The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP026324	Helicobacter pylori strain 26695-dRdM2 chromosome, complete genome	1666735	1018513	1070430	1666735	tRNA,transposase,integrase	Helicobacter_phage(50.0%)	44	1029019:1029038	1080353:1080372
AUV79611.1|1018513_1019425_-|tRNA	glycine--tRNA ligase subunit alpha	tRNA	NA	NA	NA	NA
AUV79612.1|1020507_1020969_-	acyl carrier protein	NA	M4QDG5	Prochlorococcus_phage	47.1	1.3e-05
AUV79613.1|1020961_1022305_-	ATPase	NA	NA	NA	NA	NA
AUV80223.1|1022301_1023393_-	hypothetical protein	NA	NA	NA	NA	NA
AUV79614.1|1023302_1024634_-	ATP/GTP-binding protein	NA	NA	NA	NA	NA
AUV79615.1|1024630_1026280_-	GTPase	NA	NA	NA	NA	NA
AUV79616.1|1026500_1026788_-	endoribonuclease VapD	NA	NA	NA	NA	NA
AUV79617.1|1026857_1027139_-	DUF3240 domain-containing protein	NA	NA	NA	NA	NA
AUV79618.1|1027154_1030217_-	CusA/CzcA family heavy metal efflux RND transporter	NA	S5VTK5	Leptospira_phage	25.7	2.8e-83
1029019:1029038	attL	ATGAGCATGCCTATAGCGAT	NA	NA	NA	NA
AUV79619.1|1030213_1031293_-	sodium:proton antiporter	NA	NA	NA	NA	NA
AUV80224.1|1031289_1032531_-	hypothetical protein	NA	NA	NA	NA	NA
AUV79620.1|1032580_1034686_-|tRNA	glycine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
AUV79621.1|1034797_1035859_+	hypothetical protein	NA	A0A2D1GN01	Pseudoalteromonas_phage	30.1	2.0e-09
AUV79622.1|1035871_1037347_+	2,3-bisphosphoglycerate-independent phosphoglycerate mutase	NA	NA	NA	NA	NA
AUV79623.1|1037361_1037643_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase GatCAB subunit C	tRNA	NA	NA	NA	NA
AUV79624.1|1037762_1039073_-	adenosylmethionine--8-amino-7-oxononanoate aminotransferase BioA	NA	NA	NA	NA	NA
AUV79625.1|1039201_1040665_+	peptidylprolyl isomerase	NA	NA	NA	NA	NA
AUV79626.1|1040680_1042159_+	cell division protein FtsA	NA	NA	NA	NA	NA
AUV79627.1|1042289_1043447_+	cell division protein FtsZ	NA	NA	NA	NA	NA
AUV79628.1|1044336_1044528_-	hypothetical protein	NA	NA	NA	NA	NA
AUV79629.1|1044910_1045183_+	exonuclease VII large subunit	NA	NA	NA	NA	NA
AUV79630.1|1045554_1046250_+	hypothetical protein	NA	NA	NA	NA	NA
AUV79631.1|1046250_1046541_+	hypothetical protein	NA	NA	NA	NA	NA
AUV79632.1|1047099_1047924_+	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
AUV79633.1|1048133_1048457_-	hypothetical protein	NA	NA	NA	NA	NA
AUV79634.1|1048576_1048720_-	type II restriction endonuclease	NA	NA	NA	NA	NA
AUV79635.1|1048759_1049473_-	DUF1887 domain-containing protein	NA	NA	NA	NA	NA
AUV79636.1|1050856_1051090_+	hypothetical protein	NA	NA	NA	NA	NA
AUV79637.1|1051096_1051525_-|transposase	IS200/IS605 family transposase	transposase	A0A1S5RG71	Helicobacter_phage	97.9	8.6e-76
AUV79638.1|1051594_1052878_+|transposase	transposase	transposase	A0A1S5REX3	Helicobacter_phage	85.0	2.6e-200
AUV80225.1|1053026_1054829_+	relaxase	NA	NA	NA	NA	NA
AUV79639.1|1055978_1057046_+|integrase	integrase	integrase	S5W9T9	Leptospira_phage	26.7	1.7e-08
AUV79640.1|1057362_1058166_-	hypothetical protein	NA	NA	NA	NA	NA
AUV79641.1|1058137_1058389_-	hypothetical protein	NA	NA	NA	NA	NA
AUV80226.1|1058974_1059604_+	hypothetical protein	NA	NA	NA	NA	NA
AUV80227.1|1059608_1060322_-	hypothetical protein	NA	NA	NA	NA	NA
AUV79642.1|1060370_1061654_-|transposase	transposase	transposase	A0A1S5REX3	Helicobacter_phage	85.2	1.2e-200
AUV79643.1|1061723_1062152_+|transposase	IS200/IS605 family transposase	transposase	A0A1S5RG71	Helicobacter_phage	97.9	8.6e-76
AUV79644.1|1062733_1063390_+	ParA family protein	NA	A2I303	Vibrio_virus	23.4	7.1e-05
AUV79645.1|1063474_1063759_+	hypothetical protein	NA	NA	NA	NA	NA
AUV79646.1|1063802_1064987_+	hypothetical protein	NA	NA	NA	NA	NA
AUV79647.1|1067202_1067517_+	hypothetical protein	NA	NA	NA	NA	NA
AUV79648.1|1068067_1068601_-	conjugal transfer protein TraG	NA	NA	NA	NA	NA
AUV79649.1|1070013_1070430_+|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	96.4	4.6e-74
1080353:1080372	attR	ATCGCTATAGGCATGCTCAT	NA	NA	NA	NA
