1|69468_70260_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA1	NA	NA	NA	NA	NA
AUV04536.1|70352_70826_-	trimethoprim-resistant dihydrofolate reductase DfrA1	NA	G3MBI7	Bacillus_virus	32.1	3.7e-19
AUV04537.1|70982_71996_+|integrase	integron integrase	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
AUV04538.1|72342_72774_-	recombinase family protein	NA	F1BUU6	Erwinia_phage	48.6	2.3e-20
AUV04539.1|73128_73833_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AUV04540.1|73995_75018_+|transposase	IS110-like element IS5708 family transposase	transposase	NA	NA	NA	NA
AUV04541.1|75853_77245_+	NAD-dependent succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
AUV04542.1|77343_78312_+|transposase	IS5/IS1182 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	91.3	3.8e-172
AUV04543.1|78573_79371_-	KR domain-containing protein	NA	Q06VL0	Trichoplusia_ni_ascovirus	26.9	5.1e-13
AUV04544.1|79532_80501_+|transposase	IS5/IS1182 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	91.6	1.7e-172
AUV04754.1|80704_81634_+|transposase	ISNCY family transposase	transposase	Q2A0A7	Sodalis_phage	53.1	1.4e-75
AUV04755.1|82933_83914_-	NAD(P)H-quinone oxidoreductase	NA	NA	NA	NA	NA
AUV04545.1|84616_86140_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.8	3.7e-44
AUV04546.1|86433_86805_+	hypothetical protein	NA	NA	NA	NA	NA
AUV04547.1|87372_87681_+	hypothetical protein	NA	NA	NA	NA	NA
AUV04548.1|88099_90751_+	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	34.1	5.4e-152
AUV04549.1|91691_92825_-	aldehyde dehydrogenase	NA	E3SJ82	Synechococcus_phage	28.8	9.7e-10
AUV04550.1|93256_93583_+	four-helix bundle copper-binding protein	NA	NA	NA	NA	NA
AUV04551.1|93731_93965_-	hypothetical protein	NA	NA	NA	NA	NA
AUV04552.1|94668_95328_-	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
AUV04553.1|95622_96459_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AUV04554.1|96534_97386_-	EamA/RhaT family transporter	NA	NA	NA	NA	NA
AUV04555.1|97492_98368_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
AUV04556.1|98450_99425_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUV04557.1|99643_100768_+	alkene reductase	NA	NA	NA	NA	NA
AUV04558.1|100842_101172_+	transcriptional regulator	NA	NA	NA	NA	NA
AUV04559.1|102497_102926_-	hypothetical protein	NA	NA	NA	NA	NA
AUV04560.1|102929_105047_-	hypothetical protein	NA	NA	NA	NA	NA
AUV04561.1|105034_106801_-	hypothetical protein	NA	NA	NA	NA	NA
AUV04562.1|106787_108035_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
109555:109568	attR	AAATCGCGCCAGCG	NA	NA	NA	NA
>prophage 1
CP026195	Enterobacteriaceae bacterium ENNIH1 plasmid pENT-82e8, complete sequence	16950	0	15063	16950	integrase,transposase	Salmonella_phage(28.57%)	15	1:60	8494:9068
1:60	attL	GCTGCGCTGGTACTGGCGTAACCCTTCCGATCTTTGCCCGTGGCACATGGATGAAACCTA	NA	NA	NA	NA
AUV04443.1|1021_1987_-	chromosome partitioning protein ParB	NA	A0A1B0V750	Salmonella_phage	51.1	6.9e-81
AUV04459.1|1986_3192_-	ParA family protein	NA	A0A077SL49	Escherichia_phage	68.1	4.5e-162
AUV04444.1|4042_4753_+	RepB family plasmid replication initiator protein	NA	I3WF20	Macacine_betaherpesvirus	31.8	3.9e-25
AUV04445.1|4819_6154_-	hypothetical protein	NA	NA	NA	NA	NA
AUV04446.1|6172_6961_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	84.3	7.4e-49
AUV04447.1|6985_7495_-	hypothetical protein	NA	NA	NA	NA	NA
AUV04460.1|7532_7901_-	hypothetical protein	NA	NA	NA	NA	NA
AUV04448.1|8030_8735_-|transposase	IS6 family transposase IS15DI	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
AUV04449.1|8793_8904_+	MerR family transcriptional regulator	NA	NA	NA	NA	NA
AUV04450.1|9122_9413_+	nucleotidyltransferase	NA	NA	NA	NA	NA
8494:9068	attR	TAGGTTTCATCCATGTGCCACGGGCAAAGATCGGAAGGGTTACGCCAGTACCAGCGCAGCCGTTTTTCCATTTCAGGCGCATAACGCTGAACCCAGCGGTAAATCGTGGAGTGATCGACATTCACTCCGCGTTCAGCCAGCATCTCCTGCAGCTCACGGTAACTGATGCCGTATTTGCAGTACCAGCGTACGGCCCACAGAATGATGTCACGCTGAAAATGCCGGCCTTTGAATGGGTTCATGTGCAGCTCCATCAGCAAAAGGGGATGATAAGTTTATCACCACCGACTATTTGCAACAGTGCCGTCTGATTTGGTGTGCGCCTGCCATGCGCGGAAGGGGAACGTTTCCTGTCCGCTGATTGCGTCACTGCAAGGGAAGAAAGAACCGCGCAGTGCGGACGCGGTGTAGCCCGAGGGAACTACGCCTTAGCGTGCTTTATTCCGTTTTCTGAGGCGACTCCAACGTCAGAAAAGACCGTGCGGTCGACTTTTGATATTTCGTGCTGTCGCCTTCTGAAAGTGACACGCGGCACGGGAATCAAGGCATTGCGATTCTCGAAAATAGTTCTTGAA	NA	NA	NA	NA
AUV04451.1|10605_10896_+	korC	NA	NA	NA	NA	NA
AUV04452.1|10885_11089_-	hypothetical protein	NA	NA	NA	NA	NA
AUV04453.1|11186_11375_+	hypothetical protein	NA	NA	NA	NA	NA
AUV04454.1|11465_12071_-	DNA resolvase	NA	A0A1S5Y2X8	uncultured_archaeal_virus	35.3	5.5e-20
AUV04455.1|12165_15063_+|transposase	Tn3-like element Tn5403 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	37.8	4.2e-182
>prophage 1
CP026194	Enterobacteriaceae bacterium ENNIH1 plasmid pKPC-825d, complete sequence	79128	7132	32128	79128	integrase,protease,transposase	Escherichia_phage(41.67%)	22	24683:24742	25992:26133
AUV04353.1|7132_7837_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AUV04354.1|7827_8010_+	hypothetical protein	NA	NA	NA	NA	NA
AUV04355.1|7973_8834_+	class A extended-spectrum beta-lactamase SHV-12	NA	A0A077SL40	Escherichia_phage	99.3	2.2e-155
AUV04356.1|8854_9616_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
AUV04357.1|9999_10317_-	hypothetical protein	NA	NA	NA	NA	NA
AUV04358.1|10480_11743_-|transposase	IS1380 family transposase ISEc9	transposase	A0A1B0VDR3	Salmonella_phage	100.0	1.3e-39
AUV04359.1|12961_13666_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AUV04360.1|14190_15072_+	carbapenem-hydrolyzing class A beta-lactamase KPC-2	NA	A0A1B0VBP7	Salmonella_phage	52.2	2.2e-73
AUV04361.1|15321_16641_-|transposase	IS1182 family transposase ISKpn6	transposase	Q9MBP7	Staphylococcus_prophage	24.2	1.9e-12
AUV04362.1|16954_17560_-	DNA resolvase	NA	A0A1S5Y2X8	uncultured_archaeal_virus	35.3	5.5e-20
AUV04363.1|17654_20552_+|transposase	Tn3-like element Tn5403 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	37.8	4.2e-182
AUV04364.1|21872_22577_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AUV04365.1|22934_23492_+	recombinase	NA	Q1MVP4	Enterobacteria_phage	98.4	2.0e-93
AUV04366.1|23674_24535_+	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
24683:24742	attL	TAGACAAGAAAGTCCGTTAAGTGCCAATTTTCGATTAAAAAGACACCGTTTTGATGGCGT	NA	NA	NA	NA
AUV04433.1|24930_25464_-	aminoglycoside nucleotidyltransferase ANT(2'')-Ia	NA	NA	NA	NA	NA
AUV04367.1|25612_25960_+|integrase	class 1 integron integrase IntI1	integrase	NA	NA	NA	NA
AUV04368.1|26143_28231_-	conjugal transfer protein TrbC	NA	NA	NA	NA	NA
25992:26133	attR	TAGACAAGAAAGTCCGTTAAGTGCCAATTTTCGATTAAAAAGACACCGTTTTGATGGCGTTTTCCAATGTACATTATGTTTCGATATATCAGACAGTTACTTCACTAACGTACGTTTTCGTTCTATTGGCCTTCAGACCCCT	NA	NA	NA	NA
AUV04369.1|28243_29194_-	DsbC family protein	NA	NA	NA	NA	NA
AUV04434.1|29204_30467_-	conjugal transfer protein TrbA	NA	NA	NA	NA	NA
AUV04370.1|30511_30907_-	lytic transglycosylase	NA	NA	NA	NA	NA
AUV04371.1|31011_31395_-	DUF1496 domain-containing protein	NA	NA	NA	NA	NA
AUV04372.1|31474_32128_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
