The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP026202	Escherichia coli strain ECONIH5 chromosome, complete genome	5103533	2817	46008	5103533	head,terminase,lysis,transposase,portal,tail,capsid	Enterobacteria_phage(42.11%)	46	NA	NA
AUV29344.1|2817_3969_-|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.3	5.8e-42
AUV34011.1|5396_5540_+	hypothetical protein	NA	NA	NA	NA	NA
AUV29345.1|5698_5911_+	Hok/Gef family protein	NA	A0A0U2QV81	Escherichia_phage	97.1	1.7e-29
AUV34012.1|6369_6648_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	46.9	7.4e-12
AUV29346.1|7711_8464_+	antitermination protein Q	NA	A0A192Y5X6	Salmonella_phage	92.8	7.1e-134
AUV29347.1|8885_9098_-	cold-shock protein CspF	NA	NA	NA	NA	NA
AUV29348.1|9398_9614_+	cold-shock protein CspB	NA	A0A1W6JNX5	Morganella_phage	76.5	3.4e-25
AUV29349.1|10367_10583_+|lysis	lysis protein S	lysis	A5LH82	Enterobacteria_phage	94.4	1.1e-31
AUV29350.1|10587_10863_+	hypothetical protein	NA	K7PGU6	Enterobacteria_phage	77.0	4.4e-25
AUV29351.1|11961_12174_+	cold-shock protein CspI	NA	A0A1W6JNX5	Morganella_phage	74.3	1.2e-22
AUV29352.1|12184_12373_+	cold-shock protein	NA	NA	NA	NA	NA
AUV29353.1|12403_12676_+	hypothetical protein	NA	NA	NA	NA	NA
AUV29354.1|12847_13021_+	protein GnsB	NA	NA	NA	NA	NA
AUV29355.1|13172_13583_-	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	79.4	2.5e-56
AUV29356.1|13640_13874_-	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	84.1	2.5e-21
AUV29357.1|13979_14123_+	DNA-packaging protein	NA	NA	NA	NA	NA
AUV29358.1|14262_14808_+|terminase	terminase small subunit	terminase	A0A0K2FIG2	Enterobacteria_phage	98.9	8.1e-95
AUV29359.1|14782_16708_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.2	0.0e+00
AUV29360.1|16704_16911_+|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
AUV29361.1|16907_18509_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	99.1	1.9e-309
AUV29362.1|18489_19809_+|capsid	capsid assembly protein	capsid	A0A2I6TC87	Escherichia_phage	98.9	1.6e-234
AUV29363.1|19818_20151_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	5.0e-55
AUV29364.1|20332_21010_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.8	6.6e-22
AUV29365.1|21009_21357_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
AUV29366.1|21376_22948_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
AUV29367.1|23980_24376_+	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	93.2	4.8e-57
AUV29368.1|24387_24741_+|tail	phage tail protein	tail	A0A2R9YJJ5	Escherichia_phage	100.0	9.0e-63
AUV29369.1|24752_25331_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	96.9	5.0e-79
AUV29370.1|25327_25723_+|tail	phage tail protein	tail	A0A2R9YJI2	Escherichia_phage	98.5	8.5e-70
AUV34013.1|25730_26471_+|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	97.2	4.0e-129
AUV29371.1|26486_26909_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	96.4	1.4e-70
AUV29372.1|26890_27325_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	99.2	2.0e-64
AUV29373.1|27317_29897_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	98.3	0.0e+00
AUV29374.1|29893_30223_+|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	98.2	8.1e-58
AUV29375.1|30222_30921_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	98.3	1.4e-131
AUV29376.1|30926_31670_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	98.0	4.5e-149
AUV29377.1|31567_32209_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	86.5	1.0e-96
AUV29378.1|32269_35749_+	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	89.8	0.0e+00
AUV29379.1|35816_36416_+	Ail/Lom family protein	NA	H6WZM8	Escherichia_phage	94.5	2.5e-105
AUV34014.1|36480_39831_+	short-chain fatty acid transporter	NA	X2KTY7	Enterobacteria_phage	35.5	2.4e-11
AUV29380.1|39830_40406_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.8	2.5e-102
AUV29381.1|40503_41094_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	39.3	1.5e-25
AUV29382.1|41410_41644_-	hypothetical protein	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
AUV29383.1|42428_43664_+	MFS transporter	NA	NA	NA	NA	NA
AUV29384.1|43695_44721_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
AUV29385.1|45039_46008_-|transposase	IS5-like element IS903B family transposase	transposase	A0A1B0VFY5	Salmonella_phage	99.7	2.1e-186
>prophage 2
CP026202	Escherichia coli strain ECONIH5 chromosome, complete genome	5103533	90406	121073	5103533	integrase,transposase	Acinetobacter_phage(33.33%)	20	93784:93843	124085:124852
AUV29426.1|90406_91568_+|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.1e-51
AUV29427.1|92297_93104_-	SecC motif-containing protein	NA	NA	NA	NA	NA
AUV29428.1|93121_93562_-	hypothetical protein	NA	NA	NA	NA	NA
93784:93843	attL	GGTGATGCTGCCAACTTACTGATTTAGTGTATGATGGTGTTTTTGAGGTGCTCCAGTGGC	NA	NA	NA	NA
AUV29429.1|95866_96670_-	hypothetical protein	NA	NA	NA	NA	NA
AUV34018.1|96728_98075_-|transposase	ISNCY family transposase ISLad2	transposase	NA	NA	NA	NA
AUV34019.1|98312_98945_+	hypothetical protein	NA	NA	NA	NA	NA
AUV29430.1|98973_100377_-|transposase	ISNCY-like element ISKpn21 family transposase	transposase	NA	NA	NA	NA
AUV29431.1|100523_100622_-	helicase subunit	NA	NA	NA	NA	NA
AUV29432.1|100652_102044_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
AUV29433.1|102036_103587_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
AUV29434.1|103583_105938_+	hypothetical protein	NA	NA	NA	NA	NA
AUV29435.1|106248_107368_+|transposase	IS3-like element ISSen4 family transposase	transposase	S5WIU1	Leptospira_phage	42.8	1.7e-51
AUV29436.1|107552_108715_-|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	4.0e-51
AUV29437.1|109433_110084_-	TIGR02646 family protein	NA	NA	NA	NA	NA
AUV29438.1|110086_111739_-	recombinase RecF	NA	C7BGE8	Burkholderia_phage	30.5	4.9e-10
AUV29439.1|111735_112671_-	RNA-directed DNA polymerase	NA	NA	NA	NA	NA
AUV29440.1|113399_116390_-	helicase	NA	A0A2H4UTW8	Bodo_saltans_virus	24.3	5.7e-09
AUV29441.1|117756_118320_+	fimbrial protein	NA	NA	NA	NA	NA
AUV29442.1|118671_119391_+	fimbrial chaperone protein FimC	NA	NA	NA	NA	NA
AUV29443.1|119800_121073_+|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.4e-177
124085:124852	attR	GCCACTGGAGCACCTCAAAAACACCATCATACACTAAATCAGTAAGTTGGCAGCATCACCAACCACCTATTCTGCTTTATCCGCAGATAGCGTTATTAAAATTAGCGGGCGCGTCCTCGATTATGGCTGCACAGTCTCATCGGATTCGCTTAATTTTACCGTAGATCTCCAAAAAAACAGTGCCAGACAATTTCCAACGACCGGTAGCACAAGTCCAGCCGTCCCTTTTCAGATTACGTTAAGTGAATGCAGCAAAGGGACAACGGGGGTTCGGGTTGCATTTAACGGTATTGAGGATGCAGAAAATAATACTCTGTTGAAACTGGATGAAGGAAGCAATACGGCTTCCGGTTTGGGTATAGAAATACTGGACGGAAATATGCGTCCGGTGAAATTGAATGACCTTCATGCCGGGATGCAGTGGATCGGTTCCTGTTAGCTACGTTTTGCGCGTTATTCACAGCAACTCTCCAGGCCGCCGATGTCACTATCACTGTTAATGGTCGGGTAGTCGCTAAACCCTGCACTATTCAAACCAAAGAAGCTAACGTTAATCTCGGGGATCTTTATACGCGCAATCTGCAACAACCTGGTTCTGCATCTGGCTGGCACAATATTACTCTGTCATTAACCGATTGTCCGGTTGAAACAAGTGTAGTGACGGCAATCGTGACAGGTTCAACTGACAATACGGGTTATTACAAAAATGAAGGTACTGCCGAAAATATTCAGATAGAGCTGAGGGATGACCAGGATGCGACGTTAAAA	NA	NA	NA	NA
>prophage 3
CP026202	Escherichia coli strain ECONIH5 chromosome, complete genome	5103533	287792	304377	5103533	holin,tRNA	Escherichia_phage(75.0%)	24	NA	NA
AUV29568.1|287792_289796_-|holin	high-affinity choline transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	26.2	3.4e-21
AUV29569.1|290130_290553_-	DUF977 domain-containing protein	NA	A0A0U2QQN3	Escherichia_phage	88.5	6.3e-63
AUV29570.1|290568_291381_-	hypothetical protein	NA	A0A0U2SAW4	Escherichia_phage	87.0	1.4e-114
AUV29571.1|291352_292099_-	DNA replication protein DnaC	NA	V5UQI5	Shigella_phage	79.7	1.5e-112
AUV29572.1|292105_292894_-	hypothetical protein	NA	G9L6A8	Escherichia_phage	64.3	2.0e-41
AUV29573.1|292971_293394_-	hypothetical protein	NA	A0A0U2RXZ9	Escherichia_phage	92.9	1.3e-68
AUV29574.1|293390_293645_-	hypothetical protein	NA	A0A2I6PIE5	Escherichia_phage	61.6	1.3e-18
AUV29575.1|293724_294144_+	transcriptional regulator	NA	A0A2I6PIE7	Escherichia_phage	46.5	5.5e-19
AUV29576.1|294180_294399_+	hypothetical protein	NA	NA	NA	NA	NA
AUV29577.1|294386_294566_+	hypothetical protein	NA	NA	NA	NA	NA
AUV29578.1|294576_294732_+	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	55.3	6.1e-08
AUV29579.1|294728_295217_-	superinfection exclusion protein B	NA	NA	NA	NA	NA
AUV29580.1|295251_295530_-	hypothetical protein	NA	NA	NA	NA	NA
AUV29581.1|295658_295880_+	cell division protein FtsZ	NA	A0A0U2RTC4	Escherichia_phage	98.6	2.0e-36
AUV34030.1|295879_296050_+	hypothetical protein	NA	A0A0U2SHB5	Escherichia_phage	71.4	3.6e-17
AUV29582.1|296124_296400_+	protein RacC	NA	A0A0U2QW85	Escherichia_phage	96.7	1.4e-42
AUV29583.1|296501_299102_+	exonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	63.4	4.4e-247
AUV29584.1|299094_299904_+	recombination and repair protein RecT	NA	A0A1P8DTF2	Proteus_phage	71.5	1.2e-105
AUV29585.1|299960_300155_+	restriction alleviation and modification enhancement protein	NA	A0A0U2QQP4	Escherichia_phage	96.9	5.8e-32
AUV29586.1|300147_300357_+	double-strand break reduction protein	NA	A0A0U2QL97	Escherichia_phage	98.4	6.1e-27
AUV29587.1|300435_300651_+	hypothetical protein	NA	A0A0U2RY08	Escherichia_phage	100.0	1.8e-37
AUV29588.1|300652_301888_+	DUF3596 domain-containing protein	NA	A0A0U2JGI6	Escherichia_phage	98.5	1.6e-239
AUV29589.1|301939_302875_+|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	98.8	5.9e-146
AUV29590.1|303003_304377_-	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
>prophage 4
CP026202	Escherichia coli strain ECONIH5 chromosome, complete genome	5103533	414036	490571	5103533	head,transposase,plate,tail,tRNA	Vibrio_phage(48.94%)	85	NA	NA
AUV29694.1|414036_415309_+|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.4e-177
AUV29695.1|415819_416233_+	DNA-binding protein H-NS	NA	NA	NA	NA	NA
AUV29696.1|416377_417286_-	UTP--glucose-1-phosphate uridylyltransferase	NA	A0A127AW70	Bacillus_phage	46.8	1.4e-59
AUV29697.1|417487_418501_-	two-component system response regulator RssB	NA	NA	NA	NA	NA
AUV29698.1|419068_420559_+	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	82.2	8.6e-224
AUV29699.1|420593_421451_+	universal stress protein	NA	A0A2H4J154	uncultured_Caudovirales_phage	48.4	6.6e-67
AUV29700.1|421541_421874_+	conjugal transfer protein TraR	NA	NA	NA	NA	NA
AUV29701.1|421991_422612_-	recombinase family protein	NA	A0A286S1P7	Klebsiella_phage	37.1	1.7e-24
AUV29702.1|422781_423042_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
AUV29703.1|423041_423353_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
AUV29704.1|423376_426457_+|transposase	DDE transposase	transposase	NA	NA	NA	NA
AUV29705.1|426536_427442_-	patatin family protein	NA	NA	NA	NA	NA
AUV29706.1|427554_428013_+	hypothetical protein	NA	NA	NA	NA	NA
AUV29707.1|428062_428905_+	formyltetrahydrofolate deformylase	NA	M4QRX9	Synechococcus_phage	47.6	1.1e-13
AUV29708.1|430525_431203_-	respiratory nitrate reductase subunit gamma	NA	NA	NA	NA	NA
AUV29709.1|431202_431913_-	nitrate reductase molybdenum cofactor assembly chaperone	NA	NA	NA	NA	NA
AUV29710.1|431909_433448_-	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	40.8	6.3e-20
AUV29711.1|437703_439095_-	nitrate/nitrite transporter NarK	NA	NA	NA	NA	NA
AUV29712.1|439189_439408_-	hypothetical protein	NA	NA	NA	NA	NA
AUV29713.1|441435_441927_-	hypothetical protein	NA	NA	NA	NA	NA
AUV29714.1|442158_442395_+	transcriptional regulator	NA	A0A2I7S995	Vibrio_phage	57.6	3.0e-14
AUV29715.1|442394_444377_+|transposase	transposase	transposase	A0A0C4UR24	Shigella_phage	50.6	8.3e-190
AUV29716.1|444472_445411_+	hypothetical protein	NA	A0A0C4UQR3	Shigella_phage	47.5	1.9e-75
AUV29717.1|445415_445655_+	hypothetical protein	NA	NA	NA	NA	NA
AUV29718.1|445657_445948_+	hypothetical protein	NA	C9DGL7	Escherichia_phage	44.9	3.1e-13
AUV29719.1|445960_446212_+	hypothetical protein	NA	NA	NA	NA	NA
AUV29720.1|446219_446747_+	host-nuclease inhibitor protein Gam	NA	A0A125RNF6	Pseudomonas_phage	57.9	3.0e-46
AUV29721.1|446836_447493_+	hypothetical protein	NA	A0A291AUJ5	Sinorhizobium_phage	47.7	1.2e-12
AUV29722.1|447470_447998_+	regulatory protein GemA	NA	A0A0C4UQU3	Shigella_phage	49.4	1.7e-41
AUV29723.1|447994_448405_+	transcriptional regulator	NA	A0A0C4UR27	Shigella_phage	63.5	3.1e-38
AUV29724.1|448408_448918_+	hypothetical protein	NA	NA	NA	NA	NA
AUV29725.1|449028_449619_+	peptidoglycan-binding protein	NA	A0A2I7S9B9	Vibrio_phage	46.7	1.7e-37
AUV29726.1|449620_449839_+	hypothetical protein	NA	A0A0C4UQR6	Shigella_phage	69.4	1.0e-24
AUV29727.1|449831_450239_+	hypothetical protein	NA	NA	NA	NA	NA
AUV29728.1|450226_450835_+	hypothetical protein	NA	NA	NA	NA	NA
AUV29729.1|450831_451038_+	conjugal transfer protein TraR	NA	NA	NA	NA	NA
AUV29730.1|451038_451344_+	DUF2730 domain-containing protein	NA	M1Q558	Vibrio_phage	38.3	5.6e-13
AUV34035.1|451356_451644_+	hypothetical protein	NA	M1PPT9	Vibrio_phage	64.5	4.6e-25
AUV29731.1|451646_452021_+	hypothetical protein	NA	NA	NA	NA	NA
AUV29732.1|452013_452292_+	hypothetical protein	NA	NA	NA	NA	NA
AUV29733.1|452281_452860_+	DUF3486 domain-containing protein	NA	M4MCR3	Vibrio_phage	55.0	9.6e-46
AUV29734.1|452856_454440_+	hypothetical protein	NA	M4MHG0	Vibrio_phage	68.9	1.0e-198
AUV29735.1|454439_456008_+	DUF935 domain-containing protein	NA	A0A2I7S9K0	Vibrio_phage	56.2	5.1e-158
AUV29736.1|456000_456789_+	hypothetical protein	NA	M4M9M5	Vibrio_phage	57.6	2.1e-91
AUV29737.1|456998_457955_+	peptidase	NA	M1Q578	Vibrio_phage	50.6	9.8e-80
AUV29738.1|457958_458852_+|head	phage head protein	head	M4MB71	Vibrio_phage	56.4	1.3e-94
AUV29739.1|458935_459529_+	hypothetical protein	NA	NA	NA	NA	NA
AUV29740.1|459528_459969_+	DUF1320 domain-containing protein	NA	A0A2I7S9E9	Vibrio_phage	47.9	1.4e-33
AUV29741.1|459968_460511_+	phage morphogenesis protein	NA	M4MB67	Vibrio_phage	59.2	1.4e-54
AUV29742.1|460507_461131_+	hypothetical protein	NA	M4MHF0	Vibrio_phage	44.5	1.7e-35
AUV29743.1|461111_461300_+	DUF2635 domain-containing protein	NA	NA	NA	NA	NA
AUV29744.1|461299_462778_+|tail	phage tail protein	tail	M1Q565	Vibrio_phage	53.8	2.2e-150
AUV29745.1|462787_463144_+|tail	phage tail protein	tail	A0A2I7S9D5	Vibrio_phage	44.6	2.0e-22
AUV29746.1|463147_463543_+	hypothetical protein	NA	M1NVT1	Vibrio_phage	42.9	5.2e-19
AUV29747.1|463629_465531_+|tail	phage tail protein	tail	M4MHE6	Vibrio_phage	53.0	1.8e-120
AUV29748.1|465530_466862_+	multidrug DMT transporter	NA	M4M9N2	Vibrio_phage	37.6	1.0e-74
AUV29749.1|466861_467953_+|tail	phage tail protein	tail	M1PVV2	Vibrio_phage	46.0	3.7e-91
AUV29750.1|467943_468486_+|plate	phage baseplate assembly protein V	plate	M1Q572	Vibrio_phage	40.4	2.5e-27
AUV29751.1|468482_468935_+	hypothetical protein	NA	M1PPW1	Vibrio_phage	42.8	4.0e-23
AUV29752.1|468924_470001_+|plate	phage baseplate protein	plate	A0A2I7S9E5	Vibrio_phage	53.4	1.6e-102
AUV29753.1|469985_470576_+	DUF2313 domain-containing protein	NA	M4M9M8	Vibrio_phage	50.3	3.7e-53
AUV29754.1|470575_471226_+	hypothetical protein	NA	O22004	Shigella_phage	37.4	6.8e-24
AUV29755.1|471228_471651_+|tail	phage tail protein	tail	A0A0M4S6V4	Salmonella_phage	76.0	3.1e-25
AUV29756.1|471622_472075_-|tail	phage tail protein	tail	A0A0F7LDZ0	Escherichia_phage	55.6	3.0e-39
AUV29757.1|472504_473059_+	DNA-invertase	NA	A0A0F7LA37	Escherichia_phage	85.7	6.9e-86
AUV29758.1|473205_473856_+	DNA-binding response regulator	NA	NA	NA	NA	NA
AUV34036.1|473856_475251_-	YchO family inverse autotransporter domain-containing protein	NA	NA	NA	NA	NA
AUV29759.1|475436_475790_+	hypothetical protein	NA	NA	NA	NA	NA
AUV29760.1|475833_476529_-	glutathione-specific gamma-glutamylcyclotransferase	NA	NA	NA	NA	NA
AUV29761.1|476686_476917_-	cation transport regulator ChaB	NA	A5IZT6	Spodoptera_litura_granulovirus	40.0	8.5e-06
AUV29762.1|477186_478287_+	sodium-potassium/proton antiporter ChaA	NA	NA	NA	NA	NA
AUV29763.1|478691_478799_+	small toxic polypeptide LdrB	NA	NA	NA	NA	NA
AUV29764.1|479199_479334_+	toxin Ldr, type I toxin-antitoxin system family protein	NA	NA	NA	NA	NA
AUV29765.1|479480_480335_-	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	39.0	8.3e-46
AUV29766.1|480370_481180_-	protein sirB1	NA	NA	NA	NA	NA
AUV29767.1|481183_481576_-	hypothetical protein	NA	NA	NA	NA	NA
AUV29768.1|481572_482406_-	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
AUV29769.1|482405_483488_-	peptide chain release factor 1	NA	W8EDB3	Pseudomonas_phage	41.6	1.5e-07
AUV29770.1|483529_484786_-|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
AUV29771.1|484999_485623_+	outer membrane lipoprotein LolB	NA	NA	NA	NA	NA
AUV29772.1|485622_486474_+	4-diphosphocytidyl-2C-methyl-D-erythritol kinase	NA	NA	NA	NA	NA
AUV34037.1|486624_487572_+	ribose-phosphate pyrophosphokinase	NA	A0A2K9L2G2	Tupanvirus	37.8	3.9e-44
AUV29773.1|487696_489376_+	C4-dicarboxylic acid transporter DauA	NA	A0A2H4J153	uncultured_Caudovirales_phage	23.6	2.3e-23
AUV29774.1|489430_489709_-	hypothetical protein	NA	NA	NA	NA	NA
AUV29775.1|489986_490571_+|tRNA	peptidyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
>prophage 5
CP026202	Escherichia coli strain ECONIH5 chromosome, complete genome	5103533	535774	577577	5103533	head,terminase,protease,capsid,lysis,plate,transposase,portal,tail,holin,integrase	Shigella_phage(46.0%)	60	533929:533943	575901:575915
533929:533943	attL	TTTCAAAATCTCAGT	NA	NA	NA	NA
AUV29821.1|535774_536506_+	helix-turn-helix-type transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	50.5	2.7e-53
AUV29822.1|536726_537131_+	DUF1398 domain-containing protein	NA	NA	NA	NA	NA
AUV29823.1|537830_538154_+	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	64.5	2.6e-40
AUV29824.1|538256_538421_-	isocitrate dehydrogenase	NA	Q77Z09	Phage_21	96.3	4.2e-23
AUV29825.1|539594_540149_-	DNA-invertase	NA	A0A1S6L009	Salmonella_phage	88.9	3.3e-88
AUV29826.1|540175_540574_+|tail	phage tail protein	tail	A0A0F7LBW5	Escherichia_phage	37.5	2.8e-12
AUV29827.1|540576_541017_+|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	66.7	7.5e-51
AUV29828.1|540994_541591_-|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	88.4	9.4e-97
AUV29829.1|541590_542379_-|integrase	integrase	integrase	U5P0I1	Shigella_phage	94.4	4.6e-51
AUV29830.1|542382_542967_-	DUF2313 domain-containing protein	NA	O22003	Shigella_phage	100.0	1.1e-113
AUV29831.1|542957_544016_-|plate	phage baseplate protein	plate	M1FQW3	Enterobacteria_phage	98.9	1.2e-200
AUV29832.1|544002_544431_-|tail	phage tail protein	tail	U5P0R9	Shigella_phage	100.0	2.3e-81
AUV29833.1|544427_544976_-|plate	phage baseplate assembly protein V	plate	U5P081	Shigella_phage	98.9	5.1e-97
AUV29834.1|546052_547423_-	DNA circularization protein	NA	S5FUX4	Shigella_phage	96.9	2.0e-251
AUV29835.1|547441_549277_-|tail	phage tail tape measure protein	tail	S5FM63	Shigella_phage	98.5	1.2e-304
AUV29836.1|549269_549452_-	hypothetical protein	NA	NA	NA	NA	NA
AUV29837.1|549418_549688_-|tail	phage tail assembly protein	tail	M1FPE4	Enterobacteria_phage	98.9	6.0e-43
AUV29838.1|549687_550044_-|tail	phage tail protein	tail	U5P076	Shigella_phage	100.0	5.3e-63
AUV29839.1|550043_551540_-|tail	phage tail protein	tail	U5P0H3	Shigella_phage	99.0	2.0e-276
AUV29840.1|551523_551694_-	DUF2635 domain-containing protein	NA	Q8SBH3	Shigella_phage	98.2	2.7e-25
AUV29841.1|551702_552263_-	hypothetical protein	NA	M1FQV7	Enterobacteria_phage	99.5	3.0e-105
AUV29842.1|552259_552766_-	hypothetical protein	NA	M1FPE2	Enterobacteria_phage	92.9	1.3e-83
AUV29843.1|552740_553151_-|head,tail	head-tail adaptor protein	head,tail	M1FJ87	Enterobacteria_phage	94.1	6.7e-70
AUV29844.1|553147_553471_-|head,tail	phage gp6-like head-tail connector protein	head,tail	U5P072	Shigella_phage	99.1	1.1e-56
AUV29845.1|553473_553674_-	hypothetical protein	NA	S5FNU1	Shigella_phage	97.0	3.8e-26
AUV29846.1|553723_554929_-|capsid	phage major capsid protein	capsid	U5P0G9	Shigella_phage	98.7	3.8e-222
AUV29847.1|554943_555630_-|head,protease	HK97 family phage prohead protease	head,protease	U5P4H2	Shigella_phage	100.0	1.1e-125
AUV29848.1|555571_556813_-|portal	phage portal protein	portal	U5P411	Shigella_phage	99.8	2.0e-242
AUV29849.1|556812_556995_-	hypothetical protein	NA	S5FXQ9	Shigella_phage	100.0	1.7e-25
AUV29850.1|557006_558740_-|terminase	terminase large subunit	terminase	U5P0Q5	Shigella_phage	98.4	0.0e+00
AUV29851.1|558736_559240_-|terminase	phage terminase small subunit P27 family	terminase	Q8SBI1	Shigella_phage	100.0	1.0e-88
AUV34041.1|559356_559707_-	HNH endonuclease	NA	Q8SBD7	Shigella_phage	97.4	4.0e-63
AUV29852.1|559783_560647_-	hypothetical protein	NA	NA	NA	NA	NA
AUV29853.1|560719_561178_-|lysis	lysis protein	lysis	K7P735	Enterobacteria_phage	86.7	6.6e-66
AUV29854.1|561263_562295_+|transposase	IS630 family transposase ISEc33	transposase	NA	NA	NA	NA
AUV29855.1|562319_562796_-	lysozyme	NA	S5FV07	Shigella_phage	97.5	7.0e-87
AUV34042.1|562799_563126_-|holin	phage holin, lambda family	holin	S5FM86	Shigella_phage	98.1	3.4e-56
AUV29856.1|563202_564255_-	site-specific DNA-methyltransferase	NA	A5LH81	Enterobacteria_phage	99.1	6.8e-207
AUV29857.1|564405_564609_-	hypothetical protein	NA	A0A291AWX6	Escherichia_phage	100.0	6.1e-32
AUV29858.1|564873_565800_+	hypothetical protein	NA	NA	NA	NA	NA
AUV29859.1|565786_566335_+	hypothetical protein	NA	NA	NA	NA	NA
AUV29860.1|566347_566689_-	antitermination protein	NA	A0A0P0ZCW0	Stx2-converting_phage	90.3	4.2e-57
AUV29861.1|566706_567696_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	99.1	1.5e-192
AUV29862.1|567703_568501_-	DNA-binding protein	NA	A0A0P0ZCS0	Stx2-converting_phage	98.5	3.2e-148
AUV29863.1|568520_568910_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A0P0ZD39	Stx2-converting_phage	98.4	2.7e-68
AUV29864.1|568906_569233_-	LexA family transcriptional regulator	NA	A0A0N7KZF7	Stx2-converting_phage	99.1	2.7e-53
AUV29865.1|569229_569883_-	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	99.1	3.3e-127
AUV29866.1|569882_570377_-	PerC family transcriptional regulator	NA	A0A291AWV6	Escherichia_phage	99.4	1.5e-87
AUV29867.1|570373_571315_-	helix-turn-helix domain-containing protein	NA	S5FM81	Shigella_phage	99.4	5.6e-144
AUV29868.1|571304_571484_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	7.8e-15
AUV34043.1|571659_572211_-	hypothetical protein	NA	S5FXP0	Shigella_phage	98.9	7.6e-101
AUV29869.1|572248_572449_-	cell division protein	NA	NA	NA	NA	NA
AUV29870.1|572546_573173_+	LexA family transcriptional repressor	NA	K7PM82	Enterobacteria_phage	48.8	5.5e-47
AUV29871.1|573357_573561_+	hypothetical protein	NA	A0A1C9II97	Salmonella_phage	75.5	2.0e-14
AUV29872.1|573569_573845_+	hypothetical protein	NA	Q8SBF7	Shigella_phage	97.8	7.0e-47
AUV29873.1|573762_574008_-	hypothetical protein	NA	NA	NA	NA	NA
AUV29874.1|574148_574373_-	hypothetical protein	NA	A0A291AWX8	Escherichia_phage	61.5	1.6e-12
AUV29875.1|574470_574716_+	excisionase-like protein from lambdoid prophage 14	NA	NA	NA	NA	NA
AUV29876.1|575747_575927_-	hypothetical protein	NA	NA	NA	NA	NA
575901:575915	attR	TTTCAAAATCTCAGT	NA	NA	NA	NA
AUV29877.1|576326_577577_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	3.8e-23
>prophage 6
CP026202	Escherichia coli strain ECONIH5 chromosome, complete genome	5103533	675633	790948	5103533	head,lysis,transposase,plate,tail,holin,integrase	Salmonella_phage(23.33%)	143	746906:746965	791035:792232
AUV29980.1|675633_676650_+|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.7	9.8e-187
AUV34050.1|676687_676807_-	sugar kinase	NA	Q6QLL3	Human_immunodeficiency_virus	94.4	1.8e-12
AUV29981.1|676758_676938_-	hypothetical protein	NA	NA	NA	NA	NA
AUV29982.1|677023_678185_+|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.1e-51
AUV29983.1|678226_679585_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	33.2	1.9e-20
AUV29984.1|682603_684622_+	poly-beta-1,6-N-acetyl-D-glucosamine N-deacetylase PgaB	NA	NA	NA	NA	NA
AUV29985.1|684614_685940_+	poly-beta-1,6 N-acetyl-D-glucosamine synthase	NA	NA	NA	NA	NA
AUV29986.1|685941_686355_+	poly-beta-1,6-N-acetyl-D-glucosamine biosynthesis protein PgaD	NA	NA	NA	NA	NA
AUV29987.1|686404_687328_-	phosphate starvation-inducible protein PhoH	NA	R4II13	Cronobacter_phage	76.2	4.1e-91
AUV29988.1|687799_689071_-	deferrochelatase/peroxidase EfeB	NA	NA	NA	NA	NA
AUV29989.1|689076_690204_-	iron uptake system component EfeO	NA	NA	NA	NA	NA
AUV29990.1|690261_691092_-	ferrous iron permease EfeU	NA	NA	NA	NA	NA
AUV29991.1|691349_691559_-	hypothetical protein	NA	NA	NA	NA	NA
AUV29992.1|691633_693142_-	sodium/proline symporter PutP	NA	NA	NA	NA	NA
AUV34051.1|693221_693413_+	hypothetical protein	NA	NA	NA	NA	NA
AUV29993.1|693300_693510_-	hypothetical protein	NA	NA	NA	NA	NA
AUV29994.1|693564_697527_+	trifunctional transcriptional regulator/proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
AUV29995.1|697566_698205_-	transcriptional regulator	NA	NA	NA	NA	NA
AUV29996.1|698435_699584_+	pyrimidine monooxygenase RutA	NA	NA	NA	NA	NA
AUV34052.1|699583_700276_+	peroxyureidoacrylate/ureidoacrylate amidohydrolase RutB	NA	NA	NA	NA	NA
AUV29997.1|700287_700674_+	pyrimidine utilization protein C	NA	NA	NA	NA	NA
AUV29998.1|700681_701482_+	pyrimidine utilization protein D	NA	NA	NA	NA	NA
AUV29999.1|701491_702082_+	nitroreductase family protein	NA	NA	NA	NA	NA
AUV30000.1|702092_702587_+	FMN reductase	NA	Q9KX93	Enterobacteria_phage	97.9	5.0e-51
AUV30001.1|702607_703936_+	pyrimidine utilization transport protein G	NA	Q9KX94	Enterobacteria_phage	99.5	6.7e-236
AUV30002.1|704193_704367_-	stress-induced protein	NA	Q9KX95	Enterobacteria_phage	96.3	4.9e-06
AUV30003.1|704299_704536_-	hypothetical protein	NA	NA	NA	NA	NA
AUV30004.1|705289_705838_+	recombinase family protein	NA	G8I4U3	Mycobacterium_phage	35.6	1.0e-20
AUV30005.1|707143_707332_-	hypothetical protein	NA	NA	NA	NA	NA
AUV30006.1|709292_710828_-|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	87.7	1.6e-260
AUV30007.1|710877_711225_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZDM8	Stx2-converting_phage	95.7	2.7e-59
AUV30008.1|711491_711938_+	hypothetical protein	NA	S5WIU1	Leptospira_phage	43.8	1.6e-16
AUV30009.1|711947_712787_-	hypothetical protein	NA	NA	NA	NA	NA
AUV30010.1|714026_714995_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
AUV34053.1|715004_715181_-	hypothetical protein	NA	Q76S41	Shigella_phage	63.5	3.9e-11
AUV30011.1|715467_716630_-|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.1e-51
AUV30012.1|716975_717581_+	NAD(P)H:quinone oxidoreductase	NA	NA	NA	NA	NA
AUV30013.1|717601_717829_+	hypothetical protein	NA	NA	NA	NA	NA
AUV30014.1|717866_719108_-	bifunctional glucose-1-phosphatase/inositol phosphatase	NA	NA	NA	NA	NA
AUV30015.1|719762_720647_-	hypothetical protein	NA	NA	NA	NA	NA
AUV30016.1|720906_721827_+	curved DNA-binding protein	NA	A0A1V0SIM1	Klosneuvirus	43.0	4.2e-11
AUV34054.1|721826_722132_+	chaperone modulatory protein CbpM	NA	NA	NA	NA	NA
AUV30017.1|722224_722824_-	molecular chaperone TorD	NA	NA	NA	NA	NA
AUV30018.1|722820_725367_-	trimethylamine-N-oxide reductase TorA	NA	A0A077SK27	Escherichia_phage	30.7	1.0e-70
AUV30019.1|725366_726539_-	pentaheme c-type cytochrome TorC	NA	NA	NA	NA	NA
AUV30020.1|726668_727361_+	two-component system response regulator TorR	NA	W8CYM9	Bacillus_phage	28.0	4.5e-18
AUV30021.1|727333_728362_-	TMAO reductase system periplasmic protein TorT	NA	NA	NA	NA	NA
AUV30022.1|729378_729753_+|tail	phage tail protein	tail	A0A0F7LBW5	Escherichia_phage	37.6	3.4e-12
AUV30023.1|729755_730196_+|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	66.0	8.3e-50
AUV30024.1|730167_730770_-|tail	phage tail protein	tail	M1SV83	Escherichia_phage	89.0	1.9e-97
AUV30025.1|730769_731696_-|tail	phage tail protein	tail	A0A0M3ULD8	Salmonella_phage	71.3	6.9e-62
AUV30026.1|731695_732376_-	DUF2612 domain-containing protein	NA	A0A0M5M1K4	Salmonella_phage	81.4	1.4e-109
AUV30027.1|732372_733572_-	hypothetical protein	NA	A0A0M4RD32	Salmonella_phage	82.2	4.0e-179
AUV30028.1|733572_733926_-	hypothetical protein	NA	A0A2H4J629	uncultured_Caudovirales_phage	76.1	8.4e-45
AUV30029.1|733925_734666_-|plate	phage baseplate protein	plate	A0A0M5M1K7	Salmonella_phage	60.8	2.9e-71
AUV30030.1|734724_735132_-	type II toxin-antitoxin system death-on-curing family toxin	NA	A0A222YZ88	Escherichia_phage	40.7	1.8e-14
AUV30031.1|735131_735545_-	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
AUV30032.1|735627_735978_-	hypothetical protein	NA	A0A2H4J1A5	uncultured_Caudovirales_phage	42.7	9.3e-20
AUV30033.1|735979_737044_-	hypothetical protein	NA	A0A2H4J1B2	uncultured_Caudovirales_phage	66.4	4.4e-137
AUV30034.1|737046_737352_-	hypothetical protein	NA	A0A2H4J495	uncultured_Caudovirales_phage	52.6	4.3e-21
AUV30035.1|737348_737975_-	hypothetical protein	NA	A0A0M3ULD5	Salmonella_phage	64.8	7.9e-62
AUV30036.1|737974_740182_-	lytic transglycosylase	NA	A0A0M4REK7	Salmonella_phage	64.5	2.8e-263
AUV34055.1|740171_740300_-	lytic transglycosylase	NA	NA	NA	NA	NA
AUV30037.1|740359_740785_-	hypothetical protein	NA	A0A2H4J2V6	uncultured_Caudovirales_phage	57.5	1.6e-37
AUV30038.1|740788_741229_-	DUF3277 domain-containing protein	NA	A0A0M5M1K6	Salmonella_phage	77.4	1.3e-58
AUV30039.1|741239_742400_-	hypothetical protein	NA	A0A2H4J8G4	uncultured_Caudovirales_phage	74.1	2.4e-157
AUV30040.1|742403_742967_-	hypothetical protein	NA	A0A0M4R331	Salmonella_phage	76.3	2.6e-80
AUV30041.1|742941_743331_-|head,tail	head-tail adaptor	head,tail	A0A0M3ULK0	Salmonella_phage	98.4	3.5e-68
AUV30042.1|743317_743872_-	hypothetical protein	NA	A0A0M4S631	Salmonella_phage	85.3	6.1e-82
AUV30043.1|743868_744276_-	DUF4054 domain-containing protein	NA	A0A0M5M3S2	Salmonella_phage	97.0	4.6e-71
AUV30044.1|744241_744631_-	hypothetical protein	NA	A0A0M4RTX5	Salmonella_phage	57.4	6.5e-30
AUV30045.1|744672_745614_-	DUF2184 domain-containing protein	NA	A0A0M3ULD3	Salmonella_phage	97.1	1.2e-175
AUV30046.1|745625_746108_-	hypothetical protein	NA	A0A0M4QWZ6	Salmonella_phage	83.8	1.0e-69
AUV30047.1|746340_746814_-	DUF2280 domain-containing protein	NA	F1C5D6	Cronobacter_phage	67.9	1.4e-50
AUV34056.1|746864_747014_+	sugar kinase	NA	Q6QLL3	Human_immunodeficiency_virus	94.4	3.0e-12
746906:746965	attL	GGAAGGTGCGAATAAGTGGGGAAATTCTTCTCGGCTGACTCAGTCATTTCATTTCTTCAT	NA	NA	NA	NA
AUV30048.1|747051_748068_-|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.7	9.8e-187
AUV30049.1|748467_748926_-	hypothetical protein	NA	NA	NA	NA	NA
AUV30050.1|748996_749590_-	hypothetical protein	NA	A0A0M4S631	Salmonella_phage	69.3	5.5e-65
AUV30051.1|749746_749941_-	hypothetical protein	NA	NA	NA	NA	NA
AUV30052.1|749947_750511_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AUV30053.1|751112_753794_-	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	54.4	2.4e-280
AUV30054.1|753790_754009_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
AUV30055.1|754011_754308_-	ubiquinol-cytochrome C reductase	NA	NA	NA	NA	NA
AUV30056.1|754304_755180_-|integrase	integrase	integrase	NA	NA	NA	NA
AUV34057.1|755172_755367_-	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
AUV30057.1|755423_755510_-	hypothetical protein	NA	NA	NA	NA	NA
AUV34058.1|755717_756773_-	hypothetical protein	NA	NA	NA	NA	NA
AUV30058.1|757295_757577_+	hypothetical protein	NA	NA	NA	NA	NA
AUV30059.1|757581_757941_+	transcriptional regulator	NA	NA	NA	NA	NA
AUV30060.1|758080_758293_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
AUV30061.1|758435_759665_-	DUF4102 domain-containing protein	NA	A0A1V0E8G8	Vibrio_phage	38.1	2.4e-70
AUV30062.1|759878_761111_-	hypothetical protein	NA	A0A0M4R5A6	Salmonella_phage	92.9	5.0e-217
AUV34059.1|761125_761830_-|head	phage head morphogenesis protein	head	A0A0M4REK0	Salmonella_phage	96.0	5.7e-109
AUV30063.1|761747_763217_-	hypothetical protein	NA	A0A0M4S6U1	Salmonella_phage	94.7	5.6e-268
AUV30064.1|763216_764839_-	TerL protein	NA	A0A0M5M1R6	Salmonella_phage	95.4	6.0e-312
AUV30065.1|764841_765315_-	DUF2280 domain-containing protein	NA	H9C190	Pectobacterium_phage	72.8	4.7e-51
AUV30066.1|765346_765967_-	hypothetical protein	NA	I6S676	Salmonella_phage	72.7	8.3e-88
AUV30067.1|766027_766546_-	Rha family transcriptional regulator	NA	Q38450	Enterobacteria_phage	100.0	2.9e-94
AUV30068.1|766804_766990_-|lysis	lysis protein	lysis	M9NZE8	Enterobacteria_phage	98.3	1.5e-24
AUV30069.1|766961_767168_+	hypothetical protein	NA	NA	NA	NA	NA
AUV30070.1|767215_767665_-	lysozyme	NA	A0A0M4R365	Salmonella_phage	80.5	3.2e-65
AUV30071.1|767648_767972_-|holin	phage holin, lambda family	holin	G5DA93	Enterobacteria_phage	82.5	6.8e-41
AUV30072.1|768417_768906_-	antiterminator	NA	M1FPN0	Enterobacteria_phage	99.4	9.1e-90
AUV30073.1|768896_769568_-	serine/threonine protein phosphatase	NA	Q716B9	Shigella_phage	97.8	3.9e-131
AUV30074.1|769545_769752_-	protein ninH	NA	Q716C0	Shigella_phage	98.5	2.1e-32
AUV30075.1|769748_770360_-	protein NinG	NA	Q716C3	Shigella_phage	99.0	5.1e-98
AUV30076.1|770352_770562_-	protein ninF	NA	G9L691	Escherichia_phage	97.1	3.5e-30
AUV30077.1|770521_770923_-	hypothetical protein	NA	G9L690	Escherichia_phage	97.0	2.3e-70
AUV30078.1|770925_771102_-	NinE family protein	NA	K7PHE6	Enterobacteria_phage	100.0	2.7e-28
AUV30079.1|771098_771626_-	phage N-6-adenine-methyltransferase	NA	A0A1I9LJP9	Stx_converting_phage	98.9	5.2e-99
AUV30080.1|771622_772081_-	recombination protein NinB	NA	A0A220NRM1	Escherichia_phage	99.3	3.6e-80
AUV30081.1|772139_773576_-	helicase DnaB	NA	A0A0N7C224	Escherichia_phage	92.1	2.0e-254
AUV30082.1|773565_774465_-	DNA replication protein	NA	A0A0N7C1Z7	Escherichia_phage	55.3	4.2e-80
AUV30083.1|774457_774604_-	hypothetical protein	NA	Q687G5	Enterobacteria_phage	100.0	1.1e-19
AUV30084.1|774636_774933_-	hypothetical protein	NA	Q9MCQ0	Enterobacteria_phage	100.0	1.8e-48
AUV30085.1|775071_775305_-	transcriptional regulator	NA	A0A0P0ZDD7	Stx2-converting_phage	98.7	8.9e-35
AUV30086.1|775418_776123_+	XRE family transcriptional regulator	NA	A0A0P0ZE37	Stx2-converting_phage	100.0	1.1e-133
AUV30087.1|776192_776633_+	hypothetical protein	NA	NA	NA	NA	NA
AUV30088.1|776629_776986_+	hypothetical protein	NA	NA	NA	NA	NA
AUV30089.1|777494_777878_+	antitermination protein	NA	G9L671	Escherichia_phage	100.0	3.9e-64
AUV30090.1|777937_778126_+	hypothetical protein	NA	K7PKZ0	Enterobacterial_phage	100.0	3.9e-33
AUV30091.1|778182_778470_+	hypothetical protein	NA	K7PHN6	Enterobacterial_phage	72.6	2.6e-28
AUV30092.1|778469_778658_+	hypothetical protein	NA	A0A0B7MKW0	Enterobacteria_phage	59.3	3.8e-12
AUV30093.1|778738_779014_+	hypothetical protein	NA	K7PGS9	Enterobacteria_phage	98.9	2.3e-45
AUV30094.1|779098_779407_+	hypothetical protein	NA	K7PJM4	Enterobacteria_phage	99.0	3.3e-53
AUV30095.1|779403_780315_+	DNA recombinase	NA	K7PKG9	Enterobacteria_phage	99.0	1.4e-168
AUV30096.1|780298_780781_+	hypothetical protein	NA	K7P6T5	Enterobacteria_phage	96.9	3.5e-78
AUV30097.1|780792_781107_+	hypothetical protein	NA	K7PLT4	Enterobacteria_phage	100.0	1.2e-50
AUV30098.1|781287_781932_+	hypothetical protein	NA	K7PKY4	Enterobacterial_phage	98.6	1.0e-109
AUV30099.1|781928_782201_+	antitoxin	NA	NA	NA	NA	NA
AUV30100.1|782197_782542_+	hypothetical protein	NA	K7PHN2	Enterobacterial_phage	90.7	1.8e-28
AUV30101.1|782731_783532_+	hypothetical protein	NA	K7P7E4	Enterobacteria_phage	59.8	2.7e-83
AUV34060.1|783496_783700_-	hypothetical protein	NA	NA	NA	NA	NA
AUV30102.1|783632_783800_+	hypothetical protein	NA	A0A0K2FJ46	Enterobacteria_phage	96.4	1.4e-26
AUV30103.1|783839_784058_+	excisionase	NA	Q77WA4	Escherichia_phage	100.0	3.7e-35
AUV30104.1|784035_785109_+|integrase	integrase	integrase	Q9G075	Enterobacteria_phage	99.2	4.1e-199
AUV30105.1|785203_787948_+	TMAO reductase system sensor histidine kinase/response regulator TorS	NA	A0A1V0SGX0	Hokovirus	31.9	1.0e-36
AUV30106.1|788019_789093_+	electron transporter YccM	NA	NA	NA	NA	NA
AUV30107.1|789140_789314_-	protein GnsA	NA	NA	NA	NA	NA
AUV30108.1|789303_789534_-	cold-shock protein	NA	NA	NA	NA	NA
AUV34061.1|789508_789697_-	cold-shock protein	NA	NA	NA	NA	NA
AUV30109.1|789707_789914_-	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	71.0	1.8e-18
AUV30110.1|789931_790948_+|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.7	9.8e-187
791035:792232	attR	ATGAAGAAATGAAATGACTGAGTCAGCCGAGAAGAATTTCCCCACTTATTCGCACCTTCCCTAAACCAGTCATTTTATTAGACATATTTTACTTCCTTCATTTTGGGCCTTTCGGCAAACAGGGCTTTAATACAGAAACTACTTAGTGTTCAGGAGAGAGACTCAAAAGAAGGGGATAATGCCTGATAATGAGAACTGCTTTAGTAAACTACTTTGTATGCTGTCTGTCTTTCAAACCGACGCAGCTATTAACGCATGATAATTGAGATTAAGCAAATTTTATTTTAGCCGTCCGGCGGTCTTAAATATCGCTGGCTTTATTTTATTAACCCCGTATAGTGCAGCGCAGTATTTTCAGTAAGGAATTTGTTTGTCCCGTAAAATGACAGGAATTGTCAAAACCTTTGATCGCAAAAGCGGCAAAGGATTCATTATCCCCTCCGACGGTCGTAAAGAAGTCCATGTCCATATTTCCGCATTCACTCCCCGCGACGCAGAAGTGCTTATACCAGGATTACGCGTGGAATTTTGCCGCGTAAATGGCCTGCGAGGACCAACAGCGGCAAATGTTTATCTCTCTTAATATGACGCTGCTTGTTTAAAGCTGACTGGTTTTATTGGAATAGTTCAATAGTCAACACCATAAATTATAATATGAGTTACTTTTTCACCAGGCAACAAATCCATTTAAGCGAATATCTCTGCACCTAATAGTTATAAATGCCACTTAACAGCCAGTTATAGTACCACTTGAAACTATATTACCAACAATAGTTAATAGCTTTCTTAACAATTTTCTTATCTTTAATTTGTATTTTTCTAAGATTTATCTTATGCGCACAAGTCGTATTTCCAGAGGGAAATCGTTAACAATCTTATATTTCCCTCTGCGCGCCTTTCTCACCCGCTGTATATAGTGCAAGTGGTATGAGGAAAGGGAGATTTCACAAGGATGTTATACTCAAAGTAGACAATCCTGATCTCAAGCGTACGTATTGTCCATGCGATGAATAAAGGAAAAGTTATGAAACACAAGCTTTCTGCAATCCTTATGGCCTTCATGTTGACGACGCCAGCTGCGTTTGCTGCCCCTGAAGCAGCAAACGGGACCGAGGCAACGACGGGTACTACTGGCACCACAACAACCACTACAGGTGCAACCACGACTGCTGCTACCACTGGTGGCGTGGCTGCTGGC	NA	NA	NA	NA
>prophage 7
CP026202	Escherichia coli strain ECONIH5 chromosome, complete genome	5103533	823514	1055646	5103533	head,terminase,integrase,protease,capsid,lysis,transposase,plate,portal,tail,holin,tRNA	Salmonella_phage(31.5%)	234	835453:835473	1056610:1056642
AUV30142.1|823514_825275_+|protease	Lon protease family protein	protease	NA	NA	NA	NA
AUV34065.1|825343_825862_+	beta-hydroxydecanoyl-ACP dehydratase	NA	NA	NA	NA	NA
AUV30143.1|825931_826099_-	ribosome modulation factor	NA	NA	NA	NA	NA
AUV30144.1|826354_826918_-	hypothetical protein	NA	NA	NA	NA	NA
AUV30145.1|826914_828555_-	paraquat-inducible protein B	NA	NA	NA	NA	NA
AUV30146.1|828559_829813_-	paraquat-inducible protein A	NA	NA	NA	NA	NA
AUV30147.1|829942_831850_-	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.7	1.1e-53
AUV30148.1|831861_833970_-	ribosomal RNA large subunit methyltransferase K/L	NA	NA	NA	NA	NA
AUV30149.1|834213_835323_+	MOSC domain-containing protein	NA	NA	NA	NA	NA
AUV30150.1|835319_835862_-	cell division protein ZapC	NA	NA	NA	NA	NA
835453:835473	attL	AGTGCGGCATTTTCGCCAGAT	NA	NA	NA	NA
AUV30151.1|836035_837046_-	dihydroorotate dehydrogenase (quinone)	NA	NA	NA	NA	NA
835453:835473	attL	AGTGCGGCATTTTCGCCAGAT	NA	NA	NA	NA
AUV30152.1|837156_837867_-	pili assembly chaperone	NA	NA	NA	NA	NA
AUV30153.1|837859_838375_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
AUV30154.1|838675_839656_+|transposase	IS5 family transposase ISKpn26	transposase	A0A077SK28	Escherichia_phage	99.4	1.0e-185
AUV34066.1|839694_839820_-	ABC transporter	NA	NA	NA	NA	NA
AUV30155.1|840007_840583_+	NADPH-dependent FMN reductase	NA	NA	NA	NA	NA
AUV30156.1|840575_841535_+	sulfonate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUV30157.1|841531_842677_+	alkanesulfonate monooxygenase, FMNH(2)-dependent	NA	NA	NA	NA	NA
AUV30158.1|842688_843480_+	aliphatic sulfonate ABC transporter permease SsuC	NA	NA	NA	NA	NA
AUV30159.1|843476_844244_+	aliphatic sulfonate ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.0	5.7e-30
AUV30160.1|844286_846899_-	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.8	9.1e-19
AUV30161.1|847164_848367_+	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
AUV30162.1|848535_849936_+|tRNA	asparagine--tRNA ligase	tRNA	A0A2K9V902	Bandra_megavirus	36.1	5.3e-82
AUV30163.1|850743_852018_-|transposase	IS4-like element ISApu2 family transposase	transposase	NA	NA	NA	NA
AUV30164.1|853038_853221_-	hypothetical protein	NA	NA	NA	NA	NA
AUV30165.1|853207_854398_+	aspartate aminotransferase	NA	NA	NA	NA	NA
AUV30166.1|854619_855267_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
AUV34067.1|855293_855842_-	DUF882 domain-containing protein	NA	A0A0K1LKR7	Rhodobacter_phage	33.7	7.0e-06
AUV30167.1|856022_857870_-	L,D-transpeptidase	NA	NA	NA	NA	NA
AUV30168.1|858130_862591_-	chromosome partition protein MukB	NA	NA	NA	NA	NA
AUV30169.1|862590_863295_-	condensin subunit E	NA	NA	NA	NA	NA
AUV30170.1|863275_864598_-	chromosome partition protein MukF	NA	NA	NA	NA	NA
AUV30171.1|864594_865380_-|tRNA	tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM	tRNA	NA	NA	NA	NA
AUV30172.1|865628_866408_+	envelope biogenesis factor ElyC	NA	NA	NA	NA	NA
AUV30173.1|866384_867278_-	hypothetical protein	NA	NA	NA	NA	NA
AUV30174.1|867431_868178_-	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
AUV30175.1|868174_868357_-	protein YcaR	NA	NA	NA	NA	NA
AUV30176.1|868408_869641_-	winged helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
AUV30177.1|869677_870664_-	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
AUV30178.1|870660_872409_-	lipid A export ATP-binding/permease MsbA	NA	W8CYL7	Bacillus_phage	29.8	2.5e-57
AUV30179.1|872445_874710_-	ComEC family protein	NA	NA	NA	NA	NA
AUV30180.1|874916_875201_-	integration host factor subunit beta	NA	A7KV42	Bacillus_phage	40.2	3.2e-10
AUV30181.1|875360_877034_-	30S ribosomal protein S1	NA	NA	NA	NA	NA
AUV30182.1|877144_877828_-	cytidylate kinase	NA	NA	NA	NA	NA
AUV30183.1|878000_878765_-|protease	metalloprotease	protease	NA	NA	NA	NA
AUV30184.1|878933_880217_-	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
AUV30185.1|880287_881376_-	3-phosphoserine/phosphohydroxythreonine aminotransferase	NA	M1Q1P2	Streptococcus_phage	46.8	3.5e-81
AUV30186.1|881574_882267_-	DUF421 domain-containing protein	NA	NA	NA	NA	NA
AUV30187.1|882395_884156_+	30S ribosomal protein S12 methylthiotransferase accessory protein YcaO	NA	NA	NA	NA	NA
AUV30188.1|884561_885419_+	formate transporter FocA	NA	NA	NA	NA	NA
AUV30189.1|885473_887756_+	formate acetyltransferase 1	NA	A0A2P0VNR5	Tetraselmis_virus	41.5	1.0e-162
AUV30190.1|888075_888330_-	transcriptional regulator	NA	A0A0F7LDQ9	Escherichia_phage	100.0	6.1e-45
AUV30191.1|888375_889539_-	hypothetical protein	NA	U5N3V4	Enterobacteria_phage	99.7	6.3e-206
AUV30192.1|889538_890018_-|tail	phage tail protein	tail	A0A0F7LDE8	Escherichia_phage	99.4	1.5e-84
AUV30193.1|890032_892480_-|tail	phage tail tape measure protein	tail	M1T2S3	Escherichia_phage	96.4	0.0e+00
AUV34068.1|892472_892592_-|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	100.0	1.0e-15
AUV30194.1|892624_892900_-|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	100.0	5.7e-41
AUV30195.1|892955_893474_-|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	100.0	1.4e-93
AUV30196.1|893486_894677_-|tail	phage tail protein	tail	A0A0F7LBW9	Escherichia_phage	99.2	1.8e-224
AUV30197.1|894736_895330_-	DNA-invertase	NA	A0A0F7LA37	Escherichia_phage	97.5	4.6e-104
AUV30198.1|895360_895810_+|tail	phage tail protein	tail	A0A0F7LCR3	Escherichia_phage	61.4	1.5e-51
AUV30199.1|895809_896412_+|tail	phage tail protein	tail	Q9MCR5	Enterobacteria_phage	90.8	1.4e-95
AUV30200.1|896383_896824_-|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	66.0	6.4e-50
AUV30201.1|896826_898011_-|tail	phage tail protein	tail	A0A0F7LBW5	Escherichia_phage	80.1	4.0e-163
AUV30202.1|898007_898619_-|tail	phage tail protein I	tail	A0A0F7LA36	Escherichia_phage	99.5	3.8e-117
AUV30203.1|898611_899520_-|plate	baseplate assembly protein	plate	U5N3T9	Enterobacteria_phage	99.0	5.4e-160
AUV30204.1|899524_899872_-|plate	baseplate assembly protein	plate	A0A0F7LDQ1	Escherichia_phage	100.0	1.3e-58
AUV30205.1|899868_900504_-|plate	phage baseplate assembly protein V	plate	U5N3F0	Enterobacteria_phage	98.1	2.5e-111
AUV30206.1|900570_901023_-	phage virion morphogenesis protein	NA	A0A0F7LBV9	Escherichia_phage	99.3	4.1e-76
AUV30207.1|901015_901483_-|tail	phage tail protein	tail	Q7Y4E0	Escherichia_virus	99.4	1.9e-81
AUV30208.1|901445_901619_-|lysis	phage lysis protein	lysis	Q7Y4E1	Escherichia_virus	96.5	2.3e-24
AUV30209.1|901590_902016_-	protein lysB	NA	Q7Y4E2	Escherichia_virus	95.7	8.0e-66
AUV30210.1|902003_902429_-	protein lysA	NA	A0A0F7LDU9	Escherichia_phage	97.2	1.9e-59
AUV30211.1|902443_902941_-	lysozyme	NA	A0A0F7LBS0	Escherichia_phage	100.0	3.1e-93
AUV30212.1|902940_903222_-|holin	holin	holin	A0A0F7LA12	Escherichia_phage	100.0	1.3e-43
AUV30213.1|903225_903429_-|tail	phage tail protein	tail	A0A0F7LCN2	Escherichia_phage	100.0	3.0e-31
AUV30214.1|903428_903938_-|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	100.0	1.1e-90
AUV30215.1|904037_904781_-|terminase	terminase	terminase	A0A0F7LBP7	Escherichia_phage	98.0	1.5e-123
AUV30216.1|904784_905858_-|capsid	phage major capsid protein, P2 family	capsid	Q94MK2	Enterobacteria_phage	100.0	6.7e-202
AUV30217.1|905916_906771_-|capsid	capsid scaffolding protein	capsid	Q94MB7	Escherichia_virus	89.4	1.7e-139
AUV30218.1|906944_908717_+	oxidoreductase	NA	A0A0F7LCK3	Escherichia_phage	100.0	0.0e+00
AUV30219.1|908716_909751_+|portal	phage portal protein	portal	U5N087	Enterobacteria_phage	99.4	2.4e-201
AUV30220.1|909963_910233_+	hypothetical protein	NA	Q2P9X2	Enterobacteria_phage	89.9	3.8e-29
AUV30221.1|910456_910894_+	hypothetical protein	NA	S4TUD6	Salmonella_phage	92.3	1.6e-69
AUV30222.1|911018_911969_-	RNA-directed DNA polymerase	NA	E5E3S8	Burkholderia_phage	40.0	3.8e-39
AUV30223.1|911946_912255_-	XRE family transcriptional regulator	NA	E5E3S9	Burkholderia_phage	40.2	1.7e-12
AUV30224.1|912291_912585_-	hypothetical protein	NA	NA	NA	NA	NA
AUV30225.1|912855_915144_-	replication protein A	NA	Q7Y4B8	Escherichia_virus	97.7	0.0e+00
AUV30226.1|915133_915409_-	hypothetical protein	NA	U5N3W1	Enterobacteria_phage	98.9	1.5e-44
AUV30227.1|915405_915630_-	hypothetical protein	NA	S4TRY6	Salmonella_phage	100.0	2.9e-35
AUV30228.1|915632_915932_-	hypothetical protein	NA	S4TUD1	Salmonella_phage	99.0	3.2e-45
AUV30229.1|915931_916156_-	DUF2732 domain-containing protein	NA	S4TP68	Salmonella_phage	100.0	4.7e-33
AUV34070.1|916219_916720_-	replication protein B	NA	S4TTB7	Salmonella_phage	99.4	3.8e-91
AUV30230.1|916716_916914_-	hypothetical protein	NA	A0A0F7LDS9	Escherichia_phage	100.0	2.8e-29
AUV34069.1|916897_917254_-	hypothetical protein	NA	Q1JS28	Enterobacteria_phage	99.2	1.5e-62
AUV30231.1|917362_917662_+	XRE family transcriptional regulator	NA	Q1JS29	Enterobacteria_phage	100.0	3.0e-51
AUV30232.1|917755_918751_+|integrase	integrase	integrase	A0A0F7LBR0	Escherichia_phage	100.0	5.4e-190
AUV30233.1|918782_919580_+	pyruvate formate lyase 1-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	26.6	1.3e-21
AUV30234.1|919661_920252_-	hypothetical protein	NA	NA	NA	NA	NA
AUV30235.1|920351_921260_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUV30236.1|921260_922691_-	inner membrane transporter YcaM	NA	NA	NA	NA	NA
AUV30237.1|922900_924049_-	MFS transporter	NA	NA	NA	NA	NA
AUV30238.1|924362_924989_+	hydrolase	NA	NA	NA	NA	NA
AUV30239.1|925023_925887_-	dimethyl sulfoxide reductase	NA	NA	NA	NA	NA
AUV30240.1|925888_926506_-	dimethyl sulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	60.6	5.0e-77
AUV30241.1|929199_930492_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	48.2	1.5e-94
AUV30242.1|930582_931926_-	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	40.3	3.6e-80
AUV30243.1|931936_932548_-	outer membrane lipoprotein carrier protein LolA	NA	NA	NA	NA	NA
AUV30244.1|932702_936770_-	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	48.7	1.2e-86
933734:933754	attR	AGTGCGGCATTTTCGCCAGAT	NA	NA	NA	NA
AUV30245.1|936904_937399_-	leucine-responsive regulatory protein	NA	NA	NA	NA	NA
933734:933754	attR	AGTGCGGCATTTTCGCCAGAT	NA	NA	NA	NA
AUV30246.1|937942_938908_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.6	1.1e-62
AUV30247.1|939030_940797_+	thiol reductant ABC exporter subunit CydD	NA	W8CYL7	Bacillus_phage	24.3	7.0e-23
AUV30248.1|940797_942519_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	W8CYL7	Bacillus_phage	25.2	4.9e-21
AUV30249.1|942560_943265_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
AUV30250.1|943549_943768_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
AUV30251.1|944692_946969_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.5	1.9e-166
AUV30252.1|946999_947320_-|protease	ATP-dependent Clp protease adaptor ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
AUV30253.1|947642_947867_+	cold-shock protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	2.3e-16
AUV30254.1|947939_949886_-	macrolide ABC transporter permease/ATP-binding protein MacB	NA	G9BWD6	Planktothrix_phage	40.1	1.1e-37
AUV30255.1|949882_950998_-	MacA family efflux pump subunit	NA	NA	NA	NA	NA
AUV30256.1|951112_952105_+	DUF535 domain-containing protein	NA	NA	NA	NA	NA
AUV30257.1|952101_953760_-	ATP-dependent endonuclease	NA	NA	NA	NA	NA
AUV30258.1|954185_954881_+	aquaporin Z	NA	NA	NA	NA	NA
AUV30259.1|955375_956275_+	transporter	NA	NA	NA	NA	NA
AUV30260.1|956418_958071_+	hydroxylamine reductase	NA	NA	NA	NA	NA
AUV30261.1|958082_959051_+	hybrid-cluster NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
AUV30262.1|959183_960902_+	ubiquinone-dependent pyruvate dehydrogenase	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	24.0	5.2e-31
AUV30263.1|960938_961940_+	low-specificity L-threonine aldolase	NA	NA	NA	NA	NA
AUV30264.1|961950_963381_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
AUV34071.1|963479_964493_+	hypothetical protein	NA	NA	NA	NA	NA
AUV30265.1|964489_965320_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1B0UZW5	Roseobacter_phage	30.0	5.7e-07
AUV30266.1|965316_965640_-	hypothetical protein	NA	NA	NA	NA	NA
AUV30267.1|965765_966281_+	lipoprotein	NA	NA	NA	NA	NA
AUV30268.1|966498_967227_+	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	36.7	6.0e-29
AUV30269.1|967244_967976_+	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUV30270.1|967982_968699_+	arginine transporter permease subunit ArtQ	NA	NA	NA	NA	NA
AUV30271.1|968698_969367_+	arginine ABC transporter permease ArtM	NA	NA	NA	NA	NA
AUV30272.1|969592_970324_+	arginine/ornithine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUV30273.1|970522_971650_-	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A1X9I6F4	Streptococcus_phage	27.0	6.0e-28
AUV30274.1|971690_972179_-	DUF2593 domain-containing protein	NA	NA	NA	NA	NA
AUV30275.1|972238_973084_-	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
AUV30276.1|973080_974034_-	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
AUV30277.1|974043_975177_-	putrescine transport ATP-binding protein PotG	NA	G3M9Y6	Bacillus_virus	34.0	1.4e-29
AUV30278.1|975271_976384_-	putrescine-binding periplasmic protein	NA	NA	NA	NA	NA
AUV30279.1|976734_977211_-	YbjN domain-containing protein	NA	NA	NA	NA	NA
AUV30280.1|977298_978201_-	30S ribosomal protein S6--L-glutamate ligase	NA	I3ULC9	Synechococcus_phage	34.4	2.6e-37
AUV30281.1|978261_978984_-	oxygen-insensitive NADPH nitroreductase	NA	NA	NA	NA	NA
AUV30282.1|978967_979255_-	hypothetical protein	NA	NA	NA	NA	NA
AUV30283.1|979414_979672_+	GrxA family glutaredoxin	NA	A0A2I7SAE2	Vibrio_phage	61.9	3.0e-23
AUV30284.1|979701_980079_-	hypothetical protein	NA	NA	NA	NA	NA
AUV30285.1|980348_982034_+	transporter	NA	NA	NA	NA	NA
AUV30286.1|982269_982488_-	transcriptional regulator	NA	Q53ZE7	Salmonella_virus	69.0	7.5e-20
AUV30287.1|982578_983679_-	late control protein D	NA	A0A1S6KZZ5	Salmonella_phage	87.7	6.5e-176
AUV30288.1|983675_984161_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	80.6	6.3e-67
AUV30289.1|984157_987235_-|tail	phage tail tape measure protein	tail	E5G6Q1	Salmonella_phage	63.0	0.0e+00
AUV30290.1|987227_987347_-|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.8e-13
AUV30291.1|987361_987664_-|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	91.0	3.7e-41
AUV30292.1|987718_988234_-|tail	phage major tail tube protein	tail	A0A1S6L002	Salmonella_phage	95.3	2.1e-89
AUV30293.1|988243_989416_-|tail	phage tail protein	tail	A0A1S6KZY7	Salmonella_phage	90.3	4.6e-204
AUV30294.1|989558_990125_-	DNA-invertase	NA	A0A0F7LA37	Escherichia_phage	86.8	2.9e-87
AUV30295.1|990155_990674_+|tail	phage tail protein	tail	A0A0F7LCR3	Escherichia_phage	62.0	4.1e-56
AUV30296.1|990673_991276_+|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	91.0	2.0e-99
AUV30297.1|991247_991691_-|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	94.6	1.0e-79
AUV30298.1|991711_993133_-|tail	phage tail protein	tail	A0A0F7LBW5	Escherichia_phage	66.6	5.8e-169
AUV30299.1|993129_993735_-|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	92.0	9.8e-110
AUV30300.1|993727_994636_-|plate	baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	90.7	9.2e-144
AUV30301.1|994622_994982_-|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	86.6	9.5e-52
AUV30302.1|994978_995557_-|plate	phage baseplate assembly protein V	plate	A0A1S6KZX7	Salmonella_phage	87.0	4.2e-94
AUV30303.1|995625_996072_-	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	84.9	1.5e-62
AUV30304.1|996064_996496_-|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	92.3	8.4e-71
AUV30305.1|996458_996662_-	hypothetical protein	NA	A0A1S6KZX6	Salmonella_phage	77.6	6.1e-24
AUV30306.1|996591_997020_-	hypothetical protein	NA	E5G6N2	Salmonella_phage	77.3	2.9e-47
AUV30307.1|997016_997394_-	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	40.0	5.1e-16
AUV34072.1|997395_997869_-	lysozyme	NA	E5G6N1	Salmonella_phage	91.0	3.7e-80
AUV30308.1|997888_998104_-	hypothetical protein	NA	E5G6N0	Salmonella_phage	80.3	1.8e-26
AUV30309.1|998107_998311_-|tail	phage tail protein	tail	E5G6M9	Salmonella_phage	91.0	6.8e-31
AUV30310.1|998310_998775_-|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	89.0	1.4e-76
AUV30311.1|998870_999521_-	hypothetical protein	NA	E5G6M7	Salmonella_phage	96.3	8.7e-112
AUV30312.1|999524_1000583_-|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	93.4	2.9e-181
AUV30313.1|1000599_1001433_-|capsid	capsid protein	capsid	A0A1S6KZW9	Salmonella_phage	91.3	2.2e-123
AUV30314.1|1001575_1003342_+	oxidoreductase	NA	A0A1S6KZW3	Salmonella_phage	99.5	0.0e+00
AUV30315.1|1003341_1004400_+|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	86.1	9.6e-169
AUV30316.1|1004403_1004766_+	hypothetical protein	NA	B2ZY70	Ralstonia_phage	43.0	8.7e-13
AUV30317.1|1007125_1007431_-	DinI family protein	NA	E5G6M1	Salmonella_phage	100.0	4.7e-36
AUV34073.1|1007369_1007558_-	hypothetical protein	NA	E5G6M0	Salmonella_phage	98.4	5.5e-27
AUV30318.1|1007711_1010126_-	replication endonuclease	NA	E5G6L9	Salmonella_phage	97.4	0.0e+00
AUV30319.1|1010122_1010980_-	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	98.2	4.1e-162
AUV30320.1|1010976_1011204_-	hypothetical protein	NA	E5G6L7	Salmonella_phage	100.0	2.7e-36
AUV30321.1|1011203_1011437_-	DUF2732 domain-containing protein	NA	E5G6L6	Salmonella_phage	96.1	9.2e-32
AUV30322.1|1011504_1011846_-	hypothetical protein	NA	E5G6L5	Salmonella_phage	96.5	4.3e-54
AUV30323.1|1011809_1012010_-	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	98.5	7.1e-33
AUV30324.1|1012017_1012527_-	hypothetical protein	NA	E5G6L3	Salmonella_phage	98.2	1.3e-86
AUV30325.1|1012559_1012781_-	regulator	NA	NA	NA	NA	NA
AUV30326.1|1012906_1013476_+	phage repressor protein	NA	A0A1S6KZZ7	Salmonella_phage	43.9	2.9e-39
AUV30327.1|1013491_1013683_+	hypothetical protein	NA	A0A0R6PIH8	Moraxella_phage	65.9	6.8e-09
AUV30328.1|1013871_1014924_+|integrase	integrase	integrase	A0A218M4I3	Erwinia_phage	57.3	3.6e-107
AUV30329.1|1015028_1015565_-	DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
AUV30330.1|1015648_1016857_+	MFS transporter	NA	NA	NA	NA	NA
AUV30331.1|1016856_1017672_+	HAD family hydrolase	NA	NA	NA	NA	NA
AUV30332.1|1017757_1018042_+	hypothetical protein	NA	NA	NA	NA	NA
AUV30333.1|1018082_1019315_-	multidrug transporter MdfA	NA	NA	NA	NA	NA
AUV30334.1|1019599_1020196_+	undecaprenyl-diphosphatase	NA	NA	NA	NA	NA
AUV30335.1|1020253_1021012_+	DeoR family transcriptional regulator	NA	NA	NA	NA	NA
AUV34074.1|1021058_1022261_-	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	48.0	1.1e-99
AUV30336.1|1022507_1023134_+	glutathione S-transferase	NA	NA	NA	NA	NA
AUV30337.1|1023130_1024246_-	PQQ-dependent sugar dehydrogenase	NA	NA	NA	NA	NA
AUV30338.1|1024356_1024740_-	biofilm regulator BssR	NA	NA	NA	NA	NA
AUV30339.1|1024952_1026278_+	30S ribosomal protein S12 methylthiotransferase RimO	NA	NA	NA	NA	NA
AUV30340.1|1027769_1028045_-	hypothetical protein	NA	Q71TE9	Escherichia_phage	97.8	7.7e-46
AUV30341.1|1028214_1029126_-	glutathione ABC transporter permease	NA	NA	NA	NA	NA
AUV30342.1|1029128_1030049_-	glutathione ABC transporter permease	NA	NA	NA	NA	NA
AUV30343.1|1030066_1031605_-	glutathione ABC transporter substrate-binding protein GsiB	NA	NA	NA	NA	NA
AUV30344.1|1031624_1033496_-	glutathione ABC transporter ATP-binding protein GsiA	NA	G9BWD6	Planktothrix_phage	29.7	6.8e-16
AUV30345.1|1033482_1034448_-	beta-aspartyl-peptidase	NA	NA	NA	NA	NA
AUV30346.1|1034651_1035887_+	molybdopterin molybdotransferase	NA	NA	NA	NA	NA
AUV30347.1|1035886_1036636_+	molybdopterin-synthase adenylyltransferase MoeB	NA	NA	NA	NA	NA
AUV30348.1|1036814_1037477_-	fructose-6-phosphate aldolase	NA	A0A0E3HJ81	Synechococcus_phage	34.1	3.3e-26
AUV30349.1|1037607_1038507_+	glycyl-radical enzyme activating protein	NA	NA	NA	NA	NA
AUV30350.1|1038512_1040945_+	formate C-acetyltransferase/glycerol dehydratase family glycyl radical enzyme	NA	A0A076YHZ7	Citrobacter_phage	44.9	1.6e-09
AUV30351.1|1041090_1041906_+	sugar phosphatase YbiV	NA	NA	NA	NA	NA
AUV30352.1|1042057_1043323_+	DUF1479 domain-containing protein	NA	NA	NA	NA	NA
AUV30353.1|1043563_1045156_-	ABC-F family ATPase	NA	A0A2K9L0W2	Tupanvirus	28.7	6.9e-62
AUV30354.1|1045374_1046295_+	transpeptidase	NA	NA	NA	NA	NA
AUV30355.1|1046353_1047472_-	anion transporter	NA	NA	NA	NA	NA
AUV30356.1|1047468_1047936_-	transcriptional regulator MntR	NA	NA	NA	NA	NA
AUV30357.1|1048121_1048250_+	manganase accumulation protein MntS	NA	NA	NA	NA	NA
AUV30358.1|1048521_1050105_+	phosphoethanolamine transferase OpgE	NA	NA	NA	NA	NA
AUV30359.1|1050153_1050669_-	outer membrane protein X	NA	H6WZM8	Escherichia_phage	33.8	1.1e-16
AUV30360.1|1051021_1051909_+	threonine/homoserine exporter RhtA	NA	NA	NA	NA	NA
AUV30361.1|1052207_1052711_+	DNA starvation/stationary phase protection protein	NA	A0A222YYG6	Streptomyces_phage	29.0	4.9e-06
AUV30362.1|1052996_1053188_+	hypothetical protein	NA	NA	NA	NA	NA
AUV30363.1|1053114_1053861_+	amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUV30364.1|1053999_1054575_+	glutamine ABC transporter permease GlnP	NA	NA	NA	NA	NA
AUV30365.1|1054494_1055646_-|transposase	IS30 family transposase IS30	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
1056610:1056642	attR	ATTGCCTGATGCGCTACGCTTATCAGGCCTACA	NA	NA	NA	NA
>prophage 8
CP026202	Escherichia coli strain ECONIH5 chromosome, complete genome	5103533	1545583	1589084	5103533	protease,holin,transposase	Escherichia_phage(18.18%)	36	NA	NA
AUV30810.1|1545583_1546564_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	98.8	5.2e-185
AUV34089.1|1548519_1548735_-	hypothetical protein	NA	NA	NA	NA	NA
AUV30811.1|1548651_1549239_+	transcriptional regulator	NA	NA	NA	NA	NA
AUV30812.1|1549252_1550725_+	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
AUV30813.1|1550738_1552409_+|holin	oxygen-dependent choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	31.2	4.7e-61
AUV34090.1|1553794_1553980_+	transcriptional regulator	NA	NA	NA	NA	NA
AUV30814.1|1554251_1554878_+	inovirus Gp2 family protein	NA	NA	NA	NA	NA
AUV34091.1|1554968_1555700_-	hypothetical protein	NA	NA	NA	NA	NA
AUV30815.1|1556912_1557068_-	aldehyde dehydrogenase	NA	A0A2L1IV26	Escherichia_phage	96.3	5.2e-07
AUV30816.1|1557353_1558400_+	Fe(3+) ions import ATP-binding protein FbpC	NA	G3M9Y6	Bacillus_virus	37.7	1.5e-33
AUV30817.1|1558508_1559441_-	homocysteine S-methyltransferase	NA	NA	NA	NA	NA
AUV34092.1|1559427_1560831_-	S-methylmethionine permease	NA	NA	NA	NA	NA
AUV30818.1|1561105_1562317_-	3-(3-hydroxy-phenyl)propionate transporter MhpT	NA	NA	NA	NA	NA
AUV30819.1|1562386_1563400_-	4-hydroxy-2-oxovalerate aldolase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	30.8	1.2e-43
AUV30820.1|1563396_1564347_-	acetaldehyde dehydrogenase (acetylating)	NA	E5EQ71	Micromonas_sp._RCC1109_virus	36.0	4.0e-33
AUV30821.1|1564343_1565153_-	2-keto-4-pentenoate hydratase	NA	NA	NA	NA	NA
AUV30822.1|1565162_1566029_-	2-hydroxy-6-oxo-6-phenylhexa-2,4-dienoate hydrolase	NA	NA	NA	NA	NA
AUV30823.1|1566057_1567011_-	3-carboxyethylcatechol 2,3-dioxygenase	NA	NA	NA	NA	NA
AUV30824.1|1568749_1569187_-	hypothetical protein	NA	NA	NA	NA	NA
AUV30825.1|1569480_1571004_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.8	3.7e-44
AUV30826.1|1571545_1572622_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
AUV30827.1|1572844_1574143_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	48.6	2.3e-47
AUV34093.1|1575239_1575521_+	DNA-binding protein	NA	NA	NA	NA	NA
AUV30828.1|1575555_1576125_+	Hsp20/alpha crystallin family protein	NA	NA	NA	NA	NA
AUV30829.1|1576230_1579113_+|protease	ATP-dependent Clp protease ATP-binding subunit	protease	K4FB40	Cronobacter_phage	41.2	1.2e-128
AUV30830.1|1579112_1579304_+	hypothetical protein	NA	NA	NA	NA	NA
AUV30831.1|1579364_1581092_+	ATP-dependent metallopeptidase FtsH/Yme1/Tma family protein	NA	C7U047	Ostreococcus_tauri_virus	37.5	9.7e-86
AUV30832.1|1581179_1581638_+	Hsp20/alpha crystallin family protein	NA	NA	NA	NA	NA
AUV30833.1|1581660_1582575_+	hypothetical protein	NA	NA	NA	NA	NA
AUV30834.1|1582677_1583565_+	hypothetical protein	NA	NA	NA	NA	NA
AUV30835.1|1583661_1584273_+	HdeD family acid-resistance protein	NA	NA	NA	NA	NA
AUV30836.1|1584352_1585498_+	hypothetical protein	NA	NA	NA	NA	NA
AUV30837.1|1585487_1585928_+	thioredoxin TrxC	NA	A0A1J0GW78	Streptomyces_phage	37.2	4.5e-11
AUV30838.1|1585931_1587647_+	sodium:proton exchanger	NA	NA	NA	NA	NA
AUV30839.1|1587643_1588141_+	phosphate-starvation-inducible E family protein	NA	NA	NA	NA	NA
AUV30840.1|1588118_1589084_+|protease	Zn-dependent protease	protease	NA	NA	NA	NA
>prophage 9
CP026202	Escherichia coli strain ECONIH5 chromosome, complete genome	5103533	1598476	1641831	5103533	transposase	Escherichia_phage(33.33%)	48	NA	NA
AUV30853.1|1598476_1599639_-|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.1e-51
AUV30854.1|1600124_1600277_-	hypothetical protein	NA	NA	NA	NA	NA
AUV30855.1|1601966_1602983_-|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.7	9.8e-187
AUV30856.1|1604658_1605078_-	hypothetical protein	NA	NA	NA	NA	NA
AUV30857.1|1605760_1607371_-|transposase	IS1634 family transposase ISSpu7	transposase	NA	NA	NA	NA
AUV30858.1|1607495_1608122_+	hypothetical protein	NA	G9IA57	Pseudomonas_phage	36.0	1.2e-20
AUV30859.1|1608182_1608737_-	DNA-invertase	NA	A0A1S6L009	Salmonella_phage	86.7	1.4e-86
AUV30860.1|1608955_1609660_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AUV30861.1|1610088_1611111_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
AUV30862.1|1612158_1612488_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2I6TCA4	Escherichia_phage	43.1	3.1e-17
AUV30863.1|1612468_1612750_+	XRE family transcriptional regulator	NA	A0A2I6TC97	Escherichia_phage	38.0	1.3e-08
AUV34094.1|1612875_1613856_+|transposase	IS5/IS1182 family transposase	transposase	Q38213	Escherichia_phage	97.5	5.4e-182
AUV34096.1|1613893_1614043_-	sugar kinase	NA	Q6QLL3	Human_immunodeficiency_virus	100.0	2.1e-13
AUV34095.1|1614049_1614697_+	tyrosine-protein kinase etk	NA	NA	NA	NA	NA
AUV34097.1|1614816_1616115_-	phytase AppA	NA	NA	NA	NA	NA
AUV30864.1|1616194_1616287_-	cytochrome bd-II oxidase subunit CbdX	NA	NA	NA	NA	NA
AUV30865.1|1616299_1617436_-	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
AUV30866.1|1618261_1618639_-	hypothetical protein	NA	NA	NA	NA	NA
AUV30867.1|1618944_1619556_-	inovirus Gp2 family protein	NA	NA	NA	NA	NA
AUV30868.1|1619605_1619815_+	hypothetical protein	NA	NA	NA	NA	NA
AUV30869.1|1619960_1620167_-	AlpA family phage regulatory protein	NA	A0A1V0E888	Vibrio_phage	40.7	8.5e-05
AUV30870.1|1620616_1621543_+	hypothetical protein	NA	NA	NA	NA	NA
AUV30871.1|1621649_1622513_+	hypothetical protein	NA	NA	NA	NA	NA
AUV30872.1|1622604_1623426_+	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	38.7	6.1e-46
AUV30873.1|1623643_1624345_+	WYL domain-containing protein	NA	NA	NA	NA	NA
AUV30874.1|1624381_1624618_+	hypothetical protein	NA	NA	NA	NA	NA
AUV30875.1|1624617_1625061_+	hypothetical protein	NA	NA	NA	NA	NA
AUV30876.1|1625083_1625551_+	hypothetical protein	NA	NA	NA	NA	NA
AUV30877.1|1625627_1625867_+	DUF905 domain-containing protein	NA	NA	NA	NA	NA
AUV30878.1|1625964_1626423_+	antirestriction protein	NA	A9J566	Pseudomonas_phage	32.8	2.0e-14
AUV30879.1|1626438_1626915_+	hypothetical protein	NA	NA	NA	NA	NA
AUV30880.1|1626923_1627151_+	DUF987 domain-containing protein	NA	NA	NA	NA	NA
AUV30881.1|1627163_1627481_+	type IV toxin-antitoxin system YeeU family antitoxin	NA	NA	NA	NA	NA
AUV30882.1|1627501_1627843_+	toxin	NA	NA	NA	NA	NA
AUV30883.1|1628414_1629668_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.0	1.7e-95
AUV30884.1|1629679_1630783_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
AUV30885.1|1631070_1632126_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.9	7.7e-118
AUV30886.1|1632164_1632566_-	sigma factor-binding protein Crl	NA	NA	NA	NA	NA
AUV30887.1|1632623_1633868_-	esterase	NA	NA	NA	NA	NA
AUV30888.1|1633959_1634418_-	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
AUV30889.1|1634678_1636136_+	cytosol nonspecific dipeptidase	NA	NA	NA	NA	NA
AUV30890.1|1636492_1636759_-	hypothetical protein	NA	NA	NA	NA	NA
AUV30891.1|1636745_1636973_+	hypothetical protein	NA	NA	NA	NA	NA
AUV30892.1|1637065_1637518_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AUV30893.1|1637514_1638570_-	DNA polymerase IV	NA	NA	NA	NA	NA
AUV34098.1|1638640_1639411_-	putative lateral flagellar export/assembly protein LafU	NA	NA	NA	NA	NA
AUV30894.1|1639370_1641110_+	flagellar biosynthesis protein FlhA	NA	NA	NA	NA	NA
AUV30895.1|1641333_1641831_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 10
CP026202	Escherichia coli strain ECONIH5 chromosome, complete genome	5103533	1650733	1708302	5103533	holin,tRNA,transposase	Erysipelothrix_phage(16.67%)	53	NA	NA
AUV30903.1|1650733_1651431_-|transposase	IS1-like element IS1A family transposase	transposase	A0A077SLN4	Escherichia_phage	99.1	2.8e-132
AUV30904.1|1651545_1652496_-	magnesium/nickel/cobalt transporter CorA	NA	NA	NA	NA	NA
AUV30905.1|1652865_1653180_+	hypothetical protein	NA	NA	NA	NA	NA
AUV30906.1|1654051_1656055_+|holin	choline transporter	holin	A0A2I7QNT1	Vibrio_phage	25.9	9.7e-21
AUV30907.1|1656465_1657434_-|transposase	IS5/IS1182 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	96.9	1.0e-180
AUV30908.1|1657728_1658754_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
AUV30909.1|1659175_1660448_+|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.0	8.8e-177
AUV30910.1|1660498_1660702_-	hypothetical protein	NA	NA	NA	NA	NA
AUV30911.1|1660751_1661135_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	50.0	3.0e-11
AUV30912.1|1661131_1661479_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZDM8	Stx2-converting_phage	95.7	2.7e-59
AUV30913.1|1661528_1663064_+|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	87.9	2.4e-261
AUV34099.1|1663695_1666728_-	type III restriction endonuclease subunit R	NA	A0A2K5B256	Erysipelothrix_phage	43.3	6.1e-216
AUV30914.1|1666735_1668694_-	site-specific DNA-methyltransferase	NA	A0A2K5B2C1	Erysipelothrix_phage	42.2	1.8e-128
AUV30915.1|1668754_1669609_-	DUF4391 domain-containing protein	NA	NA	NA	NA	NA
AUV30916.1|1669601_1672868_-	helicase	NA	A0A2K5B253	Erysipelothrix_phage	45.1	4.2e-263
AUV30917.1|1674787_1675663_+	GTP-binding protein	NA	NA	NA	NA	NA
AUV30918.1|1675877_1676585_+	WYL domain-containing protein	NA	NA	NA	NA	NA
AUV30919.1|1676748_1676964_+|transposase	transposase	transposase	NA	NA	NA	NA
AUV34100.1|1677077_1677488_+	hypothetical protein	NA	J7KCA3	Erwinia_phage	50.7	2.6e-29
AUV30920.1|1677553_1678492_+	hypothetical protein	NA	NA	NA	NA	NA
AUV30921.1|1678580_1679399_+	DUF945 domain-containing protein	NA	K4F5L3	Cronobacter_phage	36.1	7.0e-42
AUV30922.1|1679666_1680137_+	antirestriction protein	NA	A0A1S5R3R9	Pseudomonas_phage	35.8	3.6e-11
AUV30923.1|1680148_1680628_+	hypothetical protein	NA	NA	NA	NA	NA
AUV30924.1|1680648_1680870_+	DUF987 domain-containing protein	NA	NA	NA	NA	NA
AUV30925.1|1680893_1681253_+	hypothetical protein	NA	NA	NA	NA	NA
AUV30926.1|1681303_1681681_+	toxin CbtA	NA	NA	NA	NA	NA
AUV30927.1|1681677_1682169_+	hypothetical protein	NA	NA	NA	NA	NA
AUV30928.1|1682200_1682404_+	DUF957 domain-containing protein	NA	NA	NA	NA	NA
AUV30929.1|1682484_1683330_+	DUF4942 domain-containing protein	NA	NA	NA	NA	NA
AUV30930.1|1683552_1683783_+	hypothetical protein	NA	NA	NA	NA	NA
AUV34101.1|1683671_1684403_-	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	38.1	1.3e-39
AUV30931.1|1684467_1684935_+	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.7	1.0e-50
AUV30932.1|1684931_1685654_-	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AUV30933.1|1685687_1686443_+	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
AUV30934.1|1686514_1687873_+	lytic transglycosylase	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	36.0	5.8e-09
AUV30935.1|1687921_1688692_-	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AUV30936.1|1688769_1689570_-	EEP domain-containing protein	NA	NA	NA	NA	NA
AUV30937.1|1689810_1690725_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUV30938.1|1690721_1691525_-	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	36.2	7.1e-39
AUV30939.1|1697274_1697847_-	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
AUV30940.1|1698034_1699066_+	methionine import ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	40.2	7.2e-36
AUV30941.1|1699058_1699712_+	methionine ABC transporter	NA	NA	NA	NA	NA
AUV30942.1|1699751_1700567_+	methionine ABC transporter substrate-binding protein MetQ	NA	NA	NA	NA	NA
AUV30943.1|1700684_1701089_+	Rcs stress response system protein RcsF	NA	NA	NA	NA	NA
AUV30944.1|1701085_1701793_+|tRNA	tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO	tRNA	NA	NA	NA	NA
AUV30945.1|1701903_1703622_+|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
AUV30946.1|1703674_1704499_+	hypothetical protein	NA	NA	NA	NA	NA
AUV30947.1|1704653_1705364_-	copper homeostasis/adhesion lipoprotein NlpE	NA	NA	NA	NA	NA
AUV30948.1|1705377_1705800_-|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
AUV30949.1|1705796_1706342_-	hypothetical protein	NA	NA	NA	NA	NA
AUV30950.1|1706507_1706708_+	hypothetical protein	NA	NA	NA	NA	NA
AUV34102.1|1706700_1706955_+	protein rof	NA	NA	NA	NA	NA
AUV30951.1|1707003_1708302_-|tRNA	tRNA(Ile)-lysidine synthetase	tRNA	NA	NA	NA	NA
>prophage 11
CP026202	Escherichia coli strain ECONIH5 chromosome, complete genome	5103533	2005070	2059921	5103533	protease,integrase,transposase,tRNA	Escherichia_phage(13.33%)	46	2017790:2017808	2026262:2026280
AUV31210.1|2005070_2006039_+|transposase	IS5-like element IS903B family transposase	transposase	A0A1B0VFY5	Salmonella_phage	99.7	2.1e-186
AUV31211.1|2006357_2007383_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
AUV31212.1|2007414_2007969_-	tyrosine recombinase	NA	A0A2L1IV36	Escherichia_phage	51.7	2.5e-43
AUV34116.1|2008445_2008853_-	tyrosine recombinase	NA	A0A2L1IV36	Escherichia_phage	57.8	1.3e-41
AUV31213.1|2011539_2011689_-	hypothetical protein	NA	NA	NA	NA	NA
AUV31214.1|2011986_2013260_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.4e-177
AUV31215.1|2013505_2014222_+	N-acetylneuraminic acid outer membrane channel protein NanC	NA	NA	NA	NA	NA
AUV31216.1|2014241_2014811_+	kelch motif family protein	NA	NA	NA	NA	NA
2017790:2017808	attL	CGAAGGCCGGACTCGAACC	NA	NA	NA	NA
AUV31217.1|2018029_2018266_-	hypothetical protein	NA	NA	NA	NA	NA
AUV31218.1|2018298_2018763_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AUV31219.1|2019635_2020196_-	recombinase family protein	NA	A0A219Y912	Aeromonas_phage	37.6	1.8e-20
AUV31220.1|2020387_2020855_+	hypothetical protein	NA	A0A1V0EBT6	Caulobacter_phage	39.8	2.0e-25
AUV31221.1|2021010_2022027_+	hypothetical protein	NA	NA	NA	NA	NA
AUV31222.1|2022400_2022913_+	hypothetical protein	NA	NA	NA	NA	NA
AUV31223.1|2022991_2023564_+	hypothetical protein	NA	NA	NA	NA	NA
AUV31224.1|2024254_2026165_-|integrase	integrase	integrase	NA	NA	NA	NA
AUV31225.1|2026535_2027555_+	aldehyde reductase Ahr	NA	A0A0G2Y405	Acanthamoeba_polyphaga_mimivirus	30.7	1.4e-44
2026262:2026280	attR	CGAAGGCCGGACTCGAACC	NA	NA	NA	NA
AUV31226.1|2027684_2029187_+	hypothetical protein	NA	A0A248XCZ8	Klebsiella_phage	44.6	6.1e-84
AUV31227.1|2029347_2030430_-	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
AUV31228.1|2030429_2031530_-	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
AUV31229.1|2031796_2033308_+	cytosol aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	38.0	6.0e-47
AUV31230.1|2033441_2033885_+	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
AUV31231.1|2033884_2036740_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	36.8	2.1e-141
AUV31232.1|2036795_2037992_-	DUF898 domain-containing protein	NA	NA	NA	NA	NA
AUV31233.1|2038184_2038688_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AUV31234.1|2038733_2039150_-	regulator of ribonuclease activity B	NA	NA	NA	NA	NA
AUV31235.1|2039311_2040316_+	ornithine carbamoyltransferase	NA	NA	NA	NA	NA
AUV31236.1|2042157_2042610_-	YhcH/YjgK/YiaL family protein	NA	NA	NA	NA	NA
AUV31237.1|2042754_2043348_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
AUV31238.1|2043418_2044132_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
AUV31239.1|2044262_2044658_+	RidA family protein	NA	NA	NA	NA	NA
AUV34117.1|2044626_2044809_-	hypothetical protein	NA	NA	NA	NA	NA
AUV31240.1|2044938_2045073_+	pyrBI operon leader peptide	NA	NA	NA	NA	NA
AUV31241.1|2045076_2046012_+	aspartate carbamoyltransferase catalytic subunit	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	40.2	2.9e-52
AUV31242.1|2046024_2046486_+	aspartate carbamoyltransferase regulatory subunit	NA	NA	NA	NA	NA
AUV31243.1|2046558_2046945_+	2-iminobutanoate/2-iminopropanoate deaminase	NA	NA	NA	NA	NA
AUV31244.1|2047010_2047466_+|transposase	transposase	transposase	NA	NA	NA	NA
AUV31245.1|2047510_2050207_-	magnesium-translocating P-type ATPase	NA	M1HLC0	Paramecium_bursaria_Chlorella_virus	27.4	2.0e-45
AUV34118.1|2050347_2050401_-	MgtA leader peptide	NA	NA	NA	NA	NA
AUV31246.1|2050585_2051533_+	HTH-type transcriptional regulator TreR	NA	C6ZCU4	Enterobacteria_phage	21.8	7.9e-13
AUV31247.1|2051651_2053073_+	PTS trehalose transporter subunit IIBC	NA	NA	NA	NA	NA
AUV31248.1|2053122_2054778_+	alpha,alpha-phosphotrehalase	NA	NA	NA	NA	NA
AUV31249.1|2055171_2057310_+	anaerobic ribonucleoside triphosphate reductase	NA	A0A2I7QNQ7	Vibrio_phage	64.5	1.5e-266
AUV31250.1|2057489_2057954_+	anaerobic ribonucleoside-triphosphate reductase activating protein	NA	K4F9T1	Cronobacter_phage	57.1	8.5e-53
AUV31251.1|2057998_2058385_-	soluble cytochrome b562	NA	NA	NA	NA	NA
AUV31252.1|2058568_2059921_-|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
>prophage 12
CP026202	Escherichia coli strain ECONIH5 chromosome, complete genome	5103533	2436522	2496580	5103533	terminase,integrase,tRNA,plate,portal,tail,holin,capsid	Salmonella_phage(80.56%)	68	2434996:2435040	2467414:2467458
2434996:2435040	attL	GATAAAAAAAACCCCCACATCATGTGGGGGAAGACAGGGATGGTG	NA	NA	NA	NA
AUV31581.1|2436522_2437641_-	hypothetical protein	NA	A0A0M4REC6	Salmonella_phage	98.9	1.2e-190
AUV31582.1|2437798_2438992_+|tail	phage tail protein	tail	A0A0M4S6M1	Salmonella_phage	94.0	1.7e-214
AUV31583.1|2439004_2439520_+|tail	phage major tail tube protein	tail	A0A0M5M1I5	Salmonella_phage	95.9	3.9e-91
AUV31584.1|2439534_2439870_+|tail	phage tail protein	tail	A0A0M4RCV2	Salmonella_phage	99.1	3.0e-52
AUV31585.1|2439878_2439995_+|tail	GpE family phage tail protein	tail	A0A0M3ULA8	Salmonella_phage	100.0	6.6e-15
AUV31586.1|2439995_2443166_+|tail	phage tail tape measure protein	tail	A0A0M4R2V3	Salmonella_phage	74.2	0.0e+00
AUV31587.1|2443176_2443626_+	oxidoreductase	NA	A0A1J0I2L5	Salmonella_phage	92.6	2.2e-74
AUV31588.1|2444029_2444380_+|tail	phage tail protein	tail	E5G6P1	Salmonella_phage	43.9	6.7e-10
AUV31589.1|2444351_2444786_-|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	59.9	8.8e-44
AUV31590.1|2446191_2446800_-|tail	phage tail protein I	tail	E5G6N9	Salmonella_phage	82.5	2.1e-96
AUV31591.1|2446792_2447704_-|plate	baseplate assembly protein	plate	A0A0M4REB7	Salmonella_phage	98.7	2.2e-161
AUV31592.1|2447700_2448063_-|plate	baseplate assembly protein	plate	A0A0M4S6L5	Salmonella_phage	99.2	9.5e-60
AUV31593.1|2448059_2448689_-|plate	phage baseplate assembly protein V	plate	A0A0M3ULA5	Salmonella_phage	96.7	1.0e-109
AUV31594.1|2448846_2449491_-	phage virion morphogenesis protein	NA	A0A0M4RCU1	Salmonella_phage	97.7	4.4e-116
AUV31595.1|2449451_2449946_-|tail	phage tail protein	tail	A0A0M4R2U5	Salmonella_phage	98.0	8.7e-80
AUV31596.1|2449945_2450479_-	DUF2514 domain-containing protein	NA	A0A0M4S5V1	Salmonella_phage	94.3	1.8e-43
AUV31597.1|2450580_2451021_-	muraminidase	NA	A0A0M5M782	Salmonella_phage	95.9	3.4e-75
AUV31598.1|2451004_2451340_-|holin	phage holin, lambda family	holin	A0A0M3ULH4	Salmonella_phage	98.2	2.1e-53
AUV31599.1|2451350_2451551_-|tail	phage tail protein	tail	A0A0M4RTN6	Salmonella_phage	100.0	1.8e-31
AUV31600.1|2451550_2452039_-|capsid	capsid assembly protein	capsid	A0A0M4QWR7	Salmonella_phage	97.5	5.2e-85
AUV31601.1|2452141_2452990_-|terminase	terminase	terminase	A0A0M4R523	Salmonella_phage	97.5	1.4e-133
AUV31602.1|2453032_2454079_-|capsid	phage major capsid protein, P2 family	capsid	A0A0M3ULA3	Salmonella_phage	98.8	9.1e-196
AUV34131.1|2454119_2454965_-|capsid	phage capsid protein	capsid	A0A1J0I2E9	Salmonella_phage	97.5	1.2e-153
AUV31603.1|2455118_2456831_+	oxidoreductase	NA	A0A0M4S6K7	Salmonella_phage	98.4	0.0e+00
AUV31604.1|2456831_2457881_+|portal	phage portal protein	portal	A0A0M5M1H6	Salmonella_phage	100.0	6.7e-207
AUV31605.1|2458290_2458596_-	hypothetical protein	NA	NA	NA	NA	NA
AUV31606.1|2458802_2459312_-	hypothetical protein	NA	NA	NA	NA	NA
AUV31607.1|2459278_2461888_-	replication endonuclease	NA	F1BUS0	Erwinia_phage	41.9	8.0e-140
AUV31608.1|2461884_2462193_-	nucleoside 2-deoxyribosyltransferase	NA	A0A0U2SAZ1	Escherichia_phage	67.1	4.8e-28
AUV31609.1|2463103_2463676_-	3'-5' exoribonuclease	NA	NA	NA	NA	NA
AUV31610.1|2463745_2464138_-	hypothetical protein	NA	NA	NA	NA	NA
AUV31611.1|2464223_2464406_-	DUF3927 domain-containing protein	NA	NA	NA	NA	NA
AUV31612.1|2464405_2464837_-	tellurite resistance protein	NA	Q1MVI3	Enterobacteria_phage	90.3	3.1e-65
AUV31613.1|2464923_2465151_-	hypothetical protein	NA	A0A0M4S6M9	Salmonella_phage	68.0	9.6e-26
AUV31614.1|2465326_2465530_-	DUF4761 domain-containing protein	NA	A0A0M5M1I3	Salmonella_phage	66.2	1.9e-17
AUV31615.1|2465542_2465824_-	regulator	NA	A0A0M4RCW1	Salmonella_phage	96.8	3.4e-49
AUV31616.1|2465935_2466256_+	transcriptional regulator	NA	A0A0M5M1I9	Salmonella_phage	84.9	2.9e-44
AUV31617.1|2466325_2467306_+|integrase	integrase	integrase	A0A0M4RTQ0	Salmonella_phage	98.8	2.1e-186
AUV34132.1|2467483_2467984_-	periplasmic protein CpxP	NA	NA	NA	NA	NA
2467414:2467458	attR	GATAAAAAAAACCCCCACATCATGTGGGGGAAGACAGGGATGGTG	NA	NA	NA	NA
AUV31618.1|2468133_2468832_+	DNA-binding response regulator	NA	Q6XM27	Feldmannia_irregularis_virus	30.3	5.3e-06
AUV31619.1|2468828_2470202_+	two-component system sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	25.9	2.9e-16
AUV31620.1|2470307_2470982_-	MOSC domain-containing protein	NA	NA	NA	NA	NA
AUV31621.1|2471130_2472114_-	2-keto-3-deoxygluconate transporter	NA	NA	NA	NA	NA
AUV31622.1|2472091_2472199_-	2-keto-3-deoxygluconate permease	NA	NA	NA	NA	NA
AUV31623.1|2472373_2472994_-	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	59.8	4.9e-64
AUV31624.1|2473278_2474313_+	L-rhamnose/proton symporter RhaT	NA	NA	NA	NA	NA
AUV31625.1|2474309_2475248_-	HTH-type transcriptional activator RhaR	NA	NA	NA	NA	NA
AUV31626.1|2475231_2476068_-	HTH-type transcriptional activator RhaS	NA	NA	NA	NA	NA
AUV31627.1|2476355_2477825_+	rhamnulokinase	NA	NA	NA	NA	NA
AUV31628.1|2477821_2479081_+	L-rhamnose isomerase	NA	NA	NA	NA	NA
AUV31629.1|2479322_2480147_+	rhamnulose-1-phosphate aldolase	NA	NA	NA	NA	NA
AUV31630.1|2480156_2480471_+	L-rhamnose mutarotase	NA	NA	NA	NA	NA
AUV31631.1|2480771_2481218_+	fructose-like phosphotransferase enzyme IIA component	NA	NA	NA	NA	NA
AUV31632.1|2481228_2482680_+	PTS subunit IIBC	NA	NA	NA	NA	NA
AUV31633.1|2482669_2483740_+	peptidase	NA	NA	NA	NA	NA
AUV31634.1|2483739_2485488_+	HTH domain-containing protein	NA	NA	NA	NA	NA
AUV31635.1|2485537_2486593_-	DUF3829 domain-containing protein	NA	NA	NA	NA	NA
AUV31636.1|2486745_2487579_-	sulfurtransferase FdhD	NA	NA	NA	NA	NA
AUV31637.1|2487514_2487769_-	hypothetical protein	NA	NA	NA	NA	NA
AUV31638.1|2487772_2488360_+	sulfate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUV31639.1|2488408_2490823_+	formate dehydrogenase-N subunit alpha	NA	NA	NA	NA	NA
AUV31640.1|2490835_2491738_+	formate dehydrogenase-O iron-sulfur subunit	NA	NA	NA	NA	NA
AUV31641.1|2491734_2492370_+	formate dehydrogenase cytochrome b556(fdo) subunit	NA	NA	NA	NA	NA
AUV31642.1|2492366_2493296_+	formate dehydrogenase accessory protein FdhE	NA	NA	NA	NA	NA
AUV31643.1|2493625_2493844_-	hypothetical protein	NA	NA	NA	NA	NA
AUV34133.1|2494085_2494298_-	CopG family transcriptional regulator	NA	NA	NA	NA	NA
AUV31644.1|2495156_2496146_-	acetyltransferase	NA	NA	NA	NA	NA
AUV31645.1|2496142_2496580_-|tRNA	D-aminoacyl-tRNA deacylase	tRNA	NA	NA	NA	NA
>prophage 13
CP026202	Escherichia coli strain ECONIH5 chromosome, complete genome	5103533	2763036	2777509	5103533	transposase	Morganella_phage(25.0%)	15	NA	NA
AUV31873.1|2763036_2763861_-	DNA damage-inducible protein D	NA	A0A1W6JPJ7	Morganella_phage	77.0	2.8e-91
AUV31874.1|2764067_2764298_+	hypothetical protein	NA	NA	NA	NA	NA
AUV31875.1|2764397_2765162_-	hypothetical protein	NA	NA	NA	NA	NA
AUV31876.1|2765331_2765619_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
AUV31877.1|2765850_2766042_-	hypothetical protein	NA	NA	NA	NA	NA
AUV31878.1|2766138_2767674_-|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	87.7	1.6e-260
AUV31879.1|2767723_2768071_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZDM8	Stx2-converting_phage	95.7	2.7e-59
AUV31880.1|2768067_2768451_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	50.0	3.0e-11
AUV31881.1|2768739_2768925_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
AUV31882.1|2768921_2769257_+	hypothetical protein	NA	NA	NA	NA	NA
AUV34146.1|2769919_2770357_+	hypothetical protein	NA	I6S5X4	Salmonella_phage	33.1	3.1e-12
AUV31883.1|2770418_2772524_-	injection protein	NA	A0A2I7QQN9	Vibrio_phage	37.1	3.6e-90
AUV31884.1|2772523_2773990_-	acyltransferase	NA	B6SCW4	Bacteriophage	51.5	3.7e-110
AUV34147.1|2774434_2774686_-	hypothetical protein	NA	NA	NA	NA	NA
AUV31885.1|2774752_2777509_-	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	57.3	1.8e-299
>prophage 14
CP026202	Escherichia coli strain ECONIH5 chromosome, complete genome	5103533	3371473	3422798	5103533	integrase,tRNA,transposase	Escherichia_phage(25.0%)	45	3389593:3389607	3417646:3417660
AUV32455.1|3371473_3372496_-|transposase	IS110 family transposase IS5708	transposase	NA	NA	NA	NA
AUV32456.1|3373481_3374894_+	uronate isomerase	NA	NA	NA	NA	NA
AUV32457.1|3374908_3376396_+	altronate dehydratase	NA	NA	NA	NA	NA
AUV32458.1|3376478_3377030_+	YgjV family protein	NA	NA	NA	NA	NA
AUV32459.1|3377034_3378279_-	serine/threonine transporter SstT	NA	NA	NA	NA	NA
AUV32460.1|3378483_3378738_-	DNA helicase	NA	NA	NA	NA	NA
AUV32461.1|3378894_3379860_-	TerC family protein	NA	A0A291LBC5	Escherichia_phage	33.8	5.2e-36
AUV34173.1|3380142_3381129_-	gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
AUV32462.1|3381207_3381891_-	vancomycin high temperature exclusion protein	NA	NA	NA	NA	NA
AUV32463.1|3381967_3382471_-	M48 family peptidase	NA	NA	NA	NA	NA
AUV32464.1|3382556_3383693_+	23S rRNA (guanine(1835)-N(2))-methyltransferase RlmG	NA	NA	NA	NA	NA
AUV32465.1|3383796_3384036_+	addiction module toxin RelE	NA	NA	NA	NA	NA
AUV32466.1|3383977_3384292_+	mRNA interferase HigB	NA	NA	NA	NA	NA
AUV32467.1|3384288_3384705_+	transcriptional regulator	NA	NA	NA	NA	NA
AUV32468.1|3384749_3386768_-	NADPH-dependent 2,4-dienoyl-CoA reductase	NA	NA	NA	NA	NA
AUV32469.1|3387293_3389645_-	alpha-glucosidase	NA	NA	NA	NA	NA
3389593:3389607	attL	AAACTTATCAGCAGA	NA	NA	NA	NA
AUV32470.1|3389661_3390732_-	protein YgjJ	NA	NA	NA	NA	NA
AUV32471.1|3390865_3392299_-	oxidoreductase	NA	NA	NA	NA	NA
AUV32472.1|3392361_3392811_-	evolved beta-galactosidase subunit beta	NA	NA	NA	NA	NA
AUV32473.1|3392807_3395900_-	beta-galactosidase subunit alpha	NA	L0N6M2	Herpes_simplex_virus	34.2	3.4e-158
AUV32474.1|3396083_3397067_-	transcriptional regulator EbgR	NA	NA	NA	NA	NA
AUV32475.1|3396996_3397179_-	hypothetical protein	NA	NA	NA	NA	NA
AUV32476.1|3397285_3397618_+|tRNA	tRNA-binding protein	tRNA	NA	NA	NA	NA
AUV34174.1|3397659_3399039_-	putrescine aminotransferase	NA	A0A1V0SKB7	Klosneuvirus	28.6	2.0e-33
AUV34175.1|3398974_3399181_-	hypothetical protein	NA	NA	NA	NA	NA
AUV32477.1|3399456_3400977_+	hypothetical protein	NA	A0A1B0V854	Salmonella_phage	52.2	1.4e-35
AUV32478.1|3401130_3401754_-	PadR family transcriptional regulator	NA	NA	NA	NA	NA
AUV32479.1|3402041_3402806_+	siderophore-interacting protein	NA	NA	NA	NA	NA
AUV32480.1|3403103_3404420_+|integrase	integrase	integrase	A0A248SL35	Klebsiella_phage	30.5	1.2e-35
AUV34176.1|3404705_3404852_-	hypothetical protein	NA	NA	NA	NA	NA
AUV32481.1|3405032_3406043_+	hypothetical protein	NA	NA	NA	NA	NA
AUV32482.1|3406162_3406399_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
AUV32483.1|3406533_3407955_+	DUF3987 domain-containing protein	NA	NA	NA	NA	NA
AUV32484.1|3408080_3408707_+	inovirus Gp2 family protein	NA	NA	NA	NA	NA
AUV32485.1|3409050_3410082_-|transposase	IS630 family transposase ISEc33	transposase	NA	NA	NA	NA
AUV32486.1|3411046_3411823_+	polysialic acid transporter	NA	NA	NA	NA	NA
AUV32487.1|3411819_3412488_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.4	1.7e-09
AUV34177.1|3412484_3412604_+	ABC transporter	NA	NA	NA	NA	NA
AUV32488.1|3412642_3413623_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	98.5	4.9e-183
AUV32489.1|3413715_3417192_+	hypothetical protein	NA	A0A1P8DJK6	Virus_Rctr41k	26.7	7.1e-11
AUV32490.1|3417255_3418338_+	hypothetical protein	NA	NA	NA	NA	NA
3417646:3417660	attR	TCTGCTGATAAGTTT	NA	NA	NA	NA
AUV32491.1|3418421_3419453_+|transposase	IS630 family transposase ISEc33	transposase	NA	NA	NA	NA
AUV32492.1|3419433_3419949_+	hypothetical protein	NA	NA	NA	NA	NA
AUV32493.1|3419965_3421063_-	capsular biosynthesis protein	NA	NA	NA	NA	NA
AUV32494.1|3421187_3422798_+|transposase	IS1634 family transposase ISSpu7	transposase	NA	NA	NA	NA
>prophage 15
CP026202	Escherichia coli strain ECONIH5 chromosome, complete genome	5103533	3523810	3573918	5103533	protease,integrase,transposase,tRNA	Escherichia_phage(37.5%)	51	3518469:3518492	3566441:3566464
3518469:3518492	attL	TTGCCGGATGCGGCGTGAATGCCT	NA	NA	NA	NA
AUV32597.1|3523810_3524749_-|transposase	IS5/IS1182 family transposase	transposase	Q38213	Escherichia_phage	99.7	4.5e-170
AUV32598.1|3524754_3525459_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AUV32599.1|3525483_3526701_+	hypothetical protein	NA	NA	NA	NA	NA
AUV32600.1|3528041_3529565_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.8	3.7e-44
AUV32601.1|3529858_3530230_+	hypothetical protein	NA	NA	NA	NA	NA
AUV32602.1|3531225_3531774_+	hypothetical protein	NA	NA	NA	NA	NA
AUV32603.1|3531882_3532899_-|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.7	9.8e-187
AUV32604.1|3532952_3534122_+	hypothetical protein	NA	NA	NA	NA	NA
AUV32605.1|3535232_3536486_-|integrase	integrase	integrase	Q7M297	Enterobacteria_phage	38.6	2.4e-78
AUV32606.1|3537047_3537251_+	AlpA family transcriptional regulator	NA	A0A1V0E8E5	Vibrio_phage	42.6	8.0e-08
AUV32607.1|3537276_3537534_-	plasmid replication protein	NA	NA	NA	NA	NA
AUV32608.1|3537530_3538388_-	replication protein	NA	NA	NA	NA	NA
AUV32609.1|3538701_3539406_-	hypothetical protein	NA	NA	NA	NA	NA
AUV32610.1|3539983_3540274_+	hypothetical protein	NA	NA	NA	NA	NA
AUV32611.1|3540277_3540667_+	plasmid mobilization relaxosome protein MobC	NA	NA	NA	NA	NA
AUV32612.1|3540647_3542126_+	relaxase	NA	NA	NA	NA	NA
AUV32613.1|3542166_3542490_-	hypothetical protein	NA	NA	NA	NA	NA
AUV32614.1|3542498_3543770_-	DUF4102 domain-containing protein	NA	Q7M297	Enterobacteria_phage	36.3	5.3e-73
AUV32615.1|3544133_3544841_-	hypothetical protein	NA	NA	NA	NA	NA
AUV32616.1|3544955_3545159_+	hypothetical protein	NA	NA	NA	NA	NA
AUV32617.1|3547410_3548667_-	nucleoside permease NupG	NA	NA	NA	NA	NA
AUV32618.1|3548868_3549948_-	lytic murein transglycosylase	NA	NA	NA	NA	NA
AUV32619.1|3550012_3550288_-	Fe(2+)-trafficking protein	NA	NA	NA	NA	NA
AUV32620.1|3550315_3551368_-	adenine DNA glycosylase	NA	NA	NA	NA	NA
AUV32621.1|3551321_3551459_-	adenine glycosylase	NA	NA	NA	NA	NA
AUV32622.1|3551528_3552248_+|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
AUV32623.1|3552247_3552574_+	DUF469 domain-containing protein	NA	NA	NA	NA	NA
AUV32624.1|3552757_3553477_+	DUF2884 domain-containing protein	NA	NA	NA	NA	NA
AUV32625.1|3553652_3554699_+	L-asparaginase 2	NA	NA	NA	NA	NA
AUV32626.1|3554815_3555823_+	DUF1202 domain-containing protein	NA	NA	NA	NA	NA
AUV32627.1|3555977_3557114_-	YggW family oxidoreductase	NA	NA	NA	NA	NA
AUV32628.1|3557106_3557700_-	XTP/dITP diphosphatase	NA	NA	NA	NA	NA
AUV32629.1|3557707_3557998_-	YggU family protein	NA	NA	NA	NA	NA
AUV32630.1|3557994_3558561_-	YggT family protein	NA	NA	NA	NA	NA
AUV32631.1|3558578_3559283_-	YggS family pyridoxal phosphate enzyme	NA	NA	NA	NA	NA
AUV32632.1|3559300_3560281_+	type IV pili twitching motility protein PilT	NA	NA	NA	NA	NA
AUV32633.1|3560464_3560881_-	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
AUV32634.1|3560880_3561444_-	YqgE/AlgH family protein	NA	NA	NA	NA	NA
AUV32635.1|3561552_3562503_-	glutathione synthetase	NA	NA	NA	NA	NA
AUV32636.1|3562515_3563247_-	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
AUV32637.1|3563326_3564034_-	endonuclease-1	NA	NA	NA	NA	NA
AUV32638.1|3564128_3564626_-	SprT family protein	NA	NA	NA	NA	NA
AUV32639.1|3564702_3566097_-	galactose-proton symporter	NA	NA	NA	NA	NA
AUV32640.1|3566520_3567849_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
3566441:3566464	attR	TTGCCGGATGCGGCGTGAATGCCT	NA	NA	NA	NA
AUV32641.1|3567971_3569126_-	S-adenosylmethionine synthase	NA	A0A2H4PQS6	Staphylococcus_phage	63.2	4.0e-128
AUV32642.1|3569181_3569433_+	DUF2684 domain-containing protein	NA	NA	NA	NA	NA
AUV32643.1|3569429_3569645_-	hypothetical protein	NA	NA	NA	NA	NA
AUV34181.1|3569780_3569912_+	virulence promoting factor	NA	NA	NA	NA	NA
AUV32644.1|3569920_3571897_+	arginine decarboxylase	NA	NA	NA	NA	NA
AUV32645.1|3572033_3572954_+	agmatinase	NA	NA	NA	NA	NA
AUV32646.1|3573159_3573918_-|protease	metalloprotease	protease	NA	NA	NA	NA
>prophage 16
CP026202	Escherichia coli strain ECONIH5 chromosome, complete genome	5103533	3789178	3802361	5103533		Escherichia_phage(50.0%)	12	NA	NA
AUV32827.1|3789178_3789940_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	48.0	3.4e-59
AUV32828.1|3789933_3790560_+	protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	49.7	5.7e-36
AUV32829.1|3790699_3791839_+	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	35.6	1.7e-06
AUV32830.1|3791901_3792894_+	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	6.1e-32
AUV32831.1|3792987_3794352_-	GntP family transporter	NA	NA	NA	NA	NA
AUV32832.1|3794440_3795217_-	hypothetical protein	NA	NA	NA	NA	NA
AUV32833.1|3795221_3795860_-	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
AUV32834.1|3795856_3797119_-	3-oxo-tetronate kinase	NA	A0A077SLJ7	Escherichia_phage	61.4	1.3e-135
AUV32835.1|3797115_3798024_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
AUV32836.1|3798219_3798987_+	DeoR family transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.3	7.4e-70
AUV32837.1|3799037_3799694_-	serine/threonine protein phosphatase	NA	A0A222YWF0	Escherichia_phage	45.3	5.2e-48
AUV32838.1|3799799_3802361_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	1.7e-30
>prophage 17
CP026202	Escherichia coli strain ECONIH5 chromosome, complete genome	5103533	3839261	3896265	5103533	integrase,tRNA,transposase	Human_immunodeficiency_virus(13.33%)	54	3884506:3884565	3898458:3899506
AUV32872.1|3839261_3841892_+|tRNA	alanine--tRNA ligase	tRNA	A0A2K9L1X7	Tupanvirus	38.6	5.5e-80
AUV32873.1|3842126_3842312_+	carbon storage regulator	NA	A0A2I7RT00	Vibrio_phage	66.7	4.9e-12
AUV32874.1|3843769_3844336_+	fructose-1-phosphate/6-phosphogluconate phosphatase	NA	NA	NA	NA	NA
AUV32875.1|3844332_3844761_+	hypothetical protein	NA	NA	NA	NA	NA
AUV32876.1|3844833_3846390_+	glutamate--cysteine ligase	NA	NA	NA	NA	NA
AUV32877.1|3846539_3847055_+	S-ribosylhomocysteine lyase	NA	NA	NA	NA	NA
AUV32878.1|3847118_3848657_-	multidrug effux MFS transporter subunit EmrB	NA	NA	NA	NA	NA
AUV32879.1|3848673_3849846_-	multidrug export protein EmrA	NA	NA	NA	NA	NA
AUV32880.1|3849972_3850503_-	transcriptional regulator	NA	NA	NA	NA	NA
AUV32881.1|3850593_3850929_-	L-valine transporter subunit YgaH	NA	NA	NA	NA	NA
AUV32882.1|3850918_3851656_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
AUV32883.1|3851779_3852964_-	MFS transporter	NA	NA	NA	NA	NA
AUV32884.1|3853029_3853224_+	hypothetical protein	NA	NA	NA	NA	NA
AUV32885.1|3853255_3854248_-	glycine betaine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUV32886.1|3854305_3855370_-	proline/glycine betaine ABC transporter permease ProW	NA	NA	NA	NA	NA
AUV32887.1|3855362_3856565_-	glycine betaine/L-proline ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	39.4	3.8e-28
AUV32888.1|3856919_3857879_-	ribonucleoside-diphosphate reductase 2 subunit beta	NA	R4TBI6	Mycobacterium_phage	71.8	3.5e-133
AUV32889.1|3857888_3860033_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	A8E2R1	Enterococcus_phage	48.4	2.2e-196
AUV32890.1|3860005_3860416_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A142F1R4	Bacillus_phage	44.4	4.6e-18
AUV32891.1|3860412_3860658_-	NrdH-redoxin	NA	Q5K5J3	Oenococcus_phage	35.3	1.8e-06
AUV32892.1|3860905_3861235_-	DUF883 domain-containing protein	NA	NA	NA	NA	NA
AUV32893.1|3861386_3861731_+	hypothetical protein	NA	NA	NA	NA	NA
AUV32894.1|3861767_3862217_-	L-alanine exporter AlaE	NA	NA	NA	NA	NA
AUV32895.1|3862885_3863290_+	DNA-binding protein StpA	NA	NA	NA	NA	NA
AUV32896.1|3863336_3863861_-	rhodanese-like domain-containing protein YgaP	NA	NA	NA	NA	NA
AUV32897.1|3863870_3864170_-	transcriptional regulator	NA	NA	NA	NA	NA
AUV32898.1|3864352_3864511_+	YqaE/Pmp3 family membrane protein	NA	NA	NA	NA	NA
AUV32899.1|3864594_3865044_+	peptidoglycan-binding protein LysM	NA	A0A090DBR9	Clostridium_phage	39.5	2.0e-06
AUV32900.1|3865044_3865707_-	transcriptional regulator	NA	NA	NA	NA	NA
AUV32901.1|3865727_3867128_-	GABA permease	NA	NA	NA	NA	NA
AUV32902.1|3867365_3868646_-	4-aminobutyrate--2-oxoglutarate transaminase	NA	A0A1V0SKB7	Klosneuvirus	30.1	1.4e-33
AUV32903.1|3868659_3870108_-	succinate-semialdehyde dehydrogenase I	NA	NA	NA	NA	NA
AUV32904.1|3870130_3871399_-	L-2-hydroxyglutarate oxidase	NA	NA	NA	NA	NA
AUV32905.1|3871418_3872396_-	carbon starvation induced protein	NA	NA	NA	NA	NA
AUV32906.1|3872631_3873654_+|transposase	IS110 family transposase IS5708	transposase	NA	NA	NA	NA
AUV34192.1|3874667_3874799_+	sugar kinase	NA	Q6QLL3	Human_immunodeficiency_virus	94.7	4.1e-13
AUV32907.1|3874836_3875853_-|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.7	9.8e-187
AUV34193.1|3877512_3877710_+	hypothetical protein	NA	NA	NA	NA	NA
AUV32908.1|3877998_3878322_-	hypothetical protein	NA	NA	NA	NA	NA
AUV32909.1|3879925_3880303_+	hypothetical protein	NA	NA	NA	NA	NA
AUV32910.1|3880402_3881194_+	hypothetical protein	NA	NA	NA	NA	NA
AUV34194.1|3881424_3881622_-	hypothetical protein	NA	NA	NA	NA	NA
AUV32911.1|3881557_3881767_+	DNA invertase	NA	A0A1S6L009	Salmonella_phage	68.1	1.3e-08
AUV32912.1|3881821_3881980_+	glyoxalase	NA	NA	NA	NA	NA
AUV32913.1|3883209_3884235_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
3884506:3884565	attL	TGAATAAATCGAACTTTTGCTGAGTTGAAGGATCAGATCACGTATCTTCCCGACAACGCA	NA	NA	NA	NA
AUV32914.1|3884529_3885498_+|transposase	IS5-like element IS903B family transposase	transposase	A0A1B0VFY5	Salmonella_phage	99.7	2.1e-186
AUV32915.1|3885626_3886643_+|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.7	9.8e-187
AUV34195.1|3886680_3886833_-	sugar kinase	NA	Q6QLL3	Human_immunodeficiency_virus	97.2	1.4e-12
AUV32916.1|3890938_3891469_+	hypothetical protein	NA	NA	NA	NA	NA
AUV32917.1|3891479_3892820_+	adenylate/guanylate cyclase domain-containing protein	NA	NA	NA	NA	NA
AUV32918.1|3893115_3893961_+	hypothetical protein	NA	NA	NA	NA	NA
AUV32919.1|3894237_3894444_+	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
AUV32920.1|3894465_3894780_+	hypothetical protein	NA	NA	NA	NA	NA
AUV32921.1|3895062_3896265_+|integrase	integrase	integrase	NA	NA	NA	NA
3898458:3899506	attR	TGCGTTGTCGGGAAGATACGTGATCTGATCCTTCAACTCAGCAAAAGTTCGATTTATTCAACAAAGCCATTTTTTTCTTCAAGTAGATGCCAGAGTCAGAATTCAGGATTCCCTTGCAATCAATGTATATTTTTTATTCCGATTGATCGCAGTGAGGTGAATCAACTATGAATAATATTATTTTGTTCAAATCAAAAAAACATATTCTTGTAGAAGAAAATTATAATGAGTTCATAAAATTTTGTCGCTATCAACTGTCCGGACTAACCCAAACTCAGGATTGGGAGCAGTATGCCTGGAAAGGATATGTCACATTTAGAAAAATAGGGATTGGAAATAAAATCTTTGATTCCATTGATGCAATGCACGAAGATTATATCAATTTTGCGAAAGCATATATCAGATATCAACACACATTGAAACCATTAAAAAATTATGGGGTTATTATGATGGCCTTGCGATGTCTCGAACAGGCCCTTTTGCAGGTTCAGAACACTGGTCTCATTTATAATGTTACAGCCGTTGTTTTCGATGAGGCAATGCAGATCGGGAGTAAATATTTTGAAGGTAACGTTTTGGCTAAATGTGGAATACAGCTTGAAAAAATATCAAAGTTTCTGTGTGAACATAATCTTGTGAAGTCAGGATATATCTCATGGAAAAACCATGTAAAACAGAAAGTCAAAAACAATTATCTTCCTGAGATTGAGGATTATCACCGAAGCGATAAGTTACCAGATGAAGAAGCATTGCTCGCTATTGCTGATATTTTTTCTCAAAATGATGAGTTACTGAGTCCAAGGGATAAGTTCACCAGTTCAGTATTTGCACTTCTACTTTGTTGTCCGAGCAGAATTTCTGAAATTTTAGCCTTACCTGCTGATTGTGAGATTACACAAATAGATGGCAAGGGTATCGAAAGATATGGTTTGAGATTTTATTCGGTAAAAGGGTATGGCCCTAATATCAAATGGATTCCACGGGTTATGATACCAGTTGCAAAGAAAGCGATTAGAAGATTACTTTCCTTATCACAAAATGCAAGAGCA	NA	NA	NA	NA
>prophage 18
CP026202	Escherichia coli strain ECONIH5 chromosome, complete genome	5103533	4009880	4097830	5103533	head,terminase,protease,capsid,portal,tail,tRNA	Escherichia_phage(20.69%)	96	NA	NA
AUV33023.1|4009880_4010621_+|tRNA	tRNA (cytosine(32)/uridine(32)-2'-O)-methyltransferase TrmJ	tRNA	NA	NA	NA	NA
AUV33024.1|4010890_4011379_+	Fe-S cluster assembly transcriptional regulator IscR	NA	NA	NA	NA	NA
AUV33025.1|4011490_4012705_+	IscS subfamily cysteine desulfurase	NA	A0A1X7C038	Faustovirus	31.8	8.8e-33
AUV33026.1|4012732_4013119_+	iron-sulfur cluster scaffold-like protein	NA	A0A218MKD1	uncultured_virus	78.9	1.4e-53
AUV33027.1|4013135_4013459_+	iron-sulfur cluster assembly accessory protein	NA	A0A2H4N7N5	Lake_Baikal_phage	48.6	5.4e-22
AUV33028.1|4013554_4014070_+	co-chaperone protein HscB	NA	NA	NA	NA	NA
AUV33029.1|4014086_4015937_+	molecular chaperone HscA	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	41.6	5.5e-103
AUV33030.1|4015938_4016274_+	ISC system 2Fe-2S type ferredoxin	NA	NA	NA	NA	NA
AUV33031.1|4016285_4016486_+	Fe-S assembly protein IscX	NA	NA	NA	NA	NA
AUV33032.1|4016663_4017947_+	aminopeptidase PepB	NA	Q6GYZ8	Mycoplasma_phage	37.8	9.9e-35
AUV33033.1|4018088_4018865_+	enhanced serine sensitivity protein SseB	NA	NA	NA	NA	NA
AUV33034.1|4019358_4020204_-	sulfurtransferase	NA	NA	NA	NA	NA
AUV33035.1|4020410_4025372_+	alpha-2-macroglobulin family protein	NA	NA	NA	NA	NA
AUV33036.1|4025372_4027685_+	penicillin-binding protein 1C	NA	NA	NA	NA	NA
AUV33037.1|4027833_4028265_+	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	37.9	3.7e-18
AUV33038.1|4028414_4029569_+|tRNA	bifunctional tRNA (adenosine(37)-C2)-methyltransferase TrmG/ribosomal RNA large subunit methyltransferase RlmN	tRNA	NA	NA	NA	NA
AUV33039.1|4029853_4030867_+	cytoskeleton protein RodZ	NA	NA	NA	NA	NA
AUV33040.1|4030893_4032012_+	4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin)	NA	NA	NA	NA	NA
AUV33041.1|4032122_4033397_+|tRNA	histidine--tRNA ligase	tRNA	NA	NA	NA	NA
AUV33042.1|4033414_4034035_+	hypothetical protein	NA	NA	NA	NA	NA
AUV33043.1|4034045_4035224_+	outer membrane protein assembly factor BamB	NA	NA	NA	NA	NA
AUV33044.1|4035341_4036814_+	ribosome biogenesis GTPase Der	NA	NA	NA	NA	NA
AUV33045.1|4036883_4037099_+	hypothetical protein	NA	NA	NA	NA	NA
AUV33046.1|4037095_4038466_-	exodeoxyribonuclease VII large subunit	NA	A0A2H4UVM9	Bodo_saltans_virus	35.8	4.0e-42
AUV33047.1|4038627_4040094_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	39.1	2.3e-88
AUV33048.1|4040162_4041740_+	GMP synthase (glutamine-hydrolyzing)	NA	NA	NA	NA	NA
AUV33049.1|4041832_4042372_-	hypothetical protein	NA	G9L6F0	Escherichia_phage	98.9	1.4e-43
AUV33050.1|4042387_4042906_-	hypothetical protein	NA	G9L6F1	Escherichia_phage	99.4	2.9e-62
AUV33051.1|4043008_4043155_-	succinate dehydrogenase	NA	NA	NA	NA	NA
AUV33052.1|4043216_4043408_-	DUF2633 domain-containing protein	NA	G9L6F2	Escherichia_phage	100.0	7.3e-27
AUV33053.1|4043425_4043578_+	hypothetical protein	NA	G9L6F3	Escherichia_phage	96.0	1.7e-18
AUV33054.1|4043759_4046003_+	sensor domain-containing phosphodiesterase	NA	NA	NA	NA	NA
AUV33055.1|4046168_4046489_-	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	74.5	4.6e-42
AUV33056.1|4046882_4047470_+	hypothetical protein	NA	NA	NA	NA	NA
AUV33057.1|4047540_4047801_-	hypothetical protein	NA	NA	NA	NA	NA
AUV33058.1|4047793_4050352_-	hypothetical protein	NA	U5PSK6	Bacillus_phage	47.2	2.0e-34
AUV33059.1|4050405_4053495_-	kinase	NA	A0A286S259	Klebsiella_phage	52.6	1.4e-305
AUV33060.1|4053491_4053872_-	nitrite transporter	NA	A0A286S2A6	Klebsiella_phage	74.6	9.1e-53
AUV33061.1|4054079_4054634_-	hypothetical protein	NA	NA	NA	NA	NA
AUV33062.1|4054689_4055178_-	ArsR family transcriptional regulator	NA	A0A286S2B1	Klebsiella_phage	68.2	1.0e-56
AUV33063.1|4055174_4055642_-	hypothetical protein	NA	A0A286S298	Klebsiella_phage	58.3	9.8e-49
AUV33064.1|4055646_4059114_-|tail	phage tail tape measure protein	tail	A0A2H4JHR1	uncultured_Caudovirales_phage	82.7	3.1e-248
AUV33065.1|4059203_4059623_+	hypothetical protein	NA	NA	NA	NA	NA
AUV33066.1|4059643_4059922_-	DUF4035 domain-containing protein	NA	Q9MCS5	Enterobacteria_phage	96.7	2.4e-42
AUV33067.1|4059930_4060314_-|tail	phage tail protein	tail	K7PKV6	Enterobacterial_phage	92.9	2.2e-62
AUV33068.1|4060322_4060766_-	hypothetical protein	NA	K7PHL2	Enterobacterial_phage	92.4	3.9e-71
AUV33069.1|4060825_4061173_-	DUF3168 domain-containing protein	NA	K7PM93	Enterobacterial_phage	96.5	5.5e-57
AUV33070.1|4061169_4061619_-	hypothetical protein	NA	K7PH04	Enterobacteria_phage	94.6	1.8e-71
AUV33071.1|4061615_4061954_-|head,tail	head-tail adaptor protein	head,tail	A0A2H4JHK5	uncultured_Caudovirales_phage	71.4	2.7e-40
AUV33072.1|4061962_4062283_-|head,tail	phage gp6-like head-tail connector protein	head,tail	Q8SBH7	Shigella_phage	44.1	6.3e-15
AUV33073.1|4062279_4062510_-	hypothetical protein	NA	NA	NA	NA	NA
AUV33074.1|4062548_4063757_-|capsid	phage major capsid protein	capsid	A0A192Y5T6	Salmonella_phage	82.2	5.8e-186
AUV33075.1|4063770_4064424_-|head,protease	HK97 family phage prohead protease	head,protease	Q8W628	Enterobacteria_phage	86.0	3.5e-105
AUV33076.1|4064410_4065640_-|portal	phage portal protein	portal	U5P411	Shigella_phage	82.9	3.3e-205
AUV33077.1|4065639_4065825_-	hypothetical protein	NA	A0A1B5FP99	Escherichia_phage	57.6	2.9e-12
AUV33078.1|4065835_4067593_-|terminase	terminase large subunit	terminase	A0A1B5FP96	Escherichia_phage	89.6	0.0e+00
AUV33079.1|4067592_4068090_-|terminase	phage terminase small subunit P27 family	terminase	K7PHI2	Enterobacteria_phage	73.3	6.3e-62
AUV33080.1|4068282_4068483_-	hypothetical protein	NA	Q6UAR8	Klebsiella_phage	89.4	1.7e-10
AUV33081.1|4068479_4068830_-	HNH endonuclease	NA	A0A1B5FP94	Escherichia_phage	81.6	1.2e-51
AUV33082.1|4068986_4069880_-|protease	serine protease	protease	S5FV10	Shigella_phage	70.7	8.3e-73
AUV33083.1|4069946_4070174_-	hypothetical protein	NA	NA	NA	NA	NA
AUV33084.1|4070261_4070777_-	hypothetical protein	NA	K7PHH7	Enterobacteria_phage	89.5	1.7e-78
AUV33085.1|4070773_4071310_-	lysozyme	NA	K7PM52	Enterobacteria_phage	90.8	4.1e-91
AUV33086.1|4071309_4071612_-	hypothetical protein	NA	O64361	Escherichia_phage	67.3	1.8e-32
AUV33087.1|4071680_4072733_-	DNA adenine methylase	NA	A5LH81	Enterobacteria_phage	81.7	1.5e-174
AUV33088.1|4073059_4073539_+	hypothetical protein	NA	F1C594	Cronobacter_phage	55.7	5.9e-41
AUV33089.1|4073660_4074353_-	antitermination protein	NA	NA	NA	NA	NA
AUV33090.1|4074374_4075436_-	hypothetical protein	NA	A0A291AWV9	Escherichia_phage	55.7	1.7e-112
AUV33091.1|4075480_4076125_-	phage regulatory protein/antirepressor Ant	NA	G0ZND1	Cronobacter_phage	56.4	1.5e-55
AUV33092.1|4076215_4077550_-	phage N-6-adenine-methyltransferase	NA	Q8HA94	Salmonella_phage	51.0	7.5e-118
AUV33093.1|4077546_4078401_-	GntR family transcriptional regulator	NA	A0A1C9IHW0	Salmonella_phage	82.2	1.5e-55
AUV33094.1|4078390_4078570_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	65.4	7.3e-13
AUV33095.1|4078745_4079309_-	hypothetical protein	NA	S5FXP0	Shigella_phage	27.1	6.5e-07
AUV33096.1|4079340_4079598_-	hypothetical protein	NA	H6WRX5	Salmonella_phage	41.1	3.5e-08
AUV33097.1|4079667_4080387_+	XRE family transcriptional regulator	NA	S5FUZ3	Shigella_phage	34.7	1.8e-25
AUV34201.1|4080631_4080997_+|protease	Clp protease	protease	A0A1C9IHZ4	Salmonella_phage	51.6	9.7e-12
AUV33098.1|4081339_4082257_+	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	64.0	1.7e-105
AUV33099.1|4082365_4082905_+	hypothetical protein	NA	A0A192Y8M4	Salmonella_phage	69.3	5.9e-66
AUV33100.1|4083065_4083320_+	hypothetical protein	NA	NA	NA	NA	NA
AUV33101.1|4083316_4083634_+	hypothetical protein	NA	A0A222YY67	Escherichia_phage	61.2	2.1e-34
AUV33102.1|4083630_4083987_+	hypothetical protein	NA	NA	NA	NA	NA
AUV33103.1|4083979_4084249_+	hypothetical protein	NA	NA	NA	NA	NA
AUV33104.1|4084673_4084913_+	hypothetical protein	NA	G8C7S3	Escherichia_phage	59.4	3.0e-14
AUV33105.1|4085091_4085664_+	3'-5' exoribonuclease	NA	K7PLW7	Enterobacteria_phage	83.0	2.1e-93
AUV33106.1|4085708_4085918_+	hypothetical protein	NA	NA	NA	NA	NA
AUV33107.1|4085920_4087108_+	recombinase	NA	A0A2D1GN00	Marinobacter_phage	30.0	1.9e-32
AUV33108.1|4087268_4088810_-	exopolyphosphatase	NA	NA	NA	NA	NA
AUV33109.1|4088814_4090881_-	polyphosphate kinase	NA	NA	NA	NA	NA
AUV33110.1|4091051_4091690_-	phosphoribosylglycinamide formyltransferase	NA	E3SNR5	Prochlorococcus_phage	42.9	2.4e-29
AUV33111.1|4091689_4092727_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A1D7SE90	Cyanophage	43.3	1.1e-71
AUV33112.1|4092745_4092931_-	hypothetical protein	NA	NA	NA	NA	NA
AUV33113.1|4093051_4093678_+	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
AUV33114.1|4093763_4095053_+	uracil/xanthine transporter	NA	Q9KX94	Enterobacteria_phage	37.4	5.1e-63
AUV33115.1|4095102_4095849_+	DnaA inactivator Hda	NA	NA	NA	NA	NA
AUV33116.1|4095986_4096346_-	arsenate reductase (glutaredoxin)	NA	NA	NA	NA	NA
AUV33117.1|4096366_4097830_-|protease	beta-barrel assembly-enhancing protease	protease	NA	NA	NA	NA
>prophage 19
CP026202	Escherichia coli strain ECONIH5 chromosome, complete genome	5103533	4478672	4488113	5103533		Enterobacteria_phage(85.71%)	10	NA	NA
AUV33455.1|4478672_4479599_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.8	1.7e-23
AUV33456.1|4479603_4480335_+	osmoprotectant uptake system permease	NA	NA	NA	NA	NA
AUV33457.1|4480315_4480423_-	hypothetical protein	NA	NA	NA	NA	NA
AUV33458.1|4480482_4481214_-	transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
AUV33459.1|4481435_4483121_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	99.5	7.3e-304
AUV33460.1|4483117_4483837_+	DNA-binding response regulator	NA	NA	NA	NA	NA
AUV33461.1|4483883_4484354_+	DUF1456 domain-containing protein	NA	Q9EYF4	Enterobacteria_phage	100.0	5.2e-82
AUV33462.1|4484393_4484855_-	hypothetical protein	NA	Q9EYF5	Enterobacteria_phage	99.3	4.1e-76
AUV33463.1|4484979_4486980_-	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	95.5	0.0e+00
AUV33464.1|4486976_4488113_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.4	3.2e-162
>prophage 20
CP026202	Escherichia coli strain ECONIH5 chromosome, complete genome	5103533	4746275	4807143	5103533	tRNA,transposase	Salmonella_phage(23.53%)	56	NA	NA
AUV33681.1|4746275_4747244_-|transposase	IS5-like element IS903B family transposase	transposase	A0A1B0VFY5	Salmonella_phage	99.7	2.1e-186
AUV33682.1|4747549_4747900_+	flagellar transcriptional activator FlhD	NA	NA	NA	NA	NA
AUV33683.1|4747902_4748481_+	flagellar transcriptional regulator FlhC	NA	NA	NA	NA	NA
AUV33684.1|4748607_4749495_+	flagellar motor stator protein MotA	NA	NA	NA	NA	NA
AUV33685.1|4749491_4750418_+	motility protein B	NA	NA	NA	NA	NA
AUV33686.1|4750422_4752387_+	chemotaxis protein CheA	NA	NA	NA	NA	NA
AUV33687.1|4752407_4752911_+	chemotaxis protein CheW	NA	NA	NA	NA	NA
AUV33688.1|4753055_4754717_+	methyl-accepting chemotaxis protein II	NA	A0A2H4J162	uncultured_Caudovirales_phage	38.4	7.6e-11
AUV33689.1|4754762_4756364_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	29.7	8.3e-15
AUV33690.1|4756382_4757243_+	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
AUV33691.1|4757245_4758295_+	chemotaxis response regulator protein-glutamate methylesterase	NA	Q56AR1	Bacillus_thuringiensis_phage	32.8	1.0e-05
AUV33692.1|4758309_4758699_+	two-component system response regulator	NA	A0A2K9L4R0	Tupanvirus	32.0	1.3e-06
AUV33693.1|4758709_4759354_+	protein phosphatase CheZ	NA	NA	NA	NA	NA
AUV33694.1|4759555_4760704_+	flagellar type III secretion system protein FlhB	NA	NA	NA	NA	NA
AUV33695.1|4760696_4762775_+	flagellar biosynthesis protein FlhA	NA	NA	NA	NA	NA
AUV33696.1|4762774_4763167_+	flagellar protein FlhE	NA	NA	NA	NA	NA
AUV33697.1|4763287_4763776_-	DUF1311 domain-containing protein	NA	NA	NA	NA	NA
AUV33698.1|4763952_4765686_-|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.7	8.8e-87
AUV33699.1|4765901_4766468_+	VOC family protein	NA	NA	NA	NA	NA
AUV33700.1|4766481_4767228_+	copper homeostasis protein CutC	NA	NA	NA	NA	NA
AUV33701.1|4767615_4768716_+	cytochrome C	NA	NA	NA	NA	NA
AUV33702.1|4768740_4771170_+	molybdopterin guanine dinucleotide-containing S/N-oxide reductase	NA	NA	NA	NA	NA
AUV33703.1|4771334_4772306_-|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
AUV33704.1|4772302_4773046_-	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	30.0	3.5e-24
AUV33705.1|4773086_4773482_-	hypothetical protein	NA	NA	NA	NA	NA
AUV33706.1|4773534_4774353_-	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	98.4	2.5e-71
AUV33707.1|4774349_4774916_-	hydrolase	NA	NA	NA	NA	NA
AUV33708.1|4775225_4776998_+|tRNA	aspartate--tRNA ligase	tRNA	NA	NA	NA	NA
AUV33709.1|4777115_4777568_+	NUDIX pyrophosphatase	NA	NA	NA	NA	NA
AUV33710.1|4777596_4778337_+	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
AUV33711.1|4778371_4778893_+	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	35.1	2.0e-10
AUV33712.1|4778894_4779497_-	hypothetical protein	NA	NA	NA	NA	NA
AUV34224.1|4779567_4779633_+	hypothetical protein	NA	NA	NA	NA	NA
AUV33713.1|4779771_4780383_+	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
AUV33714.1|4780391_4781402_+	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	25.5	5.6e-09
AUV33715.1|4781548_4782334_-	zinc ABC transporter permease	NA	NA	NA	NA	NA
AUV33716.1|4782330_4783086_-	Mn2+/Zn2+ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	28.3	1.3e-18
AUV34225.1|4783164_4784097_+	zinc ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUV33717.1|4784112_4785435_+	murein DD-endopeptidase MepM	NA	A8ATH6	Listeria_phage	40.9	1.2e-14
AUV33718.1|4785554_4786526_+	lauroyl-Kdo(2)-lipid IV(A) myristoyltransferase	NA	NA	NA	NA	NA
AUV33719.1|4786614_4787388_-	glycosyl hydrolase family 38	NA	NA	NA	NA	NA
AUV33720.1|4787431_4788400_-|transposase	IS5-like element IS903B family transposase	transposase	A0A1B0VFY5	Salmonella_phage	99.7	2.1e-186
AUV33721.1|4788948_4790817_-	glycosyl hydrolase	NA	NA	NA	NA	NA
AUV33722.1|4790904_4791420_-	cymJ protein	NA	NA	NA	NA	NA
AUV33723.1|4791589_4792558_-|transposase	IS5-like element IS903B family transposase	transposase	A0A1B0VFY5	Salmonella_phage	99.7	2.1e-186
AUV33724.1|4792579_4792780_-	TrmB family transcriptional regulator	NA	NA	NA	NA	NA
AUV33725.1|4793187_4794315_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.5	3.6e-20
AUV33726.1|4794397_4794886_-	glycosidase	NA	NA	NA	NA	NA
AUV33727.1|4794970_4795927_-	UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase	NA	NA	NA	NA	NA
AUV33728.1|4795945_4796983_-	porin	NA	NA	NA	NA	NA
AUV33729.1|4797255_4798488_+	maltose ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUV34226.1|4798732_4798909_+	hypothetical protein	NA	Q76S41	Shigella_phage	63.5	5.2e-11
AUV33730.1|4798918_4799887_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
AUV33731.1|4802395_4803133_+	maltose ABC transporter permease	NA	NA	NA	NA	NA
AUV33732.1|4804830_4805799_+|transposase	IS5-like element IS903B family transposase	transposase	A0A1B0VFY5	Salmonella_phage	99.7	2.1e-186
AUV33733.1|4806117_4807143_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
>prophage 1
CP026208	Escherichia coli strain ECONIH5 plasmid pECO-109b, complete sequence	298633	218169	249581	298633	transposase	Escherichia_phage(33.33%)	23	NA	NA
AUV35109.1|218169_219246_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
AUV35110.1|219778_221818_-	ATP-dependent helicase	NA	E3T5J8	Cafeteria_roenbergensis_virus	26.4	4.6e-26
AUV35111.1|222958_223663_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AUV35112.1|223608_223824_-	hypothetical protein	NA	NA	NA	NA	NA
AUV35113.1|227603_227804_-	glycogen synthesis protein GlgS	NA	NA	NA	NA	NA
AUV35114.1|228104_229073_-|transposase	IS5-like element IS903B family transposase	transposase	A0A1B0VFY5	Salmonella_phage	99.1	1.0e-185
AUV35115.1|229444_231637_+	1,4-alpha-glucan branching enzyme	NA	NA	NA	NA	NA
AUV35116.1|231766_233050_+	glucose-1-phosphate adenylyltransferase	NA	NA	NA	NA	NA
AUV35117.1|233138_234572_+	glycogen synthase GlgA	NA	NA	NA	NA	NA
AUV35118.1|234590_237038_+	glycogen phosphorylase	NA	A0A140XAG6	Dickeya_phage	69.2	6.1e-25
AUV35119.1|237151_238795_+	alpha-D-glucose phosphate-specific phosphoglucomutase	NA	A0A1X9I671	Streptococcus_phage	25.0	1.5e-22
AUV35120.1|238919_239486_+	LuxR family transcriptional regulator	NA	NA	NA	NA	NA
AUV35121.1|239820_240099_+	hypothetical protein	NA	NA	NA	NA	NA
AUV35122.1|240338_241736_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
AUV35123.1|241924_242320_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
AUV35191.1|242368_243715_-|transposase	transposase	transposase	NA	NA	NA	NA
AUV35124.1|243945_244887_-	hypothetical protein	NA	NA	NA	NA	NA
AUV35125.1|244896_245085_-	hypothetical protein	NA	NA	NA	NA	NA
AUV35126.1|245121_246522_-|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
AUV35127.1|246799_247057_-	hypothetical protein	NA	NA	NA	NA	NA
AUV35128.1|247039_247267_+	hypothetical protein	NA	NA	NA	NA	NA
AUV35129.1|247371_248469_+	hypothetical protein	NA	NA	NA	NA	NA
AUV35130.1|248600_249581_-|transposase	IS5/IS1182 family transposase	transposase	Q38213	Escherichia_phage	98.5	6.8e-185
>prophage 1
CP026203	Escherichia coli strain ECONIH5 plasmid pECO-a7e8, complete sequence	35036	668	11960	35036	transposase	Salmonella_phage(25.0%)	11	NA	NA
AUV34247.1|668_1373_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AUV34277.1|1406_1523_-	sugar kinase	NA	Q6QLL3	Human_immunodeficiency_virus	91.2	4.9e-10
AUV34248.1|1623_2481_-	RNA polymerase sigma factor RpoH	NA	A0A248SJA5	Salicola_phage	39.9	1.9e-45
AUV34249.1|2578_3547_+|transposase	IS5/IS1182 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	91.6	1.7e-172
AUV34250.1|4571_6062_+	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	82.2	8.6e-224
AUV34251.1|6096_6954_+	universal stress protein	NA	A0A2H4J154	uncultured_Caudovirales_phage	48.4	6.6e-67
AUV34252.1|7044_7377_+	conjugal transfer protein TraR	NA	NA	NA	NA	NA
AUV34253.1|7494_8115_-	recombinase family protein	NA	E5FFF9	Burkholderia_phage	37.1	1.1e-26
AUV34254.1|8284_8545_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
AUV34255.1|8544_8856_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
AUV34256.1|8879_11960_+|transposase	DDE transposase	transposase	A0A1B0V7H9	Salmonella_phage	30.6	8.2e-51
>prophage 2
CP026203	Escherichia coli strain ECONIH5 plasmid pECO-a7e8, complete sequence	35036	26494	34604	35036	transposase,integrase	Escherichia_phage(50.0%)	8	18482:18494	27716:27728
18482:18494	attL	TATCGCTTTTGCC	NA	NA	NA	NA
AUV34269.1|26494_27271_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	92.9	6.4e-53
AUV34270.1|27328_27586_-	hypothetical protein	NA	NA	NA	NA	NA
AUV34271.1|28353_29220_+	RepB family plasmid replication initiator protein	NA	A0A222YYK1	Escherichia_phage	31.1	1.5e-23
27716:27728	attR	TATCGCTTTTGCC	NA	NA	NA	NA
AUV34272.1|29540_29810_-	hypothetical protein	NA	NA	NA	NA	NA
AUV34273.1|30224_31430_+	ParA family protein	NA	A0A077SL49	Escherichia_phage	69.6	2.4e-163
AUV34274.1|31426_32404_+	chromosome partitioning protein ParB	NA	Q38420	Escherichia_phage	54.4	2.6e-88
AUV34279.1|32485_33187_-	translesion error-prone DNA polymerase V subunit UmuC	NA	F1C5A5	Cronobacter_phage	64.5	2.2e-81
AUV34275.1|33635_34604_+|transposase	IS5-like element IS903B family transposase	transposase	A0A1B0VFY5	Salmonella_phage	98.8	1.1e-184
>prophage 1
CP026206	Escherichia coli strain ECONIH5 plasmid pECO-cbb3, complete sequence	191344	4348	113647	191344	transposase,protease	Escherichia_phage(22.58%)	111	NA	NA
AUV34450.1|4348_5053_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AUV34451.1|5317_6463_+	ABC transporter permease	NA	NA	NA	NA	NA
AUV34636.1|6459_7260_+	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	27.7	1.8e-10
AUV34452.1|7261_8200_+	MCE family protein	NA	NA	NA	NA	NA
AUV34453.1|8199_8841_+	ABC transporter	NA	NA	NA	NA	NA
AUV34454.1|9188_10466_+	serine dehydratase subunit alpha family protein	NA	NA	NA	NA	NA
AUV34455.1|11829_12912_+	murein transglycosylase B	NA	NA	NA	NA	NA
AUV34456.1|13492_14926_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	50.6	7.0e-106
AUV34457.1|14959_16168_-	restriction endonuclease	NA	E5E3X4	Burkholderia_phage	42.5	1.2e-34
AUV34458.1|16792_17497_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.1	2.6e-138
AUV34459.1|17597_17834_-	mercury resistance protein	NA	NA	NA	NA	NA
AUV34460.1|17830_18196_-	transcriptional regulator	NA	NA	NA	NA	NA
AUV34461.1|18213_19896_-	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.8	1.9e-38
AUV34462.1|19934_20342_-	mercury transport protein MerC	NA	NA	NA	NA	NA
AUV34463.1|20369_20645_-	mercuric transporter periplasmic component	NA	NA	NA	NA	NA
AUV34464.1|20660_21011_-	mercuric transporter	NA	NA	NA	NA	NA
AUV34465.1|21082_21538_+	Hg(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
AUV34466.1|21902_22193_+	nucleotidyltransferase	NA	NA	NA	NA	NA
AUV34467.1|22189_22591_+	DUF86 domain-containing protein	NA	NA	NA	NA	NA
AUV34468.1|22580_22937_+	cupin domain-containing protein	NA	NA	NA	NA	NA
AUV34469.1|23191_23506_+	hypothetical protein	NA	NA	NA	NA	NA
AUV34470.1|23678_24212_-	phospholipase D family protein	NA	A0A1B2LRT6	Wolbachia_phage	33.9	5.8e-21
AUV34471.1|24529_25234_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	5.3e-139
AUV34472.1|25224_25419_+	replication initiator protein	NA	NA	NA	NA	NA
AUV34473.1|25490_25706_+	hypothetical protein	NA	NA	NA	NA	NA
AUV34474.1|25710_25929_+	hypothetical protein	NA	NA	NA	NA	NA
AUV34475.1|26046_26757_+	type VI secretion protein	NA	NA	NA	NA	NA
AUV34476.1|26753_27059_+	TriB protein	NA	NA	NA	NA	NA
AUV34477.1|27071_29810_+	ATPase	NA	NA	NA	NA	NA
AUV34478.1|29827_30535_+	type IV secretion system protein VirB5	NA	NA	NA	NA	NA
AUV34479.1|30542_30785_+	hypothetical protein	NA	NA	NA	NA	NA
AUV34480.1|30788_31862_+	conjugal transfer protein TrbL	NA	NA	NA	NA	NA
AUV34481.1|32082_32766_+	type IV secretion system protein	NA	NA	NA	NA	NA
AUV34482.1|32762_33671_+	P-type conjugative transfer protein VirB9	NA	NA	NA	NA	NA
AUV34483.1|33706_34957_+	type VI secretion protein	NA	NA	NA	NA	NA
AUV34484.1|34946_35972_+	P-type DNA transfer ATPase VirB11	NA	NA	NA	NA	NA
AUV34485.1|35968_36376_+	Cag pathogenicity island protein Cag12	NA	NA	NA	NA	NA
AUV34486.1|36402_36708_+	conjugal transfer protein	NA	NA	NA	NA	NA
AUV34487.1|36741_37047_+	dpoa decarboxylase	NA	A0A248SL90	Klebsiella_phage	38.4	7.1e-08
AUV34488.1|37478_37775_+	hypothetical protein	NA	NA	NA	NA	NA
AUV34489.1|37824_39561_+	MFS transporter	NA	NA	NA	NA	NA
AUV34490.1|39569_40319_+	molybdopterin-guanine dinucleotide biosynthesis protein MobC	NA	NA	NA	NA	NA
AUV34491.1|40356_40830_+	nuclease	NA	A0A0R6PHV6	Moraxella_phage	40.3	1.3e-19
AUV34492.1|40886_41231_+	hypothetical protein	NA	NA	NA	NA	NA
AUV34493.1|41269_41503_-	hypothetical protein	NA	NA	NA	NA	NA
AUV34494.1|41543_42191_-	chromosome partitioning protein	NA	A0A219YB79	Aeromonas_phage	29.8	4.5e-20
AUV34495.1|42309_43092_-	sprT domain-containing protein	NA	NA	NA	NA	NA
AUV34496.1|43491_43710_+	hypothetical protein	NA	NA	NA	NA	NA
AUV34497.1|43711_44017_+	plasmid maintenance protein CcdB	NA	NA	NA	NA	NA
AUV34498.1|44034_44589_+	DNA primase	NA	NA	NA	NA	NA
AUV34499.1|44867_46550_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	37.4	3.8e-10
AUV34500.1|46668_47115_-	hypothetical protein	NA	NA	NA	NA	NA
AUV34501.1|47105_47810_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AUV34637.1|48593_50654_+|transposase	transposase	transposase	NA	NA	NA	NA
AUV34502.1|50646_52257_+	ATP-binding protein	NA	NA	NA	NA	NA
AUV34503.1|52258_53761_+|transposase	transposase	transposase	NA	NA	NA	NA
AUV34504.1|53753_55376_+|transposase	transposase	transposase	NA	NA	NA	NA
AUV34505.1|56246_56510_+	hypothetical protein	NA	NA	NA	NA	NA
AUV34506.1|56737_57019_+	DNA-binding protein	NA	NA	NA	NA	NA
AUV34507.1|57054_57624_+	Hsp20/alpha crystallin family protein	NA	NA	NA	NA	NA
AUV34508.1|57721_60571_+|protease	ATP-dependent Clp protease ATP-binding subunit	protease	K4FB40	Cronobacter_phage	41.3	1.2e-128
AUV34638.1|60587_62018_+	cardiolipin synthase	NA	NA	NA	NA	NA
AUV34509.1|62045_63875_+	ATP-dependent metallopeptidase FtsH/Yme1/Tma family protein	NA	C7U047	Ostreococcus_tauri_virus	41.5	5.3e-106
AUV34510.1|63953_64412_+	Hsp20/alpha crystallin family protein	NA	NA	NA	NA	NA
AUV34511.1|64433_65342_+	hypothetical protein	NA	NA	NA	NA	NA
AUV34512.1|65444_66332_+	hypothetical protein	NA	NA	NA	NA	NA
AUV34513.1|66421_67033_+	HdeD family acid-resistance protein	NA	NA	NA	NA	NA
AUV34514.1|67870_68782_+	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
AUV34515.1|68856_69561_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AUV34516.1|69963_71355_+	hypothetical protein	NA	NA	NA	NA	NA
AUV34517.1|71351_73430_+	ATPase	NA	NA	NA	NA	NA
AUV34518.1|73441_74146_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AUV34519.1|74731_75685_+	cation transporter	NA	NA	NA	NA	NA
AUV34520.1|75796_76171_+	hypothetical protein	NA	NA	NA	NA	NA
AUV34521.1|76608_77190_+	cytochrome b/b6 domain-containing protein	NA	NA	NA	NA	NA
AUV34522.1|77325_78015_+	VIT family protein	NA	NA	NA	NA	NA
AUV34639.1|78157_78469_-	hypothetical protein	NA	NA	NA	NA	NA
AUV34640.1|78641_78818_+	hypothetical protein	NA	Q76S41	Shigella_phage	63.5	3.9e-11
AUV34523.1|78827_79796_-|transposase	IS110 family transposase	transposase	A0A1S7J231	Thermus_phage	29.1	3.6e-13
AUV34524.1|81006_81222_-	hypothetical protein	NA	NA	NA	NA	NA
AUV34525.1|81220_81406_+	hypothetical protein	NA	NA	NA	NA	NA
AUV34641.1|81715_81841_+	ABC transporter	NA	NA	NA	NA	NA
AUV34526.1|83314_84400_-	alcohol dehydrogenase	NA	NA	NA	NA	NA
AUV34527.1|84433_85591_-	alpha-hydroxy-acid oxidizing protein	NA	NA	NA	NA	NA
AUV34528.1|85587_86754_-	histidinol-phosphate transaminase	NA	A0A1X7QHI1	Faustovirus	27.4	1.5e-18
AUV34529.1|86812_88495_-	urocanate hydratase	NA	NA	NA	NA	NA
AUV34530.1|88538_90089_-	histidine ammonia-lyase	NA	A0A1V0S940	Catovirus	39.1	1.9e-80
AUV34531.1|90203_90989_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.9	3.2e-36
AUV34532.1|90988_91870_-	ABC transporter permease	NA	G3M9Y4	Bacillus_virus	29.7	6.4e-25
AUV34533.1|91881_92868_-	ABC transporter permease	NA	NA	NA	NA	NA
AUV34534.1|93106_93703_-	HutD family protein	NA	NA	NA	NA	NA
AUV34535.1|93699_95073_-	formimidoylglutamate deiminase	NA	NA	NA	NA	NA
AUV34536.1|95313_96114_+	histidine utilization repressor	NA	NA	NA	NA	NA
AUV34537.1|96267_97530_+	imidazolonepropionase	NA	NA	NA	NA	NA
AUV34538.1|97526_98351_+	N-formylglutamate deformylase	NA	NA	NA	NA	NA
AUV34539.1|98582_99260_+	4-carboxymuconolactone decarboxylase	NA	NA	NA	NA	NA
AUV34540.1|99305_100274_-|transposase	IS5/IS1182 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	98.4	4.3e-184
AUV34541.1|100854_101241_+	hypothetical protein	NA	NA	NA	NA	NA
AUV34542.1|101249_101441_+	plasmid stabilization protein	NA	NA	NA	NA	NA
AUV34543.1|102187_103672_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	4.5e-31
AUV34544.1|103671_103923_-	hypothetical protein	NA	NA	NA	NA	NA
AUV34545.1|104077_104503_+	peptidase	NA	A0A1W6JNS2	Morganella_phage	50.4	2.9e-31
AUV34546.1|104502_105774_+	translesion error-prone DNA polymerase V subunit UmuC	NA	F1C5A5	Cronobacter_phage	64.0	8.6e-156
AUV34547.1|105852_106104_+	plasmid stabilization protein	NA	NA	NA	NA	NA
AUV34548.1|106157_106463_+	hypothetical protein	NA	NA	NA	NA	NA
AUV34549.1|106488_106746_+	hypothetical protein	NA	NA	NA	NA	NA
AUV34550.1|107745_108717_-	plasmid-partitioning protein	NA	I3WF22	Macacine_betaherpesvirus	86.3	9.2e-150
AUV34551.1|108716_109883_-	plasmid-partitioning protein SopA	NA	A0A2I6B2X3	Macacine_betaherpesvirus	97.7	3.0e-224
AUV34552.1|110633_111644_+	replication initiation protein	NA	J9Q7H0	Salmonella_phage	54.3	3.0e-87
AUV34642.1|112541_112628_+	ABC transporter	NA	NA	NA	NA	NA
AUV34553.1|112666_113647_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	98.8	5.2e-185
>prophage 2
CP026206	Escherichia coli strain ECONIH5 plasmid pECO-cbb3, complete sequence	191344	119168	176614	191344	transposase,tail,integrase	Escherichia_phage(39.29%)	63	154672:154731	184477:184589
AUV34563.1|119168_120572_+|transposase	ISNCY-like element ISKpn21 family transposase	transposase	NA	NA	NA	NA
AUV34643.1|120600_121233_-	hypothetical protein	NA	NA	NA	NA	NA
AUV34564.1|121468_122869_+|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
AUV34565.1|122905_123094_+	hypothetical protein	NA	NA	NA	NA	NA
AUV34566.1|123103_124045_+	hypothetical protein	NA	NA	NA	NA	NA
AUV34567.1|125380_126085_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.1	2.6e-138
AUV34568.1|126381_127839_-	potassium transporter TrkG	NA	NA	NA	NA	NA
AUV34569.1|128035_128221_-	Spanin from lambdoid prophage Rac, outer membrane subunit	NA	K7PHU6	Enterobacteria_phage	98.2	2.8e-15
AUV34570.1|128643_128808_+	DUF1317 domain-containing protein	NA	A0A1U8QQC1	Enterobacteria_phage	100.0	7.9e-22
AUV34571.1|128780_128972_+	hypothetical protein	NA	A0A0P0ZC67	Stx2-converting_phage	98.4	2.1e-26
AUV34572.1|128982_129264_+	cell division protein ZapA	NA	A0A0P0ZE02	Stx2-converting_phage	100.0	2.5e-47
AUV34573.1|129362_129584_+	conjugal transfer protein TraR	NA	A0A0N7C211	Escherichia_phage	95.9	5.5e-34
AUV34574.1|129580_129832_+	hypothetical protein	NA	A0A0K2FJF6	Enterobacteria_phage	92.3	5.8e-32
AUV34575.1|131038_131377_+	hypothetical protein	NA	A0A0F6TJR3	Escherichia_coli_O157_typing_phage	86.6	6.4e-50
AUV34576.1|131405_131834_+	DUF2513 domain-containing protein	NA	NA	NA	NA	NA
AUV34577.1|131917_132085_+	hypothetical protein	NA	A0A0K2FJ46	Enterobacteria_phage	98.2	4.9e-27
AUV34578.1|132207_133176_-|transposase	IS5/IS1182 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	96.9	1.0e-180
AUV34579.1|133470_134496_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
AUV34580.1|134552_134783_+	excisionase	NA	Q77WA4	Escherichia_phage	100.0	9.1e-32
AUV34581.1|134760_135831_+|integrase	integrase	integrase	Q9MCR4	Enterobacteria_phage	99.4	7.4e-201
AUV34582.1|135993_136470_+	DNA starvation/stationary phase protection protein	NA	G0X506	Salmonella_phage	28.7	6.7e-05
AUV34583.1|136774_137125_-	transcriptional regulator	NA	NA	NA	NA	NA
AUV34584.1|137286_138945_+	CoA-disulfide reductase	NA	NA	NA	NA	NA
AUV34585.1|139190_139655_+	isoprenylcysteine carboxylmethyltransferase family protein	NA	NA	NA	NA	NA
AUV34586.1|139764_139896_+	ABC transporter	NA	NA	NA	NA	NA
AUV34587.1|141190_142213_+|transposase	IS110 family transposase IS5708	transposase	NA	NA	NA	NA
AUV34588.1|142592_144656_-	ATP-binding protein	NA	NA	NA	NA	NA
AUV34589.1|144652_146044_-	hypothetical protein	NA	NA	NA	NA	NA
AUV34590.1|146703_147408_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AUV34644.1|147432_147834_+|tail	tail fiber assembly protein	tail	A0A077SK10	Escherichia_phage	94.4	9.9e-58
AUV34591.1|147837_148209_-	chromosome partitioning protein ParB	NA	A0A2I7RQE2	Vibrio_phage	54.1	7.5e-28
AUV34592.1|148233_148938_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.1	2.6e-138
AUV34645.1|149422_149632_+	hypothetical protein	NA	NA	NA	NA	NA
AUV34593.1|149668_150088_-	transcriptional regulator	NA	A0A222YXG1	Escherichia_phage	31.4	1.8e-06
AUV34594.1|150084_150396_-	type II toxin-antitoxin system HigB family toxin	NA	NA	NA	NA	NA
AUV34595.1|150625_153634_-|transposase	Tn3 family transposase	transposase	Q1MVP5	Enterobacteria_phage	64.6	0.0e+00
AUV34596.1|153914_154619_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AUV34597.1|154564_154762_-	hypothetical protein	NA	NA	NA	NA	NA
154672:154731	attL	TTTTATTATGGTGATCCCCTGGGCGAAATGCGCCTGGTAAGCAGAGTTTTTGAAATGTAA	NA	NA	NA	NA
AUV34598.1|155385_156309_+	aminoimidazole riboside kinase	NA	NA	NA	NA	NA
AUV34599.1|156474_157992_+	porin	NA	NA	NA	NA	NA
AUV34600.1|158129_159500_+	PTS sucrose transporter subunit IIBC	NA	NA	NA	NA	NA
AUV34601.1|159499_160900_+	glycosyl hydrolase family 32	NA	S6ATV4	Bacillus_phage	23.7	7.5e-12
AUV34602.1|160929_161934_+	transcriptional regulator	NA	NA	NA	NA	NA
AUV34603.1|163118_163340_-	hypothetical protein	NA	NA	NA	NA	NA
AUV34604.1|163647_163800_+	UV protection protein	NA	NA	NA	NA	NA
AUV34605.1|163914_164715_-	DsbA family protein	NA	NA	NA	NA	NA
AUV34646.1|164941_165028_+	ABC transporter	NA	NA	NA	NA	NA
AUV34606.1|165341_166035_+|transposase	IS1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	94.8	3.7e-129
AUV34607.1|166216_167239_-	DNA helicase UvrD	NA	NA	NA	NA	NA
AUV34608.1|167223_168786_-	ATP-dependent endonuclease	NA	NA	NA	NA	NA
AUV34609.1|168851_169268_-	PIN domain-containing protein	NA	NA	NA	NA	NA
AUV34610.1|169264_169495_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
AUV34611.1|169478_169913_+	hypothetical protein	NA	NA	NA	NA	NA
AUV34612.1|170056_170407_+	hypothetical protein	NA	NA	NA	NA	NA
AUV34613.1|170549_171158_+	hypothetical protein	NA	NA	NA	NA	NA
AUV34614.1|171225_172008_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	91.1	7.1e-52
AUV34615.1|172145_172421_-	CopG family transcriptional regulator	NA	NA	NA	NA	NA
AUV34616.1|172414_173059_-	chromosome partitioning protein ParA	NA	A0A222YXS3	Escherichia_phage	43.0	1.9e-39
AUV34617.1|173287_174259_+	plasmid segregation protein parM	NA	A0A222YXF2	Escherichia_phage	42.9	1.3e-66
AUV34618.1|174227_174656_+	plasmid stability protein	NA	NA	NA	NA	NA
AUV34619.1|174660_175932_-	translesion error-prone DNA polymerase V subunit UmuC	NA	F1C5A5	Cronobacter_phage	60.5	1.4e-142
AUV34620.1|175931_176369_-	peptidase	NA	A0A1W6JNS2	Morganella_phage	48.4	8.3e-26
AUV34621.1|176365_176614_-	protein ImpC	NA	Q2A098	Sodalis_phage	48.0	1.9e-14
184477:184589	attR	TTACATTTCAAAAACTCTGCTTACCAGGCGCATTTCGCCCAGGGGATCACCATAATAAAATGCTGAGGCCTGGCCTTTGCGTAGTGCACGCATCACCTCAATACCTTTGATGG	NA	NA	NA	NA
>prophage 1
CP026207	Escherichia coli strain ECONIH5 plasmid pECO-dc1b, complete sequence	202687	27781	60440	202687	transposase	Acidithiobacillus_phage(28.57%)	44	NA	NA
AUV34690.1|27781_29347_+|transposase	transposase	transposase	K4I413	Acidithiobacillus_phage	36.6	1.1e-83
AUV34691.1|29336_30077_+	AAA family ATPase	NA	K4HZD4	Acidithiobacillus_phage	45.8	1.4e-52
AUV34692.1|30573_31035_+	DUF1643 domain-containing protein	NA	B5WZV8	Pseudomonas_phage	60.5	1.5e-46
AUV34693.1|31037_31535_+	hypothetical protein	NA	NA	NA	NA	NA
AUV34694.1|31638_31902_+	hypothetical protein	NA	NA	NA	NA	NA
AUV34695.1|32096_33029_+	hypothetical protein	NA	NA	NA	NA	NA
AUV34696.1|33102_34566_+	ATPase	NA	U5XGM6	Phormidium_phage	38.2	2.4e-45
AUV34697.1|34721_35051_+	hypothetical protein	NA	NA	NA	NA	NA
AUV34698.1|35055_35448_+	hypothetical protein	NA	NA	NA	NA	NA
AUV34699.1|35496_35691_+	hypothetical protein	NA	NA	NA	NA	NA
AUV34700.1|35684_36683_+	hypothetical protein	NA	NA	NA	NA	NA
AUV34701.1|36690_37527_-|transposase	IS5 family transposase ISEc61	transposase	NA	NA	NA	NA
AUV34702.1|37764_38079_+	hypothetical protein	NA	NA	NA	NA	NA
AUV34703.1|38092_38887_+	APH(3')-II family aminoglycoside O-phosphotransferase	NA	Q75ZG1	Hepacivirus	74.3	6.4e-109
AUV34704.1|38913_39273_+	BLMT family bleomycin binding protein	NA	NA	NA	NA	NA
AUV34705.1|39203_39392_+	hypothetical protein	NA	NA	NA	NA	NA
AUV34706.1|39435_40383_+|transposase	IS30-like element ISAs2 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.7	1.4e-41
AUV34707.1|40465_41614_+	cephalosporin-hydrolyzing class C beta-lactamase FOX-5	NA	NA	NA	NA	NA
AUV34708.1|41938_43111_+	multidrug transporter MdtL	NA	NA	NA	NA	NA
AUV34709.1|43129_44092_+	HTH-type transcriptional regulator YidZ	NA	NA	NA	NA	NA
AUV34710.1|44406_44613_+	hypothetical protein	NA	NA	NA	NA	NA
AUV34711.1|44703_45651_+|transposase	IS30-like element ISAs2 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.7	1.4e-41
AUV34884.1|46372_46621_+	type II toxin-antitoxin system YafQ family toxin	NA	NA	NA	NA	NA
AUV34712.1|46747_47323_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	52.7	5.6e-46
AUV34713.1|48069_48906_+|transposase	IS5 family transposase ISEc61	transposase	NA	NA	NA	NA
AUV34714.1|49129_49477_+	hypothetical protein	NA	NA	NA	NA	NA
AUV34715.1|49473_49902_+	hypothetical protein	NA	NA	NA	NA	NA
AUV34716.1|49894_50176_+	hypothetical protein	NA	NA	NA	NA	NA
AUV34717.1|50240_50459_+	hypothetical protein	NA	NA	NA	NA	NA
AUV34718.1|50470_51040_+	hypothetical protein	NA	NA	NA	NA	NA
AUV34719.1|51042_51588_+	hypothetical protein	NA	NA	NA	NA	NA
AUV34720.1|51704_52643_+	chromosome partitioning protein ParB	NA	A0A2P9HXK7	Yersinia_phage	50.2	1.5e-69
AUV34721.1|52642_52840_+	hypothetical protein	NA	NA	NA	NA	NA
AUV34722.1|52826_53078_+	hypothetical protein	NA	NA	NA	NA	NA
AUV34723.1|53077_53320_+	hypothetical protein	NA	NA	NA	NA	NA
AUV34724.1|53322_53685_+	hypothetical protein	NA	NA	NA	NA	NA
AUV34725.1|53677_53890_+	hypothetical protein	NA	NA	NA	NA	NA
AUV34726.1|53949_54705_-	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	51.0	5.8e-59
AUV34727.1|54719_56261_-|transposase	IS21-like element ISAs29 family transposase	transposase	K4I413	Acidithiobacillus_phage	47.6	4.4e-130
AUV34728.1|56505_57540_+	site-specific DNA-methyltransferase	NA	H8ZMF1	Synechococcus_phage	20.9	1.0e-05
AUV34729.1|57553_58003_+	hypothetical protein	NA	NA	NA	NA	NA
AUV34730.1|57984_58296_+	hypothetical protein	NA	NA	NA	NA	NA
AUV34731.1|58469_59255_+	ParA family protein	NA	A0A1X9IGI7	Lactococcus_phage	26.4	6.1e-11
AUV34732.1|59258_60440_+	chromosome partitioning protein ParB	NA	I3NLC2	Bifidobacterium_phage	28.7	2.4e-11
>prophage 2
CP026207	Escherichia coli strain ECONIH5 plasmid pECO-dc1b, complete sequence	202687	134355	161449	202687	integrase,transposase	Pandoravirus(25.0%)	28	139075:139134	160612:161473
AUV34813.1|134355_135360_-|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
AUV34814.1|135438_138411_-|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.1	0.0e+00
AUV34815.1|138413_138971_-	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	81.3	5.8e-48
AUV34816.1|139008_139332_-|transposase	transposase	transposase	NA	NA	NA	NA
139075:139134	attL	TGTCGTTTTCAGAAGACGGCTGCACTGAACGTCAGAAGCCGACTGCACTATAGCAGCGGA	NA	NA	NA	NA
AUV34817.1|139276_140290_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
139075:139134	attL	TGTCGTTTTCAGAAGACGGCTGCACTGAACGTCAGAAGCCGACTGCACTATAGCAGCGGA	NA	NA	NA	NA
AUV34887.1|140435_141227_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA2	NA	NA	NA	NA	NA
AUV34818.1|141390_141738_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
AUV34819.1|141731_142571_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
AUV34820.1|142975_144517_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
AUV34821.1|144849_145506_+	quinolone resistance pentapeptide repeat protein QnrA1	NA	NA	NA	NA	NA
AUV34822.1|145705_146545_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
AUV34823.1|146949_148491_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
AUV34824.1|148756_149257_+	hypothetical protein	NA	A0A1V0SB21	Catovirus	31.7	3.3e-10
AUV34825.1|149256_149826_+	trimethoprim-resistant dihydrofolate reductase DfrA19	NA	A0A1V0SD48	Indivirus	27.2	3.5e-08
AUV34826.1|150208_150490_-|transposase	transposase	transposase	NA	NA	NA	NA
150227:150427	attR	TGTCGTTTTCAGAAGACGGCTGCACTGAACGTCAGAAGCCGACTGCACTATAGCAGCGGAGGGGTTGGATCCATCAGGCAACGACGGGCTGCTGCCGGCCATCAGCGGACGCAGGGAGGACTTTCCGCAACCGGCCGTTCGATGCGGCACCGATGGCCTTCGCGCAGGGGTAGTGAATCCGCCAGGATTGACTTGCGCTGC	NA	NA	NA	NA
AUV34827.1|150428_151442_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
150227:150427	attR	TGTCGTTTTCAGAAGACGGCTGCACTGAACGTCAGAAGCCGACTGCACTATAGCAGCGGAGGGGTTGGATCCATCAGGCAACGACGGGCTGCTGCCGGCCATCAGCGGACGCAGGGAGGACTTTCCGCAACCGGCCGTTCGATGCGGCACCGATGGCCTTCGCGCAGGGGTAGTGAATCCGCCAGGATTGACTTGCGCTGC	NA	NA	NA	NA
AUV34888.1|151587_152121_+	aminoglycoside nucleotidyltransferase ANT(2'')-Ia	NA	NA	NA	NA	NA
AUV34828.1|152203_152836_+	type B-3 chloramphenicol O-acetyltransferase CatB3	NA	A0A2R8FE91	Brazilian_cedratvirus	41.2	4.1e-26
AUV34829.1|152992_153340_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
AUV34830.1|153333_154173_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
AUV34831.1|154102_154282_-	hypothetical protein	NA	NA	NA	NA	NA
AUV34832.1|154347_155112_+|transposase	IS6 family transposase IS6100	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
AUV34833.1|155288_155993_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AUV34834.1|156442_157918_+	ABC-F type ribosomal protection protein Msr(E)	NA	A0A1B0RXA0	Streptococcus_phage	59.0	2.3e-160
AUV34835.1|157973_158858_+	Mph(E) family macrolide 2'-phosphotransferase	NA	NA	NA	NA	NA
AUV34836.1|158941_159646_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AUV34837.1|159536_160496_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	40.5	1.7e-47
AUV34838.1|160597_161449_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.1e-11
160612:161473	attR	GGTGACGGTGTTCGGCATTCTGAATCTCACCGAGGACTCCTTCTTCGATGAGAGCCGGCGGCTAGACCCCGCCGGCGCTGTCACCGCGGCGATCGAAATGCTGCGAGTCGGATCAGACGTCGTGGATGTCGGACCGGCCGCCAGCCATCCGGACGCGAGGCCTGTATCGCCGGCCGATGAGATCAGACGTATTGCGCCGCTCTTAGACGCCCTGTCCGATCAGATGCACCGTGTTTCAATCGACAGCTTCCAACCGGAAACCCAGCGCTATGCGCTCAAGCGCGGCGTGGGCTACCTGAACGATATCCAAGGATTTCCTGACCCTGCGCTCTATCCCGATATTGCTGAGGCGGACTGCAGGCTGGTGGTTATGCACTCAGCGCAGCGGGATGGCATCGCCACCCGCACCGGTCACCTTCGACCCGAAGACGCGCTCGACGAGATTGTGCGGTTCTTCGAGGCGCGGGTTTCCGCCTTGCGACGGAGCGGGGTCGCTGCCGACCGGCTCATCCTCGATCCGGGGATGGGATTTTTCTTGAGCCCCGCACCGGAAACATCGCTGCACGTGCTGTCGAACCTTCAAAAGCTGAAGTCGGCGTTGGGGCTTCCGCTATTGGTCTCGGTGTCGCGGAAATCCTTCTTGGGCGCCACCGTTGGCCTTCCTGTAAAGGATCTGGGTCCAGCGAGCCTTGCGGCGGAACTTCACGCGATCGGCAATGGCGCTGACTACGTCCGCACCCACGCGCCTGGAGATCTGCGAAGCGCAATCACCTTCTCGGAAACCCTCGCGAAATTTCGCAGTCGCGACGCCAGAGACCGAGGGTTAGATCATGCCTAGCATTCACCTTCCGGCCGCCCGCTA	NA	NA	NA	NA
>prophage 1
CP026204	Escherichia coli strain ECONIH5 plasmid pKPC-bca9, complete sequence	76500	14153	53984	76500	coat,transposase	Escherichia_phage(20.0%)	43	NA	NA
AUV34295.1|14153_15314_-|coat	spore coat protein CotH	coat	NA	NA	NA	NA
AUV34363.1|15316_15865_-	DNA distortion polypeptide 1	NA	NA	NA	NA	NA
AUV34296.1|16192_16450_-	hypothetical protein	NA	NA	NA	NA	NA
AUV34297.1|16692_17034_-	hypothetical protein	NA	NA	NA	NA	NA
AUV34298.1|17130_17370_-	hypothetical protein	NA	NA	NA	NA	NA
AUV34299.1|17362_17629_-	hypothetical protein	NA	NA	NA	NA	NA
AUV34300.1|17640_18183_-	hypothetical protein	NA	NA	NA	NA	NA
AUV34301.1|18226_18742_-	molecular chaperone DnaJ	NA	NA	NA	NA	NA
AUV34302.1|18933_19152_+	hypothetical protein	NA	NA	NA	NA	NA
AUV34303.1|20275_21178_+	replication initiation protein	NA	NA	NA	NA	NA
AUV34304.1|21186_21630_+	hypothetical protein	NA	NA	NA	NA	NA
AUV34305.1|21803_22160_+	DNA distortion polypeptide 3	NA	NA	NA	NA	NA
AUV34306.1|22156_23134_-	hypothetical protein	NA	NA	NA	NA	NA
AUV34307.1|23158_23440_-	CopG family transcriptional regulator	NA	NA	NA	NA	NA
AUV34308.1|23536_24199_-	peptidyl-arginine deiminase	NA	E5FFJ3	Burkholderia_phage	25.1	6.5e-06
AUV34364.1|24535_25183_+	resolvase	NA	M9Q1K0	Clostridium_phage	29.1	6.1e-09
AUV34309.1|25325_26030_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	4.0e-139
AUV34310.1|26006_26234_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AUV34311.1|26263_26782_-	DUF417 domain-containing protein	NA	NA	NA	NA	NA
AUV34312.1|27512_27887_+	succinate dehydrogenase, cytochrome b556 subunit	NA	NA	NA	NA	NA
AUV34365.1|27862_27949_+	ABC transporter	NA	NA	NA	NA	NA
AUV34313.1|27987_28968_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.1	1.8e-185
AUV34314.1|29622_29868_+	hypothetical protein	NA	NA	NA	NA	NA
AUV34315.1|29947_30214_-	hypothetical protein	NA	NA	NA	NA	NA
AUV34316.1|30383_30665_-	nucleotidyltransferase domain-containing protein	NA	NA	NA	NA	NA
AUV34317.1|30732_31005_-	glutaredoxin 3	NA	V9QKN6	Rhizobium_phage	41.9	7.5e-09
AUV34318.1|31458_32205_-	oxidoreductase	NA	NA	NA	NA	NA
AUV34319.1|32197_32800_-	sulfite oxidase-like oxidoreductase	NA	NA	NA	NA	NA
AUV34320.1|33267_33738_+	thiol-disulfide isomerase	NA	NA	NA	NA	NA
AUV34321.1|34308_35799_+	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	82.2	8.6e-224
AUV34322.1|35833_36691_+	universal stress protein	NA	A0A2H4J154	uncultured_Caudovirales_phage	48.4	6.6e-67
AUV34323.1|36781_37114_+	conjugal transfer protein TraR	NA	NA	NA	NA	NA
AUV34324.1|37231_37852_-	recombinase family protein	NA	E5FFF9	Burkholderia_phage	37.1	1.1e-26
AUV34325.1|38021_38282_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
AUV34326.1|38281_38593_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
AUV34327.1|38616_41697_+|transposase	DDE transposase	transposase	A0A1B0V7H9	Salmonella_phage	30.6	8.2e-51
AUV34328.1|43257_46266_-|transposase	Tn3 family transposase	transposase	Q1MVP5	Enterobacteria_phage	64.3	0.0e+00
AUV34329.1|46429_46996_+	resolvase/recombinase	NA	Q1MVP4	Enterobacteria_phage	82.6	3.5e-77
AUV34330.1|47023_47731_+	hypothetical protein	NA	NA	NA	NA	NA
AUV34331.1|48554_49322_+	DUF1883 domain-containing protein	NA	S6BFN8	Thermus_phage	46.4	9.8e-30
AUV34332.1|50304_51624_+|transposase	IS1182 family transposase ISKpn6	transposase	Q9MBP7	Staphylococcus_prophage	24.2	1.9e-12
AUV34333.1|51873_52755_-	carbapenem-hydrolyzing class A beta-lactamase KPC-2	NA	A0A1B0VBP7	Salmonella_phage	52.2	2.2e-73
AUV34334.1|53279_53984_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
